DOCSLIB.ORG

Deleted Genes Associated with Digeorge/22Q11.2 Deletion Syndrome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Deleted Genes Associated with Digeorge/22Q11.2 Deletion Syndrome Motahari et al. Journal of Neurodevelopmental Disorders (2019) 11:7 https://doi.org/10.1186/s11689-019-9267-z REVIEW Open Access In the line-up: deleted genes associated with DiGeorge/22q11.2 deletion syndrome: are they all suspects? Zahra Motahari, Sally Ann Moody, Thomas Michael Maynard and Anthony-Samuel LaMantia* Abstract Background: 22q11.2 deletion syndrome (22q11DS), a copy number variation(CNV)disorder,occursinapproximately 1:4000 live births due to a heterozygous microdeletion at position 11.2 (proximal) on the q arm of human chromosome 22 (hChr22) (McDonald-McGinn and Sullivan, Medicine 90:1-18, 2011). This disorder was known as DiGeorge syndrome, Velo-cardio-facial syndrome (VCFS) or conotruncal anomaly face syndrome (CTAF) based upon diagnostic cardiovascular, pharyngeal, and craniofacial anomalies (McDonald-McGinn and Sullivan, Medicine 90:1-18, 2011; Burn et al., J Med Genet 30:822-4, 1993) before this phenotypic spectrum was associated with 22q11.2 CNVs. Subsequently, 22q11.2 deletion emerged as a major genomic lesion associated with vulnerability for several clinically defined behavioral deficits common to a number of neurodevelopmental disorders (Fernandez et al., Principles of Developmental Genetics, 2015; Robin and Shprintzen, J Pediatr 147:90-6, 2005; Schneider et al., Am J Psychiatry 171:627-39, 2014). Results: The mechanistic relationships between heterozygously deleted 22q11.2 genes and 22q11DS phenotypes are still unknown. We assembled a comprehensive “line-up” of the 36 protein coding loci in the 1.5 Mb minimal critical deleted region on hChr22q11.2, plus 20 protein coding loci in the distal 1.5 Mb that defines the 3 Mb typical 22q11DS deletion. We categorized candidates based upon apparent primary cell biological functions. We analyzed 41 of these genes that encode known proteins to determine whether haploinsufficiency of any single 22q11.2 gene—a one gene to one phenotype correspondence due to heterozygous deletion restricted to that locus—versus complex multigenic interactions can account for single or multiple 22q11DS phenotypes. Conclusions: Our 22q11.2 functional genomic assessment does not support current theories of single gene haploinsufficiency for one or all 22q11DS phenotypes. Shared molecular functions, convergence on fundamental cell biological processes, and related consequences of individual 22q11.2 genes point to a matrix of multigenic interactions due to diminished 22q11.2 gene dosage. These interactions target fundamental cellular mechanisms essential for development, maturation, or homeostasis at subsets of 22q11DS phenotypic sites. Keywords: 22q11DS, Neural development, Cognition, Cardiovascular, Craniofacial, Copy number variants, Polygenic Background define the region (Fig. 1a) [6].TheseLCRs,duetosubstan- The frequency of 22q11.2 deletion—the chromosomal/copy tial sequence similarity, facilitate non-allelic homologous number variant (CNV) that results in most cases of meiotic recombination, or “deletion by crossing over of DiGeorge/22q11DS [1, 2]—reflects the unusual genomic repetitive DNA” [7], resulting in unbalanced translocation, architecture of human chromosome 22 (hChr22), position deletions, or duplication [8]. More than 85% of recombi- q11.2. At least four repetitive DNA “cassettes” known as nation occurs between LCR A and LCR D resulting in a low copy-number repeats (LCRs): LCR A, B, C, and D; 3Mb“typical” deletion. The smaller 1.5 Mb “minimal critical” deletion, occurs between LCR A and LCR B in * Correspondence: [email protected] ∼ 10% of affected individuals [6, 8]. Deleted individuals The Institute for Neuroscience, and Department of Anatomy and Cell Biology, The George Washington University School of Medicine and Health have complex and variable phenotypes including de- Sciences, Washington DC 20037, USA velopmental delay, congenital heart defects, craniofacial © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Motahari et al. Journal of Neurodevelopmental Disorders (2019) 11:7 Page 2 of 28 Fig. 1 Genes deleted in 22q11DS. a Schematic of the 22q11.2 region. Low copy repeats (LCRs) are shown as gray boxes: LCR A-D (not to scale). b Protein-coding genes (n = 56) are color-coded based on primary, putative, or family member functions as eleven groups. c mRNA (Prodh, Zdhhc8, Sept5, Gnb1l, Ranbp1, Dgcr8, Arvcf, Dgcr2,andTrmt2a) or protein (Ufd1l, Hira, Comt) expression of selected genes at mouse embryonic stageE10.5[58, 73, 169]. d Expression localization of Cdc45, Ranbp1,andSept5 in the entire cortical hemisphere of E14.5 embryos (left) and in a higher magnification (right) [60]. Expression pattern of Zdhhc8 is shown in the adult cerebellum (left) and the cortex (right) [310]. Immunolocalization of Ufd1l and Comt proteins in the hippocampus (left) and cerebellum (right) of the adult mouse brain are shown [58]. VZ ventricular zone, IZ intermediate zone, CP cortical plate, gc granular cell layer, P purkinje cell layer, ml molecular layer, Cb cerebellum, Ctx cortex. Hip hippocampus, Calb calbindin. Scale bars: Cdc45, Ranbp1, Sept5 =250μm, insets = 6.6x, Zdhhc8 =50μm(left)and100μm (right). Ufd/Comt: hippocampus (upper left) = 250 μm, insets (lower left) = 10x, cerebellum (right) = 25 μm anomalies such as cleft palate and retrognathia, muscu- 22q11.2 deletion syndrome (22q11DS) is associated loskeletal anomalies, eye anomalies, hearing loss, absent with behavioral and psychiatric complications such as or small thymus and parathyroid glands, hypocalcemia, schizophrenia (SCZ) autistic spectrum disorders (ASD), compromised immune system, feeding difficulties, and attention deficit hyperactivity disorder (ADHD), anxiety seizures. In addition to these physical manifestations, disorder, as well as intellectual and learning disabilities Motahari et al. Journal of Neurodevelopmental Disorders (2019) 11:7 Page 3 of 28 [3–5]. Clearly, the range of genomic lesions, numbers supports polygenic inheritance of broader, clinically defined of genes, and spectrum of phenotypes that define behavioral disorders. In ASD, aside from 22q11.2, five 22q11 CNV disorders defies straightforward expla- additional CNV loci: 1q21.1, 3q29, 7q11.23, 16p11.2, nations of genotype to phenotype correlations. The and 15q11.2–13, as well as multiple de novo gene va- essential question remains: how CNVs of one, many, or riants have been identified as risk factors [21]. Similarly, all 22q11.2 genes disrupts developmental and homeo- SCZ is associated with multiple, rare loss and gain of static mechanisms and complicates the lives of children function mutations in genes that encode calcium chan- and adults with 22q11DS. nels, postsynaptic cytoskeleton-associated scaffold pro- Individuals with the AtoBdeletion (we use this no- teins, and cell adhesion/signaling molecules [22, 23]. menclature to identify heterozygous elimination of Whole exome sequence analyses in individuals with 22q11.2 genes between LCRs A and B) have the full non-syndromic congenital heart defects also fail to sup- spectrum of phenotypes seen also with the typical Ato port robust individual gene/phenotype correlations D deletion (i.e., elimination of genes between LCRs A [24]. It is thus unlikely that developmental phenotypes and D), suggesting that key 22q11DS phenotypes are in individuals with 22q11.2 CNVs—including com- largely due to diminished AtoBgene dosage [9–11]. monly diagnosed behavioral deficits associated with Microcephaly and ocular anomalies occur in about 50% neurodevelopmental disorders—arise from the con- of individuals with AtoBor AtoDdeletions compared sequences of altered dosage of one single gene within the to 7% in BtoDor CtoDdeleted individuals, and AtoDregion. Indeed, single gene explanation for indi- cardiovascular defects also appear to be > 3 times more vidual phenotypes or complete phenotypic spectra are frequent in AtoBor AtoDdeletions [12]. Neverthe- unlikely for most CNV syndromes, including fairly less, deletions in distal regions, BtoDor CtoD, have common deletions and duplications at 7q11.23 (Williams been associated with cardiac developmental anomalies Syndrome), 15q11.2 (Prader-Willi Angelman Syndrome), similar to those associated with AtoBor AtoDdele- 16p11.2 (Autism Susceptibility), and even whole or partial tions, albeit with lower frequency [13]. Furthermore, the chromosomal anomalies like trisomy 21 (Down syn- presence and severity of phenotypes among individuals drome). Thus, a reassessment of the known protein carrying the AtoBdeletion [14] varies significantly, coding genes at 22q11.2 between LCRs A and D, and their even in siblings who inherit the same deletion from a causal relationship to 22q11DS, based upon a thorough 22q11.2-deleted parent [15]. In the context of these review of molecular and cellular mechanisms through complex associations between penetrance and severity, it which each gene influences development or ongoing is unlikely that haploinsufficiency of TBX1 (a 22q11.2 A physiological function, is necessary, timely, and may have to B gene
Load more

Recommended publications
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name DiGeorge syndrome critical region gene 14 Gene Symbol Dgcr14 Organism Mouse Gene Summary The human ortholog of this gene is located within the minimal DGS critical region (MDGCR) thought to contain the gene(s) responsible for a group of developmental disorders. These disorders include DiGeorge syndrome velocardiofacial syndrome conotruncal anomaly face syndrome and some familial or sporadic conotruncal cardiac defects which have been associated with microdeletion of human chromosome band 22q11.2. The encoded protein localizes to the nucleus and the orthologous protein in humans co-purifies with C complex spliceosomes. Multiple transcript variants encoding different isoforms have been found for this gene. Gene Aliases AI462402, D16H22S1269E, Dgcr1, Dgsi, ES2, Es2el RefSeq Accession No. NC_000082.6, NT_039624.8, NT_187007.1 UniGene ID Mm.256480 Ensembl Gene ID ENSMUSG00000003527 Entrez Gene ID 27886 Assay Information Unique Assay ID qMmuCID0011048 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000003621 Amplicon Context Sequence GCCTGTAGCTTCTCCACATCAGGGAAGAAGTCTCTCTGGATAACTGTCTGAAGTC CCTCGATGTACTCTTCTTCATCCAGGACCCGCTGCCTGCTTCTCGCAACTCCGG CCT Amplicon Length (bp) 82 Chromosome Location 16:17910201-17911217 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 95 R2 0.9994 cDNA Cq 21.87 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79.5 gDNA Cq 23.94 Specificity (%) 100 Information to assist with data interpretation is provided
    [Show full text]
  • CRNKL1 Is a Highly Selective Regulator of Intron-Retaining HIV-1 and Cellular Mrnas
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934927; this version posted February 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 CRNKL1 is a highly selective regulator of intron-retaining HIV-1 and cellular mRNAs 2 3 4 Han Xiao1, Emanuel Wyler2#, Miha Milek2#, Bastian Grewe3, Philipp Kirchner4, Arif Ekici4, Ana Beatriz 5 Oliveira Villela Silva1, Doris Jungnickl1, Markus Landthaler2,5, Armin Ensser1, and Klaus Überla1* 6 7 1 Institute of Clinical and Molecular Virology, University Hospital Erlangen, Friedrich-Alexander 8 Universität Erlangen-Nürnberg, Erlangen, Germany 9 2 Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine in the 10 Helmholtz Association, Robert-Rössle-Strasse 10, 13125, Berlin, Germany 11 3 Department of Molecular and Medical Virology, Ruhr-University, Bochum, Germany 12 4 Institute of Human Genetics, University Hospital Erlangen, Friedrich-Alexander Universität Erlangen- 13 Nürnberg, Erlangen, Germany 14 5 IRI Life Sciences, Institute für Biologie, Humboldt Universität zu Berlin, Philippstraße 13, 10115, Berlin, 15 Germany 16 # these two authors contributed equally 17 18 19 *Corresponding author: 20 Prof. Dr. Klaus Überla 21 Institute of Clinical and Molecular Virology, University Hospital Erlangen 22 Friedrich-Alexander Universität Erlangen-Nürnberg 23 Schlossgarten 4, 91054 Erlangen 24 Germany 25 Tel: (+49) 9131-8523563 26 e-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934927; this version posted February 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis
    cells Article Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis Han-Yu Wang 1,2, Chun-Hsiang Lin 1, Yi-Ru Shen 1, Ting-Yu Chen 2,3, Chia-Yih Wang 2,3,* and Pao-Lin Kuo 1,2,4,* 1 Department of Obstetrics and Gynecology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] (H.-Y.W.); [email protected] (C.-H.L.); [email protected] (Y.-R.S.) 2 Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] 3 Department of Cell Biology and Anatomy, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan 4 Department of Obstetrics and Gynecology, National Cheng-Kung University Hospital, Tainan 704, Taiwan * Correspondence: [email protected] (C.-Y.W.); [email protected] (P.-L.K.); Tel.: +886-6-2353535 (ext. 5338); (C.-Y.W.)+886-6-2353535 (ext. 5262) (P.-L.K.) Abstract: Septins are GTP-binding proteins that form heteromeric filaments for proper cell growth and migration. Among the septins, septin7 (SEPT7) is an important component of all septin filaments. Here we show that protein kinase A (PKA) phosphorylates SEPT7 at Thr197, thus disrupting septin filament dynamics and ciliogenesis. The Thr197 residue of SEPT7, a PKA phosphorylating site, was conserved among different species. Treatment with cAMP or overexpression of PKA catalytic subunit (PKACA2) induced SEPT7 phosphorylation, followed by disruption of septin filament formation. Constitutive phosphorylation of SEPT7 at Thr197 reduced SEPT7-SEPT7 interaction, but did not affect SEPT7-SEPT6-SEPT2 or SEPT4 interaction.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Hira Peracha a Thesis
    DIAGNOSIS METHOD FOR MUCOPOLYSACCHARIDOSES by Hira Peracha A thesis submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Bachelor of Arts in Biological Sciences with Distinction Spring 2018 © 2018 Hira Peracha All Rights Reserved i DIAGNOSIS METHOD FOR MUCOPOLYSACCHARIDOSES by Hira Peracha Approved: __________________________________________________________ Shunji Tomatsu, MD, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee Approved: __________________________________________________________ Deni Galileo, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee Approved: __________________________________________________________ Jessica Tanis, Ph.D. Committee member from the Department of Department Name Approved: __________________________________________________________ Barbara Settles, Ph.D. Committee member from the Board of Senior Thesis Readers Approved: __________________________________________________________ Michael Chajes, Ph.D. Chair of the University Committee on Student and Faculty Honors ii “Education is the key to unlocking the world, a passport to freedom.” -Oprah Winfrey iii ACKNOWLEDGMENTS I dedicate my thesis to my late grandfather, who taught me the value of life, hard work and sacrifice- especially in sickness and in health. I would like to express my deepest acknowledgements to my family. I could not have achieved all of my dreams and goals in life without my parents; my mom and my dad, whose sacrifices, love and support have been endless and infinite. Thank you for raising me to believe that anything was possible, and for spending your entire lives to better mine. To my younger siblings, Saarah, Hafsah and Arif, who have been the light in the dark times in my life and have always brought joy and happiness in my life.
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Anti-Histone H2B Antibody (ARG41373)
    Product datasheet [email protected] ARG41373 Package: 100 μl anti-Histone H2B antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes Histone H2B Tested Reactivity Hu, Ms, Rat Tested Application FACS, ICC/IF, IHC-P, IP, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name Histone H2B Antigen Species Human Immunogen Synthetic peptide derived from Human Histone H2B. Conjugation Un-conjugated Alternate Names Histone H2B type 1-K; H2BFAiii; H2BFT; H2B/S; H2B K; H2BK; HIRA-interacting protein 1 Application Instructions Application table Application Dilution FACS 1:50 ICC/IF 1:50 - 1:200 IHC-P 1:50 - 1:200 IP 1:30 WB 1:5000 - 1:20000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 14 kDa Observed Size ~ 14 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.4), 150 mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot www.arigobio.com 1/2 and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol HIST1H2BK Gene Full Name histone cluster 1, H2bk Background Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes.
    [Show full text]
  • Protein Interactions in the Cancer Proteome† Cite This: Mol
    Molecular BioSystems View Article Online PAPER View Journal | View Issue Small-molecule binding sites to explore protein– protein interactions in the cancer proteome† Cite this: Mol. BioSyst., 2016, 12,3067 David Xu,ab Shadia I. Jalal,c George W. Sledge Jr.d and Samy O. Meroueh*aef The Cancer Genome Atlas (TCGA) offers an unprecedented opportunity to identify small-molecule binding sites on proteins with overexpressed mRNA levels that correlate with poor survival. Here, we analyze RNA-seq and clinical data for 10 tumor types to identify genes that are both overexpressed and correlate with patient survival. Protein products of these genes were scanned for binding sites that possess shape and physicochemical properties that can accommodate small-molecule probes or therapeutic agents (druggable). These binding sites were classified as enzyme active sites (ENZ), protein–protein interaction sites (PPI), or other sites whose function is unknown (OTH). Interestingly, the overwhelming majority of binding sites were classified as OTH. We find that ENZ, PPI, and OTH binding sites often occurred on the same structure suggesting that many of these OTH cavities can be used for allosteric modulation of Creative Commons Attribution 3.0 Unported Licence. enzyme activity or protein–protein interactions with small molecules. We discovered several ENZ (PYCR1, QPRT,andHSPA6)andPPI(CASC5, ZBTB32,andCSAD) binding sites on proteins that have been seldom explored in cancer. We also found proteins that have been extensively studied in cancer that have not been previously explored with small molecules that harbor ENZ (PKMYT1, STEAP3,andNNMT) and PPI (HNF4A, MEF2B,andCBX2) binding sites. All binding sites were classified by the signaling pathways to Received 29th March 2016, which the protein that harbors them belongs using KEGG.
    [Show full text]
  • Análise Correlacional Entre a Expressão Dos Fatores De Splicing E a Ocorrência De Splicing Alternativo Em Tecidos Humanos E De Camundongos
    ANÁLISE CORRELACIONAL ENTRE A EXPRESSÃO DOS FATORES DE SPLICING E A OCORRÊNCIA DE SPLICING ALTERNATIVO EM TECIDOS HUMANOS E DE CAMUNDONGOS JULIO CÉSAR NUNES Dissertação apresentada à Fundação Antônio Prudente para a obtenção do título de Mestre em Ciências Área de Concentração: Oncologia Orientador: Dr. Sandro José de Souza São Paulo 2008 Livros Grátis http://www.livrosgratis.com.br Milhares de livros grátis para download. FICHA CATALOGRÁFICA Preparada pela Biblioteca da Fundação Antônio Prudente Nunes, Julio César Análise correlacional entre a expressão dos fatores de splicing e a ocorrência de splicing alternativo em tecidos humanos e de camundongos / Julio César Nunes – São Paulo, 2008. 79p. Dissertação (Mestrado) - Fundação Antônio Prudente. Curso de Pós-Graduação em Ciências - Área de concentração: Oncologia. Orientador: Sandro José Souza Descritores: 1. SPLICING ALTERNATIVO 2. BIOLOGIA MOLECULAR COMPUTACIONAL 3. CÂNCER 4. GENOMICA. AGRADECIMENTOS Agradeço à FAPESP e CAPES pela bolsa de Mestrado. Ao Sandro José de Souza agradeço toda orientação e conhecimento oferecido. Meus especiais agradecimentos ao Pedro Alexandre Favoretto Galante que dedicou atenção a minha formação no processo de Pós-Graduação na Fundação Antônio Prudente, bem como pela sua oficiosa co-orientação ao projeto de pesquisa. À grande família e amigos pela dedicação e incentivo a minha formação acadêmica. À Fundação Antônio Prudente, Hospital do Câncer e Instituto Ludwig de Pesquisa sobre o Câncer dedico os meus nobres agradecimentos finais. RESUMO Nunes JC. Análise correlacional entre a expressão dos fatores de splicing e a ocorrência de splicing alternativo em tecidos humanos e de camundongos. São Paulo; 2007. [Dissertacão de Mestrado - Fundação Antônio Prudente] Splicing alternativo desempenha uma significante função no aumento da complexidade genômica, produzindo um extenso número de mRNA e isoformas protéicas.
    [Show full text]
  • Genomic and Functional Analysis Identifies CRKL As an Oncogene
    Oncogene (2010) 29, 1421–1430 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc ORIGINAL ARTICLE Genomic and functional analysis identifies CRKL as an oncogene amplified in lung cancer YH Kim1,7, KA Kwei1,7, L Girard2, K Salari1,3, J Kao1, M Pacyna-Gengelbach4, P Wang5, T Hernandez-Boussard3, AF Gazdar2, I Petersen6, JD Minna2 and JR Pollack1 1Department of Pathology, Stanford University, Stanford, CA, USA; 2Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, TX, USA; 3Department of Genetics, Stanford University, Stanford, CA, USA; 4Institute of Pathology, University Hospital Charite´, Berlin, Germany; 5Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA and 6Institute of Pathology, Universita¨tsklinikum Jena, Jena, Germany DNA amplifications, leading to the overexpression of related mortality (Jemal et al., 2008). Nearly 80% oncogenes, are a cardinal feature of lung cancer and of lung cancers diagnosed are non-small-cell lung directly contribute to its pathogenesis. To uncover such cancers (NSCLCs), which are classified into three main novel alterations, we performed an array-based compara- histological subtypes: adenocarcinoma, squamous cell tive genomic hybridization survey of 128 non-small-cell carcinoma and large cell carcinoma. Despite the lung cancer cell lines and tumors. Prominent among our advancement of surgical, cytotoxic and radiological findings, we identified recurrent high-level amplification at treatment options over the years, lung cancer therapy cytoband 22q11.21 in 3% of lung cancer specimens, with remains largely ineffective from a clinical standpoint, another 11% of specimens exhibiting low-level gain spanning as evidenced by a low 5-year survival rate (o15%), that locus.
    [Show full text]
  • DGCR6 at the Proximal Part of the Digeorge Critical Region Is Involved in Conotruncal Heart Defects
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Institutional Repository : the EHIME area OPEN Citation: Human Genome Variation (2015) 2, 15004; doi:10.1038/hgv.2015.4 © 2015 The Japan Society of Human Genetics All rights reserved 2054-345X/15 www.nature.com/hgv ARTICLE DGCR6 at the proximal part of the DiGeorge critical region is involved in conotruncal heart defects Wenming Gao1, Takashi Higaki1, Minenori Eguchi-Ishimae1, Hidehiko Iwabuki1, Zhouying Wu1, Eiichi Yamamoto2, Hidemi Takata1, Masaaki Ohta1, Issei Imoto3, Eiichi Ishii1 and Mariko Eguchi1 Cardiac anomaly is one of the hallmarks of DiGeorge syndrome (DGS), observed in approximately 80% of patients. It often shows a characteristic morphology, termed as conotruncal heart defects. In many cases showing only the conotruncal heart defect, deletion of 22q11.2 region cannot be detected by fluorescence in situ hybridization (FISH), which is used to detect deletion in DGS. We investigated the presence of genomic aberrations in six patients with congenital conotruncal heart defects, who show no deletion at 22q11.2 in an initial screening by FISH. In these patients, no abnormalities were identified in the coding region of the TBX1 gene, one of the key genes responsible for the phenotype of DGS. However, when copy number alteration was analyzed by high-resolution array analysis, a small deletion or duplication in the proximal end of DiGeorge critical region was detected in two patients. The affected region contains the DGCR6 and PRODH genes. DGCR6 has been reported to affect the expression of the TBX1 gene. Our results suggest that altered dosage of gene(s) other than TBX1, possibly DGCR6, may also be responsible for the development of conotruncal heart defects observed in patients with DGS and, in particular, in those with stand-alone conotruncal heart defects.
    [Show full text]