First Report of Two Successive Deletions on Chromosome 15Q13

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Alsagob et al. Molecular Cytogenetics (2019) 12:21 https://doi.org/10.1186/s13039-019-0432-6 SHORTREPORT Open Access First report of two successive deletions on chromosome 15q13 cytogenetic bands in a boy and girl: additional data to 15q13.3 syndrome with a report of high IQ patient Maysoon Alsagob1, Mustafa A. Salih2, Muddathir H. A. Hamad2, Yusra Al-Yafee1, Jawaher Al-Zahrani1, Albandary Al-Bakheet1, Michael Nester3, Nadia Sakati3, Salma M. Wakil1, Ali AlOdaib1, Dilek Colak4 and Namik Kaya1,2* Abstract 15q13.3 syndrome is associated with a wide spectrum of neurological disorders. Among a cohort of 150 neurodevelopmental cases, we identified two patients with two close proximity interstitial hemizygous deletions on chromosome 15q13. Using high-density microarrays, we characterized these deletions and their approximate breakpoints. The second deletion in both patients overlaps in a small area containing CHRNA7 where the gene is partially deleted. The CHRNA7 is considered a strong candidate for the 15q13.3 deletion syndrome’s pathogenicity. Patient 1 has cognitive impairment, learning disabilities, hyperactivity and subtle dysmorphic features whereas patient 2 has mild language impairment with speech difficulty, mild dysmorphia, heart defect and interestingly a high IQ that has not been reported in 15q13.3 syndrome patients before. Our study presents first report of such two successive deletions in 15q13.3 syndrome patients and a high IQ in a 15q13.3 syndrome patient. Our study expands the breakpoints and phenotypic features related to 15q13.3 syndrome. Keywords: 15q13.3 syndrome, Consecutive deletions, High IQ, CHRNA7, Hyperactivity, Cognitive impairment, And learning disability Background psychiatric problems, such as schizophrenia and epilepsy 15q13.3 microdeletion syndrome (MS) expands on ap- with recurring seizures or in some cases asymptomatic proximately 1.5 Mbp on chromosome 15q. This region [3–8]. 15q13.3 MS may appear as de novo or could be is also known to involve in other diseases such as Prader transmitted in an autosomal dominant mode with re- Willi, Angelman syndrome, and autism [1, 2]. The syn- duced penetrance. Presence of homozygous microdele- drome has a wide spectrum of phenotypic consequences tions have also been reported [9, 10]. The prevalence of even within the same family. Patients exhibit various de- the disease remains unknown [1, 10–16]. However, a re- grees of intellectual disabilities ranging from rarely nor- cent study estimated that 1 in 5525 live birth has a mal intelligence to a high degree of impairment that pathogenic 15q13.3 microdeletion, which can indicates leads to severe learning difficulties. The condition may that the syndrome is under-diagnosed [17]. include various dysmorphic characteristics, neurodeve- In this study, a pool of 150 cases suspected to have lopmental phenotypes, impaired vision as well as chromosomal abnormalities, including dysmorphia, aut- ism, language delay, ADHD, speech and developmental * Correspondence: [email protected]; [email protected] delay, were examined. The investigation was carried out 1Department of Genetics, King Faisal Specialist Hospital and Research Centre, by different types of oligonucleotide microarrays. Among MBC: 03, Riyadh 11211, Kingdom of Saudi Arabia the cohort, two cases related to 15q13.3 deletion syn- 2Division of Pediatric Neurology, Department of Pediatrics, College of Medicine, King Saud University, Riyadh, Saudi Arabia drome were identified. Both patients have consecutive Full list of author information is available at the end of the article microdeletions separated by an intact region in the © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Alsagob et al. Molecular Cytogenetics (2019) 12:21 Page 2 of 6 15q13 cytogenetic bands where CHRNA7 is partially with some help but could dress and feed herself without deleted. help. She was quite irritable and demanding, particularly with her parents, but not aggressive. At the age of 6 Clinical presentation years, she had an echocardiogram that showed a Patient 1 The patient is an 8 ½ -year-old boy presented redundant mildly prolapsed mitral valve. The cardiac with hyperactivity, cognitive impairment, learning dis- muscle was mildly thickened, but otherwise normal in abilities and subtle dysmorphic features. He was born at function. At the age of 7 years she was evaluated by a term to non-consanguineous parents. Pregnancy history neurophysiologist due to speech delay and diagnosed was not remarkable and there were no postnatal compli- with expressive language delay but normal psychomotor cations. He was said to be floppy initially, but managed development. Her weight was only 15.3 kg, which is far to sit by the age of 8 months, and walked by his 15th below the 5th percentile; and her height was 104.5 cm, month. Additionally, language abilities are significantly which is also far below 5th percentile. The second ECG delayed and he is currently able to say comprehensible was also performed confirming previous findings of lo- sentences of 3–4 words only. He was also noted to be calized septal hypertrophy and redundant anterior mitral hyperactive with stereotypic hands movements which leaflet. At the age of 16 she has a short status found to improved significantly after some sessions of behavioral have growth hormone deficiency and delayed puberty. therapy. His parents noted improvement in his social Molecular analysis of the patient 1 was done using skills after he was on methylphenidate hydrochloride high-resolution GTW-banding and high-density oligo with a dose of 36 mg once daily 2 years ago. His IQ was arrays. High-resolution GTW-banding (550 band reso- graded as 70 at the age of 6 years and was attending a lution) was carried out as part of diagnostic procedures special needs school. Upon examination, his weight was and did not reveal any gross abnormality. Cytoscan HD 21 kg at the 5th centile, height was 126.6 cm (> 25th arrays (Affymetrix Inc., San Paolo, CA, US) identified <50th centile) and his head circumference was 53 cm two deletions with close proximity on 15q13 cytogenetic. (slightly above the 50th centile). He showed subtle dys- The second deletion sits on 15q13.3 band (Table 1, morphic features with large ears, prominent nasal tip, Fig. 1a). The deletion sites are covered by more than clinodactyly of the fifth finger and persistent fetal finger- 1082 probes in the first and 1052 probes in the second tip pads. There was one tiny pigmented naevus on the deletions. There are probeless regions on both deletions left cheek and another two (about 0.5 cm) over the abdo- making precise BP calculations difficult. Interestingly, an men and back. Cranial nerves were intact and he had area covered by 435 SNP-CP probes between the dele- normal tone, power and reflexes in the upper and the tions clearly demonstrated that these deletions are two lower limbs with normal gait. separate unique deletions in the region (Fig. 1a). Parental Patient 2 The patient is a 17-year-old female who has DNA was tested using the same chip, no chromosomal been followed up at King Faisal Specialist Hospital and imbalance was detected hence the hemizygous deletion Research Center (KFSHRC) for nearly 15 years. The pa- in our patient is considered de novo. tient was referred to KFSHRC with the suspicion of aut- Patient 2 was also analyzed using GTW-banding that ism and had history of speech and language delay. She did not revealed any abnormality. However, similar to had normal pre- and perinatal history with slow mile- patient 1, SNP Array 6.0 (Affymetrix Inc.) indicated two stones in language areas. She was given Beery-VMI, Lei- consecutive deletions on 15q13. The first deletion is ter International Performance Scale, Selected subtests, located on 15q13.2 while the second deletion resides on and McCarthy Scales of Children’s Abilities (MSCA) at 15q13.3 (Table 1, Fig. 1b). During the analyses, we the age of 4-year-2-month-old. She managed a 3 and 5 converted hg18 annotations to hg19 using UCSC’s Left block figures on MSCA without difficulty for an equiva- Genome Annotations application for the purpose of lency of 4+ years. She stacked only six blocks, showed comparison (Fig. 1c). The coordinates after the conversion some motor clumsiness. She speaks full sentences with are 30,450,356–30,779,579 (hg19) and 32,561,665– reasonable clarity but her vocabulary was limited. She 32,876,972 (hg19) for the first and the second deletion, re- named only one of the picture vocabulary cards and was spectively. The first deletion is pointed out by 95 CN and able to point 17 out of 19. She follows directions and 2 SNP probes on 6.0 arrays whereas the second deletion is her receptive language skills seem relatively impact. She covered by only 43 CN probes on the same arrays. The did extremely well on the Leiter with an age equivalency parental DNA was not available for examination. of 5-years-5-months-old and IQ of 134. On the Beery-VMI she had similar but little lesser score. She Discussion and conclusions showed poor pencil control with an age of equivalency Six break points (BPs) have been characterized in 15q of 42 months and a standard score of 93. There were no region, due to the prevalence of low-copy repeats in attention related problems.
Recommended publications
  • Genome-Wide Analysis of Host-Chromosome Binding Sites For

    Genome-Wide Analysis of Host-Chromosome Binding Sites For

    Lu et al. Virology Journal 2010, 7:262 http://www.virologyj.com/content/7/1/262 RESEARCH Open Access Genome-wide analysis of host-chromosome binding sites for Epstein-Barr Virus Nuclear Antigen 1 (EBNA1) Fang Lu1, Priyankara Wikramasinghe1, Julie Norseen1,2, Kevin Tsai1, Pu Wang1, Louise Showe1, Ramana V Davuluri1, Paul M Lieberman1* Abstract The Epstein-Barr Virus (EBV) Nuclear Antigen 1 (EBNA1) protein is required for the establishment of EBV latent infection in proliferating B-lymphocytes. EBNA1 is a multifunctional DNA-binding protein that stimulates DNA replication at the viral origin of plasmid replication (OriP), regulates transcription of viral and cellular genes, and tethers the viral episome to the cellular chromosome. EBNA1 also provides a survival function to B-lymphocytes, potentially through its ability to alter cellular gene expression. To better understand these various functions of EBNA1, we performed a genome-wide analysis of the viral and cellular DNA sites associated with EBNA1 protein in a latently infected Burkitt lymphoma B-cell line. Chromatin-immunoprecipitation (ChIP) combined with massively parallel deep-sequencing (ChIP-Seq) was used to identify cellular sites bound by EBNA1. Sites identified by ChIP- Seq were validated by conventional real-time PCR, and ChIP-Seq provided quantitative, high-resolution detection of the known EBNA1 binding sites on the EBV genome at OriP and Qp. We identified at least one cluster of unusually high-affinity EBNA1 binding sites on chromosome 11, between the divergent FAM55 D and FAM55B genes. A con- sensus for all cellular EBNA1 binding sites is distinct from those derived from the known viral binding sites, sug- gesting that some of these sites are indirectly bound by EBNA1.
  • APBA2 Antibody A

    APBA2 Antibody A

    C 0 2 - t APBA2 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 3 9 Web: [email protected] 5 www.cellsignal.com 8 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB, IP M R Endogenous 135 Rabbit Q99767 321 Product Usage Information Application Dilution Western Blotting 1:1000 Immunoprecipitation 1:50 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity APBA2 Antibody recognizes endogenous levels of total APBA2 protein. Species Reactivity: Mouse, Rat Species predicted to react based on 100% sequence homology: Human Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Phe300 of human APBA2 protein. Antibodies are purified by protein A and peptide affinity chromatography. Background Amyloid β A4 precursor protein-binding family A member 2 (APBA2) is a neuronal adaptor protein that interacts with the amyloid β precursor protein (APP) (1). The amyloid β-protein (Aβ) is the principal component of amyloid plaques, a pathological hallmark of Alzheimer’s disease (2). APBA2 has been shown to stabilize APP metabolism and suppress the secretion of Aβ (3). APBA2 mediates interaction between APP and the neural type I membrane protein Alcadein (Alc) by linking their cytoplasmic domains, thereby forming a tripartite complex of the three proteins in neurons (4).
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?

    Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?

    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
  • Expression Analysis of Circular Rnas in Young and Sexually Mature Boar Testes

    Expression Analysis of Circular Rnas in Young and Sexually Mature Boar Testes

    animals Article Expression Analysis of Circular RNAs in Young and Sexually Mature Boar Testes Fei Zhang 1,2,† , Xiaodong Zhang 1,†, Wei Ning 1, Xiangdong Zhang 1, Zhenyuan Ru 1, Shiqi Wang 1, Mei Sheng 1, Junrui Zhang 1, Xueying Zhang 1, Haiqin Luo 1, Xin Wang 1, Zubing Cao 1,* and Yunhai Zhang 1,* 1 Anhui Province Key Laboratory of Local Livestock and Poultry, Genetical Resource Conservation and Breeding, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China; [email protected] (F.Z.); [email protected] (X.Z.); [email protected] (W.N.); [email protected] (X.Z.); [email protected] (Z.R.); [email protected] (S.W.); [email protected] (M.S.); [email protected] (J.Z.); [email protected] (X.Z.); [email protected] (H.L.); [email protected] (X.W.) 2 School of Life Sciences, Anhui Agricultural University, Hefei 230036, China * Correspondence: [email protected] (Z.C.); [email protected] (Y.Z.); Tel.: +86-551-6578-6357 (Y.Z.) † These authors contributed equally to this study. Simple Summary: Circular RNAs are novel long non-coding RNA involved in the regulation of gene expression. Recently, the expression of circRNAs was characterized in testes of humans and bulls. However, the profiling of circRNAs and their potential biological functions in boar testicular development are yet to be known. In this study we characterized expression and biological roles of circRNAs in piglet (30 d) and adult (210 d) boar testes by high-throughput sequencing. We identified a large number of circRNAs during testicular development, of which 2326 circRNAs exhibited a significantly differential expression.
  • Integrative Bulk and Single-Cell Profiling of Premanufacture T-Cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-Cell Therapy

    Integrative Bulk and Single-Cell Profiling of Premanufacture T-Cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-Cell Therapy

    Published OnlineFirst April 5, 2021; DOI: 10.1158/2159-8290.CD-20-1677 RESEARCH ARTICLE Integrative Bulk and Single-Cell Profiling of Premanufacture T-cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-cell Therapy Gregory M. Chen1, Changya Chen2,3, Rajat K. Das2, Peng Gao2, Chia-Hui Chen2, Shovik Bandyopadhyay4, Yang-Yang Ding2,5, Yasin Uzun2,3, Wenbao Yu2, Qin Zhu1, Regina M. Myers2, Stephan A. Grupp2,5, David M. Barrett2,5, and Kai Tan2,3,5 Downloaded from cancerdiscovery.aacrjournals.org on October 1, 2021. © 2021 American Association for Cancer Research. Published OnlineFirst April 5, 2021; DOI: 10.1158/2159-8290.CD-20-1677 ABSTRACT The adoptive transfer of chimeric antigen receptor (CAR) T cells represents a breakthrough in clinical oncology, yet both between- and within-patient differences in autologously derived T cells are a major contributor to therapy failure. To interrogate the molecular determinants of clinical CAR T-cell persistence, we extensively characterized the premanufacture T cells of 71 patients with B-cell malignancies on trial to receive anti-CD19 CAR T-cell therapy. We performed RNA-sequencing analysis on sorted T-cell subsets from all 71 patients, followed by paired Cellular Indexing of Transcriptomes and Epitopes (CITE) sequencing and single-cell assay for transposase-accessible chromatin sequencing (scATAC-seq) on T cells from six of these patients. We found that chronic IFN signaling regulated by IRF7 was associated with poor CAR T-cell persistence across T-cell subsets, and that the TCF7 regulon not only associates with the favorable naïve T-cell state, but is maintained in effector T cells among patients with long-term CAR T-cell persistence.
  • Gene Ontology Functional Annotations and Pleiotropy

    Gene Ontology Functional Annotations and Pleiotropy

    Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
  • APBA2 Blocking Peptide (CDBP5073) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use

    APBA2 Blocking Peptide (CDBP5073) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use

    APBA2 blocking peptide (CDBP5073) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Immunogen 18 amino acids near the amino terminus of human APBA2. Nature Synthetic Expression System N/A Species Reactivity Human Conjugate Unconjugated Applications Used as a blocking peptide in immunoblotting applications. Procedure None Format Liquid Concentration 200 μg/mL Size 0.05mg Preservative None Storage -20°C ANTIGEN GENE INFORMATION Gene Name APBA2 amyloid beta (A4) precursor protein-binding, family A, member 2 [ Homo sapiens (human) ] Official Symbol APBA2 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Synonyms APBA2; amyloid beta (A4) precursor
  • Gene Networks Activated by Specific Patterns of Action Potentials in Dorsal Root Ganglia Neurons Received: 10 August 2016 Philip R

    Gene Networks Activated by Specific Patterns of Action Potentials in Dorsal Root Ganglia Neurons Received: 10 August 2016 Philip R

    www.nature.com/scientificreports OPEN Gene networks activated by specific patterns of action potentials in dorsal root ganglia neurons Received: 10 August 2016 Philip R. Lee1,*, Jonathan E. Cohen1,*, Dumitru A. Iacobas2,3, Sanda Iacobas2 & Accepted: 23 January 2017 R. Douglas Fields1 Published: 03 March 2017 Gene regulatory networks underlie the long-term changes in cell specification, growth of synaptic connections, and adaptation that occur throughout neonatal and postnatal life. Here we show that the transcriptional response in neurons is exquisitely sensitive to the temporal nature of action potential firing patterns. Neurons were electrically stimulated with the same number of action potentials, but with different inter-burst intervals. We found that these subtle alterations in the timing of action potential firing differentially regulates hundreds of genes, across many functional categories, through the activation or repression of distinct transcriptional networks. Our results demonstrate that the transcriptional response in neurons to environmental stimuli, coded in the pattern of action potential firing, can be very sensitive to the temporal nature of action potential delivery rather than the intensity of stimulation or the total number of action potentials delivered. These data identify temporal kinetics of action potential firing as critical components regulating intracellular signalling pathways and gene expression in neurons to extracellular cues during early development and throughout life. Adaptation in the nervous system in response to external stimuli requires synthesis of new gene products in order to elicit long lasting changes in processes such as development, response to injury, learning, and memory1. Information in the environment is coded in the pattern of action-potential firing, therefore gene transcription must be regulated by the pattern of neuronal firing.
  • Strong Synaptic Transmission Impact by Copy Number Variations in Schizophrenia

    Strong Synaptic Transmission Impact by Copy Number Variations in Schizophrenia

    Strong synaptic transmission impact by copy number variations in schizophrenia Joseph T. Glessnera, Muredach P. Reillyb, Cecilia E. Kima, Nagahide Takahashic, Anthony Albanoa, Cuiping Houa, Jonathan P. Bradfielda, Haitao Zhanga, Patrick M. A. Sleimana, James H. Florya, Marcin Imielinskia, Edward C. Frackeltona, Rosetta Chiavaccia, Kelly A. Thomasa, Maria Garrisa, Frederick G. Otienoa, Michael Davidsond, Mark Weiserd, Abraham Reichenberge, Kenneth L. Davisc,JosephI.Friedmanc, Thomas P. Cappolab, Kenneth B. Marguliesb, Daniel J. Raderb, Struan F. A. Granta,f,g, Joseph D. Buxbaumc, Raquel E. Gurh, and Hakon Hakonarsona,f,g,1 aCenter for Applied Genomics, The Children’s Hospital of Philadelphia, Philadelphia, PA 19104; bPenn Cardiovascular Institute, University of Pennsylvania School of Medicine, Philadelphia, PA 19104; cConte Center for the Neuroscience of Mental Disorders and Department of Psychiatry, Mount Sinai School of Medicine, New York, NY, 10029; dSheba Medical Center, Tel Hashomer, 52621, Israel; eMount Sinai and Institute of Psychiatry, King’s College, London, SE5 8AF, United Kingdom; fDivision of Human Genetics, The Children’s Hospital of Philadelphia, Philadelphia, PA 19104; gDepartment of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, PA 19104; and hSchizophrenia Center, Neuropsychiatry Division, Department of Psychiatry, University of Pennsylvania, Philadelphia, PA 19104 Edited by James R. Lupski, Baylor College of Medicine, Houston, TX, and accepted by the Editorial Board April 13, 2010 (received for review January 7, 2010) Schizophrenia is a psychiatric disorder with onset in late adoles- contribute to the complex etiology underlying various psychiatric cence and unclear etiology characterized by both positive and ne- and neurodevelopmental disorders (13, 14). Whereas rare recurrent gative symptoms, as well as cognitive deficits.
  • An Application for CEN Module Extraction And

    An Application for CEN Module Extraction And

    www.nature.com/scientificreports OPEN THD-Module Extractor: An Application for CEN Module Extraction and Interesting Gene Received: 30 June 2016 Accepted: 03 November 2016 Identification for Alzheimer’s Published: 30 November 2016 Disease Tulika Kakati1, Hirak Kashyap2 & Dhruba K. Bhattacharyya1 There exist many tools and methods for construction of co-expression network from gene expression data and for extraction of densely connected gene modules. In this paper, a method is introduced to construct co-expression network and to extract co-expressed modules having high biological significance. The proposed method has been validated on several well known microarray datasets extracted from a diverse set of species, using statistical measures, such as p and q values. The modules obtained in these studies are found to be biologically significant based on Gene Ontology enrichment analysis, pathway analysis, and KEGG enrichment analysis. Further, the method was applied on an Alzheimer’s disease dataset and some interesting genes are found, which have high semantic similarity among them, but are not significantly correlated in terms of expression similarity. Some of these interesting genes, such as MAPT, CASP2, and PSEN2, are linked with important aspects of Alzheimer’s disease, such as dementia, increase cell death, and deposition of amyloid-beta proteins in Alzheimer’s disease brains. The biological pathways associated with Alzheimer’s disease, such as, Wnt signaling, Apoptosis, p53 signaling, and Notch signaling, incorporate these interesting genes. The proposed method is evaluated in regard to existing literature. The volume of data obtained by microarray or other new high throughput technologies have been increasing enormously, and as a result, the biological databases are growing enormously.
  • Human Chromosome 15Q11-Q14 Regions of Rearrangements Contain Clusters of LCR15 Duplicons

    Human Chromosome 15Q11-Q14 Regions of Rearrangements Contain Clusters of LCR15 Duplicons

    European Journal of Human Genetics (2002) 10, 26 ± 35 ã 2002 Nature Publishing Group All rights reserved 1018-4813/02 $25.00 www.nature.com/ejhg ARTICLE Human chromosome 15q11-q14 regions of rearrangements contain clusters of LCR15 duplicons Miguel Angel Pujana1, Marga Nadal1, Miriam Guitart2, LluõÂs Armengol1,MoÁnica GratacoÁs1 and Xavier Estivill*,1 1Centre de GeneÁtica MeÁdicaiMolecular-IRO,HospitalDuraniReynals,GranVõÂa km 2.7, 08907 L'Hospitalet de Llobregat, Barcelona, Spain; 2Corporacio Parc TaulõÂ, Laboratori de GeneÁtica, Sabadell, Spain Six breakpoint regions for rearrangements of human chromosome 15q11-q14 have been described. These rearrangements involve deletions found in approximately 70% of Prader-Willi or Angelman's syndrome patients (PWS, AS), duplications detected in some cases of autism, triplications and inverted duplications. HERC2-containing (HEct domain and RCc1 domain protein 2) segmental duplications or duplicons are present at two of these breakpoints (BP2 and BP3) mainly associated with deletions. We show here that clusters containing several copies of the human chromosome 15 low-copy repeat (LCR15) duplicon are located at each of the six described 15q11-q14 BPs. In addition, our results suggest the existence of breakpoints for large 15q11-q13 deletions in a proximal duplicon-containing clone. The study reveals that HERC2-containing duplicons (estimated on 50 ± 400 kb) and LCR15 duplicons (*15 kb on 15q11-q14) share the golgin-like protein (GLP) genomic sequence. Through the analysis of a human BAC library and public databases we have identified 36 LCR15 related sequences in the human genome, most (27) mapping to chromosome 15q and being transcribed. LCR15 analysis in non-human primates and age-sequence divergences support a recent origin of this family of segmental duplications through human speciation.
  • Apba2 (NM 007461) Mouse Tagged ORF Clone Product Data

    Apba2 (NM 007461) Mouse Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG210457 Apba2 (NM_007461) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Apba2 (NM_007461) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Apba2 Synonyms: mXllL; X11-like; X11L; XllL Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Apba2 (NM_007461) Mouse Tagged ORF Clone – MG210457 ORF Nucleotide >MG210457 representing NM_007461 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCACCGCAAGCGTCAGAGCACTGCAAGCAGCATGCTGGACCACAGGGCCAGGCCAGGTCCTATCC CCCATGACCAGGAGCCTGAGAGTGAGGACACAGAACTGCCTCTGGAGAGCTATGTACCCACAGGCCTGGA GCTGGGCACTCTGAGGCCAGAGAGCCCCACGCCCGAGGAACAGGAGTGCCACAACCATAGTCCTGATGGG GACTCCAGCTCTGACTATGTGAACAACACATCTGAGGAGGAGGACTATGACGAGGGCCTCCCTGAGGAGG AGGAGGGTGTCACCTACTACATCCGCTACTGTCCTGAGGATGACAGCTACCTGGAGGGCATGGACTGTAA TGGGGAGGAATACATAGCACACGGTGCACATCCCGTGGACACCGATGAGTGTCAGGAGGCGGTGGAGGAC TGGACGGACTCAGTGGGCCCTCATACTCATAGCCACGGGGCTGAAAACAGCCAGGAGTACCCAGATGGCC ACCTGCCTATCCCAGAGGATGACCCTACTGTCCTGGAGGTCCATGACCAGGAAGAAGATGGCCACTACTG TTCCAGCAAGGAGAGCTACCAGGACTATTACCCCCCAGAGACCAATGGGAACACAGGTGGCGCCTCCCCC