APBA2 Blocking Peptide (CDBP5073) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use

Total Page：16

File Type：pdf, Size：1020Kb

APBA2 blocking peptide (CDBP5073) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Immunogen 18 amino acids near the amino terminus of human APBA2. Nature Synthetic Expression System N/A Species Reactivity Human Conjugate Unconjugated Applications Used as a blocking peptide in immunoblotting applications. Procedure None Format Liquid Concentration 200 μg/mL Size 0.05mg Preservative None Storage -20°C ANTIGEN GENE INFORMATION Gene Name APBA2 amyloid beta (A4) precursor protein-binding, family A, member 2 [ Homo sapiens (human) ] Official Symbol APBA2 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Synonyms APBA2; amyloid beta (A4) precursor protein-binding, family A, member 2; X11L; MINT2; LIN-10; HsT16821; X11-BETA; D15S1518E; MGC:14091; amyloid beta A4 precursor protein-binding family A member 2; mint-2; X11-like protein; adapter protein X11beta; neuron-specific X11L protein; neuronal munc18-1-interacting protein 2; phosphotyrosine-binding/-interacting domain (PTB)-bearing protein; amyloid beta (A4) precursor protein-binding, family A, member 2 (X11- like) Entrez Gene ID 321 mRNA Refseq NM_001130414 Protein Refseq NP_001123886 UniProt ID Q99767 Function beta-amyloid binding; protein binding 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 2 © Creative Diagnostics All Rights Reserved.

Copy Link

Recommended publications

Genome-Wide Analysis of Host-Chromosome Binding Sites For
Lu et al. Virology Journal 2010, 7:262 http://www.virologyj.com/content/7/1/262 RESEARCH Open Access Genome-wide analysis of host-chromosome binding sites for Epstein-Barr Virus Nuclear Antigen 1 (EBNA1) Fang Lu1, Priyankara Wikramasinghe1, Julie Norseen1,2, Kevin Tsai1, Pu Wang1, Louise Showe1, Ramana V Davuluri1, Paul M Lieberman1* Abstract The Epstein-Barr Virus (EBV) Nuclear Antigen 1 (EBNA1) protein is required for the establishment of EBV latent infection in proliferating B-lymphocytes. EBNA1 is a multifunctional DNA-binding protein that stimulates DNA replication at the viral origin of plasmid replication (OriP), regulates transcription of viral and cellular genes, and tethers the viral episome to the cellular chromosome. EBNA1 also provides a survival function to B-lymphocytes, potentially through its ability to alter cellular gene expression. To better understand these various functions of EBNA1, we performed a genome-wide analysis of the viral and cellular DNA sites associated with EBNA1 protein in a latently infected Burkitt lymphoma B-cell line. Chromatin-immunoprecipitation (ChIP) combined with massively parallel deep-sequencing (ChIP-Seq) was used to identify cellular sites bound by EBNA1. Sites identified by ChIP- Seq were validated by conventional real-time PCR, and ChIP-Seq provided quantitative, high-resolution detection of the known EBNA1 binding sites on the EBV genome at OriP and Qp. We identified at least one cluster of unusually high-affinity EBNA1 binding sites on chromosome 11, between the divergent FAM55 D and FAM55B genes. A con- sensus for all cellular EBNA1 binding sites is distinct from those derived from the known viral binding sites, sug- gesting that some of these sites are indirectly bound by EBNA1.
[Show full text]
APBA2 Antibody A
C 0 2 - t APBA2 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 3 9 Web: [email protected] 5 www.cellsignal.com 8 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB, IP M R Endogenous 135 Rabbit Q99767 321 Product Usage Information Application Dilution Western Blotting 1:1000 Immunoprecipitation 1:50 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity APBA2 Antibody recognizes endogenous levels of total APBA2 protein. Species Reactivity: Mouse, Rat Species predicted to react based on 100% sequence homology: Human Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Phe300 of human APBA2 protein. Antibodies are purified by protein A and peptide affinity chromatography. Background Amyloid β A4 precursor protein-binding family A member 2 (APBA2) is a neuronal adaptor protein that interacts with the amyloid β precursor protein (APP) (1). The amyloid β-protein (Aβ) is the principal component of amyloid plaques, a pathological hallmark of Alzheimer’s disease (2). APBA2 has been shown to stabilize APP metabolism and suppress the secretion of Aβ (3). APBA2 mediates interaction between APP and the neural type I membrane protein Alcadein (Alc) by linking their cytoplasmic domains, thereby forming a tripartite complex of the three proteins in neurons (4).
[Show full text]
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
[Show full text]
Expression Analysis of Circular Rnas in Young and Sexually Mature Boar Testes
animals Article Expression Analysis of Circular RNAs in Young and Sexually Mature Boar Testes Fei Zhang 1,2,† , Xiaodong Zhang 1,†, Wei Ning 1, Xiangdong Zhang 1, Zhenyuan Ru 1, Shiqi Wang 1, Mei Sheng 1, Junrui Zhang 1, Xueying Zhang 1, Haiqin Luo 1, Xin Wang 1, Zubing Cao 1,* and Yunhai Zhang 1,* 1 Anhui Province Key Laboratory of Local Livestock and Poultry, Genetical Resource Conservation and Breeding, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China; [email protected] (F.Z.); [email protected] (X.Z.); [email protected] (W.N.); [email protected] (X.Z.); [email protected] (Z.R.); [email protected] (S.W.); [email protected] (M.S.); [email protected] (J.Z.); [email protected] (X.Z.); [email protected] (H.L.); [email protected] (X.W.) 2 School of Life Sciences, Anhui Agricultural University, Hefei 230036, China * Correspondence: [email protected] (Z.C.); [email protected] (Y.Z.); Tel.: +86-551-6578-6357 (Y.Z.) † These authors contributed equally to this study. Simple Summary: Circular RNAs are novel long non-coding RNA involved in the regulation of gene expression. Recently, the expression of circRNAs was characterized in testes of humans and bulls. However, the profiling of circRNAs and their potential biological functions in boar testicular development are yet to be known. In this study we characterized expression and biological roles of circRNAs in piglet (30 d) and adult (210 d) boar testes by high-throughput sequencing. We identified a large number of circRNAs during testicular development, of which 2326 circRNAs exhibited a significantly differential expression.
[Show full text]
Integrative Bulk and Single-Cell Profiling of Premanufacture T-Cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-Cell Therapy
Published OnlineFirst April 5, 2021; DOI: 10.1158/2159-8290.CD-20-1677 RESEARCH ARTICLE Integrative Bulk and Single-Cell Profiling of Premanufacture T-cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-cell Therapy Gregory M. Chen1, Changya Chen2,3, Rajat K. Das2, Peng Gao2, Chia-Hui Chen2, Shovik Bandyopadhyay4, Yang-Yang Ding2,5, Yasin Uzun2,3, Wenbao Yu2, Qin Zhu1, Regina M. Myers2, Stephan A. Grupp2,5, David M. Barrett2,5, and Kai Tan2,3,5 Downloaded from cancerdiscovery.aacrjournals.org on October 1, 2021. © 2021 American Association for Cancer Research. Published OnlineFirst April 5, 2021; DOI: 10.1158/2159-8290.CD-20-1677 ABSTRACT The adoptive transfer of chimeric antigen receptor (CAR) T cells represents a breakthrough in clinical oncology, yet both between- and within-patient differences in autologously derived T cells are a major contributor to therapy failure. To interrogate the molecular determinants of clinical CAR T-cell persistence, we extensively characterized the premanufacture T cells of 71 patients with B-cell malignancies on trial to receive anti-CD19 CAR T-cell therapy. We performed RNA-sequencing analysis on sorted T-cell subsets from all 71 patients, followed by paired Cellular Indexing of Transcriptomes and Epitopes (CITE) sequencing and single-cell assay for transposase-accessible chromatin sequencing (scATAC-seq) on T cells from six of these patients. We found that chronic IFN signaling regulated by IRF7 was associated with poor CAR T-cell persistence across T-cell subsets, and that the TCF7 regulon not only associates with the favorable naïve T-cell state, but is maintained in effector T cells among patients with long-term CAR T-cell persistence.
[Show full text]
Gene Ontology Functional Annotations and Pleiotropy
Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
[Show full text]
Gene Networks Activated by Specific Patterns of Action Potentials in Dorsal Root Ganglia Neurons Received: 10 August 2016 Philip R
www.nature.com/scientificreports OPEN Gene networks activated by specific patterns of action potentials in dorsal root ganglia neurons Received: 10 August 2016 Philip R. Lee1,*, Jonathan E. Cohen1,*, Dumitru A. Iacobas2,3, Sanda Iacobas2 & Accepted: 23 January 2017 R. Douglas Fields1 Published: 03 March 2017 Gene regulatory networks underlie the long-term changes in cell specification, growth of synaptic connections, and adaptation that occur throughout neonatal and postnatal life. Here we show that the transcriptional response in neurons is exquisitely sensitive to the temporal nature of action potential firing patterns. Neurons were electrically stimulated with the same number of action potentials, but with different inter-burst intervals. We found that these subtle alterations in the timing of action potential firing differentially regulates hundreds of genes, across many functional categories, through the activation or repression of distinct transcriptional networks. Our results demonstrate that the transcriptional response in neurons to environmental stimuli, coded in the pattern of action potential firing, can be very sensitive to the temporal nature of action potential delivery rather than the intensity of stimulation or the total number of action potentials delivered. These data identify temporal kinetics of action potential firing as critical components regulating intracellular signalling pathways and gene expression in neurons to extracellular cues during early development and throughout life. Adaptation in the nervous system in response to external stimuli requires synthesis of new gene products in order to elicit long lasting changes in processes such as development, response to injury, learning, and memory1. Information in the environment is coded in the pattern of action-potential firing, therefore gene transcription must be regulated by the pattern of neuronal firing.
[Show full text]
Strong Synaptic Transmission Impact by Copy Number Variations in Schizophrenia
Strong synaptic transmission impact by copy number variations in schizophrenia Joseph T. Glessnera, Muredach P. Reillyb, Cecilia E. Kima, Nagahide Takahashic, Anthony Albanoa, Cuiping Houa, Jonathan P. Bradﬁelda, Haitao Zhanga, Patrick M. A. Sleimana, James H. Florya, Marcin Imielinskia, Edward C. Frackeltona, Rosetta Chiavaccia, Kelly A. Thomasa, Maria Garrisa, Frederick G. Otienoa, Michael Davidsond, Mark Weiserd, Abraham Reichenberge, Kenneth L. Davisc,JosephI.Friedmanc, Thomas P. Cappolab, Kenneth B. Marguliesb, Daniel J. Raderb, Struan F. A. Granta,f,g, Joseph D. Buxbaumc, Raquel E. Gurh, and Hakon Hakonarsona,f,g,1 aCenter for Applied Genomics, The Children’s Hospital of Philadelphia, Philadelphia, PA 19104; bPenn Cardiovascular Institute, University of Pennsylvania School of Medicine, Philadelphia, PA 19104; cConte Center for the Neuroscience of Mental Disorders and Department of Psychiatry, Mount Sinai School of Medicine, New York, NY, 10029; dSheba Medical Center, Tel Hashomer, 52621, Israel; eMount Sinai and Institute of Psychiatry, King’s College, London, SE5 8AF, United Kingdom; fDivision of Human Genetics, The Children’s Hospital of Philadelphia, Philadelphia, PA 19104; gDepartment of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, PA 19104; and hSchizophrenia Center, Neuropsychiatry Division, Department of Psychiatry, University of Pennsylvania, Philadelphia, PA 19104 Edited by James R. Lupski, Baylor College of Medicine, Houston, TX, and accepted by the Editorial Board April 13, 2010 (received for review January 7, 2010) Schizophrenia is a psychiatric disorder with onset in late adoles- contribute to the complex etiology underlying various psychiatric cence and unclear etiology characterized by both positive and ne- and neurodevelopmental disorders (13, 14). Whereas rare recurrent gative symptoms, as well as cognitive deﬁcits.
[Show full text]
An Application for CEN Module Extraction And
www.nature.com/scientificreports OPEN THD-Module Extractor: An Application for CEN Module Extraction and Interesting Gene Received: 30 June 2016 Accepted: 03 November 2016 Identification for Alzheimer’s Published: 30 November 2016 Disease Tulika Kakati1, Hirak Kashyap2 & Dhruba K. Bhattacharyya1 There exist many tools and methods for construction of co-expression network from gene expression data and for extraction of densely connected gene modules. In this paper, a method is introduced to construct co-expression network and to extract co-expressed modules having high biological significance. The proposed method has been validated on several well known microarray datasets extracted from a diverse set of species, using statistical measures, such as p and q values. The modules obtained in these studies are found to be biologically significant based on Gene Ontology enrichment analysis, pathway analysis, and KEGG enrichment analysis. Further, the method was applied on an Alzheimer’s disease dataset and some interesting genes are found, which have high semantic similarity among them, but are not significantly correlated in terms of expression similarity. Some of these interesting genes, such as MAPT, CASP2, and PSEN2, are linked with important aspects of Alzheimer’s disease, such as dementia, increase cell death, and deposition of amyloid-beta proteins in Alzheimer’s disease brains. The biological pathways associated with Alzheimer’s disease, such as, Wnt signaling, Apoptosis, p53 signaling, and Notch signaling, incorporate these interesting genes. The proposed method is evaluated in regard to existing literature. The volume of data obtained by microarray or other new high throughput technologies have been increasing enormously, and as a result, the biological databases are growing enormously.
[Show full text]
Human Chromosome 15Q11-Q14 Regions of Rearrangements Contain Clusters of LCR15 Duplicons
European Journal of Human Genetics (2002) 10, 26 ± 35 ã 2002 Nature Publishing Group All rights reserved 1018-4813/02 $25.00 www.nature.com/ejhg ARTICLE Human chromosome 15q11-q14 regions of rearrangements contain clusters of LCR15 duplicons Miguel Angel Pujana1, Marga Nadal1, Miriam Guitart2, LluõÂs Armengol1,MoÁnica GratacoÁs1 and Xavier Estivill*,1 1Centre de GeneÁtica MeÁdicaiMolecular-IRO,HospitalDuraniReynals,GranVõÂa km 2.7, 08907 L'Hospitalet de Llobregat, Barcelona, Spain; 2CorporacioÂ Parc TaulõÂ, Laboratori de GeneÁtica, Sabadell, Spain Six breakpoint regions for rearrangements of human chromosome 15q11-q14 have been described. These rearrangements involve deletions found in approximately 70% of Prader-Willi or Angelman's syndrome patients (PWS, AS), duplications detected in some cases of autism, triplications and inverted duplications. HERC2-containing (HEct domain and RCc1 domain protein 2) segmental duplications or duplicons are present at two of these breakpoints (BP2 and BP3) mainly associated with deletions. We show here that clusters containing several copies of the human chromosome 15 low-copy repeat (LCR15) duplicon are located at each of the six described 15q11-q14 BPs. In addition, our results suggest the existence of breakpoints for large 15q11-q13 deletions in a proximal duplicon-containing clone. The study reveals that HERC2-containing duplicons (estimated on 50 ± 400 kb) and LCR15 duplicons (*15 kb on 15q11-q14) share the golgin-like protein (GLP) genomic sequence. Through the analysis of a human BAC library and public databases we have identified 36 LCR15 related sequences in the human genome, most (27) mapping to chromosome 15q and being transcribed. LCR15 analysis in non-human primates and age-sequence divergences support a recent origin of this family of segmental duplications through human speciation.
[Show full text]
Apba2 (NM 007461) Mouse Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG210457 Apba2 (NM_007461) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Apba2 (NM_007461) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Apba2 Synonyms: mXllL; X11-like; X11L; XllL Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Apba2 (NM_007461) Mouse Tagged ORF Clone – MG210457 ORF Nucleotide >MG210457 representing NM_007461 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCACCGCAAGCGTCAGAGCACTGCAAGCAGCATGCTGGACCACAGGGCCAGGCCAGGTCCTATCC CCCATGACCAGGAGCCTGAGAGTGAGGACACAGAACTGCCTCTGGAGAGCTATGTACCCACAGGCCTGGA GCTGGGCACTCTGAGGCCAGAGAGCCCCACGCCCGAGGAACAGGAGTGCCACAACCATAGTCCTGATGGG GACTCCAGCTCTGACTATGTGAACAACACATCTGAGGAGGAGGACTATGACGAGGGCCTCCCTGAGGAGG AGGAGGGTGTCACCTACTACATCCGCTACTGTCCTGAGGATGACAGCTACCTGGAGGGCATGGACTGTAA TGGGGAGGAATACATAGCACACGGTGCACATCCCGTGGACACCGATGAGTGTCAGGAGGCGGTGGAGGAC TGGACGGACTCAGTGGGCCCTCATACTCATAGCCACGGGGCTGAAAACAGCCAGGAGTACCCAGATGGCC ACCTGCCTATCCCAGAGGATGACCCTACTGTCCTGGAGGTCCATGACCAGGAAGAAGATGGCCACTACTG TTCCAGCAAGGAGAGCTACCAGGACTATTACCCCCCAGAGACCAATGGGAACACAGGTGGCGCCTCCCCC
[Show full text]
Localizing Recent Adaptive Evolution in the Human Genome
Localizing Recent Adaptive Evolution in the Human Genome Scott H. Williamson1*, Melissa J. Hubisz1¤a, Andrew G. Clark2, Bret A. Payseur2¤b, Carlos D. Bustamante1, Rasmus Nielsen3 1 Department of Biological Statistics and Computational Biology, Cornell University, Ithaca, New York, United States of America, 2 Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York, United States of America, 3 Center for Bioinformatics and Department of Biology, University of Copenhagen, Copenhagen, Denmark Identifying genomic locations that have experienced selective sweeps is an important first step toward understanding the molecular basis of adaptive evolution. Using statistical methods that account for the confounding effects of population demography, recombination rate variation, and single-nucleotide polymorphism ascertainment, while also providing fine-scale estimates of the position of the selected site, we analyzed a genomic dataset of 1.2 million human single-nucleotide polymorphisms genotyped in African-American, European-American, and Chinese samples. We identify 101 regions of the human genome with very strong evidence (p , 10À5) of a recent selective sweep and where our estimate of the position of the selective sweep falls within 100 kb of a known gene. Within these regions, genes of biological interest include genes in pigmentation pathways, components of the dystrophin protein complex, clusters of olfactory receptors, genes involved in nervous system development and function, immune system genes, and heat shock genes. We also observe consistent evidence of selective sweeps in centromeric regions. In general, we find that recent adaptation is strikingly pervasive in the human genome, with as much as 10% of the genome affected by linkage to a selective sweep.
[Show full text]