DOCSLIB.ORG

Signal Peptide Peptidase (HM13) (NM 030789) Human Untagged Clone Product Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Signal Peptide Peptidase (HM13) (NM 030789) Human Untagged Clone Product Data OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC321523 Signal Peptide Peptidase (HM13) (NM_030789) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Signal Peptide Peptidase (HM13) (NM_030789) Human Untagged Clone Tag: Tag Free Symbol: HM13 Synonyms: H13; IMP1; IMPAS; IMPAS-1; MSTP086; PSENL3; PSL3; SPP; SPPL1 Vector: pCMV6-AC (PS100020) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Signal Peptide Peptidase (HM13) (NM_030789) Human Untagged Clone – SC321523 Fully Sequenced ORF: >OriGene sequence for NM_030789.2 AACCCTTCCTGTTGCCTTAGGGGAACGTGGCTTTCCCTGCAGAGCCGGTGTCTCCGCCTG CGTCCCTGCTGCAGCAACCGGAGCTGGAGTCGGATCCCGAACGCACCCTCGCCATGGACT CGGCCCTCAGCGATCCGCATAACGGCAGTGCCGAGGCAGGCGGCCCCACCAACAGCACTA CGCGGCCGCCTTCCACGCCCGAGGGCATCGCGCTGGCCTACGGCAGCCTCCTGCTCATGG CGCTGCTGCCCATCTTCTTCGGCGCCCTGCGCTCCGTACGCTGCGCCCGCGGCAAGAATG CTTCAGACATGCCTGAAACAATCACCAGCCGGGATGCCGCCCGCTTCCCCATCATCGCCA GCTGCACACTCTTGGGGCTCTACCTCTTTTTCAAAATATTCTCCCAGGAGTACATCAACC TCCTGCTGTCCATGTATTTCTTCGTGCTGGGAATCCTGGCCCTGTCCCACACCATCAGCC CCTTCATGAATAAGTTTTTTCCAGCCAGCTTTCCAAATCGACAGTACCAGCTGCTCTTCA CACAGGGTTCTGGGGAAAACAAGGAAGAGATCATCAATTATGAATTTGACACCAAGGACC TGGTGTGCCTGGGCCTGAGCAGCATCGTTGGCGTCTGGTACCTGCTGAGGAAGCACTGGA TTGCCAACAACCTTTTTGGCCTGGCCTTCTCCCTTAATGGAGTAGAGCTCCTGCACCTCA ACAATGTCAGCACTGGCTGCATCCTGCTGGGCGGACTCTTCATCTACGATGTCTTCTGGG TATTTGGCACCAATGTGATGGTGACAGTGGCCAAGTTCTTCGAGGCACCAATAAAATTGG TGTTTCCCCAGGATCTGCTGGAGAAAGGCCTCGAAGCAAACAACTTTGCCATGCTGGGAC TTGGAGATGTCGTCATTCCAGGGATCTTCATTGCCTTGCTGCTGCGCTTTGACATCAGCT TGAAGAAGAATACCCACACCTACTTCTACACCAGCTTTGCAGCCTACATCTTCGGCCTGG GCCTTACCATCTTCATCATGCACATCTTCAAGCATGCTCAGCCTGCCCTCCTATACCTGG TCCCCGCCTGCATCGGTTTTCCTGTCCTGGTGGCGCTGGCCAAGGGAGAAGTGACAGAGA TGTTCAGTTATGAGGAGTCAAATCCTAAGGATCCAGCGGCAGTGACAGAATCCAAAGAGG GAACAGAGGCATCAGCATCGAAGGGGCTGGAGAAGAAAGAGAAATGATGCAGCTGGTGCC CGAGCCTCTCAGGGCCAGACCAGACAGATGGGGGCTGGGCCCACACAGGCGTGCACCGGT AGAGGGCACAGGAGGCCAAGGGCAGCTCCAGGACAGGGCAGGGGGCAGCAGGATACCTCC AGCCAGGCCTCTGTGGCCTCTGTTTCCTTCTCCCTTTCTTGGCCCTCCTCTGCTCCTCCC CACACCCTGCAGGCAAAAGAAACCCCCAGCTTCCCCCCTCCCCGGGAGCCAGGTGGGAAA AGTGGGTGTGATTTTTAGATTTTGTATTGTGGACTGATTTTGCCTCACATTAAAAACTCA TCCCATGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAA Restriction Sites: Please inquire ACCN: NM_030789 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_030789.2, NP_110416.1 RefSeq Size: 1604 bp RefSeq ORF: 1134 bp Locus ID: 81502 UniProt ID: Q8TCT9, A0A0S2Z5V7 Domains: DUF435 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 3 Signal Peptide Peptidase (HM13) (NM_030789) Human Untagged Clone – SC321523 Protein Families: Protease, Transmembrane Gene Summary: The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the predominant isoform (1). This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 3 / 3.
Load more

Recommended publications
  • New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology
    Cancer Research and Treatment 2003;35(4):304-313 New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology Yong-Wan Kim, Ph.D.1, Min-Je Suh, M.S.1, Jin-Sik Bae, M.S.1, Su Mi Bae, M.S.1, Joo Hee Yoon, M.D.2, Soo Young Hur, M.D.2, Jae Hoon Kim, M.D.2, Duck Young Ro, M.D.2, Joon Mo Lee, M.D.2, Sung Eun Namkoong, M.D.2, Chong Kook Kim, Ph.D.3 and Woong Shick Ahn, M.D.2 1Catholic Research Institutes of Medical Science, 2Department of Obstetrics and Gynecology, College of Medicine, The Catholic University of Korea, Seoul; 3College of Pharmacy, Seoul National University, Seoul, Korea Purpose: This study utilized both mRNA differential significant genes of unknown function affected by the display and the Gene Ontology (GO) analysis to char- HPV-16-derived pathway. The GO analysis suggested that acterize the multiple interactions of a number of genes the cervical cancer cells underwent repression of the with gene expression profiles involved in the HPV-16- cancer-specific cell adhesive properties. Also, genes induced cervical carcinogenesis. belonging to DNA metabolism, such as DNA repair and Materials and Methods: mRNA differential displays, replication, were strongly down-regulated, whereas sig- with HPV-16 positive cervical cancer cell line (SiHa), and nificant increases were shown in the protein degradation normal human keratinocyte cell line (HaCaT) as a con- and synthesis. trol, were used. Each human gene has several biological Conclusion: The GO analysis can overcome the com- functions in the Gene Ontology; therefore, several func- plexity of the gene expression profile of the HPV-16- tions of each gene were chosen to establish a powerful associated pathway, identify several cancer-specific cel- cervical carcinogenesis pathway.
    [Show full text]
  • The Landscape of Genomic Imprinting Across Diverse Adult Human Tissues
    Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Research The landscape of genomic imprinting across diverse adult human tissues Yael Baran,1 Meena Subramaniam,2 Anne Biton,2 Taru Tukiainen,3,4 Emily K. Tsang,5,6 Manuel A. Rivas,7 Matti Pirinen,8 Maria Gutierrez-Arcelus,9 Kevin S. Smith,5,10 Kim R. Kukurba,5,10 Rui Zhang,10 Celeste Eng,2 Dara G. Torgerson,2 Cydney Urbanek,11 the GTEx Consortium, Jin Billy Li,10 Jose R. Rodriguez-Santana,12 Esteban G. Burchard,2,13 Max A. Seibold,11,14,15 Daniel G. MacArthur,3,4,16 Stephen B. Montgomery,5,10 Noah A. Zaitlen,2,19 and Tuuli Lappalainen17,18,19 1The Blavatnik School of Computer Science, Tel-Aviv University, Tel Aviv 69978, Israel; 2Department of Medicine, University of California San Francisco, San Francisco, California 94158, USA; 3Analytic and Translational Genetics Unit, Massachusetts General Hospital, Boston, Massachusetts 02114, USA; 4Program in Medical and Population Genetics, Broad Institute of Harvard and MIT, Cambridge, Massachusetts 02142, USA; 5Department of Pathology, Stanford University, Stanford, California 94305, USA; 6Biomedical Informatics Program, Stanford University, Stanford, California 94305, USA; 7Wellcome Trust Center for Human Genetics, Nuffield Department of Clinical Medicine, University of Oxford, Oxford, OX3 7BN, United Kingdom; 8Institute for Molecular Medicine Finland, University of Helsinki, 00014 Helsinki, Finland; 9Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, Switzerland;
    [Show full text]
  • Vigilin Interacts with Signal Peptide Peptidase
    Lu et al. Proteome Science 2012, 10:33 http://www.proteomesci.com/content/10/1/33 RESEARCH Open Access Vigilin interacts with signal peptide peptidase Stephen Hsueh-Jeng Lu1, Amy Hye Won Jeon2, Gerold Schmitt-Ulms2, Seema Qamar1, Roger Dodd1, Beth McDonald1,YiLi1, William Meadows1, Katie Cox1, Christopher Bohm2, Fusheng Chen2, Paul Fraser2 and Peter St George-Hyslop1,2* Abstract Background: Signal peptide peptidase (SPP), a member of the presenilin-like intra-membrane cleaving aspartyl protease family, migrates on Blue Native (BN) gels as 100 kDa, 200 kDa and 450 kDa species. SPP has recently been implicated in other non-proteolytic functions such as retro-translocation of MHC Class I molecules and binding of misfolded proteins in the endoplasmic reticulum (ER). These high molecular weight SPP complexes might contain additional proteins that regulate the proteolytic activity of SPP or support its non-catalytic functions. Results: In this study, an unbiased iTRAQ-labeling mass spectrometry approach was used to identify SPP-interacting proteins. We found that vigilin, a ubiquitous multi-KH domain containing cytoplasmic protein involved in RNA binding and protein translation control, selectively enriched with SPP. Vigilin interacted with SPP and both proteins co-localized in restricted intracellular domains near the ER, biochemically co-fractionated and were part of the same 450 kDa complex on BN gels. However, vigilin does not alter the protease activity of SPP, suggesting that the SPP-vigilin interaction might be involved in the non-proteolytic functions of SPP. Conclusions: We have identified and validated vigilin as a novel interacting partner of SPP that could play an important role in the non-proteolytic functions of SPP.
    [Show full text]
  • The DNA Sequence and Comparative Analysis of Human Chromosome 20
    articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.
    [Show full text]
  • Mining Novel Candidate Imprinted Genes Using Genome-Wide Methylation Screening and Literature Review
    epigenomes Article Mining Novel Candidate Imprinted Genes Using Genome-Wide Methylation Screening and Literature Review Adriano Bonaldi 1, André Kashiwabara 2, Érica S. de Araújo 3, Lygia V. Pereira 1, Alexandre R. Paschoal 2 ID , Mayra B. Andozia 1, Darine Villela 1, Maria P. Rivas 1 ID , Claudia K. Suemoto 4,5, Carlos A. Pasqualucci 5,6, Lea T. Grinberg 5,7, Helena Brentani 8 ID , Silvya S. Maria-Engler 9, Dirce M. Carraro 3, Angela M. Vianna-Morgante 1, Carla Rosenberg 1, Luciana R. Vasques 1,† and Ana Krepischi 1,*,† ID 1 Department of Genetics and Evolutionary Biology, Institute of Biosciences, University of São Paulo, Rua do Matão 277, 05508-090 São Paulo, SP, Brazil; [email protected] (A.B.); [email protected] (L.V.P.); [email protected] (M.B.A.); [email protected] (D.V.); [email protected] (M.P.R.); [email protected] (A.M.V.-M.); [email protected] (C.R.); [email protected] (L.R.V.) 2 Department of Computation, Federal University of Technology-Paraná, Avenida Alberto Carazzai, 1640, 86300-000 Cornélio Procópio, PR, Brazil; [email protected] (A.K.); [email protected] (A.R.P.) 3 International Center for Research, A. C. Camargo Cancer Center, Rua Taguá, 440, 01508-010 São Paulo, SP, Brazil; [email protected] (É.S.d.A.); [email protected] (D.M.C.) 4 Division of Geriatrics, University of São Paulo Medical School, Av. Dr. Arnaldo, 455, 01246-903 São Paulo, SP, Brazil; [email protected] 5 Brazilian Aging Brain Study Group-LIM22, Department of Pathology, University of São Paulo Medical School, Av.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information Flow
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Transcriptome Analysis of Aeromonas Hydrophila Infected Hybrid Sturgeon
    www.nature.com/scientificreports OPEN Transcriptome analysis of Aeromonas hydrophila infected hybrid sturgeon (Huso Received: 29 June 2017 Accepted: 16 November 2018 dauricus×Acipenser schrenckii) Published: xx xx xxxx Nan Jiang, Yuding Fan, Yong Zhou, Weiling Wang, Jie Ma & Lingbing Zeng The hybrid sturgeon (Huso dauricus × Acipenser schrenckii) is an economically important species in China. With the increasing aquaculture of hybrid sturgeon, the bacterial diseases are a great concern of the industry. In this study, de novo sequencing was used to compare the diference in transcriptome in spleen of the infected and mock infected sturgeon with Aeromonas hydrophila. Among 187,244 unigenes obtained, 87,887 unigenes were annotated and 1,147 unigenes were associated with immune responses genes. Comparative expression analysis indicated that 2,723 diferently expressed genes between the infected and mock-infected group were identifed, including 1,420 up-regulated and 1,303 down-regulated genes. 283 diferently expressed anti-bacterial immune related genes were scrutinized, including 168 up-regulated and 115 down-regulated genes. Ten of the diferently expressed genes were further validated by qRT-PCR. In this study, toll like receptors (TLRs) pathway, NF-kappa B pathway, class A scavenger receptor pathway, phagocytosis pathway, mannose receptor pathway and complement pathway were shown to be up-regulated in Aeromonas hydrophila infected hybrid sturgeon. Additionally, 65,040 potential SSRs and 2,133,505 candidate SNPs were identifed from the hybrid sturgeon spleen transcriptome. This study could provide an insight of host immune genes associated with bacterial infection in hybrid sturgeon. Sturgeon is an important fsh species farmed worldwide, which has signifcant economic value as an animal protein source, including caviar and meat1,2.
    [Show full text]
  • APOL1 Renal-Risk Variants Induce Mitochondrial Dysfunction
    BASIC RESEARCH www.jasn.org APOL1 Renal-Risk Variants Induce Mitochondrial Dysfunction † †‡ | Lijun Ma,* Jeff W. Chou, James A. Snipes,* Manish S. Bharadwaj,§ Ann L. Craddock, †† Dongmei Cheng,¶ Allison Weckerle,¶ Snezana Petrovic,** Pamela J. Hicks, ‡‡ †| | Ashok K. Hemal, Gregory A. Hawkins, Lance D. Miller, Anthony J.A. Molina,§ †‡ † Carl D. Langefeld, Mariana Murea,* John S. Parks,¶ and Barry I. Freedman* §§ *Department of Internal Medicine, Section on Nephrology, †Center for Public Health Genomics, ‡Division of Public Health Sciences, Department of Biostatistical Sciences, §Department of Internal Medicine, Section on Gerontology and Geriatric Medicine, |Department of Cancer Biology, ¶Department of Internal Medicine, Section on Molecular Medicine, **Department of Physiology and Pharmacology, ††Department of Biochemistry, ‡‡Department of Urology, and §§Center for Diabetes Research, Wake Forest School of Medicine, Winston-Salem, North Carolina ABSTRACT APOL1 G1 and G2 variants facilitate kidney disease in blacks. To elucidate the pathways whereby these variants contribute to disease pathogenesis, we established HEK293 cell lines stably expressing doxycycline- BASIC RESEARCH inducible (Tet-on) reference APOL1 G0 or the G1 and G2 renal-risk variants, and used Illumina human HT-12 v4 arrays and Affymetrix HTA 2.0 arrays to generate global gene expression data with doxycycline induction. Significantly altered pathways identified through bioinformatics analyses involved mitochondrial function; results from immunoblotting, immunofluorescence, and functional assays validated these findings. Overex- pression of APOL1 by doxycycline induction in HEK293 Tet-on G1 and G2 cells led to impaired mitochondrial function, with markedly reduced maximum respiration rate, reserve respiration capacity, and mitochondrial membrane potential. Impaired mitochondrial function occurred before intracellular potassium depletion or reduced cell viability occurred.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Cleavage by Signal Peptide Peptidase Is Required for the Degradation of Selected Tail-Anchored Proteins
    JCB: Article Cleavage by signal peptide peptidase is required for the degradation of selected tail-anchored proteins Jessica M. Boname,1,2 Stuart Bloor,1,2 Michal P. Wandel,1,3 James A. Nathan,1,2 Robin Antrobus,1 Kevin S. Dingwell,4 Teresa L. Thurston,3 Duncan L. Smith,5 James C. Smith,4 Felix Randow,2,3 and Paul J. Lehner1,2 1Cambridge Institute for Medical Research, University of Cambridge, Cambridge CB2 0XY, England, UK 2Department of Medicine, University of Cambridge, Cambridge CB2 0QQ, England, UK 3Division of Protein and Nucleic Acid Chemistry, Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 0QH, England, UK 4Medical Research Council National Institute for Medical Research, London NW7 1AA, England, UK 5Cancer Research UK Manchester Institute, University of Manchester, Manchester M20 4B, England, UK he regulated turnover of endoplasmic reticulum (ER)– identified HO-1 (heme oxygenase-1), the rate-limiting en- resident membrane proteins requires their extraction zyme in the degradation of heme to biliverdin, as a novel T from the membrane lipid bilayer and subsequent SPP substrate. Intramembrane cleavage by catalytically proteasome-mediated degradation. Cleavage within the active SPP provided the primary proteolytic step required transmembrane domain provides an attractive mechanism for the extraction and subsequent proteasome-dependent to facilitate protein dislocation but has never been shown for degradation of HO-1, an ER-resident tail-anchored protein. endogenous substrates. To determine whether intramembrane SPP-mediated proteolysis was not limited to HO-1 but was proteolysis, specifically cleavage by the intramembrane- required for the dislocation and degradation of additional cleaving aspartyl protease signal peptide peptidase (SPP), tail-anchored ER-resident proteins.
    [Show full text]
  • Product Data Sheet
    For research purposes only, not for human use Product Data Sheet HM13 siRNA (Human) Catalog # Source Reactivity Applications CRJ2980 Synthetic H RNAi Description siRNA to inhibit HM13 expression using RNA interference Specificity HM13 siRNA (Human) is a target-specific 19-23 nt siRNA oligo duplexes designed to knock down gene expression. Form Lyophilized powder Gene Symbol HM13 Alternative Names H13; IMP1; PSL3; SPP; Minor histocompatibility antigen H13; Intramembrane protease 1; IMP-1; IMPAS-1; hIMP1; Presenilin-like protein 3; Signal peptide peptidase Entrez Gene 81502 (Human) SwissProt Q8TCT9 (Human) Purity > 97% Quality Control Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency. Components We offers pre-designed sets of 3 different target-specific siRNA oligo duplexes of human HM13 gene. Each vial contains 5 nmol of lyophilized siRNA. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. Our siRNA oligos are also chemically modified (2’-OMe) at no extra charge for increased stability and Application key: E- ELISA, WB- Western blot, IH- Immunohistochemistry, IF- Immunofluorescence,
    [Show full text]
  • Molecular Pathways for Immune Recognition of Preproinsulin Signal Peptide in Type 1 Diabetes
    Diabetes Volume 67, April 2018 687 Molecular Pathways for Immune Recognition of Preproinsulin Signal Peptide in Type 1 Diabetes Deborah Kronenberg-Versteeg,1,2 Martin Eichmann,1 Mark A. Russell,3 Arnoud de Ru,4 Beate Hehn,5 Norkhairin Yusuf,1 Peter A. van Veelen,4 Sarah J. Richardson,3 Noel G. Morgan,3 Marius K. Lemberg,5 and Mark Peakman1,2 Diabetes 2018;67:687–696 | https://doi.org/10.2337/db17-0021 The signal peptide region of preproinsulin (PPI) contains In type 1 diabetes, the pathological process of immune- epitopes targeted by HLA-A-restricted (HLA-A0201, A2402) mediated destruction of insulin-producing b-cells leads to IMMUNOLOGY AND TRANSPLANTATION cytotoxic T cells as part of the pathogenesis of b-cell de- insulin deficiency and hyperglycemia (1). Multiple arms of struction in type 1 diabetes. We extended the discovery of the immune system are likely to contribute to this tissue- the PPI epitope to disease-associated HLA-B*1801 and damaging process, with strong indications that CD8+ cyto- HLA-B*3906 (risk) and HLA-A*1101 and HLA-B*3801 (pro- toxic T lymphocytes (CTLs) are a dominant killing pathway. tective) alleles, revealing that four of six alleles present Evidence includes data from preclinical models showing de- epitopes derived from the signal peptide region. During pendence of disease development on intact CD8/MHC class cotranslational translocation of PPI, its signal peptide is I mechanisms (2), supported by compelling findings in hu- cleaved and retained within the endoplasmic reticulum man studies, including the existence of high-risk polymor- (ER) membrane, implying it is processed for immune phic HLA class I genes (3); enrichment of effector CTLs recognition outside of the canonical proteasome-directed specificforb-cell targets in the circulation in new-onset pathway.
    [Show full text]