Research Article: New Research | Cognition and Behavior Inhibiting PDE7A enhances the protective effects of neural stem cells on neurodegeneration and memory deficits in sevoflurane-exposed mice https://doi.org/10.1523/ENEURO.0071-21.2021
Cite as: eNeuro 2021; 10.1523/ENEURO.0071-21.2021 Received: 19 February 2021 Revised: 21 May 2021 Accepted: 25 May 2021
This Early Release article has been peer-reviewed and accepted, but has not been through the composition and copyediting processes. The final version may differ slightly in style or formatting and will contain links to any extended data.
Alerts: Sign up at www.eneuro.org/alerts to receive customized email alerts when the fully formatted version of this article is published.
Copyright © 2021 Huang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license, which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed.
1 Inhibiting PDE7A enhances the protective effects of neural stem cells on
2 neurodegeneration and memory deficits in sevoflurane-exposed mice
3 Yanfang Huang, Yingle Chen*, Zhenming Kang, Shunyuan Li*
4 Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical
5 University, Quanzhou 362000, Fujian, China
6
7 *Corresponding authors
8 Shunyuan Li and Yingle Chen
9 Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical
10 University, Quanzhou 362000, Fujian, China
11 Email: [email protected] (Shunyuan Li); [email protected] (Yingle Chen)
12 Tel: 86-18960333666
13
14
15 Running title: Role of PDE7A in neurodegeneration
16
17
1
18 Abstract
19 Sevoflurane is widely used in general anesthesia, especially for children. However,
20 prolonged exposure to sevoflurane is reported to be associated with adverse effects on
21 the development of brain in infant monkey. Neural stem cells (NSCs), with potent
22 proliferation, differentiation, and renewing ability, provide an encouraging tool for
23 basic research and clinical therapies for neurodegenerative diseases. We aim to explore
24 the functional effects of injecting NSCs with Phosphodiesterase 7A (PDE7A)
25 knockdown in infant mice exposed to sevoflurane. The effects of PDE7A in NSCs
26 proliferation and differentiation were determined by CCK-8 assay and
27 differentiation-related gene expression assay, respectively. The effects of NSCs with
28 modified PDE7A on mice’s long-term memory and learning ability were assessed
29 by behavioral assays. Our data demonstrated that depleting PDE7A promoted,
30 whereas forcing PDE7A suppressed the activation of cAMP/CREB signaling as well as
31 cell proliferation and neuronal differentiation of NSCs. Inhibition of PDE7A in NSCs
32 exhibited profound improved effects on long-term memory and learning ability of mice
33 exposed to sevoflurane. Our results for the first time show that knockdown of PDE7A
34 improves the neurogenesis of NSCs in vitro and in vivo, and is beneficial for alleviating
35 sevoflurane-induced brain damage in infant mice.
36
37 Key words: Sevoflurane; Neural stem cells; Phosphodiesterase 7A (PDE7A);
38 Behavioral assays; cAMP/CREB signaling
2
39 Significance Statement
40 Our results for the first time show that knockdown of PDE7A improves the
41 neurogenesis of NSCs in vitro and in vivo, and is beneficial for alleviating
42 sevoflurane-induced brain damage in infant mice.
43
44
3
45 Introduction
46 Millions of people, including newborns, infants, and children, are subjected to general
47 anesthesia for surgical procedures worldwide. Accumulating evidence has
48 demonstrated that anesthetic reagents administration may have detrimental effects on
49 the development of the brain, causing potential neurodegeneration and deficits in
50 long-term memory and learning ability (Lu, Wu et al. 2010). Sevoflurane, a highly
51 fluorinated methyl isopropyl ether, is commonly used as an anesthetic agent for
52 inducing and maintaining anesthesia. Compared to other intravenous or inhalation
53 anesthetics, sevoflurane is less irritating to the airway, a lower solubility in the blood,
54 and sweeter smell. These features make sevoflurane a favorable choice for use in
55 children (Eger 2004). However, numerous studies have suggested that sevoflurane
56 may cause neuronal apoptosis, resulting in the development of learning disability and
57 deviant behavior (Liang, Ward et al. 2010, Lu, Wu et al. 2010, Wei, Wang et al. 2019).
58 Therefore, it is critical to clarify the detailed effects of sevoflurane on the nervous
59 system and behavior development, and to discover a potential therapeutic treatment to
60 prevent or mitigate the adverse effects of sevoflurane.
61 Neural stem cells (NSCs), abundant in the fetal or adult nervous system, can be
62 dissected from specific brain regions. With appropriate supplements with mitogens
63 (e.g., epidermal growth factor (EGF), nerve growth factor (NGF) and fibroblast
64 growth factor 2 (FGF 2)) in growth media, NSCs are capable of maintaining stable
65 proliferation, and differentiation into astrocytes, oligodendrocytes, and neurons in
66 vitro. These features make NSCs an ideal cell source for regenerative medicine for
67 various brain diseases, including stroke, spinal cord injury, and neurodegenerative
68 diseases (Kim, Lee et al. 2013). Several preclinical studies using mouse, rat, or
69 monkey models demonstrated that transplantation of NSCs into the brain of mice with
4
70 different neurodegenerative diseases exhibited encouraging evidence of improving the
71 functions of the brain (Lunn, Sakowski et al. 2011, Sakthiswary and Raymond 2012).
72 For example, Forotti et al. recently reported that transplantation of human induced
73 pluripotent stem cell-derived NSCs in the ventral horn of the mouse spinal cord
74 ameliorates neuropathological characteristics and improves the neuromuscular
75 function and lifespan (Forotti, Nizzardo et al. 2019). Despite these favorable
76 outcomes of application of NSCs for neurodegenerative disease treatment, the safety
77 and efficacy of NSCs transplantation remain a major challenge for its clinical
78 application in human.
79 Genetic modification is a useful tool to improve the function and avidity of NSCs. For
80 example, ectopic expression of oncogene c-myc actively promotes the proliferative
81 potential of NSCs (Swartling, Cancer et al. 2015). Similarly, overexpression of
82 Shroom Family Member 4 (Shrm4) activates gamma-aminobutyric acid (GABA)
83 pathway in NSCs, resulting in enhanced cell growth, colony formation, anti-apoptosis,
84 and ability to differentiate into neurons (Tian, Guo et al. 2020). The
85 phosphodiesterase 7A (PDE7A) is an enzyme responsible for the regulation of
86 intracellular cAMP in the central nervous system (Morales-Garcia, Alonso-Gil et al.
87 2015). It has been revealed that administration of S14, a PDE7 inhibitor, increased
88 NSCs proliferation, and neuronal differentiation (Chen, Li et al. 2020). In view of
89 those findings, we aim to investigate the functional roles of PDE7A on the NSCs cell
90 proliferation and differentiation in vitro, and long-term memory and learning ability of
91 sevoflurane-treated mice in vivo using genetic modification strategies.
92
93 Materials and Methods
94 Animals
5
95 C57BL/6 mice of either sex were purchased from GemPharmatech (Nanjing, China),
96 and maintained in the standard animal care facility with free access to clean food and
97 water. All animal experiment protocols were approved by the Ethics Committee of
98 XXX.
99 NSCs isolation, culture, and transplantation
100 The pregnant mice were euthanized, and the embryos isolated from uteruses were
101 immersed in D-hank’s solution. The embryos’ brain tissues were carefully separated,
102 followed by the removal of blood vessels and meninges. The hippocampus was
103 carefully dissected, washed, cut into small pieces (0.2 mm × 0.2 mm), and digested in
104 DMEM medium with 0.1% trypsin-EDTA, 0.15% DNAase, and 0.01% hyaluronidase
105 in 37-degree for 15 mins. The NSCs were washed, responded, and seeded into 12-well
106 plate with a density of 4 × 104 cells per well in DMEM/F12 medium supplied with 10
107 ng/ml EGF, 10 ng/ml FGF.
108 Two weeks pups were exposed to 3% sevoflurane for 4 h, and were returned to the
109 original cages for recovery. The main reason for the pups received NSCs injection two
110 weeks post-treatment is that the two-week interval is an ideal period to allow the mice
111 to recover and to familiarize themselves with new environment. We tried to minimize
112 the potential unrelated factors, such as poor health condition or emotion, that may
113 affect the therapeutic effect of NSCs. Thus, two weeks later, the pups were restricted
114 in stereotaxis, and a small hole was drilled in the skull at coordinates AP, +1.7 mm,
115 and LM, -1.0 mm. A total of 5 × 105 NSCs in 100 μl of suspension was gently injected
116 into the frontal cortex's parenchyma with a Hamilton 80300 microsyringe. Each pup
117 only received one-time NSCs injection.
118 Morris water maze test and novel object recognition test
119 For Morris water maze test, a 0.6 m high and 1.6 m diameter circular tank containing
6
120 0.3 m high of water was incorporated in the study. A round platform (0.12 m diameter)
121 was placed in the center of one of the four-quadrant and submerged 1 cm beneath the
122 water surface. The mice were trained for 3 times per day for a consecutive 7 days
123 before the test. The mouse was placed into the water, and its navigation to the
124 platform was recorded by a video camera located above the water tank. The maximum
125 time for a mouse in the water tank was 80 s. If a mouse cannot find the platform with
126 60 s, the mouse was guided to the platform, and the time was recorded as 60 s. The
127 mouse was sent back to their cages with a heat lamp after finished the test. The test
128 was performed three times per day for three days, and the data were analyzed by
129 ViewTrack video behavior tracking system (ViewPoint, distributor in Shanghai,
130 China).
131 For novel object recognition test, a square plastic chamber (0.4 m long, 0.4 m wide,
132 and 0.4 m high) was used. The detailed procedures were conducted with the published
133 papers (Lueptow 2017, Chen, Li et al. 2020).
134 Immunofluorescence staining
135 Immunofluorescence staining was performed as previously described (Chen, Li et al.
136 2020). Briefly, NSCs were fixed with 4% paraformaldehyde and treated with 0.1%
137 Triton X100 for 30 min. Cells were blocked in 5% normal goat serum for 1h, and the
138 primary anti-mouse Nestin antibody (ab105398, Abcam, Cambridge, UK) was added
139 into the cells for overnight incubation at 4-degree. The cells were washed and further
140 incubated with goat anti-rabbit immunoglobulin G (IgG) antibody (ab150077, Abcam,
141 Cambridge, UK) at 37-degree for 1 h. The cells were sealed using glycerol and were
142 examined using an Olympus IX70 inverted fluorescence phase contrast microscope.
143 Cell counting kit-8 (CCK-8) assay
7
144 Cell counting kit-8 (CCK-8) assay (Yeasen Biotechnology, Shanghai, China) was
145 performed according to manufactory’s instruction. Briefly, cells in 96-well plate were
146 incubated with CCK-8 reagent for 4 h, and the optical density (OD) value of each
147 sample was measured at the wavelength of 450 nm using GloMax® Discover
148 Microplate Reader (Promega, Madison, WI, USA).
149 Enzyme-linked immunosorbent assay (ELISA)
150 The cAMP levels were tested by cAMP Assay Kit (ab133051) following the
151 manufactory’s instruction.
152 Lentivirus packaging
153 Lentiviral plasmids (shPDE7A-1, shPDE7A-2, shNC, PLVX-PDE7A, and PLVX-NC)
154 were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Lentiviral
155 plasmids were co-transfected with packaging plasmids into 293T cells. The cell
156 supernatant containing lentiviral particles were collected 48 h after transfection.
157 Real-time polymerase chain reaction (RT-qPCR)
158 TRIZOL reagent (Invitrogen, ThermoFisher scientific, MD, USA) was used to extract
159 total RNA from samples according to manufactory's instruction. The RNA was
160 reverse transcribed into cDNA using the ReverTra Ace qPCR RT Kit (FSQ-101,
161 Toyobo Co, Japan). For gene expression analysis, the RT-qPCR was carried out using
162 SYBR Green PCR master mix (Bio-Rad Laboratories, CA, USA) and analyzed with
163 an ABI 7500 instrument (Life Technology, USA). The relative expression levels of
164 target genes were normalized to GAPDH. The primer sequences are shown as
165 following:
166 PDE7A Forward: AGACGTGGAGCTATTTCCTATGA
167 PDE7A Reverse: CAATGTACGGATGGGAACCTC
168 Microtubule-associated protein 2 (MAP-2) Forward: GCC AGC CTC AGA ACA
8
169 AAC AG
170 MAP-2 Reverse: AAG GTC TTG GGA GGG AAG AAC
171 Suppressor of cytokine signaling 2 (SOCS2) Forward: AGT TCG CAT TCA GAC
172 TAC CTACT
173 SOCS2 Reverse: TGG TAC TCA ATC CGC AGG TTAG
174 GAPDH Forward: TTC ACC ACC ATG GAG AAG GC
175 GAPDH Reverse: GGC ATG GAC TGT GGT CAT GA
176 Western blot
177 An equal amount of protein samples was loaded on an 8% sodium dodecyl
178 sulfate-polyacrylamide (SDS-PAGE) gel and separated via electrophoresis. The
179 separated proteins were transferred to a PVDF (polyvinylidene difluoride)
180 immobilon-P membrane (Millipore, Billerica, MA, USA). After incubated with 5 %
181 bovine serum albumin, the membranes were probed with primary antibodies in
182 cold-room overnight and followed by incubated with second antibodies. The target
183 protein bands were visualized using an iBind western system (ThermoFisher
184 Scientific, MA, USA). The antibodies against pCREB (Ser133, #9198), CREB
185 (#9197), and β-actin (#4970) were from Cell Signaling Technology (Danvers, MA,
186 USA).
187 Statistical analysis
188 Data values were presented as the mean and standard deviation (mean ± SD) and were
189 analyzed using GraphPad Prism 5. The Student's t-test, two- or one-way analysis of
190 variance (ANOVAs) followed by a post hoc test was used to compare the statistical
191 difference. A value of P < 0.05 was considered statistically significant.
192
193 Results
9
194 Depletion of PDE7A promotes the cell proliferation of NSCs
195 To confirm the purity of isolated NSCs, the expression of nestin, an NSCs marker,
196 was assessed by immunofluorescent staining. The results showed that almost all cells
197 were positive for nestin, suggesting the successful establishment of NSCs in vitro
198 (Figure 1A). To investigate the functional role of PDE7A on NSCs proliferation,
199 NSCs were infected with two lentivirally shRNA (shPDE7A-1, and shPDE7A-2)
200 specifically against PDE7A, but not PDE7B. As showed in Figure 1B-C, transfection
201 of shPDE7A-1 or shPDE7A-2 resulted in a profound decrease in the mRNA and
202 protein levels of PDE7A in NSCs, as evidenced by RT-qPCR and western blot,
203 respectively (Figure 1B and C). We observed that PDE7A depletion enhanced NSCs
204 cell proliferation (Figure 1D). On the contrary, NSCs were transduced with lentivirus
205 carrying PDE7A or non-sense control (NC), and overexpression of PDE7A in NSCs
206 was confirmed by western blot assay (Figure 1E and F). We found that forced PDE7A
207 attenuated the cell proliferation of NSCs (Figure 1G). These data suggested that
208 PDE7A plays a negative role in the cell growth of NSCs.
209 Suppression of PDE7A enhances the cell differentiation of NSCs
210 To study the effect of PDE7A on NSCs differentiation, we applied the same strategies
211 in Figure 1 to knockdown of or overexpression of PDE7A in NSCs. The differentiated
212 NSCs generally present prolonged fusiform, and continuously growing spores. We
213 observed that silencing PDE7A promoted, whereas enhancing PDE7A inhibited cell
214 differentiation of NSCs (Figure 2A and C). The results were further confirmed by
215 detection of microtubule-associated protein 2 (MAP-2) and suppressor of cytokine
216 signaling 2 (SOCS2), two NSCs differentiation markers, in the NSCs. As illustrated in
217 Figure 2B and D, knockdown of PDE7A induced, whereas overexpression of PDE7A
218 decreased the expression of MAP-2 and SOCS2 in NSCs. The findings were further
10
219 confirmed by immunostaining against MAP-2 (Figure 2-1A and 2-1B). These data
220 implied that PDE7A overexpression blocks NSCs differentiation.
221 Silencing PDE7A actives cAMP/CREB signaling
222 Cyclic adenosine 3',5'-monophosphate (cAMP) / cAMP-response element binding
223 protein (CREB) signaling is known to play an essential role in learning and long-term
224 memory (Kandel 2012). To explore the effect of PDE7A on the activation of
225 cAMP/CREB signaling, NSCs were again subjected to shPDE7A-1/2 or shNC, and
226 PLVX-PDE7A or PLVX-NC transduction. The results demonstrated that PDE7A
227 suppression substantially increased, while PDE7A augmentation significantly
228 decreased cAMP (Figure 3A and D) and pCREB (Figure 3B, C, E and F) expression
229 in NSCs, suggesting inhibition of PDE7A promotes cAMP/CREB signaling
230 activation.
231 Transplantation of NSCs/shPDE7A enhances the long-term memory of
232 sevoflurane exposed mice
233 To determine whether PDE7A inhibition promotes the cellar function of NSCs in vivo,
234 the two-week aged mice were exposed to sevoflurane, and then received PBS,
235 NSCs/shNC or NSCs/shPDE7A transplantation 14-day post sevoflurane exposure
236 (Figure 4A). The long-term memory ability of mice was assessed by the Morris water
237 maze test. As revealed in Figure 4B-C, after the first day of training, mice from all
238 groups exhibited comparable time (60 s) to find the platform and length of swimming
239 (2500 cm). On days 2 and 3 after training, the normal control mice spent 38s (day 2)
240 and 20s (day 3), as well as swan 1250 cm (day 2), and 1000 cm (day 3) to find the
241 platform. However, sevoflurane exposed and sevoflurane+PBS mice spent the amount
242 of time (58 s on day 2 and 3) and slightly decreased swimming length (2250 cm on
243 day 2, and 2000 cm on day 3), suggesting sevoflurane exposed significantly impaired
11
244 long-term memory of mice (Figure 4B and C). The NSCs/shNC transplanted
245 sevoflurane-exposed mice spent less time and swam less length to find the platform
246 compared to sevoflurane-exposed mice, suggesting NSCs/shNC transplantation
247 partially improved the neural function of sevoflurane exposed mice (Figure 4B and C).
248 Strikingly, the NSCs/shPDE7A transplanted sevoflurane-exposed mice spent similar
249 time and swam comparable length to find the platform compared to normal control
250 mice (Figure 4B and C).
251 Furthermore, mice subjected to sevoflurane exposure spent approximately 30% less
252 time in the targeted quadrant compared to normal control mice. Sevoflurane exposed
253 mice with NSCs/shNC transplantation, but not PBS injection, stayed longer (20%
254 more time) in the targeted quadrant than in control mice. Furthermore,
255 NSCs/shPDE7A transplantation further improved the long-term memory healing
256 effect of NSCs/shNC on sevoflurane exposed mice, as evidenced by comparable time
257 in the targeted quadrant between sevoflurane+NSCs/shPDE7A mice, and normal
258 control mice (Figure 4D).
259 Transplantation of NSCs/shPDE7A promotes the learning ability of sevoflurane
260 exposed mice
261 To further assess the learning and memory in those mice, mice were subjected to the
262 novel object recognition test. As displayed in Figure 5, the normal healthy mice spent
263 80% longer time on the new object than on the old object. Both sevoflurane- and
264 sevoflurane+PBS-mice spent equivalent amounts of time on new and old objects, with
265 the same discrimination index value, which was considerably low compared to normal
266 control (Figure 5A and 5B). Both NSCs/shNC and NSCs/shPDE7A transplantation
267 resulted in a prolonged time on the new object than on the old one. Of note, the
268 NSCs/shPDE7A transplantation yielded an improved memory rescue effect than
12
269 NSCs/shNC transplantation, as evidenced by the discrimination index value in
270 sevoflurane+NSCs/shPDE7A mice was higher than that in sevoflurane+NSCs/shNC
271 mice (Figure 5A and 5B). Furthermore, the mRNA levels of PDE7A, MAP-2, and
272 SOCS2 in brain tissues were measured by RT-qPCR. As manifested in (Figure 5C-5E),
273 the expression levels of PDE7A were significantly decreased, whereas the expression
274 levels of MAP-2 and SOCS2 were markedly upregulated in the brain tissues of
275 sevoflurane+NSCs/shPDE7A mice when compared with that from
276 sevoflurane+NSCs/shNC mice. No significant difference of PDE7A, MAP-2, and
277 SOCS2 expression was observed in the other four groups. In addition, the Western blot
278 analysis showed that the expression of pCREB was also upregulated in the brain
279 tissues of sevoflurane+NSCs/shPDE7A mice when compared with that from
280 sevoflurane+NSCs/shNC mice (Figure 5-1).
281
282 Discussion
283 In recent years, Dr. Gil's lab and others have published a series of papers to reveal the
284 critical role of PDE7 in regulating various biological functions of NSCs (Miro,
285 Perez-Torres et al. 2001, Sasaki, Kotera et al. 2002, Morales-Garcia, Redondo et al.
286 2011, Redondo, Zarruk et al. 2012, Perez-Gonzalez, Pascual et al. 2013, Liu,
287 Rainosek et al. 2015, Morales-Garcia, Echeverry-Alzate et al. 2017). PDE7 is a
288 cAMP-specific phosphodiesterase (PDEs), and the latter comprises a family of 21
289 members with distinct sequence homology, cellular distribution, and expression
290 pattern in central nervous systems. Strikingly, several studies have exhibited that
291 suppression of PDE7 using different PDE7 inhibitor or shRNA, exerts potent
292 neuroprotective and anti-inflammatory effects on animal models of neurodegenerative
293 disorders (Morales-Garcia, Redondo et al. 2011, Redondo, Zarruk et al. 2012,
13
294 Perez-Gonzalez, Pascual et al. 2013, Liu, Rainosek et al. 2015, Morales-Garcia,
295 Echeverry-Alzate et al. 2017). Administration of inhibitor of PDE7 (e.g., S14, or
296 3-phenyl-2,4-dithioxo-1,2,3,4-tetrahydroquinazoline) can protect neurons against
297 adverse chemical- or inflammatory- induced cell death, promote NSCs generation,
298 migration, and differentiation, ameliorate neuron system damage, improved learning
299 and behavioral outcome of animal models of neurodegenerative diseases, including
300 stroke, Alzheimer's disease (AD), and Parkinson's disease (PD) (Morales-Garcia,
301 Redondo et al. 2011, Redondo, Zarruk et al. 2012, Perez-Gonzalez, Pascual et al.
302 2013, Liu, Rainosek et al. 2015, Morales-Garcia, Echeverry-Alzate et al. 2017). In
303 line with these findings, instead of using PDE7 inhibitor, we knockdown of
304 endogenous PDE7A using shPDE7A-1/2 in NSCs. We found that depletion of PDE7A
305 enhanced NSCs cell proliferation and differentiation. More importantly, we forced
306 expression of PDE7A using lentiviral transduction in NSCs, and we revealed that
307 overexpression profoundly inhibited NSCs cell proliferation and differentiation. Our
308 data further confirmed the previous findings, highlighting that PDE7A plays a
309 negative role in NSCs cell proliferation and differentiation.
310 Cyclic AMP (cAMP) levels have been shown to play a pivotal role in neuronal
311 differentiation, neuroprotection, and neuroinflammatory response (Lee 2015). Several
312 studies suggested that modulation of cAMP levels could trigger the pathological
313 features of neurons, and delay the progression of neurodegenerative disorders (Inda,
314 Bonfiglio et al. 2017). CREB is a nuclear transcription factor that binds to cAMP
315 response element of the targeted genes’ promoter and regulates the expression of
316 genes that participate in neuronal function and survival (Wang, Xu et al. 2018). The
317 activation of cAMP/CREB signaling pathway has been demonstrated to be closely
318 associated with various neuronal functions, including cell proliferation, apoptosis,
14
319 differentiation, neurogenesis, and neural plasticity. Numerous studies reported that
320 cAMP/CREB signaling pathway plays an essential role for maintaining normal
321 neuronal functions, memory formation and retention, healthy mental status, and
322 normal behavior. Disruption of cAMP/CREB signaling pathway has been reported to
323 be associated with schizophrenia, AD, and PD (Sakamoto, Karelina et al. 2011).
324 Studies from Dr. Gil’s lab have presented that inhibition of PDE7 induced the
325 activation of cAMP/PKA signaling pathway and subsequently activated CREB by
326 phosphorylation at Ser133 (Morales-Garcia, Redondo et al. 2011). In accordance with
327 these observations, we confirmed that knockdown of PDE7A enhanced, whereas
328 overexpression of PDE7A inhibited the activity of cAMP/CREB signaling in NSCs.
329 cAMP signaling has been associated with neuroplasticity and protection, and
330 influencing their levels in the cell by inhibition of PDEs has become a studied target
331 for treatment in a wide array of disorders, including neurodegenerative disorders
332 (Bollen and Prickaerts 2012). Therefore, we believe that inhibition of PDE7A leads to
333 activation of cAMP/PKA signaling pathway, which is beneficial for neural cell
334 survival, proliferation, and differentiation (Neumann, Bradke et al. 2002, Nikulina,
335 Tidwell et al. 2004, Perez-Gonzalez, Pascual et al. 2013).
336 NSCs are known as the “seed” cells of the central nervous system. They are a group
337 of cells that are capable of self-proliferation, renewing, and differentiation into
338 neurons and glia during central nervous system development (Lu, Jones et al. 2003).
339 The limited source for NSCs hampered the application of NSCs in the clinical field in
340 the past decades. With the rapid advances in the stem cell researches, several
341 pluripotent stem cells, such as induced pluripotent stem cells, mesenchymal stem cells
342 (MSCs), and embryonic stem cells (ESCs) can be induced to differentiate into NSCs,
343 making the use of NSCs for treatment of neurodegenerative diseases becomes
15
344 possible (Marsh and Blurton-Jones 2017). Remarkably, accumulating studies have
345 reported the encouraging results of a significant functional benefit after NSCs
346 transplantation in various animal models (Hattiangady and Shetty 2011, Yi, Kim et al.
347 2013). Furthermore, several strategies have been explored to improve the therapeutic
348 potential of NSCs. For instance, genetically modified NSCs to produce
349 neurotrophin-3 induce secreting other growth factors and promote host neural repair
350 (Lu, Jones et al. 2003). Similarly, NSCs stable-expressing neurotrophies, such as Glial
351 cell-derived neurotrophic factor (GDNF), Brain-derived neurotrophic factor (BDNF),
352 and Nerve growth factor (NGF), exhibited remarkably improved proliferation,
353 survival, and functional recovery in different neurological disease animal models
354 (Chen, Yu et al. 2017). Morales-Garcia et al. showed that application of S14, a PDE7
355 inhibitor, exerts potent anti-inflammatory and neuroprotective effects, and promotes
356 dopaminergic neuron generation in mice with Parkinson’s disease (Morales-Garcia,
357 Redondo et al. 2011). To extend this finding, we used shRNA to specifically
358 knockdown PDE7A in NSCs. Importantly, we found that NSCs/shPDE7A
359 transplantation substantially improved the long-term memory and learning ability in
360 sevoflurane exposed mice. Compared with inhibitor treatment, genetic modification
361 has apparent advantages. Repetitive administration of inhibitor is labor-consuming,
362 and may potentially cause adverse side effects to the recipients. In the next step, we
363 aim to exploit the depletion of PDE7A using clustered regularly interspaced short
364 palindromic repeats (CRISPR)-knockout technology in NSCs and apply the
365 engineered NSCs-CRISPR-PDE7A to mice exposed to sevoflurane or mice with PD
366 or AD symptoms.
367
368 Conclusion
16
369 Our results confirmed that PDE7A is a crucial target in the regulation of NSCs
370 functions. Suppression of PDE7A in NSCs may serve as a new therapeutic strategy
371 for the treatment of sevoflurane-induced brain impairment in newborns, infants, and
372 children.
373
374 Authors’ contributions
375 Yanfang Huang, Yingle Chen, Zhenming Kang and Shunyuan Li conceived and
376 designed the experiments; Yanfang Huang and Shunyuan Li performed the
377 experiments; Yanfang Huang, Yingle Chen, Zhenming Kang and Shunyuan Li
378 analyzed and interpreted the data and contributed reagents, materials, analysis tools or
379 data; Yanfang Huang and Shunyuan Li wrote the paper.
380
381 Acknowledgements
382 None.
383
384 Declaration of conflict of interest
385 None.
386
387 References
388 Bollen, E. and J. Prickaerts (2012) Phosphodiesterases in neurodegenerative
389 disorders. IUBMB Life 64(12):965-970.
390 Chen, T., Y. Yu, L. J. Tang, L. Kong, C. H. Zhang, H. Y. Chu, L. W. Yin and H. Y. Ma (2017)
391 Neural stem cells over-expressing brain-derived neurotrophic factor promote
392 neuronal survival and cytoskeletal protein expression in traumatic brain injury sites.
393 Neural Regen Res 12(3):433-439.
17
394 Chen, Y., S. Li, X. Zhong, Z. Kang and R. Chen (2020) PDE-7 Inhibitor BRL-50481
395 Reduces Neurodegeneration and Long-Term Memory Deficits in Mice Following
396 Sevoflurane Exposure. ACS Chem Neurosci 11(9):1353-1358.
397 Eger, E. I., 2nd (2004) Characteristics of anesthetic agents used for induction and
398 maintenance of general anesthesia. Am J Health Syst Pharm 61 Suppl 4:S3-10.
399 Forotti, G., M. Nizzardo, M. Bucchia, A. Ramirez, E. Trombetta, S. Gatti, N. Bresolin, G.
400 P. Comi and S. Corti (2019) CSF transplantation of a specific iPSC-derived neural stem
401 cell subpopulation ameliorates the disease phenotype in a mouse model of spinal
402 muscular atrophy with respiratory distress type 1. Exp Neurol 321:113041.
403 Hattiangady, B. and A. K. Shetty (2011) Neural stem cell grafting in an animal model
404 of chronic temporal lobe epilepsy. Curr Protoc Stem Cell Biol Chapter 2:Unit2D 7.
405 Inda, C., J. J. Bonfiglio, P. A. Dos Santos Claro, S. A. Senin, N. G. Armando, J. M.
406 Deussing and S. Silberstein (2017) cAMP-dependent cell differentiation triggered by
407 activated CRHR1 in hippocampal neuronal cells. Sci Rep 7(1):1944.
408 Kandel, E. R. (2012) The molecular biology of memory: cAMP, PKA, CRE, CREB-1,
409 CREB-2, and CPEB. Mol Brain 5:14.
410 Kim, S. U., H. J. Lee and Y. B. Kim (2013) Neural stem cell-based treatment for
411 neurodegenerative diseases. Neuropathology 33(5):491-504.
412 Lee, D. (2015) Global and local missions of cAMP signaling in neural plasticity,
413 learning, and memory. Front Pharmacol 6:161.
414 Liang, G., C. Ward, J. Peng, Y. Zhao, B. Huang and H. Wei (2010) Isoflurane causes
415 greater neurodegeneration than an equivalent exposure of sevoflurane in the
416 developing brain of neonatal mice. Anesthesiology 112(6):1325-1334.
417 Liu, F., S. W. Rainosek, J. L. Frisch-Daiello, T. A. Patterson, M. G. Paule, W. Slikker, Jr., C.
18
418 Wang and X. Han (2015) Potential Adverse Effects of Prolonged Sevoflurane Exposure
419 on Developing Monkey Brain: From Abnormal Lipid Metabolism to Neuronal Damage.
420 Toxicol Sci 147(2):562-572.
421 Lu, P., L. L. Jones, E. Y. Snyder and M. H. Tuszynski (2003) Neural stem cells
422 constitutively secrete neurotrophic factors and promote extensive host axonal
423 growth after spinal cord injury. Exp Neurol 181(2):115-129.
424 Lu, Y., X. Wu, Y. Dong, Z. Xu, Y. Zhang and Z. Xie (2010) Anesthetic sevoflurane causes
425 neurotoxicity differently in neonatal naive and Alzheimer disease transgenic mice.
426 Anesthesiology 112(6):1404-1416.
427 Lueptow, L. M. (2017) Novel Object Recognition Test for the Investigation of Learning
428 and Memory in Mice. J Vis Exp(126).
429 Lunn, J. S., S. A. Sakowski, J. Hur and E. L. Feldman (2011) Stem cell technology for
430 neurodegenerative diseases. Ann Neurol 70(3):353-361.
431 Marsh, S. E. and M. Blurton-Jones (2017) Neural stem cell therapy for
432 neurodegenerative disorders: The role of neurotrophic support. Neurochem Int
433 106:94-100.
434 Miro, X., S. Perez-Torres, J. M. Palacios, P. Puigdomenech and G. Mengod (2001)
435 Differential distribution of cAMP-specific phosphodiesterase 7A mRNA in rat brain
436 and peripheral organs. Synapse 40(3):201-214.
437 Morales-Garcia, J. A., S. Alonso-Gil, C. Gil, A. Martinez, A. Santos and A. Perez-Castillo
438 (2015) Phosphodiesterase 7 inhibition induces dopaminergic neurogenesis in
439 hemiparkinsonian rats. Stem Cells Transl Med 4(6):564-575.
440 Morales-Garcia, J. A., V. Echeverry-Alzate, S. Alonso-Gil, M. Sanz-SanCristobal, J. A.
441 Lopez-Moreno, C. Gil, A. Martinez, A. Santos and A. Perez-Castillo (2017)
19
442 Phosphodiesterase7 Inhibition Activates Adult Neurogenesis in Hippocampus and
443 Subventricular Zone In Vitro and In Vivo. Stem Cells 35(2):458-472.
444 Morales-Garcia, J. A., M. Redondo, S. Alonso-Gil, C. Gil, C. Perez, A. Martinez, A.
445 Santos and A. Perez-Castillo (2011) Phosphodiesterase 7 inhibition preserves
446 dopaminergic neurons in cellular and rodent models of Parkinson disease. PLoS One
447 6(2):e17240.
448 Neumann, S., F. Bradke, M. Tessier-Lavigne and A. I. Basbaum (2002) Regeneration of
449 sensory axons within the injured spinal cord induced by intraganglionic cAMP
450 elevation. Neuron 34(6):885-893.
451 Nikulina, E., J. L. Tidwell, H. N. Dai, B. S. Bregman and M. T. Filbin (2004) The
452 phosphodiesterase inhibitor rolipram delivered after a spinal cord lesion promotes
453 axonal regeneration and functional recovery. Proc Natl Acad Sci U S A
454 101(23):8786-8790.
455 Perez-Gonzalez, R., C. Pascual, D. Antequera, M. Bolos, M. Redondo, D. I. Perez, V.
456 Perez-Grijalba, A. Krzyzanowska, M. Sarasa, C. Gil, I. Ferrer, A. Martinez and E. Carro
457 (2013) Phosphodiesterase 7 inhibitor reduced cognitive impairment and pathological
458 hallmarks in a mouse model of Alzheimer's disease. Neurobiol Aging
459 34(9):2133-2145.
460 Redondo, M., J. G. Zarruk, P. Ceballos, D. I. Pérez, C. Pérez, A. Perez-Castillo, M. A.
461 Moro, J. Brea, C. Val, M. I. Cadavid, M. I. Loza, N. E. Campillo, A. Martínez and C. Gil
462 (2012) Neuroprotective efficacy of quinazoline type phosphodiesterase 7 inhibitors in
463 cellular cultures and experimental stroke model. European Journal of Medicinal
464 Chemistry 47(1):175-185.
465 Sakamoto, K., K. Karelina and K. Obrietan (2011) CREB: a multifaceted regulator of
20
466 neuronal plasticity and protection. Journal of Neurochemistry 116(1):1-9.
467 Sakthiswary, R. and A. A. Raymond (2012) Stem cell therapy in neurodegenerative
468 diseases: From principles to practice. Neural Regen Res 7(23):1822-1831.
469 Sasaki, T., J. Kotera and K. Omori (2002) Novel alternative splice variants of rat
470 phosphodiesterase 7B showing unique tissue-specific expression and
471 phosphorylation. Biochem J 361(Pt 2):211-220.
472 Swartling, F. J., M. Cancer, A. Frantz, H. Weishaupt and A. I. Persson (2015)
473 Deregulated proliferation and differentiation in brain tumors. Cell Tissue Res
474 359(1):225-254.
475 Tian, R., K. Guo, B. Wu and H. Wang (2020) Overexpression of Shrm4 promotes
476 proliferation and differentiation of neural stem cells through activation of GABA
477 signaling pathway. Mol Cell Biochem 463(1-2):115-126.
478 Wang, H., J. Xu, P. Lazarovici, R. Quirion and W. Zheng (2018) cAMP Response
479 Element-Binding Protein (CREB): A Possible Signaling Molecule Link in the
480 Pathophysiology of Schizophrenia. Front Mol Neurosci 11:255.
481 Wei, H., X. Wang, Y. Dong, Y. Zhang, T. Li and Z. Xie (2019) Sevoflurane induces
482 cognitive impairment in young mice via autophagy. Plos One 14(5):e0216372.
483 Yi, B. R., S. U. Kim and K. C. Choi (2013) Development and application of neural stem
484 cells for treating various human neurological diseases in animal models. Lab Anim
485 Res 29(3):131-137.
486
487
21
488 Figure legends
489 Figure 1. Inhibiting PDE-7A promotes cell growth of NSCs. A. Nestin positive
490 cells of NSCs (red). DAPI, nucleus of NSCs (blue). B & C. The silenced efficacy of
491 shPDE7As in mouse NSCs were determined by qRT-PCR (B) and western blot (C). D.
492 NSCs infected with shNC, shPDE7A-1 or shPDE7A-2 were cultured for 0, 1, 2 or 4
493 days, followed by CCK-8 assay. E & F. The overexpressing efficacy of
494 PLVX-PDE7A in mouse NSCs were determined by western blot (E), and the optical
495 density of PDE7A was analyzed (F). G. NSCs infected with PLVX-PDE7A were
496 cultured for 0, 1, 2 or 4 days, followed by CCK-8 assay. **p<0.01.
497
498 Figure 2. Inhibiting PDE-7A promotes cell differentiation of NSCs. A. NSCs
499 infected with shNC, shPDE7A-1 or shPDE7A-2 were cultured for two weeks, and
500 then cell-differentiation rate was measured. B. NSCs infected with shNC, shPDE7A-1
501 or shPDE7A-2 were cultured for two weeks, and then cells were prepared for
502 measuring the mRNA expression of cell differentiation-related genes, including
503 MAP-2 and SOCS2. C. NSCs infected with PLVX-PDE7A were cultured for two
504 weeks, and then cell-differentiation rate was measured. D. NSCs infected with
505 PLVX-PDE7A were cultured for two weeks, and then cells were prepared for
506 measuring the mRNA expression of cell differentiation-related genes, including
507 MAP-2 and SOCS2. **p<0.01. Figure 2-1 is supporting Figure 2.
508
509 Figure 3. Inhibiting PDE-7A activates cAMP/CREB signaling in NSCs. A. The
510 cAMP levels in NSCs infected with shNC, shPDE7A-1 or shPDE7A-2 were
511 determined using a mouse cAMP ELISA kit. B & C. NSCs infected with shNC,
512 shPDE7A-1 or shPDE7A-2 were prepared for western blot (B), and the optical
22
513 density of pCREB was analyzed (C). D. The cAMP levels in NSCs infected with
514 PLVX-NC or PLVX-PDE7A were determined using a mouse cAMP ELISA kit. E & F.
515 NSCs infected with PLVX-NC or PLVX-PDE7A were prepared for western blot (E),
516 and the optical density of pCREB was analyzed (F). **p<0.01.
517
518 Figure 4. NSCs attenuates sevoflurane-induced learning and memory defects,
519 and silenced PDE7A enhances the effects of NSCs. A. Experimental design. B-C.
520 Eight weeks after sevoflurane exposure, spatial learning and memory were examined
521 by Morris water maze test on Day 1 (P71), Day 2 (P72), and Day 3 (P73). (B) Delay
522 time to reach the platform of indicated groups. *p<0.05, **p<0.01 compared with
523 Sevoflurane group; ##p<0.01 compared with Sevoflurane+NSCs/shNC. (C)
524 Swimming path length before reaching the platform of indicated groups. **p<0.01
525 compared with Sevoflurane group; #p<0.05, ##p<0.01 compared with
526 Sevoflurane+NSCs/shNC. D. Percent of time spent in the target quadrant in a probe
527 test of indicated groups. *p<0.05, **p<0.01. n = 8 for each time point.
528
529 Figure 5. NSCs attenuates sevoflurane-induced deterioration of recognition
530 memory, and silenced PDE7A enhances the effects of NSCs. A. Exploration time of
531 indicated group spent with an old object and new object. B. Discrimination index of
532 recognizing the new vs old object of an indicated group. n=8 for each group. **p<0.01.
533 C-E. The mRNA levels of PDE7A, MAP-2 and SOCS2 in brain tissues were
534 measured by RT-qPCR. β-actin was used as an internal control. *p<0.05, **p<0.01.
535 Figure 5-1 is supporting Figure 5.
536
537
23
538
539 Extended Data
540 Figure 2-1. Immunostaining of the differentiated cells with MAP2 (A-B). The 541 mouse monoclonal anti-MAP2 antibody and Alexa Fluor 488 goat anti-mouse 542 secondary antibody were used for detection. Counterstaining was done with Hoechst, 543 and images were acquired using a Leica ILMD LED inverted fluorescence 544 microscope. 545
546 Figure 5-1. Western blot analysis of pCREB expression in brain tissues. The 547 protein levels of pCREB in brain tissues were measured by Western blot. β-actin was 548 used as a loading control. 549
24