DOCSLIB.ORG

CYP4A22 (NM 001010969) Human Untagged Clone – SC301547 | Origene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
CYP4A22 (NM 001010969) Human Untagged Clone – SC301547 | Origene OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC301547 CYP4A22 (NM_001010969) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CYP4A22 (NM_001010969) Human Untagged Clone Tag: Tag Free Symbol: CYP4A22 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001010969, the custom clone sequence may differ by one or more nucleotides ATGAGTGTCTCTGTCCTGAGCCCCAGCAGACGCCTGGGTGGTGTCTCCGGGATCCTCCAAGTGACCTCCC TGCTCATTCTGCTTCTGCTGCTGATCAAGGCAGCTCAGCTCTACCTGCATAGGCAGTGGCTGCTCAAAGC CCTCCAGCAGTTCCCGTGCCCTCCCTCCCACTGGCTCTTCGGGCACATCCAGGAGTTCCAACACGACCAG GAGCTACAACGGATTCAGGAACGGGTGAAGACATTCCCAAGTGCCTGTCCTTATTGGATATGGGGAGGCA AAGTTCGTGTCCAGCTCTATGACCCTGACTATATGAAGGTGATTCTGGGGAGATCAGACCCGAAATCCCA TGGATCCTACAAATTCCTGGCTCCACGGATTGGGTACGGCTTGCTCCTGTTGAATGGGCAGACATGGTTC CAGCATCGACGGATGCTGACCCCAGCCTTCCACAATGACATCCTGAAGCCATACGTGGGGCTCATGGCAG ACTCTGTACGAGTGATGCTGGACAAATGGGAAGAGCTCCTTGGCCAGGATTCCCCTCTGGAGGTCTTTCA GCACGTCTCCTTGATGACCCTGGACACCATCATGAAGAGTGCCTTCAGCCATCAGGGCAGCATCCAGGTG GACAGGAATTCTCAGTCCTACATCCAGGCCATTAGTGACCTGAACAGCCTGGTTTTTTGCTGTATGAGGA ATGCCTTTCATGAGAATGACACCATCTACAGCCTGACCTCTGCTGGCCGCTGGACACACCGCGCCTGCCA GCTGGCCCATCAGCACACAGACCAAGTGATCCAACTGAGGAAGGCTCAACTACAGAAGGAGGGGGAGCTG GAGAAGATCAAGAGGAAGAGGCACTTGGATTTTCTGGACATCCTCCTCTTGGCCAAAATGGAGAATGGGA GCATCTTGTCAGACAAGGACCTCCGTGCTGAGGTGGACACGTTCATGTTTGAGGGCCACGACACCACAGC CAGTGGGATCTCCTGGATCCTCTATGCTCTGGCCACACACCCCAAGCATCAGGAGAGGTGCCGGGAGGAG ATCCATGGCCTCCTGGGTGATGGAGCCTCCATCACCTGGAACCACCTGGACCAGATGCCCTACACCACCA TGTGCATTAAGGAGGCACTGAGGCTCTACCCACCGGTGCCAGGCATTGGAAGAGAGCTCAGCACTCCCGT CACCTTCCCTGATGGGCGCTCCTTGCCCAAAGGTATCATGGTCCTCCTCTCCATTTATGGCCTTCACCAC AACCCAAAAGTGTGGCCCAACCTAGAGGTGTTTGACCCTTCCCGTTTTGCACCGGGTTCTGCTCAACACA GCCACGCTTTCCTGCCCTTCTCAGGAGGATCAAGGAACTGCATCGGGAAACAATTTGCCATGAACCAGCT GAAGGTGGCCAGGGCCCTGACCCTGCTCCGCTTTGAGCTGCTGCCTGATCCCACCAGGATCCCCATCCCC ATGGCACGACTTGTGTTGAAATCCAAAAATGGAATCCACCTGCGTCTCAGGAGGCTCCCTAACCCTTGTG AAGACAAGGACCAGCTTTGA Restriction Sites: SgfI-MluI This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 CYP4A22 (NM_001010969) Human Untagged Clone – SC301547 ACCN: NM_001010969 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_001010969.3, NP_001010969.2 RefSeq Size: 1678 bp RefSeq ORF: 1560 bp Locus ID: 284541 UniProt ID: Q5TCH4 Protein Families: P450, Transmembrane Protein Pathways: Arachidonic acid metabolism, Fatty acid metabolism, Metabolic pathways, PPAR signaling pathway, Retinol metabolism, Vascular smooth muscle contraction Gene Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 1p33. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Load more

Recommended publications
  • Transcriptomic Characterization of Fibrolamellar Hepatocellular
    Transcriptomic characterization of fibrolamellar PNAS PLUS hepatocellular carcinoma Elana P. Simona, Catherine A. Freijeb, Benjamin A. Farbera,c, Gadi Lalazara, David G. Darcya,c, Joshua N. Honeymana,c, Rachel Chiaroni-Clarkea, Brian D. Dilld, Henrik Molinad, Umesh K. Bhanote, Michael P. La Quagliac, Brad R. Rosenbergb,f, and Sanford M. Simona,1 aLaboratory of Cellular Biophysics, The Rockefeller University, New York, NY 10065; bPresidential Fellows Laboratory, The Rockefeller University, New York, NY 10065; cDivision of Pediatric Surgery, Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; dProteomics Resource Center, The Rockefeller University, New York, NY 10065; ePathology Core Facility, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; and fJohn C. Whitehead Presidential Fellows Program, The Rockefeller University, New York, NY 10065 Edited by Susan S. Taylor, University of California, San Diego, La Jolla, CA, and approved September 22, 2015 (received for review December 29, 2014) Fibrolamellar hepatocellular carcinoma (FLHCC) tumors all carry a exon of DNAJB1 and all but the first exon of PRKACA. This deletion of ∼400 kb in chromosome 19, resulting in a fusion of the produced a chimeric RNA transcript and a translated chimeric genes for the heat shock protein, DNAJ (Hsp40) homolog, subfam- protein that retains the full catalytic activity of wild-type PKA. ily B, member 1, DNAJB1, and the catalytic subunit of protein ki- This chimeric protein was found in 15 of 15 FLHCC patients nase A, PRKACA. The resulting chimeric transcript produces a (21) in the absence of any other recurrent mutations in the DNA fusion protein that retains kinase activity.
    [Show full text]
  • Synonymous Single Nucleotide Polymorphisms in Human Cytochrome
    DMD Fast Forward. Published on February 9, 2009 as doi:10.1124/dmd.108.026047 DMD #26047 TITLE PAGE: A BIOINFORMATICS APPROACH FOR THE PHENOTYPE PREDICTION OF NON- SYNONYMOUS SINGLE NUCLEOTIDE POLYMORPHISMS IN HUMAN CYTOCHROME P450S LIN-LIN WANG, YONG LI, SHU-FENG ZHOU Department of Nutrition and Food Hygiene, School of Public Health, Peking University, Beijing 100191, P. R. China (LL Wang & Y Li) Discipline of Chinese Medicine, School of Health Sciences, RMIT University, Bundoora, Victoria 3083, Australia (LL Wang & SF Zhou). 1 Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics. DMD #26047 RUNNING TITLE PAGE: a) Running title: Prediction of phenotype of human CYPs. b) Author for correspondence: A/Prof. Shu-Feng Zhou, MD, PhD Discipline of Chinese Medicine, School of Health Sciences, RMIT University, WHO Collaborating Center for Traditional Medicine, Bundoora, Victoria 3083, Australia. Tel: + 61 3 9925 7794; fax: +61 3 9925 7178. Email: [email protected] c) Number of text pages: 21 Number of tables: 10 Number of figures: 2 Number of references: 40 Number of words in Abstract: 249 Number of words in Introduction: 749 Number of words in Discussion: 1459 d) Non-standard abbreviations: CYP, cytochrome P450; nsSNP, non-synonymous single nucleotide polymorphism. 2 DMD #26047 ABSTRACT Non-synonymous single nucleotide polymorphisms (nsSNPs) in coding regions that can lead to amino acid changes may cause alteration of protein function and account for susceptivity to disease. Identification of deleterious nsSNPs from tolerant nsSNPs is important for characterizing the genetic basis of human disease, assessing individual susceptibility to disease, understanding the pathogenesis of disease, identifying molecular targets for drug treatment and conducting individualized pharmacotherapy.
    [Show full text]
  • Supplementary Material
    Supplementary Material Table S1: Significant downregulated KEGGs pathways identified by DAVID following exposure to five cinnamon- based phenylpropanoids (p < 0.05). p-value Term: Genes (Benjamini) Cytokine-cytokine receptor interaction: FASLG, TNFSF14, CXCL11, IL11, FLT3LG, CCL3L1, CCL3L3, CXCR6, XCR1, 2.43 × 105 RTEL1, CSF2RA, TNFRSF17, TNFRSF14, CCNL2, VEGFB, AMH, TNFRSF10B, INHBE, IFNB1, CCR3, VEGFA, CCR2, IL12A, CCL1, CCL3, CXCL5, TNFRSF25, CCR1, CSF1, CX3CL1, CCL7, CCL24, TNFRSF1B, IL12RB1, CCL21, FIGF, EPO, IL4, IL18R1, FLT1, TGFBR1, EDA2R, HGF, TNFSF8, KDR, LEP, GH2, CCL13, EPOR, XCL1, IFNA16, XCL2 Neuroactive ligand-receptor interaction: OPRM1, THRA, GRIK1, DRD2, GRIK2, TACR2, TACR1, GABRB1, LPAR4, 9.68 × 105 GRIK5, FPR1, PRSS1, GNRHR, FPR2, EDNRA, AGTR2, LTB4R, PRSS2, CNR1, S1PR4, CALCRL, TAAR5, GABRE, PTGER1, GABRG3, C5AR1, PTGER3, PTGER4, GABRA6, GABRA5, GRM1, PLG, LEP, CRHR1, GH2, GRM3, SSTR2, Chlorogenic acid Chlorogenic CHRM3, GRIA1, MC2R, P2RX2, TBXA2R, GHSR, HTR2C, TSHR, LHB, GLP1R, OPRD1 Hematopoietic cell lineage: IL4, CR1, CD8B, CSF1, FCER2, GYPA, ITGA2, IL11, GP9, FLT3LG, CD38, CD19, DNTT, 9.29 × 104 GP1BB, CD22, EPOR, CSF2RA, CD14, THPO, EPO, HLA-DRA, ITGA2B Cytokine-cytokine receptor interaction: IL6ST, IL21R, IL19, TNFSF15, CXCR3, IL15, CXCL11, TGFB1, IL11, FLT3LG, CXCL10, CCR10, XCR1, RTEL1, CSF2RA, IL21, CCNL2, VEGFB, CCR8, AMH, TNFRSF10C, IFNB1, PDGFRA, EDA, CXCL5, TNFRSF25, CSF1, IFNW1, CNTFR, CX3CL1, CCL5, TNFRSF4, CCL4, CCL27, CCL24, CCL25, CCL23, IFNA6, IFNA5, FIGF, EPO, AMHR2, IL2RA, FLT4, TGFBR2, EDA2R,
    [Show full text]
  • CYP4A22 Antibody Cat
    CYP4A22 Antibody Cat. No.: 29-654 CYP4A22 Antibody Antibody used in IHC on Human Kidney at 4.0-8.0 ug/ml. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human Antibody produced in rabbits immunized with a synthetic peptide corresponding a region IMMUNOGEN: of human CYP4A22. TESTED APPLICATIONS: ELISA, IHC, WB CYP4A22 antibody can be used for detection of CYP4A22 by ELISA at 1:312500. CYP4A22 APPLICATIONS: antibody can be used for detection of CYP4A22 by western blot at 0.25 μg/mL, and HRP conjugated secondary antibody should be diluted 1:50,000 - 100,000. POSITIVE CONTROL: 1) Cat. No. 1205 - Jurkat Cell Lysate PREDICTED MOLECULAR 57 kDa WEIGHT: October 2, 2021 1 https://www.prosci-inc.com/cyp4a22-antibody-29-654.html Properties PURIFICATION: Antibody is purified by peptide affinity chromatography method. CLONALITY: Polyclonal CONJUGATE: Unconjugated PHYSICAL STATE: Liquid Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% BUFFER: sucrose. CONCENTRATION: batch dependent For short periods of storage (days) store at 4˚C. For longer periods of storage, store STORAGE CONDITIONS: CYP4A22 antibody at -20˚C. As with any antibody avoid repeat freeze-thaw cycles. Additional Info OFFICIAL SYMBOL: CYP4A22 ALTERNATE NAMES: CYP4A22, RP1-18D14.1, ACCESSION NO.: NP_001010969 PROTEIN GI NO.: 62952506 GENE ID: 284541 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References CYP4A22 is a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids.This gene encodes a BACKGROUND: member of the cytochrome P450 superfamily of enzymes.
    [Show full text]
  • Metabolic Activation and Toxicological Evaluation of Polychlorinated Biphenyls in Drosophila Melanogaster T
    www.nature.com/scientificreports OPEN Metabolic activation and toxicological evaluation of polychlorinated biphenyls in Drosophila melanogaster T. Idda1,7, C. Bonas1,7, J. Hofmann1, J. Bertram1, N. Quinete1,2, T. Schettgen1, K. Fietkau3, A. Esser1, M. B. Stope4, M. M. Leijs3, J. M. Baron3, T. Kraus1, A. Voigt5,6 & P. Ziegler1* Degradation of polychlorinated biphenyls (PCBs) is initiated by cytochrome P450 (CYP) enzymes and includes PCB oxidation to OH-metabolites, which often display a higher toxicity than their parental compounds. In search of an animal model refecting PCB metabolism and toxicity, we tested Drosophila melanogaster, a well-known model system for genetics and human disease. Feeding Drosophila with lower chlorinated (LC) PCB congeners 28, 52 or 101 resulted in the detection of a human-like pattern of respective OH-metabolites in fy lysates. Feeding fies high PCB 28 concentrations caused lethality. Thus we silenced selected CYPs via RNA interference and analyzed the efect on PCB 28-derived metabolite formation by assaying 3-OH-2′,4,4′-trichlorobiphenyl (3-OHCB 28) and 3′-OH-4′,4,6′-trichlorobiphenyl (3′-OHCB 28) in fy lysates. We identifed several drosophila CYPs (dCYPs) whose knockdown reduced PCB 28-derived OH-metabolites and suppressed PCB 28 induced lethality including dCYP1A2. Following in vitro analysis using a liver-like CYP-cocktail, containing human orthologues of dCYP1A2, we confrm human CYP1A2 as a PCB 28 metabolizing enzyme. PCB 28-induced mortality in fies was accompanied by locomotor impairment, a common phenotype of neurodegenerative disorders. Along this line, we show PCB 28-initiated caspase activation in diferentiated fy neurons.
    [Show full text]
  • Rapid Birth–Death Evolution Specific to Xenobiotic Cytochrome P450 Genes in Vertebrates
    Rapid Birth–Death Evolution Specific to Xenobiotic Cytochrome P450 Genes in Vertebrates James H. Thomas* Department of Genome Sciences, University of Washington, Seattle, Washington, United States of America Genes vary greatly in their long-term phylogenetic stability and there exists no general explanation for these differences. The cytochrome P450 (CYP450) gene superfamily is well suited to investigating this problem because it is large and well studied, and it includes both stable and unstable genes. CYP450 genes encode oxidase enzymes that function in metabolism of endogenous small molecules and in detoxification of xenobiotic compounds. Both types of enzymes have been intensively studied. My analysis of ten nearly complete vertebrate genomes indicates that each genome contains 50–80 CYP450 genes, which are about evenly divided between phylogenetically stable and unstable genes. The stable genes are characterized by few or no gene duplications or losses in species ranging from bony fish to mammals, whereas unstable genes are characterized by frequent gene duplications and losses (birth–death evolution) even among closely related species. All of the CYP450 genes that encode enzymes with known endogenous substrates are phylogenetically stable. In contrast, most of the unstable genes encode enzymes that function as xenobiotic detoxifiers. Nearly all unstable CYP450 genes in the mouse and human genomes reside in a few dense gene clusters, forming unstable gene islands that arose by recurrent local gene duplication. Evidence for positive selection in amino acid sequence is restricted to these unstable CYP450 genes, and sites of selection are associated with substrate-binding regions in the protein structure. These results can be explained by a general model in which phylogenetically stable genes have core functions in development and physiology, whereas unstable genes have accessory functions associated with unstable environmental interactions such as toxin and pathogen exposure.
    [Show full text]
  • Widespread Signals of Convergent Adaptation to High Altitude in Asia and America
    bioRxiv preprint doi: https://doi.org/10.1101/002816; this version posted September 26, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Widespread signals of convergent adaptation to high altitude in Asia and America Matthieu Foll 1,2,3,*, Oscar E. Gaggiotti 4,5, Josephine T. Daub 1,2, Alexandra Vatsiou 5 and Laurent Excoffier 1,2 1 CMPG, Institute oF Ecology and Evolution, University oF Berne, Berne, 3012, Switzerland 2 Swiss Institute oF BioinFormatics, Lausanne, 1015, Switzerland 3 Present address: School oF LiFe Sciences, École Polytechnique Fédérale de Lausanne (EPFL), Lausanne, 1015, Switzerland 4 School oF Biology, Scottish Oceans Institute, University oF St Andrews, St Andrews, FiFe, KY16 8LB, UK 5 Laboratoire d'Ecologie Alpine (LECA), UMR 5553 CNRS-Université de Grenoble, Grenoble, France * Corresponding author: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/002816; this version posted September 26, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Living at high-altitude is one oF the most diFFicult challenges that humans had to cope with during their evolution. Whereas several genomic studies have revealed some oF the genetic bases oF adaptations in Tibetan, Andean and Ethiopian populations, relatively little evidence oF convergent evolution to altitude in diFFerent continents has accumulated.
    [Show full text]
  • Conformational Changes in Binding of Substrates with Human Cytochrome P450 Enzymes
    Book of oral abstracts 100 Conformational changes in binding of substrates with human cytochrome P450 enzymes F. Peter Guengerich, Clayton J. Wilkey, Michael J. Reddish, Sarah M. Glass, and Thanh T. N. Phan Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, TN, USA Introduction. Extensive evidence now exists that P450 enzymes can exist in multiple conformations, at least in the substrate-bound forms (e.g., crystallography). This multiplicity can be the result of either an induced fit mechanism or conformational selection (selective substrate binding to one of two or more equilibrating P450 conformations). Aims. Kinetic approaches can be used to distinguish between induced fit and conformational selection models. The same energy is involved in reaching the final state, regardless of the kinetic path. Methods. Stopped-flow absorbance and fluorescence measurements were made with recombinant human P450 enzymes. Analysis utilized kinetic modeling software (KinTek Explorer®). Results. P450 17A1 binding to its steroid ligands (pregnenolone and progesterone and the 17-hydroxy derivatives) is dominated by a conformational selection process, as judged by (a) decreasing rates of substrate binding as a function of substrate concentration, (b) opposite patterns of the dependence of binding rates as a function of varying concentrations of (i) substrate and (ii) enzyme, and (c) modeling of the data in KinTek Explorer. The inhibitory drugs orteronel and abiraterone bind P450 17A1 in multi-step processes, apparently in different ways. The dye Nile Red is also a substrate for P450 17A1 and its sequential binding to the enzyme can be resolved in fluorescence and absorbance changes. P450s 2C8, 2D6, 2E1, and 4A11 have also been analyzed with regard to substrate binding and utilize primarily conformational selection models, as revealed by analysis of binding rates vs.
    [Show full text]
  • Expression of CYP2S1 in Human Hepatic Stellate Cells
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 581 (2007) 781–786 Expression of CYP2S1 in human hepatic stellate cells Carylyn J. Mareka, Steven J. Tuckera, Matthew Korutha, Karen Wallacea,b, Matthew C. Wrighta,b,* a School of Medical Sciences, Institute of Medical Science, University of Aberdeen, Aberdeen, UK b Liver Faculty Research Group, School of Clinical and Laboratory Sciences, University of Newcastle, Newcastle, UK Received 22 November 2006; revised 16 January 2007; accepted 23 January 2007 Available online 2 February 2007 Edited by Laszlo Nagy the expression and accumulation of scarring extracellular Abstract Activated stellate cells are myofibroblast-like cells associated with the generation of fibrotic scaring in chronically fibrotic matrix protein [2]. It is currently thought an inhibition damaged liver. Gene chip analysis was performed on cultured fi- of fibrosis in liver diseases may be an effective approach to brotic stellate cells. Of the 51 human CYP genes known, 13 treating patients for which the cause is refractive to current CYP and 5 CYP reduction-related genes were detected with 4 treatments (e.g. in approx. 30% of hepatitis C infected CYPs (CYP1A1, CYP2E1, CY2S1 and CYP4F3) consistently patients) [2,3]. At present, there is no approved treatment for present in stellate cells isolated from three individuals. Quantita- fibrosis. tive RT-PCR indicated that CYP2S1 was a major expressed Inadvertent toxicity of drugs is often associated with a ‘‘met- CYP mRNA transcript. The presence of a CYP2A-related pro- abolic activation’’ by CYPs [1].
    [Show full text]
  • Consequences of Exchanging Carbohydrates for Proteins in the Cholesterol Metabolism of Mice Fed a High-Fat Diet
    Consequences of Exchanging Carbohydrates for Proteins in the Cholesterol Metabolism of Mice Fed a High-fat Diet Fre´de´ ric Raymond1.¤a, Long Wang2., Mireille Moser1, Sylviane Metairon1¤a, Robert Mansourian1, Marie- Camille Zwahlen1, Martin Kussmann3,4,5, Andreas Fuerholz1, Katherine Mace´ 6, Chieh Jason Chou6*¤b 1 Bioanalytical Science Department, Nestle´ Research Center, Lausanne, Switzerland, 2 Department of Nutrition Science and Dietetics, Syracuse University, Syracuse, New York, United States of America, 3 Proteomics and Metabonomics Core, Nestle´ Institute of Health Sciences, Lausanne, Switzerland, 4 Faculty of Science, Aarhus University, Aarhus, Denmark, 5 Faculty of Life Sciences, Federal Institute of Technology, Lausanne, Switzerland, 6 Nutrition and Health Department, Nestle´ Research Center, Lausanne, Switzerland Abstract Consumption of low-carbohydrate, high-protein, high-fat diets lead to rapid weight loss but the cardioprotective effects of these diets have been questioned. We examined the impact of high-protein and high-fat diets on cholesterol metabolism by comparing the plasma cholesterol and the expression of cholesterol biosynthesis genes in the liver of mice fed a high-fat (HF) diet that has a high (H) or a low (L) protein-to-carbohydrate (P/C) ratio. H-P/C-HF feeding, compared with L-P/C-HF feeding, decreased plasma total cholesterol and increased HDL cholesterol concentrations at 4-wk. Interestingly, the expression of genes involved in hepatic steroid biosynthesis responded to an increased dietary P/C ratio by first down- regulation (2-d) followed by later up-regulation at 4-wk, and the temporal gene expression patterns were connected to the putative activity of SREBF1 and 2.
    [Show full text]
  • A Graph-Theoretic Approach to Model Genomic Data and Identify Biological Modules Asscociated with Cancer Outcomes
    A Graph-Theoretic Approach to Model Genomic Data and Identify Biological Modules Asscociated with Cancer Outcomes Deanna Petrochilos A dissertation presented in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2013 Reading Committee: Neil Abernethy, Chair John Gennari, Ali Shojaie Program Authorized to Offer Degree: Biomedical Informatics and Health Education UMI Number: 3588836 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. UMI 3588836 Published by ProQuest LLC (2013). Copyright in the Dissertation held by the Author. Microform Edition © ProQuest LLC. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code ProQuest LLC. 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, MI 48106 - 1346 ©Copyright 2013 Deanna Petrochilos University of Washington Abstract Using Graph-Based Methods to Integrate and Analyze Cancer Genomic Data Deanna Petrochilos Chair of the Supervisory Committee: Assistant Professor Neil Abernethy Biomedical Informatics and Health Education Studies of the genetic basis of complex disease present statistical and methodological challenges in the discovery of reliable and high-confidence genes that reveal biological phenomena underlying the etiology of disease or gene signatures prognostic of disease outcomes. This dissertation examines the capacity of graph-theoretical methods to model and analyze genomic information and thus facilitate using prior knowledge to create a more discrete and functionally relevant feature space.
    [Show full text]
  • Rapid Birth–Death Evolution Specific to Xenobiotic Cytochrome P450 Genes in Vertebrates
    Rapid Birth–Death Evolution Specific to Xenobiotic Cytochrome P450 Genes in Vertebrates James H. Thomas* Department of Genome Sciences, University of Washington, Seattle, Washington, United States of America Genes vary greatly in their long-term phylogenetic stability and there exists no general explanation for these differences. The cytochrome P450 (CYP450) gene superfamily is well suited to investigating this problem because it is large and well studied, and it includes both stable and unstable genes. CYP450 genes encode oxidase enzymes that function in metabolism of endogenous small molecules and in detoxification of xenobiotic compounds. Both types of enzymes have been intensively studied. My analysis of ten nearly complete vertebrate genomes indicates that each genome contains 50–80 CYP450 genes, which are about evenly divided between phylogenetically stable and unstable genes. The stable genes are characterized by few or no gene duplications or losses in species ranging from bony fish to mammals, whereas unstable genes are characterized by frequent gene duplications and losses (birth–death evolution) even among closely related species. All of the CYP450 genes that encode enzymes with known endogenous substrates are phylogenetically stable. In contrast, most of the unstable genes encode enzymes that function as xenobiotic detoxifiers. Nearly all unstable CYP450 genes in the mouse and human genomes reside in a few dense gene clusters, forming unstable gene islands that arose by recurrent local gene duplication. Evidence for positive selection in amino acid sequence is restricted to these unstable CYP450 genes, and sites of selection are associated with substrate-binding regions in the protein structure. These results can be explained by a general model in which phylogenetically stable genes have core functions in development and physiology, whereas unstable genes have accessory functions associated with unstable environmental interactions such as toxin and pathogen exposure.
    [Show full text]