Comparison of Bacterial Diversity from Solar Salterns and a Simulated Laboratory Study

Ann Microbiol (2015) 65:995–1005 DOI 10.1007/s13213-014-0944-6

ORIGINAL ARTICLE

Comparison of bacterial diversity from solar salterns and a simulated laboratory study

Kabilan Mani & Sivaraman Chandrasekaran & Bhakti B. Salgaonkar & Srikanth Mutnuri & Judith M. Bragança

Received: 8 January 2014 /Accepted: 14 July 2014 /Published online: 2 August 2014 # Springer-Verlag Berlin Heidelberg and the University of Milan 2014

Abstract Bacterial diversity in solar salterns and a simulated Introduction solar saltern under laboratory conditions was studied. The two systems were compared at the pre-salt harvesting phase and Hypersaline environments like salt lakes and solar salterns are salt harvesting phase using Denaturing Gradient Gel Electro- extreme ecosystems in which the change in salinity is the phoresis (DGGE). Bacterial composition was dominated by dictating factor which determines microbial diversity at any Gammaproteobacteria and more specifically with members of given point of time (Rodríguez-Valera et al. 1985). Prokary- Alteromonas, Vibrio, Pseudomonas, Tolumonas, otic diversity in any ecosystem is an important factor to be Marinobacter, Pseudoalteromonas and novel uncultured bac- considered because of its role in nutrient turnover, element teria. The Shannon–Weaver index (H), Simpson diversity recycling and as a potential hub for recovery of microorgan- index (D) and Equitability index (E) values showed that isms for industrially important metabolic products (Garcia- salterns can support a wide range of microbes during the Martinez et al. 1999; Lorenz and Eck 2005). Solar salterns pre-salt harvesting phase (3–4 % salinity) when compared to serve as a good model for studying the changes in biodiversity the salt harvesting phase (21–29 % salinity). Range-weighted over salinity, thereby providing us with information on ex- richness (Rr) values indicated that solar salterns are habitable tremes of life. Since diversity studies on hypersaline environ- only by a limited group of microbes as they have medium ments are gaining momentum in the past decade, the chances richness, indicated by physico-chemical characteristics. Prin- of obtaining novel isolates are relatively high when compared cipal Coordinate Analysis (PCO) of the simulated study with any other ecosystem. Novelty of isolates is not limited to showed a variation in diversity at a large scale with increase bacteria and archaea but includes eukaryotes like fungi, pro- in salinity. Solar salterns as well as the simulated tank showed tists and algae (Casamayor et al. 2013). more diversity during the pre-salt harvesting phase. Many reports have focussed on the occurrence of halophilic archaea in hypersaline regions (Munson et al. 1997; Ochsenreiter et al. 2002; Ahmad et al. 2008; Braganca and Keywords Solar salterns . Halophiles . Bacterial diversity . Furtado 2009;Ohetal.2010;Zafrillaetal.2010). However, DGGE . 16S rRNA information on what happens to the bacterial community in increasing salinity gradients from 2 to 30 % are limited (Henriques et al. 2006; Demergasso et al. 2008;Deshmukh K. Mani : S. Chandrasekaran : B. B. Salgaonkar : S. Mutnuri : et al. 2011; Boujelben et al. 2012). It is generally accepted that J. M. Bragança (*) diversity decreases with increase in salinity, as the case with Applied and Environmental Biotechnology Laboratory, Department any extreme ecosystem. Previous studies employing genetic of Biological Sciences, Birla Institute of Technology and Science fingerprinting techniques like clone library construction, Pilani K K Birla, Goa Campus, NH-17B Zuarinagar, Goa 403726, India DGGE, T-RFLP and RISA analysis has shown the general e-mail: [email protected] trend of decrease in diversity with increase in salinity. Fur- thermore, these studies have shown that a diverse group of Present Address: bacteria dominates salterns in low (4 %), moderate (15 %) and S. Chandrasekaran Water Pollution Group, Center of Excellence in Environmental high (32 %) salinity ponds (Casamayor et al. 2002). But trends Studies, King Abdulaziz University, Jeddah, Saudi Arabia in archaea are different with few detected in low salinity 996 Ann Microbiol (2015) 65:995–1005 ponds, and there is a gradual increase in diversity with in- Materials and methods crease in salinity. Eukaryotes, similar to bacteria, dominate low and moderate salinity ponds but gradually decrease in Sampling site, experimental set-up and physico-chemical high salinity ponds. Usually, there is a drastic variation in analysis diversity along a salinity gradient from low (4 %) to moderate salinity (15 %) and a stable community is obtained at high Sampling was carried out in Ribandar (15°25’N, 73°92’E) salinity (32 %), which is sustained until saturation (Estrada and Siridao (15°44’N, 73°86’E) salterns of Goa, India et al. 2004). Studies employing both culture-dependent and - (Fig. 1). These salterns experience two phases: namely, pre- independent techniques have shown that euryarchaeal mem- salt harvesting phase and salt harvesting phase. The first bers belonging to DHVEG-6, and Halobacteriaceae like sampling was done in January 2010, during the pre-salt har- Halorubrum sp. and Haloquadratum walsbyi are found to vesting phase and the second sampling was done in April be dominant in moderate and high salinity ponds. Low salinity 2010 during the peak salt harvesting phase. Water/brine sam- ponds are dominated by diverse bacterial groups such as ples were collected at a depth of 10 cm using sterile bottles Proteobacteria, CFB (Cytophaga–Flavobacterium– which were previously rinsed with the same sample. The Bacteroides), Actinobacteria, Firmicutes and Cyanobacteria. samples were stored at 4 °C and processed within 48 h. For With an increase in salinity, bacterial groups belonging to laboratory simulation study, 25 l of saltern inlet water from Gammaproteobacteria and CFB group members like Ribandar saltern was collected in a sterile container and trans- Halomonas and Salinibacter phylotypes become dominant. ferred to a glass tank of dimensions 0.33 × 0.23 × 0.28 m. This Organisms belonging to halotolerant and halophilic fungi like set-up was maintained under sunlight. The salinity of the Debaryomyces hansenii, Hortaea werneckii and Wallemia sampling site was measured using a conductivity meter ichthyophaga, chlorophytes like Dunaliella sp., flagellates like (Equip-tronics model EQ-682). pH of the sampling site was Halocafeteria seosinensis, ciliates like Fabrea salina,crusta- measured using a portable pH meter (Equip-tronics model ceans like Artemia sp. and novel organisms belonging to EQ-632). Salinity of the experimental set-up was measured Opisthokonta and Rhizaria taxa dominate hypersaline environ- on a daily basis. Conductivity readings were correlated to ments at various salinity gradients (Benlloch et al. 1996, 2002; salinity as described previously (Mani et al. 2012a). Anton et al. 2000, 2008; Øvreås et al. 2003;Burnsetal.2004; Estrada et al. 2004; Triado-Margarit and Casamayor 2013). Total community DNA extraction Large numbers of microbes present in the environment remain uncultured due to a lack of ambient culturable condi- Fifty ml of water sample was vacuum-filtered through tions. Therefore, biodiversity studies employing only culture- 0.22-μm pore size polycarbonate membrane. The membrane dependent techniques provide limited insight (Amann et al. was then treated with 1 ml of cell suspension buffer (0.15 M 1995). Culture-independent techniques employing 16S rRNA NaCl, 0.1 M EDTA, pH 8.0) followed by 1 ml of lysis buffer fingerprinting have provided us with much valuable and di- (0.1 M NaCl, 0.01 M EDTA, 1 % SDS, pH 8.0). To this verse information in the past two decades. Denaturing gradi- mixture, 0.5 ml of 10 % SDS was added and incubated at ent gel electrophoresis (DGGE) is a 16S rRNA fingerprinting 55 °C for 30 min. After incubation, 1.6 ml of technique is widely used for studying the structure of micro- phenol:chloroform:isoamyl alcohol (25:24:1 v/v/v) was added bial communities (Muyzer et al. 1998). and centrifuged at 12,000 rpm for 5 min. DNA was precipi- Goa is a coastal state in India having a tropical monsoon tated from the supernatant by adding 2 volumes of 95 % climate with hot and humid summers (January–May) follow- ethanol, suspended in TE (10:0.1 mM) buffer and stored at ed by lengthy monsoons (June–November). Therefore, the −20 °C for further use. DNA from the simulated glass tank salt pans operate only for a period of 3–4 months. Salterns was extracted using the same protocol on the first day, follow- in Goa experience two phases namely pre-salt harvesting ed by an interval of 15 days. The extracted DNAs were phase and salt harvesting phase. Salinity in salterns varies designated as ET0, ET15, ET30, ET45, ET60 and ET75. drastically throughout the year being around 3–4 % during the pre-salt harvesting phase and 26–29 % during the peak salt Amplification of 16S rRNA gene fragment harvesting phase (Mani et al. 2012a, b). Such salinity changes would ideally affect the distribution of microorganisms, both PCR was performed for amplifying 16S rRNA gene frag- bacteria and archaea, and their microbial succession along the ments from total genomic DNA, with primers 27F (AGAG salinity gradient (Boujelben et al. 2012). TTTGATCMTGGCTCAG) and 1492R (GGTTACCTTGTT In this study, bacterial diversity from two solar salterns ACGACTT) (Tanner et al. 1999; Sivaraman et al. 2011). during pre-salt and salt harvesting phases and a simulated Single reaction contained 10× PCR buffer, 10 mM of each solar saltern under laboratory conditions was studied using dNTPs, 2 mM MgCl2, 2 U of Taq Polymerase (Sigma), DGGE. 10 mM primers (IDT Technologies) and 1 μl of template Ann Microbiol (2015) 65:995–1005 997

Fig. 1 The location of Siridao and Ribandar solar salterns (source: Google Earth, 2010)

DNA. The reaction was carried out in a thermal cycler prepared according to the manufacturer’s instructions. The (Eppendorf, Germany) with initial denaturation at 94 °C for run was performed in 1× Tris-acetate–EDTA buffer at 60 °C 5 min followed by 30 cycles of denaturation at 94 °C for 30 s, at a constant voltage of 100 V for 10 h. DNA bands in the annealing at 52 °C for 30 s, elongation at 72 °C for 1 min and DGGE gels were visualised by silver staining. Gels were final extension at 72 °C for 10 min. For inserting the GC scanned and bands were analysed in a gel documentation clamp and reducing the amplicon size, a second PCR was system with TotalLab Quant software. performed with primers 968 F-GC (CGCCCGGGGCGCGC CCCGGGCGGGGCGGGGGCACGGGGGGAACGCGAA GAACCTTAC) and 1492R (Randazzo et al. 2002). Single Phylogenetic analysis reaction contained 10× PCR buffer, 10 mM of each dNTPs, μ 2mMMgCl2, 2 U of Taq Polymerase (Sigma), 10 mM Prominent bands were eluted and suspended in 100 l primers and 1 μl of template DNA. The reaction was per- distilled water overnight at 4 °C. Five μl of the eluent formed with initial denaturation at 94 °C for 5 min followed was used as template in the PCR reaction with primers by 30 cycles of denaturation at 94 °C for 30 s, annealing at 968 F-GC and 1492R with the same conditions de- 50 °C for 30 s, elongation at 72 °C for 50 s and final extension scribed as above. PCR products were electrophoresed at 72 °C for 30 min. on a 2.0 % agarose gel and then eluted from the gel. The purified PCR products were sequenced using an automated DNA sequencer (Applied Biosystems). The Denaturing gradient Gel electrophoresis sequencing results of the amplified 16S rRNA fragments were subjected to BLAST analysis (Altschul Amplified bacterial 16S rRNA gene fragments were loaded on et al. 1990). Multiple sequence alignment was per- to a polyacrylamide gel containing 7.5 % acrylamide using a formed using MUSCLE and phylogenetic tree was CBS DGGE system (CBS Scientific, Del Mar, CA, USA) constructed with MEGA 5.0 by the neighbor-joining with a gradient of 45–55 % (100 % denaturant was 7 M urea method with bootstrap analysis using 1,000 replicates and 40 % deionized formamide). All the reagents were and displaying 100 replicates (Tamura et al. 2011). The 998 Ann Microbiol (2015) 65:995–1005 nucleotide sequences were deposited in the DDBJ da- Results tabase and their accession numbers are AB780499, AB781157–AB781159 and AB781314–AB781321. Physical and chemical analysis of the sample

Sampling was conducted at four spots in the Siridao salterns, Statistical analysis designated as SIPSH, SIIPSH, SIIIPSH and SIVPSH, and at two spots in Ribandar salterns, designated as RIPSH and The gel was scanned and analysed using TotalLab Quant RIIPSH, during the pre-salt harvesting phase. During the salt software. Bands were identified by the software by subtracting harvesting phase, sampling was conducted at the same loca- the background fluorescence and normalising the gel lanes. tions in the Siridao saltern with the addition of one location in Each band was assumed to be an individual OTU (Reche et al. the Ribandar salterns, designated as RIIISH (Table 1). During – 2005). Bands presence absence and intensity data werer fur- the pre-salt harvesting phase, the salinity of the salterns was ther used for the statistical analysis. The similarity between around 3–4 %. But during the salt harvesting phase, the sampling sites was analysed using cluster analysis. A dendro- salinity varied from 21 to 29 %. Various sampling sites and – gram was constructed based on Bray Curtis dissimilarity their respective salinities are described in Table 1.pHofthe distance measures with UPGMA (Unweighted Pair Group sampling sites varied from 7 to 8. Method with Arithmetic Mean) (Bray and Curtis 1957;Mich- The experimental set-up containing saltern inlet water, ener and Sokal 1957). Diversity indexes describing species having a salinity of 3.6 %, was maintained for 75 days. richness and species evenness indexes were calculated using Salinity was measured daily and was found to be increasing – the bacterial bands present in the DGGE gel. The Shannon with time, with a maximum salinity of 16 % at the end of the Weaver index of diversity (H) (Shannon and Weaver 1963), study. pH was around 7–8 during the course of entire study. Simpson index of diversity (D)(Simpson1949)andthe equitability index (E) (Pielou 1975) were calculated using the following formula: DGGE analysis

H ¼ −ΣðÞni=N logðÞ ni=N ; DGGE analysis was performed after PCR amplification of the 2 D ¼ 1–ΣðÞni=N 16S rRNA gene. On silver staining, the DGGE gel showed E ¼ H=logS sharp and intense bands for all samples analysed except for the simulated saltern samples collected on the 15th, 30th and 75th days (Fig. 2). The total number of bands for all sampling sites are described in Table 2. The DGGE profile of all Siridao where n is the relative surface intensity of each DGGE i saltern water samples (SIPSH, SIIPSH and SIIIPSH) collected band, S is the number of DGGE bands (used to indicate the during the pre-salt harvesting phase were identical except for number of species) and N the sum of all surfaces for all bands the sample collected from the inlet (SIVPSH). A difference in in a given sample (used as estimates of species abundance). band pattern was observed among the Siridao and Ribandar Sampling effort was validated by constructing rarefaction saltern samples during the pre-salt harvesting phase. The curves. Analytic Rarefaction 1.3 was used for calculating profiles of 16S rRNA gene fragments were different for all rarefaction curves by considering the number of OTUs ob- samples obtained during the salt harvesting phase. In total, the served against number of sequences (Holland 2003). To de- pre-salt harvesting phase had many phylotypes as indicated by termine the habitability of the ecosystem, a range-weighted the number of bands, when compared with the salt harvesting richness (Rr) index was determined for each sample using the phase. The DGGE profiles of the tank samples were complete- following equation: ly different from one another. ÀÁ 2 Rr ¼ N xDg Phylogenetic analysis where N represents the total number of bands in the gel, and Dg is the denaturing gradient between the first and last Prominent bands were eluted, re-amplified and sequenced. bands of the gel (Marzorati et al. 2008). For determining the The sequences were compared with Genbank using the effect of salinity on variation in bacterial diversity, Principal BLAST search program. The closest environmental match Coordinate Analysis (PCO) was performed. PCO was carried (CEM) and closest cultured match (CCM) for the sequences for the 16S rRNA sequences obtained from simulated study, are described in Table 3. The analysed 16S rRNA sequences using Paleontological statistics software (PAST) (http://folk. showing similarity to cultured bacteria, belonged to the class uio.no/ohammer/past/) (Hammer et al. 2001). Gammaproteobacteria (Fig. 3). Ann Microbiol (2015) 65:995–1005 999

Table 1 Various sampling sites, their descriptions and their salin- Sampling site Description Salinity ities during the pre-salt harvesting phase and salt harvesting phase Pre-salt harvesting phase (in %) Salt harvesting phase (in %)

Siridao Site I Evaporator pan 3.9 22 Site II Reservoir pan 3.5 7 Site III Crystalliser pan 3.3 28 Site IV Inlet 3.1 3.3 Ribandar Site I Crystalliser pan 3.9 29 Site II Reservoir pan 2.1 3.4 Site III Evaporator pan – 21

Statistical analysis and 0.99 to 0.97, respectively. Samples obtained during the pre-salt harvesting phase displayed rich diversity than the Cluster analysis of DGGE lanes indicated relatedness among samples obtained during the salt harvesting phase. various sampling sites (Fig. 4). A distinct clustering pattern Samples from the simulated study displayed a decrement in was observed among the samples belonging to the pre-salt the diversity index values with increase in salinity. Range- harvesting phase and the salt harvesting phase. The DGGE weighted richness values indicate the habitability of an eco- profile of ET45 and ET60 showed similarity with the two salt system (Marzorati et al. 2008). DGGE gels indicated that all harvesting phase samples, SIISH and RIIISH, but ET15, ET30 saltern samples from the pre-salt harvesting phase generated and ET75 formed a separate cluster. All samples obtained high range-weighted richness values, from 44 to 14. Samples from the salterns showed high Shannon–Weaver, Simpson’s obtained from the salt harvesting phase displayed range- and equitability indices ranging from 3.0 to 2.2, 0.94 to 0.89 weighted richness values from 19 to 10, indicating a

Fig. 2 DGGE profile of bacterial 16S rRNA genes from various sites in the solar saltern and simulated study. The name of the sampling site is indicated at the top of the gel. The labeled bands were eluted, purified and sequenced 1000 Ann Microbiol (2015) 65:995–1005

Table 2 Number of bands obtained in the DGGE gel for each sample and their respective diversity indices [Shannon index (H), Simpson index (D)and equitability index (E)] followed by range-weighted richness (Rr)

Sampling site No. of bands obtained Shannon index H Simpson index D Equitability index E Range-weighted richness Rr

Pre-salt harvesting phase SIPSH 12 2.471 0.9142 0.9942 14.4 SIIPSH 16 2.764 0.9364 0.9969 25.6 SIIIPSH 17 2.809 0.9382 0.9915 28.9 SIVPSH 19 2.924 0.9451 0.9931 36.1 RIPSH 13 2.539 0.9189 0.99 16.9 RIIPSH 21 3.015 0.9495 0.9902 44.1 Salt harvesting phase SISH 11 2.34 0.899 0.9757 12.1 SIISH 10 2.236 0.8868 0.9712 10 SIIISH 12 2.453 0.9114 0.9871 14.4 SIVSH 13 2.521 0.9163 0.9828 16.9 RISH 12 2.448 0.9102 0.9851 14.4 RIISH 14 2.603 0.9233 0.9864 19.6 RIIISH 10 2.275 0.8946 0.9879 10 Simulated study samples ET0 13 2.539 0.9189 0.99 16.9 ET15 6 1.784 0.8308 0.9958 3.6 ET30 5 1.533 0.7684 0.9525 2.5 ET45 9 2.172 0.883 0.9885 8.1 ET60 9 2.179 0.8849 0.9919 8.1 ET75 4 1.341 0.7259 0.9673 1.6 moderately habitable environment. Samples obtained from the Principal Coordinate Analysis described the effect of simulated study had in between values, 16 and 1. The diver- salinity on bacterial diversity in the simulated saltern. sity index values and range-weighted richness values for the The graph (Fig. 6) clearly shows that samples ET15 DGGE gel are given in Table 2. Rarefaction curves were and ET30 had less change in diversity when compared constructed for individual sampling sites and for all sampling with ET0. Similarly, ET75 was highly diverse when sites together. The curves tended to plateau, validating the compared with ET45 and ET60, which were grouped sampling effort (Fig. 5). together.

Table 3 Sequenced bands with their closest environmental and closest cultured match after comparing with Genbank sequences

Band Accession no. Closest environmental match (CEM) % identity Closest cultured match (CEM) % identity

0A AB780499 Uncultured Gammaproteobacterium clone SEPR3279-22 97 Vibrio diazotrophicus 97 0B AB781157 Uncultured bacterium clone JdFBDF4-26 94 Alteromonas marina 97 0C AB781318 Uncultured bacterium clone ELB16-159 94 Marinobacter aquaeolei 92 0D AB781316 Uncultured Pseudomonas sp. C174 98 Tolumonas osonensis 98 0E AB781317 Uncultured Pseudomonas sp. De232 85 Psedomonas plecoglossicida 83 7B AB781319 Uncultured bacterium clone S90 81 Marinobacter psychrophilus 73 10A AB781158 Uncultured Gammaproteobacterium clone SEPR3279-22 99 Alteromonas macleodii 99 10B AB781315 Uncultured bacterium clone ABW114 98 Tolumonas osonensis 81 13D AB781159 Uncultured Alteromonas sp. clone TUG01-61 100 Alteromonas marina 100 13F AB781314 Uncultured bacterium clone U1371-191 88 Alteromonas macleodii 85 15C AB781320 Uncultured bacterium clone 8,572 88 Pseudoalteromonas arctica 96 17B AB781321 Uncultured bacterium clone TLC-PA3-24 98 Aeromonas veronii 89 Ann Microbiol (2015) 65:995–1005 1001

Gammaproteobacteria

Fig. 3 Phylogenetic tree displaying the sequenced DGGE bands and their related sequences obtained from the NCBI database after BLAST analysis. Separate clusters are indicated with black dots. Alkaliflexus imshenetskii was used as an out group

Discussion limited and relatively constant abiotic conditions (Estrada et al. 2004). However, majority of the studies concerning Universal primers or taxon-specific primers can be used to biodiversity of solar salterns and hypersaline regions have target the 16S rRNA genes from the community DNA and been centred on the archaeal domain, particularly halophilic then subject it to DGGE (Head et al. 1998;Muyzeretal.1998; archaea. A few culture-dependent studies in Goan salterns Muyzer and Smalla 1998). Though DGGE has some draw- showed the presence of the bacterial genera Aeromonas, backs, like PCR biases, heteroduplex formation and co- Pseudomonas, Vibrio, Desulfobacter, Desulfovibrio, migration of bands, for comparison of spatial and temporal Desulfococcus and Chlorohalobacter and archaeal genera variation of diversity it can be coupled to statistical tools like belonging to the family Halobacteriaceae, namely Diversity indices, Principal Coordinate Analysis, Principal Halococcus, Halorubrum, Haloarcula and Haloferax (Kerkar Component Analysis and Correspondence Analysis. Using and Loka Bharathi 2007;Manietal.2012a). Culture- these statistical tools, one can compare the microbial diversity independent studies indicated the occurrence of novel archae- among the sampling sites or variation of diversity with respect al members belonging to the Crenarchaeota and to changes in environmental parameters (Desnues et al. 2007; Euryarchaeota (Ahmad et al. 2011). Li et al. 2007; Webster et al. 2007). This is the first report analysing the bacterial diversity of Organisms belonging to all three domains of life, archaea, the solar salterns of Goa through culture-independent PCR- bacteria and eukarya, are known to inhabit solar salterns DGGE techniques during two different phases of salt produc- (Benlloch et al. 1996;Antonetal.1999;Litchfieldand tion (pre-salt harvesting phase and salt production phase). The Gillevet 2002; Oren 2002; Gunde-Cimerman et al. 2009). first sampling was carried out during the pre-salt harvesting Solar salterns are unique ecosystems in which the common phase. During this phase, the salinity of the sea water was 3– habitat conditions (3 % salinity) are gradually changed to 8 %. In the peak salt harvesting phase, the salinity of the extreme conditons (~30 % salinity). These conditions provide salterns increased to 28–29 %. One would expect non- a perfect scenario for studying extreme microbiology with halophilic to halotolerant bacteria to thrive during the initial 1002 Ann Microbiol (2015) 65:995–1005

Fig. 4 Cluster analysis of various sampling sites based on DGGE profiles, calculated using the Bray–Curtis similarity distance

phase while, with an increase in salinity, moderately halophilic to extremely halophilic bacteria along with archaea will dominate the salterns. To simulate the expected trend in salterns over the two phases, an experimental set-up with a glass tank filled with inlet water was created and simulated. The DGGE gel displayed bands when the whole gel was taken into account irrespective of the sampling sites considered. On visually scoring the bands, some prominent bands appeared in all the sampling sites of a single saltern during a particular salt production phase. However, the overall pattern suggested that there is a clear variation between the pre-salt harvesting phase and the salt harvesting phase. In general, pre- salt harvesting phase samples displayed more bands than samples from the salt harvesting phase. This denotes the decrease in diversity with the increase in salinity. Cluster analysis resulted in the grouping of Ribandar and Siridao saltern samples obtained during the pre-salt harvesting phase as well as the salt harvesting phase, respectively. Sam- ples collected from the simulated tank at intervals of 15 days displayed a strong decline in the diversity which was indicated by the number of the bands. However, ET45 (7.5 %) and ET60 (10 %) displayed 9 bands when compared with the ET15 (5 %) and ET30 (5.8 %) samples, which displayed 6 and 5 bands, respectively. This indicated a decrease in bacterial phylotypes with increase in salinity, probably with more Fig. 5 Rarefaction curve of a all the samples and b individual samples halotolerant or moderately halophilic bacterial phylotypes based on the DGGE profiles taking over. With further increase in salinity to 16 %, bacterial Ann Microbiol (2015) 65:995–1005 1003

Fig. 6 Principal Coordinate Analysis of the simulated study samples and the variation in diversity with change in salinity phylotypes further decreased, resulting in 4 bands for the Usually, ecosystems like solar salterns are generally sample ET75. Principal Coordinate Analysis revealed varia- considered to host relatively high levels of yet-to-be-cul- tion in the diversity among simulated study samples. tured organisms when compared with other ecosystems Bacterial communities in salterns are affected by various because of the lack of studies concerning their diversity factors at different salinities. Availability of organic carbon (Casamayor et al. 2013). Phylogenetic analysis revealed and protists grazing determine the growth rate of bacteria in bands showing similarity to CCM belonged to the the low salinity and medium salinity ponds, respectively. Gammaproteobacteria. Some of the isolated and se- Because of these pressures, bacteria dominating the low and quenced bands like 0A, 0D, 10A, and 13D displayed moderate salinity ponds have high specific growth rates. In >97 % identity to CEM and CCM. However, other bands contrast, bacterial communities in the high salinity salterns are displayed<97%identitytoCEMor<97%toCCMor not affected by any biotic and abiotic pressures except for the both. About 58.3 % of the sequenced bands displayed presence of halophilic viruses. Therefore, bacterial communi- <97 % identity to CCM indicating the presence of novel ties in the high salinity ponds have low specific growth rates bacterial phylotypes. The 16S rRNA sequence of band 0C and they usually belong to a single phylotype (Gasol et al. showed identity to Alteromonas sp., obtained during the 2004). This can be clearly seen in DGGE, on comparing the pre-salt harvesting phase and appearing again during the number of bands obtained during the pre-salt harvesting phase salt harvesting phase. This demonstrates that certain bac- and the salt harvesting phase. On assuming each band belongs terial phylotypes can resist a wide range of salinity. The to single taxa, the pre-salt harvesting phase had large number possible novel isolates were present during both the pre- of bands when compared with the salt harvesting phase. salt harvesting and the salt harvesting phase, belonging to When considering the trend of the bacterial diversity pat- Vibrio sp., Alteromonas sp., Tolumonas sp., Marinobacter tern of the simulated study tank, some factors should be taken sp., Pseudoalteromonas sp. and Pseudomonas sp. Diver- into consideration. Even though the salinity increased with sity index values indicated that salterns are rich time in the simulated study, the conditions experienced by the in bacterial diversity and are evenly distributed organisms are completely different from the salterns. In solar (Demergasso et al. 2008). The pre-salt harvesting season salterns, there is a flow of nutrients and the occurrence of exhibited high Shannon–Weaver (H) index values indicat- sediments. Algae like Dunaliella salina act as a producer in ing a richer diversity than the salt harvesting phase. Eq- the salterns (Oren 2002). The simulated study was carried out uitability (E) index values described an even pattern in the in a closed container implying a stagnant ecosystem, thereby distribution of organisms through the ecosystem. Range- limiting the availability of nutrients. Considering these factors, weighted richness (Rr) values categorised the salterns as a the simulated study may be enriching only particular bacterial medium range-weighted richness environment (during the phylotypes which can sustain themselves in the available pre-salt harvesting phase) to a low range-weighted rich- nutrients. Nevertheless, the simulated study displayed the ness environment (during the salt harvesting phase). Di- expected trend of variation of diversity with salinity. versity index values of the simulated study showed that 1004 Ann Microbiol (2015) 65:995–1005 they are low diversity environments, almost uninhabitable Anton J, Peña A, Santos F, Martinez-Garcıá M, Schmitt-Kopplin P, by microbes (Table 2). All statistical studies correlated Rossello-Mora R (2008) Distribution, abundance and diversity of the extremely halophilic bacterium Salinibacter ruber.SalineSyst4: with the experimental results. 2 This study clearly demonstrates that the salterns of Goa Baati H, Amdouni R, Gharsallah N, Sghir A, Ammar E (2010) Isolation under investigation are dominated by members belonging to and characterization of moderately halophilic bacteria from Tunisian – the Gammaproteobacteria; however, the microdiversity within solar saltern. Curr Microbiol 60:157 161 Benlloch S, Acinas SG, Martinez-Murcia AJ, Rodriguez-Valera F (1996) the phyla is clearly demonstrated. Previous studies from other Description of prokaryotic biodiversity along the salinity gradient of salterns worldwide have indicated that the dominant bacterial a multipond solar saltern by direct PCR amplification of 16S rDNA. phylotypes belonging to Gram-negative bacteria (Yeon et al. Hydrobiologia 329:19–31 – 2005; Demergasso et al. 2008; Tsiamis et al. 2008; Baati et al. Benlloch S, López López A, Casamayor EO, Øvreås L, Goddard V,Daae FL, Smerdon G, Massana R, Joint I, Thingstad F, Pedrós–Alió C, 2010) including the Gammaproteobacteria and Bacteroidetes, Rodríguez–Valera F (2002) Prokaryotic genetic diversity throughout particularly the Flavobacteriales and Sphingobacteriales, the salinity gradient of a coastal solar saltern. Environ Microbiol such as Salinibacter ruber, while Halomonas sp. and 4(6):349–360 Salinibacter ruber are the most dominant members of salterns Boujelben I, Gomariz M, Martínez-García M, Santos F, Peña A, López C, Antón J, Maalej S (2012) Spatial and seasonal prokaryotic commu- worldwide (Ventosa et al. 1998). Given their cell wall com- nity dynamics in ponds of increasing salinity of Sfax solar saltern in position, Gram-negative bacteria are more adapted to live in Tunisia. Antonie Van Leeuwenhoek 101:845–857 high ionic environments like solar salterns (Baati et al. 2010). Braganca JM, Furtado I (2009) Isolation and characterization of Gram-positive bacteria belonging to the Firmicutes have also haloarchaea from low-salinity coastal sediments and waters of Goa. Curr Sci 96:1182–1184 been reported (Yeon et al. 2005). Bray J, Curtis JT (1957) An ordination of the upland forest communities Owing to a common problem with DGGE, a few bands of southern Wisconsin. Ecol Monogr 27:325–34 failed to re-amplify and therefore some bacterial phylotypes Burns DG, Camakaris HM, Janssen PH, Dyall-Smith ML (2004) belonging to other groups may have been missed. In order to Combined use of cultivation-dependent and cultivation- independent methods indicate that members of most haloarchaeal determine whether salterns of Goa are devoid of the most groups in an Australian crystallizer pond are cultivable. Appl represented bacterial members, Halomonas sp. and Environ Microbiol 70:5258–5265 Salinibacter ruber, genera-specific studies should be carried Casamayor EO, Massana R, Benlloch S, Øvreås L, Díez B, Goddard VJ, – – out. Studies like PCR-DGGE with taxa-specific primers and Gasol JM, Joint I, Rodríguez Valera F, Pedrós Alió C (2002) Changes in archaeal, bacterial and eukaryal assemblages along a FISH using probes targeting particular phylotypes can give us salinity gradient by comparison of genetic fingerprinting methods in a conclusive result and further expand our knowledge of the a multipond solar saltern. Environ Microbiol 6:338–348 microbial ecology of salterns. Casamayor EO, Triadó–Margarit X, Castañeda C (2013) Microbial biodiversity in saline shallow lakes of the monegros desert, Spain. FEMS Microbiol Ecol 85(3):503–518 Acknowledgment J.B. acknowledges BITS Seed Grant 2013. KM and Demergasso C, Escudero L, Casamayor EO, Chong G, Balagué V, BBS thank Council of Scientific and Industrial Research India for Pedrós-Alió C (2008) Novelty and spatio–temporal heterogeneity awarding a Senior Research Fellowship (SRF) (09/919 (0017)/2012- in the bacterial diversity of hypersaline lake tebenquiche (salar de EMR-I and (09/919 (0016)/2012-EMR-I). Atacama). Extremophiles 12:491–504 Deshmukh KB, Pathak AP, Karuppayil MS (2011) Bacterial diversity of lonar soda lake of India. Indian J Microbiol 51(1):107–111 Desnues C, Michotey VD, Wieland A, Zhizang C, Fourcans A, Duran R, References Bonin PC (2007) Seasonal and diel distributions of denitrifying and bacterial communities in a hypersaline microbial mat (camargue, France). Water Res 41:3407–3419 Ahmad N, Sharma S, Khan FG, Kumar R, Johri S, Abdin MZ, Qazi GN Estrada M, Henriksen P, Gasol JM, Casamayor EO, Pedrós–Alió C (2008) Phylogenetic analyses of archaeal ribosomal DNA sequences (2004) Diversity of planktonic photoautotrophic microorganisms from salt pan sediment of Mumbai, India. Curr Microbiol 57:145– along a salinity gradient as depicted by microscopy, flow cytometry, 152 pigment analysis and DNA–based methods. FEMS Microbiol Ecol Ahmad N, Johri S, Sultan P, Abdin MZ, Qazi GN (2011) Phylogenetic 49(2):281–293 characterization of archaea in saltpan sediments. Indian J Microbiol Garcia-Martinez J, Acinas SG, Antón AI, Rodriguez-Valera F (1999) Use 51:132–137 of the 16S–23S ribosomal genes spacer region in studies of pro- Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local karyotic diversity. J Microbiol Methods 36:55–64 alignment search tool. J Mol Biol 215:403–410 Gasol JM, Casamayor EO, Joint I, Garde K, Gustavson K, Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identification Benlloch S, Diez B, Schauer M, Massana R, Pedrós-Alió and in situ detection of individual microbial cells without cultiva- C (2004) Control of heterotrophic prokaryotic abundance tion. Microbiol Rev 59:143–169 and growth rate in hypersaline planktonic environments. Anton J, Llobet-Brossa E, Rodriguez-Valera F, Amann R (1999) Aquat Microb Ecol 34(2):193–206 Fluorescence in situ hybridization analysis of the prokaryotic com- Gunde-Cimerman N, Ramos J, Plemenitaš A (2009) Halotolerant and munity inhabiting crystallizer ponds. Environ Microbiol 1:517–523 halophilic fungi. Mycol Res 113:1231–1241 Anton J, Rossello-Mora R, Rodriguez-Valera F, Amann R (2000) Hammer Ø, Harper DAT, Ryan PD (2001) PAST: paleontological statis- Extremely halophilic bacteria in crystallizer ponds from solar tics software package for education and data analysis. Palaeontol salterns. Appl Environ Microbiol 66:3052–3057 Electron 4:1–9 Ann Microbiol (2015) 65:995–1005 1005

Head IM, Saunders JR, Pickup RW (1998) Microbial evolution, diversity, Øvreås L, Daae FL, Torsvik V, Rodrıguez-Valera F (2003) and ecology: a decade of ribosomal RNA analysis of uncultivated Characterization of microbial diversity in hypersaline environments microorganisms. Microb Ecol 35:1–21 by melting profiles and reassociation kinetics in combination with Henriques IS, Alves A, Taca˜o M, Almeida A, Cunha A, Correia A terminal restriction fragment length polymorphism (T-RFLP). (2006) Seasonal and spatial variability of free-living bacterial com- Microb Ecol 46:291–301 munity composition along an estuarine gradient (Ria de aveiro, Pielou EC (1975) Ecological diversity. Wiley, New York Portugal). Estuar Coast Shelf Sci 68:139–148 Randazzo CL, Torriani S, Akkermans ADL, de Vos WM, Vaughan EE Holland SM (2003) Analytic rarefaction. (http://www.uga.edu/strata/ (2002) Diversity, dynamics and activity of bacterial communities software/) during production of an artisanal Sicilian cheese as evaluated by 16S Kerkar S, Loka Bharathi PA (2007) Stimulation of sulphate reducing rRNA analysis. Appl Environ Microbiol 68:1882–1892 activity at salt saturation in the saltern of ribandar, Goa, India. Reche I, Pulido-Villena E, Morales-Baquero R, Casamayor EO (2005) Geomicrobiol J 24:101–110 Does ecosystem size determine aquatic bacterial richness? Ecology Li K, Guan W, Wei G, Liu B, Xu J, Zhao L, Zhang Y (2007) Phylogenetic 86:1715–1722 analysis of intestinal bacteria in the Chinese mitten crab (eriocheir Rodríguez-Valera F, Ventosa A, Juez G, Imhoff JF (1985) Variation of sinensis). J Appl Microbiol 103:675–682 environmental features and microbial populations with salt concen- Litchfield CD, Gillevet PM (2002) Microbial diversity and complexity in trations in a multi-pond saltern. Microb Ecol 11:107–115 hypersaline environments: a preliminary assessment. J Ind Shannon CE, Weaver W (1963) The mathematical theory of communi- Microbiol Biotechnol 28:48–55 cation. University of Illinois Press, Urbana Lorenz P, Eck J (2005) Metagenomics and industrial applications. Nat Simpson EH (1949) Measurement of diversity. Nature 163:688 Rev Microbiol 3:510–516 Sivaraman C, Ganguly A, Nikolausz M, Mutnuri S (2011) Isolation of Mani K, Salgaonkar BB, Bragança JM (2012a) Culturable halophilic hydrocarbonoclastic bacteria from bilge oil contaminated water. Int J archaea at the initial and crystallization stages of salt production in Environ Sci Tech 8:461–470 a natural solar saltern of Goa, India. Aquat Biosyst 8:15 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) Mani K, Salgaonkar BB, Das D, Bragança JM (2012b) Community solar MEGA5: molecular evolutionary genetics analysis using maximum salt production in Goa, India. Aquat Biosyst 8:30 likelihood, evolutionary distance and maximum parsimony Marzorati M, Wittebolle L, Boon N, Daffonchio D, Verstraete W (2008) methods.MolBiolEvol28:2731–2739 How to get more out of molecular fingerprints: practical tools for Tanner MA, Shoskes D, Shahed A, Pace NR (1999) Prevalence of microbial ecology. Environ Microbiol 10:1571–1581 corynebacterial 16S rRNA sequences in patients with bacterial and Michener CD, Sokal RR (1957) A quantitative approach to a problem in “nonbacterial” prostatitis. J Clin Microbiol 37:1863–1870 classification. Evolution 11:130–162 Triado-Margarit X, Casamayor EO (2013) High genetic diversity and Munson MA, Nedwell DB, Embley TM (1997) Phylogenetic diversity of novelty in planktonic protists inhabiting inland and coastal high archaea in sediment samples from a coastal salt marsh. Appl Environ salinity water bodies. FEMS Microbiol Ecol 85:27–36 Microbiol 63:4729–4733 Tsiamis G, Katsaveli K, Ntougias S, Kyrpides N, Andersen G, Muyzer G, Smalla K (1998) Application of denaturing gradient gel electro- Piceno Y, Bourtzis K (2008) Prokaryotic community pro- phoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) files at different operational stages of a Greek solar saltern. in microbial ecology. Antonie Van Leeuwenhoek 73:127–141 Res Microbiol 159:609–627 Muyzer G, Brinkhoff T, Nubel U, Santagoeds C, Schafer H, Wawer C Ventosa A, Marquez M, Garabito M, Arahal D (1998) Moderately halo- (1998) Denaturing gradient gel electrophoresis (DGGE). In: philic gram-positive bacterial diversity in hypersaline environments. Akkermans ADL, van Elsas JD, Bruijn FJ (eds), Molecular micro- Extremophiles 2:297–304 bial ecology manual. Kluwer, Dordrecht, pp 3.4.4/1–27 WebsterG,YarramL,FreeseE,KosterJ,SassH,ParkesRJ, Ochsenreiter T, Pfeiffer F, Schleper C (2002) Diversity of archaea in Weightman AJ (2007) Distribution of candidate division JS1 hypersaline environments characterized by molecular-phylogenetic and other bacteria in tidal sediments of the German wadden and cultivation studies. Extremophiles 6:267–274 Sea using targeted 16S rRNA gene PCR-DGGE. FEMS Oh D, Porter K, Russ B, Burns D, Dyall-Smith M (2010) Diversity of Microbiol Ecol 62:78–79 haloquadratum and other haloarchaea in three, geographically distant, Yeon SH, Jeong WJ, Park JS (2005) The diversity of culturable Australian saltern crystallizer ponds. Extremophiles 14:161–169 organotrophic bacteria from local solar salterns. J Microbiol 43:1–10 Oren A (2002) Diversity of halophilic microorganisms: environments, Zafrilla B, Martinez-Espinosa RM, Alonso MA, Bonete MJ (2010) phylogeny, physiology, and applications. J Ind Microbiol Biodiversity of archaea and floral of two inland saltern ecosystems Biotechnol 28:56–63 in the alto vinalopó valley, Spain. Saline Syst 6:10