Supporting Information:

Figure S1abcd. Supplementary phylogenetic trees. Values at nodes represent support from ML bootstrap pseudoreplicates. (a) Multi-gene ML phylogeny of Tremblaya within Betaproteobacteria inferred from 49 concatenated protein sequences. (b) Zoomed-in Tremblaya ML phylogeny inferred from the 16S-23S rRNA alignment. (c) Multi-gene mealybug ML phylogeny inferred from the 419 concatenated CEGMA protein sequences. (d) ML phylogeny of gammaproteobacterial symbionts inferred from the 16S-23S rRNA alignment. Clade labels A-G were adopted from Thao et al. 2002.

Figure S2ab. Schematic diagrams of insect scaffolds containing HGTs involved in amino acid and B-vitamin metabolism. Insect exons (predicted by GeneMark ES) are color-coded as green rectangles and when in close proximity to HGTs, annotated by their putative functions. Genes of bacterial origin are highlighted in yellow. (a) Genome localization of bioABD, ribAD, lysA, dapF, and tms HGTs confirming that they are present on insect scaffolds. Only the longest scaffold for each HGT is shown as the scaffolds from different mealybug species share gene order. (b) Alignments of M. hirsutus, P. marginatus and F. virgata scaffolds showing cysK acquisition after divergence of Maconellicoccus clade and cysK duplication in F. virgata (also present in P. citri and P. longispinus), and riboflavin transporter duplication in P. marginatus.

Figure S3a-u. Phylogenetic trees for individual HGTs. Values at nodes represent support from ML bootstrap pseudoreplicates. Extremely short inner branches were extended by dashed lines for better legibility.

Table S1ab. Supplementary tables with Tremblaya gene information. (a) Gene order, functional categories from Clusters of Orthologous groups (COG), Enzyme Commission numbers (E.C.), protein products, and gene abbreviations for all Tremblaya genomes. Tremblaya phenacola PAVE inversion is designated by light yellow color, pseudogenes are in red, non-coding RNAs in magenta (tRNAs are not shown), and hypothetical proteins in blue. (b) Raw data to reproduce Figure 3. There are two copies of leuA in TPTPER and two copies of aroDQ in DEMHIR. Only glyS is found in TPPAVE, not glyQ. Legend: 0=missing gene, 1=found on the endosymbiont genome, 2=pseudogene, 3=HGT found on the insect genome, 4=insect gene.

Table S2. Extended assembly metrics for draft mealybug genomes. All values were calculated without endosymbiont and low-coverage contamination contigs. BUSCOs Arthropoda assessments for Acyrthosiphon pisum genome assembly as a reference: C:72% [D:6.1%], F:15%, M:12%.

Table S3. Supplementary table listing insect scaffolds containing horizontally transferred genes. Longest scaffolds for each of the HGT candidates are in bold.

Table S4. Overview of evidence that the HTGs are encoded on the insect genomes. Related to Figures 4 and S3.

Table S5. Tremblaya primers. These primers were used for duplicated ribosomal RNA operons and one more region breaking assemblies of the five Tremblaya princeps genomes. Supplementary Figures 1b)

85 Tremblaya princeps from Paracoccus nothofagicola 94 Tremblaya princeps from Sarococcus comis Tremblaya princeps Tremblaya princeps from Cyphonococcus alpinus 57 93 Tremblaya princeps from Antonina crawii 76 Tremblaya princeps from Antonina pretiosa Tremblaya princeps from Trionymus perrisii 63 Tremblaya princeps from Amonostherium lichtensioides 74 62 Tremblaya princeps from Crisicoccus azaleae 82 51 Tremblaya princeps fromMelanococcus albizziae Tremblaya princeps from Australicoccus grevilleae 100 TPTPER Tremblaya princeps from Nipaecoccus exocarpi Tremblaya princeps from Paracoccus marginatus 0.95

TPPMAR 97 1a) Tremblaya princeps from Planococcus citri 100 50 0.99 TPPLON 99 Alcaligenaceae (10) Tremblaya princeps from Planococcus ficus 1 0.75 Tremblaya princeps from Planococcus kraunhiae Tremblaya princeps TPPCIT Tremblaya princeps from Erium globosum 0.73 73 Tremblaya princeps from Pseudococcus calceolariae 1 55 Tremblaya princeps from Dysmicoccus boninsis TPFVIR Tremblaya princeps from Pseudococcus longispinus (Gatehouse et al., 2012) 100 Tremblaya princeps from Pseudococcus longispinus Tremblaya princeps from Dysmicoccus neobrevipes 1 100 TPMHIR 99 Tremblaya princeps from Dysmicoccus neobrevipes Tremblaya princeps from Dysmicoccus brevipes 100 Tremblaya princeps from Pseudococcus viburni (Thao et al., 2002) TPPAVE 0.91 Tremblaya princeps from Pseudococcus viburni (Gatehouse et al., 2012) 100 51 Tremblaya princeps from Pseudococcus longispinus (Thao et al., 2002) Tremblaya phenacola 98 Tremblaya princeps from Pseudococcus longispinus (Munson et al., 1992) Tremblaya princeps from Pseudococcus comstocki 0.92 Tremblaya princeps from Vryburgia brevicruris 99 Tremblaya princeps from Vryburgia amaryllidis 56 Tremblaya princeps from Ferrisia sp. 100 Tremblaya princeps from Ferrisia malvastra Tremblaya princeps from Ferrisia virgata 100 Tremblaya princeps from Anisococcus ephedrae

0.89 100 Tremblaya princeps from Maconellicoccus hirsutus Tremblaya princeps from Maconellicoccus hirsutus Lautropia mirabilis ATCC_51599 (Burkholderiaceae) 100 Tremblaya princeps from Maconellicoccus australiensis Tremblaya phenacola from Phenacoccus solani clone PG24 0.72 99 Tremblaya phenacola from Phenacoccus solani clone PG67 Tremblaya phenacola Sutterella wadsworthensis 3_1_45B (Sutterellaceae) 96 Tremblaya phenacola from Phenacoccus solenopsis clone ctn01 Tremblaya phenacola from Phenacoccus manihoti clone NH112 100 1 100 Tremblaya phenacola from Phenacoccus peruvianus Tremblaya phenacola from Phenacoccus madeirensis clone PG21 1 Parasutterella excrementihominis YIT_11859 (Sutterellaceae) 100 Tremblaya phenacola from Phenacoccus madeirensis 50 Tremblaya phenacola from Heterococcus nudus clone NH20 100 Tremblaya phenacola from Phenacoccus sp. clone NH18 56 Tremblaya phenacola from Phenacoccus avenae 1 1 Thiomonas (2) Tremblaya phenacola from Heliococcus clemente clone PG74 100 Tremblaya phenacola from Phenacoccus aceris clone NH19 1 Tremblaya phenacola from Phenacoccus azaleae 96 50 Tremblaya phenacola from Mirococcus sp. clone NH16 1 Comamonadaceae (23) Tremblaya phenacola from Oxyacanthus sp. clone NH12 0.71 80 Tremblaya phenacola from Peliococcus turanicus clone NH17 Oxalobacteraceae (6) 0.05 1 0.98 1 Burkholderiaceae (83) 1

Limnobacter (Burkholderiaceae) Rhodocyclaceae (6) 1d) Endosymbiont of Crisicoccus azaleae clade C 1 52 99 Endosymbiont of Antonina pretiosa Gallionellaceae (2) 1 Endosymbiont of Antonina crawii 1 51 Nitrosomonadaceae (5) Endosymbiont of Australicoccus grevilleae 1 98 1 81 Endosymbiont of Melanococcus albizziae Hydrogenophilaceae (1) Endosymbiont of Amonostherium lichtensioides Methylophilaceae (7) 1 Hoaglandella endobia TPER Neisseriaceae (54) 97 Moranella endobia PCIT 1 clade E 99 Endosymbiont of Planococcus ficus 0.6 Endosymbiont of Planococcus kraunhiae Mikella endobia PMAR clade G Endosymbiont of Cyphonococcus_alpinus clade D 1c) 99 Endosymbiont of Paracoccus nothofagicola Gullanella endobia FVIR clade B Trionymus perrisii 100 Endosymbiont of Dysmicoccus brevipes 100 79 Endosymbiont of Dysmicoccus neobrevipes 97 Paracoccus marginatus Endosymbiont of Pseudococcus comstocki 97 Endosymbiont of Erium globosum 100 cladeA Pseudococcus longispinus Endosymbiont of Vryburgia amaryllidis Endosymbiont of Ferrisia virgata clone P28 (Rosenblueth et al. 2012) 100 Doolittlea endobia MHIR clade F Planococcus citri Endosymbiont 1 of Pseudococcus longispinus 100 Endosymbiont of Pseudococcus longispinus (Lopez-Madrigal et al. 2014) Ferrisia virgata Endosymbiont 2 of Pseudococcus longispinus 99 Endosymbiont of Pseudococcus longispinus clone P10 (Rosenblueth et al. 2012) Maconellicoccus hirsutus Endosymbiont of Pseudococcus longispinus (Duron et al. 2008) 0.02 0.1 2a)

tyrosine-protein phosphatase lysA (FVIR) non-receptor type 4 WD repeat-containing protein 24-like hormone receptor aromatic-L-amino-acid (secretin family) (tyrosine) decarboxylase

lysA Hypoxia-inducible bioA (MHIR) DNA polymerase delta Nudix hydrolase-like factor 1-alpha bioB (MHIR) bioD (MHIR) tms (MHIR) tmstms tms ribosomal protein L23A catalytic subunit protein inhibitor hypothetical protein uncharacterized protein, cathepsin B-like bioA cytokine receptor-like

bioB bioD

85/88 kDa calcium- Eukaryotic initiation splicing factor 3B subunit 2 like protein hypothetical protein protein ariadne-2 hypothetical protein independent phospholipase A2 factor 4A-III like

ribD (FVIR) facilitated trehalose ribA (MHIR) ribD dapF (MHIR) transporter Tret1-like

ribA dapF protein singed hypothetical protein probable peroxisomal acyl- coenzyme A oxidase 1 SET and MYND domain- ribonuclease Z, mitochondrial isoform hypothetical AAA-ATPase protein like protein containing protein

2b)

histone H2B-like riboflavin transporter histone H3-like histone H2A-like

cAMP-dependent protein kinase R2 histone H4-like histone H1-like Maconellicoccus hirsutus 34,593 bp

cysK 1

Paracoccus marginatus 27,801 bp

histone H3-like histone H2A-like

cysK 2 cysK 1 riboflavin transporter cAMP-dependent protein kinase R2 histone H2B-like Ferrisia virgata 43,541 bp 3a) bioA (Alphaproteobacteria or Bacteroidetes)

1 gi 916972895 ref WP 051579607.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Neorickettsia helminthoeca] 1 gi 506296687 ref WP 015816462.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Neorickettsia risticii] gi 499771270 ref WP 011452004.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Neorickettsia sennetsu] 0.54 gi 503716903 ref WP 013950979.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Candidatus Midichloria mitochondrii]

1 gi 518061146 ref WP 019231354.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Rickettsiaceae bacterium Os18] 1 gi 751577272 ref WP 041045996.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Wolbachia endosymbiont of Cimex lectularius] 0.84 gi 656322965 dbj BAP01370.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Wolbachia sp. KTCN] 1 gi 736565716 ref WP 034577513.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Cardinium endosymbiont of Bemisia tabaci] gi 504747611 ref WP 014934713.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Cardinium endosymbiont of Encarsia pergandiella] Maconellicoccus hirsutus

1 0.82 Trionymus perrisii Paracoccus marginatus 0.85 Pseudococcus longispinus Ferrisia virgata gi 526124647 gb AGR65713.1 adenosylmethionine-8-amino-7-oxononanoate transaminase [Planococcus citri]

1 gi 388538093 gb AFK63281.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Advenella kashmirensis WT001] 1gi 575431086 gb AHG63392.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Advenella mimigardefordensis DPN7] 1 gi 754693587 ref WP 042071063.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Advenella mimigardefordensis] gi 566136903 ref WP 024007393.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Advenella kashmirensis]

0.88 gi 499845776 ref WP 011526510.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Lawsonia intracellularis] 1gi 242001124 ref XP 002435205.1 ornithine aminotransferase putative [Ixodes scapularis] 0.55 gi 241072390 ref XP 002408641.1 ornithine aminotransferase putative [Ixodes scapularis] 0.69 gi 546194982 ref WP 021827225.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Holospora obtusa] gi 617757961 dbj GAJ46112.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Holospora elegans E1] gi 932875623 dbj BAS55675.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Leptolyngbya boryana IAM M-101] 1 0.56 gi 493680825 ref WP 006631009.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Microcoleus vaginatus] 1 gi 748141372 ref WP 039716586.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Scytonema millei] 1 gi 504967366 ref WP 015154468.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Chroococcidiopsis thermalis] 0.9 gi 491146325 ref WP 005004725.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Nitrococcus mobilis] 0.52 gi 516842742 ref WP 018126565.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Balneola vulgaris] gi 493384589 ref WP 006340832.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Parachlamydia acanthamoebae] 1 gi 737293733 ref WP 035276865.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Desulforegula conservatrix]

0.87 gi 692232390 ref WP 032112762.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Candidatus Paracaedibacter symbiosus] 1 gi 497986881 ref WP 010301037.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Candidatus Odyssella thessalonicensis] gi 740677320 ref WP 038462609.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Candidatus Paracaedibacter acanthamoebae]

0.53 1 gi 522082591 ref WP 020593800.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Kiloniella laminariae] 0.51 gi 836612034 ref WP 047763710.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Kiloniella spongiae] gi 497226070 ref WP 009540332.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Caenispirillum salinarum] 0.78 0.98 gi 655040618 ref WP 028489358.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Thiothrix lacustris] gi 522047088 ref WP 020558297.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Thiothrix flexilis] 0.99 gi 736633062 ref WP 034641026.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Desulfovibrio inopinatus] gi 652937170 ref WP 027190769.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Desulfovibrio putealis]

1 gi 503965927 ref WP 014199921.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Azospirillum brasilense] 0.7 gi 749314066 ref WP 040138151.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Azospirillum brasilense] gi 737713726 ref WP 035682572.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Azospirillum brasilense] gi 527032920 ref WP 020880971.1 adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Desulfovibrio sp. X2] 1 1gi 566554923 emb CDK98142.1 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Magnetospirillum gryphiswaldense MSR-1 v2] gi 144898116 emb CAM74980.1 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase [Magnetospirillum gryphiswaldense MSR-1] 0.98 0.73 gi 497554313 ref WP 009868511.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Magnetospirillum magnetotacticum] 1 gi 499704408 ref WP 011385142.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Magnetospirillum magneticum] gi 495892868 ref WP 008617447.1 adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA [Magnetospirillum sp. SO-1] 0.31 3b) bioD (Alphaproteobacteria or Bacteroidetes)

gi 518061147 ref WP 019231355.1 dethiobiotin synthase [Rickettsiaceae bacterium Os18] gi 740774417 ref WP 038559701.1 ATP-dependent dethiobiotin synthetase BioD [Neorickettsia helminthoeca] 0.71 0.57 gi 546194632 ref WP 021827133.1 dethiobiotin synthase [Holospora obtusa] 1gi 737572463 ref WP 035544382.1 ATP-dependent dethiobiotin synthetase BioD [Holospora elegans] gi 493334245 ref WP 006291305.1 dethiobiotin synthase [Holospora undulata] Maconellicoccus hirsutus Pseudococcus longispinus 1 0.54 Trionymus perrisii 0.93 0.74 gi 526124643 gb AGR65711.1 dethiobiotin synthase [Planococcus citri] 0.6 Paracoccus marginatus Ferrisia virgata 1 gi 504747610 ref WP 014934712.1 ATP-dependent dethiobiotin synthetase BioD [Cardinium endosymbiont of Encarsia pergandiella] 0.92 gi 736565717 ref WP 034577514.1 ATP-dependent dethiobiotin synthetase BioD [Cardinium endosymbiont of Bemisia tabaci] 1 gi 656322966 dbj BAP01371.1 dethiobiotin synthetase [Wolbachia sp. KTCN] gi 751577274 ref WP 041045998.1 ATP-dependent dethiobiotin synthetase BioD [Wolbachia endosymbiont of Cimex lectularius] 0.79 gi 239920770 gb EER20796.1 dethiobiotin synthase [Rickettsia endosymbiont of Ixodes scapularis] gi 499845775 ref WP 011526509.1 ATP-dependent dethiobiotin synthetase BioD [Lawsonia intracellularis] gi 503716582 ref WP 013950658.1 ATP-dependent dethiobiotin synthetase BioD [Candidatus Midichloria mitochondrii] gi 692232391 ref WP 032112763.1 dethiobiotin synthase [Candidatus Paracaedibacter symbiosus] 1 gi 771603210 ref WP 045215105.1 dethiobiotin synthase [Desulfonatronovibrio magnus] gi 655128646 ref WP 028575744.1 dethiobiotin synthase [Desulfonatronovibrio hydrogenovorans] 1gi 575431085 gb AHG63391.1 ATP-dependent dethiobiotin synthase [Advenella mimigardefordensis DPN7] 1 gi 918204969 ref WP 052342288.1 dethiobiotin synthase [Advenella mimigardefordensis] gi 566136904 ref WP 024007394.1 ATP-dependent dethiobiotin synthetase BioD [Advenella kashmirensis] gi 495525031 ref WP 008249676.1 dethiobiotin synthase [Limnobacter sp. MED105] gi 527032922 ref WP 020880972.1 dethiobiotin synthase [Desulfovibrio sp. X2] 0.99 gi 544699789 ref WP 021130903.1 dethiobiotin synthase [Phaeospirillum fulvum] 0.84 gi 488815883 ref WP 002728289.1 dethiobiotin synthase [Phaeospirillum molischianum] gi 495892859 ref WP 008617438.1 dethiobiotin synthase [Magnetospirillum sp. SO-1] gi 499704407 ref WP 011385141.1 ATP-dependent dethiobiotin synthetase BioD [Magnetospirillum magneticum] 0.62 gi 497554312 ref WP 009868510.1 dethiobiotin synthase [Magnetospirillum magnetotacticum]

1gi 144898115 emb CAM74979.1 Dethiobiotin synthetase [Magnetospirillum gryphiswaldense MSR-1] 0.75 gi 753896771 ref WP 041634065.1 dethiobiotin synthase [Magnetospirillum gryphiswaldense] gi 566554924 emb CDK98143.1 Dethiobiotin synthetase [Magnetospirillum gryphiswaldense MSR-1 v2] gi 938917316 ref WP 054700020.1 dethiobiotin synthase [Desulfosarcina cetonica] gi 779889624 ref WP 045366455.1 dethiobiotin synthase [Methyloceanibacter caenitepidi] 0.33 3c) bioB (Alphaproteobacteria or Bacteroidetes) gi 943608023 ref WP 055437975.1 biotin synthase [Idiomarina woesei] gi 738598895 ref WP 036509367.1 biotin synthase [Nitrincola sp. AK23]

1 gi 644550356 ref WP 025330724.1 biotin synthase [Snodgrassella alvi] gi 644447912 ref WP 025316829.1 biotin synthase [Gilliamella apicola] gi 916620081 ref WP 051227172.1 biotin synthase [Oceanospirillum beijerinckii]

1 gi 517213588 ref WP 018402406.1 biotin synthase [Marinobacter lipolyticus] 0.91 gi 494592054 ref WP 007350647.1 biotin synthase [Marinobacter sp. ELB17]

0.52 gi 868621790 ref WP 048495771.1 biotin synthase [Marinobacter subterrani] 1 0.98 gi 921166926 ref WP 053112700.1 biotin synthase [Marinobacter sp. CP1] gi 495445389 ref WP 008170083.1 MULTISPECIES biotin synthase [Marinobacter] gi 738173872 ref WP 036130613.1 biotin synthase [Marinobacter sp. AK21] gi 501086056 ref WP 012136337.1 biotin synthase [Marinobacter lipolyticus]

0.99 gi 953788550 gb KRW81982.1 biotin synthase [Marinobacter sp. P4B1] 0.69 gi 552350646 ref WP 022990705.1 biotin synthase [Marinobacter sp. ES-1] 0.62 gi 954180567 ref WP 058092057.1 biotin synthase [Marinobacter sp. LQ44] gi 500110196 ref WP 011786201.1 biotin synthase [Marinobacter hydrocarbonoclasticus]

1 gi 494899969 ref WP 007626014.1 biotin synthase BioB [Paraglaciecola arctica] 0.83 gi 494912517 ref WP 007638556.1 biotin synthase BioB [Paraglaciecola psychrophila] 0.98 gi 656326280 ref WP 029257333.1 biotin synthase [Glaciecola sp. HTCC2999] gi 651234439 ref WP 026374518.1 biotin synthase [Aestuariibacter salexigens]

0.76 gi 540255230 gb ERG17934.1 biotin synthase [Pseudoalteromonas citrea DSM 8771]

0.76 gi 739097537 ref WP 036968319.1 biotin synthase [Pseudoalteromonas lipolytica] 1 0.86 gi 940385934 ref WP 054980704.1 biotin synthase [Pseudoalteromonas sp. P1-9] 0.8 gi 498245905 ref WP 010560061.1 biotin synthase [Pseudoalteromonas spongiae] gi 740856263 ref WP 038641515.1 biotin synthase [Pseudoalteromonas sp. OCN003] 0.87 gi 766747787 ref WP 044832756.1 biotin synthase [Thalassomonas actiniarum] gi 494247979 ref WP 007146767.1 biotin synthase [Methylophaga aminisulfidivorans] gi 738606995 ref WP 036517400.1 biotin synthase [Nevskia soli] gi 750089546 ref WP 040394230.1 biotin synthase [Azoarcus toluclasticus]

1 gi 546197118 ref WP 021828078.1 hypothetical protein [Holospora obtusa] 1gi 737573655 ref WP 035545437.1 biotin synthase [Holospora elegans] gi 584595921 ref WP 024161357.1 biotin synthase [Holospora undulata] gi 269308637 gb ACZ34281.1 biotin synthase [Heterodera glycines] gi 740775300 ref WP 038560584.1 biotin synthase [Neorickettsia helminthoeca]

0.87 gi 648290591 ref WP 026071740.1 biotin synthase [Rickettsiaceae bacterium Os18] Trionymus perrisii gi 526124641 gb AGR65710.1 biotin synthase [Planococcus citri] 1 0.64 Paracoccus marginatus

0.87 Pseudococcus longispinus Ferrisia virgata Maconellicoccus hirsutus

1gi 522682237 dbj GAD20115.1 biotin synthase [Helicobacter fennelliae MRY12-0050] gi 916797624 ref WP 051404680.1 biotin synthase [Helicobacter fennelliae] gi 740678162 ref WP 038463451.1 biotin synthase [Candidatus Paracaedibacter acanthamoebae] gi 503716587 ref WP 013950663.1 biotin synthase [Candidatus Midichloria mitochondrii]

1gi 94731113 emb CAJ54475.1 biotin synthase [Lawsonia intracellularis PHE/MN1-00] 0.71 gi 505166632 ref WP 015353734.1 biotin synthase [Lawsonia intracellularis] gi 239920774 gb EER20800.1 biotin synthase [Rickettsia endosymbiont of Ixodes scapularis]

0.99 gi 796990396 ref WP 045812523.1 biotin synthase [Rickettsia hoogstraalii] 1 gi 749657294 ref WP 040257475.1 biotin synthase [Rickettsia hoogstraalii] gi 499590090 ref WP 011270859.1 biotin synthase [Rickettsia felis]

0.96 gi 504747606 ref WP 014934708.1 biotin synthase [Cardinium endosymbiont of Encarsia pergandiella] 1 gi 751577279 ref WP 041046003.1 biotin synthase [Wolbachia endosymbiont of Cimex lectularius] gi 656322968 dbj BAP01373.1 biotin synthase [Wolbachia sp. KTCN]

0.27 3d) ribA (Gammaproteobacteria) 1 gi 557045329 dbj GAD88768.1 GTP cyclohydrolase II [Vibrio halioticoli NBRC 102217] gi 543451084 dbj GAD79174.1 GTP cyclohydrolase II [Vibrio ezurae NBRC 102218] gi 821246804 gb KKZ09310.1 GTP cyclohydrolase [Vibrio parahaemolyticus]

1 0.51 gi 502350729 ref WP 012769454.1 GTP cyclohydrolase II [Dickeya chrysanthemi] >gi 247537963 gb ACT06584.1 GTP cyclohydrolase II [Dickeya zeae Ech1591] gi 515509233 ref WP 016942487.1 GTP cyclohydrolase II [Dickeya zeae] >gi 744786423 gb AJC66680.1 GTP cyclohydrolase II [Dickeya zeae EC1] gi 291089958 gb EFE22519.1 GTP cyclohydrolase II [Edwardsiella tarda ATCC 23685] 0.76 gi 253781008 emb CAQ84170.1 gtp cyclohydrolase-2 [Photorhabdus asymbiotica] gi 36785757 emb CAE14805.1 GTP cyclohydrolase II [Photorhabdus luminescens subsp. laumondii TTO1] 0.9 gi 575853937 emb CDL79471.1 GTP cyclohydrolase-2 [Xenorhabdus cabanillasii JM26] gi 740355808 ref WP 038192090.1 GTP cyclohydrolase II [Xenorhabdus bovienii] gi 455420982 gb AGG31312.1 GTP cyclohydrolase II [Morganella morganii subsp. morganii KT] Maconellicoccus hirsutus 0.58 Trionymus perrisii Paracoccus marginatus

0.68 0.92 gi 526124639 gb AGR65709.1 GTP cyclohydrolase [Planococcus citri] Pseudococcus longispinus Ferrisia virgata 0.54 gi 857778277 emb CRL59224.1 GTP cyclohydrolase-2 [Proteus vulgaris] 1 0.67 gi 831646153 gb KLU19219.1 GTP cyclohydrolase-2 [Proteus mirabilis] 0.75 gi 225201026 gb EEG83380.1 GTP cyclohydrolase II [Proteus penneri ATCC 35198] gi 559231466 ref WP 023582272.1 GTP cyclohydrolase II [Proteus hauseri] gi 928453218 gb KPD02757.1 GTP cyclohydrolase II [Moellerella wisconsensis ATCC 35017] 0.58 gi 188021483 gb EDU59523.1 GTP cyclohydrolase II [Providencia stuartii ATCC 25827] gi 291315174 gb EFE55627.1 GTP cyclohydrolase II [Providencia rettgeri DSM 1131] 0.99 gi 692293985 ref WP 032115007.1 GTP cyclohydrolase II [Arsenophonus endosymbiont of Nilaparvata lugens] gi 284007506 emb CBA72995.1 GTP cyclohydrolase II [Arsenophonus nasoniae] gi 573497563 gb ETS98115.1 GTP cyclohydrolase II [Providencia alcalifaciens PAL-3] 1.27

3e) tms (Gammaproteobacteria or Betaproteobacteria)

gi 496342304 ref WP 009051482.1 hypothetical protein [Pseudomonas chlororaphis] Pseudococcus longispinus (NODE 5435) 0.55 Pseudococcus longispinus (NODE 25746) 1 Pseudococcus longispinus (NODE 13050) Pseudococcus longispinus (NODE 3006)

1 Maconellicoccus hirsutus (NODE 1166) tms3 1 Maconellicoccus hirsutus (NODE 1166) tms2 0.75 1 Maconellicoccus hirsutus (NODE 1166) tms1 Maconellicoccus hirsutus (NODE 5474)

0.95 Paracoccus marginatus (NODE 8338) 0.77 0.82 Paracoccus marginatus (NODE 12227) 0.75 Paracoccus marginatus (NODE 4174) Trionymus perrisii (NODE 19614) Trionymus perrisii (NODE 34438) Trionymus perrisii (NODE 6297)

1 Planococcus citri (NODE 6634) 0.5 Planococcus citri (NODE 7749) Planococcus citri (NODE 11115) 1gi 739126968 ref WP 036996436.1 hypothetical protein [Pseudomonas sp. P482] 0.95 gi 497909163 ref WP 010223319.1 tryptophan 2-monooxygenase oxidoreductase [Pseudomonas sp. HYS] 1 0.96 gi 820727196 gb KKX27575.1 hypothetical protein YH64 29010 [Achromobacter sp. LC458] gi 860393317 ref WP 048409368.1 hypothetical protein [Chromobacterium sp. LK1] 0.93 gi 530705206 ref WP 020957509.1 tryptophan 2-monooxygenase [Ralstonia solanacearum] 0.99 gi 83726901 gb EAP74027.1 L-phenylalanine oxidase [Ralstonia solanacearum UW551] gi 489366903 ref WP 003273740.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum] 0.99 gi 378964497 emb CCF97866.1 putative tryptophan 2-monooxygenase oxidoreductase protein [Ralstonia solanacearum K60-1] 1 0.67 gi 950505338 ref WP 057392134.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum] 0.76 0.75 gi 763063765 ref WP 043945517.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum] gi 299070302 emb CBJ41594.1 putative tryptophan 2-monooxygenase oxidoreductase protein [Ralstonia solanacearum CFBP2957] 0.53 gi 334194445 gb AEG67630.1 tryptophan 2-monooxygenase protein [Ralstonia solanacearum Po82] 0.78 gi 299065292 emb CBJ36460.1 putative tryptophan 2-monooxygenase oxidoreductase protein [Ralstonia solanacearum CMR15] gi 959208589 emb CUV15351.1 Phenylalanine 2-monooxygenase precursor [Ralstonia solanacearum] 0.99 gi 557809714 gb ESS50505.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum SD54] gi 959221415 emb CUV28215.1 Phenylalanine 2-monooxygenase precursor [Ralstonia solanacearum]

0.85 gi 655470873 ref WP 028853789.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum] 0.52 gi 518548773 ref WP 019718980.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum] gi 959212202 emb CUV18971.1 Phenylalanine 2-monooxygenase precursor [Ralstonia solanacearum] gi 959214826 emb CUV21609.1 Phenylalanine 2-monooxygenase precursor [Ralstonia solanacearum] 0.57 0.51 gi 916490428 gb AKZ25282.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum] 0.72 1 gi 499312265 ref WP 011003040.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum] gi 469775494 gb AGH85684.1 hypothetical protein F504 3173 [Ralstonia solanacearum FQY 4] gi 655479188 ref WP 028861105.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum]

1gi 502976112 ref WP 013211088.1 tryptophan 2-monooxygenase oxidoreductase [Ralstonia solanacearum] 0.79 gi 344172855 emb CCA85512.1 putative tryptophan 2-monooxygenase oxidoreductase protein [Ralstonia syzygii R24] gi 344168333 emb CCA80610.1 putative tryptophan 2-monooxygenase oxidoreductase protein [blood disease bacterium R229] gi 850368079 ref WP 048027226.1 MULTISPECIES tryptophan 2-monooxygenase oxidoreductase [Burkholderia] 0.93

0.57 gi 544728286 ref WP 021158118.1 hypothetical protein [Burkholderia sp. AU4i] 0.99 gi 685639864 gb AIO27027.1 pro-enzyme of L-phenylalanine oxidase [Burkholderia cepacia ATCC 25416] 1gi 183448182 pdb 2YR4 B Chain B Crystal Structure Of L-Phenylalanine Oxiase From Psuedomonas Sp. P-501 gi 54649976 dbj BAD66877.1 pro-enzyme of L-phenylalanine oxidase [Pseudomonas sp. P-501] 0.93 3f) cysK (Gammaproteobacteria)

0.99 gi 36784778 emb CAE13688.1 cysteine synthase A O-acetylserine sulfhydrolase A [Photorhabdus luminescens subsp. laumondii TTO1] 0.52 gi 253780336 emb CAQ83497.1 cysteine synthase [Photorhabdus asymbiotica] 0.89 gi 544914116 ref WP 021323874.1 cysteine synthase [Photorhabdus temperata] 0.89 gi 225203686 gb EEG86040.1 cysteine synthase A [Proteus penneri ATCC 35198] 1 gi 685171912 gb KGA59569.1 cysteine synthase A [Proteus vulgaris] gi 194683169 emb CAR43794.1 cysteine synthase A [Proteus mirabilis HI4320]

1 gi 386906937 gb EIJ71658.1 cysteine synthase A [Pasteurella bettyae CCUG 2042] 0.92 gi 260633066 gb EEX51231.1 cysteine synthase A [Pasteurella dagmatis ATCC 43325] gi 684176773 gb AIN47955.1 cysteine synthase A [Pasteurella multocida] gi 490860741 ref WP 004722783.1 cysteine synthase A [Yersinia ruckeri] gi 505734634 ref WP 015696317.1 cysteine synthase A [Rahnella aquatilis] gi 910783862 ref WP 050088799.1 cysteine synthase [Yersinia intermedia] 0.84 gi 727193243 ref WP 033654991.1 cysteine synthase [Serratia marcescens] gi 493760973 ref WP 006709687.1 cysteine synthase A [Serratia symbiotica] gi 647475704 ref WP 025800770.1 cysteine synthase [Hafnia alvei] 1 gi 803442530 gb AKB07506.1 cysteine synthase A [Vibrio cholerae] gi 543443450 dbj GAD65777.1 cysteine synthase A [Vibrio proteolyticus NBRC 13287] 0.75 gi 503081740 ref WP 013316621.1 cysteine synthase A [Dickeya dadantii] 0.88 gi 748744153 ref WP 040002269.1 cysteine synthase [Dickeya chrysanthemi] 0.75 gi 746308715 ref WP 039355618.1 cysteine synthase [Pectobacterium carotovorum] gi 873947629 ref WP 048636055.1 cysteine synthase [Brenneria goodwinii] Ferrisia virgata (NODE 1251) 0.6 1 Pseudococcus longispinus (NODE 28193)

0.56 1 Planococcus citri (NODE 3332) Planococcus citri (NODE 1576) 0.58 Trionymus perrisii Paracoccus marginatus 0.89 Planococcus citri (NODE 5169) 0.81 Pseudococcus longispinus (NODE 6319) Ferrisia virgata (NODE 1251)

1 gi 499730790 ref WP 011411524.1 cysteine synthase A [Sodalis glossinidius] 0.9 gi 645050162 ref WP 025421443.1 cysteine synthase [Sodalis praecaptivus] gi 643659550 ref WP 025246100.1 cysteine synthase [Candidatus Sodalis pierantonius] gi 503275330 ref WP 013509991.1 cysteine synthase A [Pantoea sp. At-9b] gi 891168647 ref WP 048912384.1 cysteine synthase [bacteria symbiont BFo2 of Frankliniella occidentalis] gi 740839617 ref WP 038624900.1 cysteine synthase [Pantoea sp. PSNIH2] gi 501911727 ref WP 012667484.1 cysteine synthase A [Erwinia pyrifoliae] gi 891172329 ref WP 048915268.1 cysteine synthase [bacteria symbiont BFo1 of Frankliniella occidentalis] gi 736941278 ref WP 034938255.1 cysteine synthase [Erwinia mallotivora] gi 502968313 ref WP 013203289.1 cysteine synthase A [Erwinia billingiae] gi 671536725 ref WP 031520445.1 cysteine synthase [Cronobacter sp. 1383] gi 906283181 emb CTQ13712.1 cysteine synthase A O-acetylserine sulfhydrolase A subunit [Klebsiella variicola] gi 640682155 ref WP 025106638.1 cysteine synthase [Klebsiella oxytoca] 0.81 gi 760374565 ref WP 043864794.1 cysteine synthase [Enterobacter aerogenes] gi 829950321 ref WP 047369359.1 cysteine synthase [Kluyvera intermedia] gi 823280854 ref WP 047037084.1 cysteine synthase [Enterobacter aerogenes] 0.39 gi 912570576 ref WP 050190242.1 cysteine synthase [Salmonella enterica] gi 501080735 ref WP 012131369.1 cysteine synthase A [Citrobacter koseri] gi 745763578 ref WP 039061632.1 cysteine synthase [Shigella boydii] 0.18

3g) ribD (Alphaproteobacteria)

gi 740170095 ref WP 038012945.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Terasakiella pusilla] 1 gi 407207772 gb EKE77703.1 riboflavin biosynthesis protein ribD [Oceanibaculum indicum P24] 0.75 1gi 759960217 ref WP 043644150.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Caenispirillum salinarum] gi 425882916 gb EKV31595.1 Diaminohydroxyphosphoribosylaminopyrimidine deaminase [Caenispirillum salinarum AK4] 1 gi 504013259 ref WP 014247253.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Azospirillum lipoferum] gi 780541287 ref WP 045582355.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Azospirillum thiophilum] gi 528192294 gb EPY02582.1 riboflavin biosynthesis protein ribD [Phaeospirillum fulvum MGU-K5] gi 82946281 dbj BAE51145.1 Riboflavin biosynthesis protein ribD [Magnetospirillum magneticum AMB-1] 1gi 144897824 emb CAM74688.1 Riboflavin biosynthesis protein [Magnetospirillum gryphiswaldense MSR-1] gi 566555167 emb CDK98386.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase N-terminal 5-amino-6- 5-phosphoribosylamino uracil reductase [Magnetospirillum gryphiswaldense MSR-1 v2] gi 795027167 ref XP 011862192.1 PREDICTED riboflavin biosynthesis protein PYRD chloroplastic-like [Vollenhovia emeryi] 0.85

1gi 505402060 ref WP 015589162.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Wolbachia endosymbiont of Drosophila simulans] 0.65 gi 740415784 ref WP 038248912.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Wolbachia endosymbiont of Glossina morsitans morsitans] 0.68 gi 740363295 ref WP 038198976.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Wolbachia pipientis] 0.87 gi 499265386 ref WP 010962779.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Wolbachia endosymbiont of Drosophila melanogaster] 0.81 gi 499575445 ref WP 011256228.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Wolbachia endosymbiont of Brugia malayi] 0.55 gi 751577125 ref WP 041045850.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Wolbachia endosymbiont of Cimex lectularius] 0.71 gi 917750620 ref WP 052264794.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Wolbachia endosymbiont of Operophtera brumata] 1 gi 516101357 ref WP 017531937.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Wolbachia endosymbiont of Diaphorina citri] 0.92 Trionymus perrisii 0.58 Paracoccus marginatus Pseudococcus longispinus

0.96 Ferrisia virgata gi 526124637 gb AGR65708.1 fused deaminase reductase [Planococcus citri] 1 Maconellicoccus hirsutus 1 gi 58416446 emb CAI27559.1 Riboflavin biosynthesis protein ribD [Ehrlichia ruminantium str. Gardel] gi 58417401 emb CAI26605.1 Riboflavin biosynthesis protein ribD [Ehrlichia ruminantium str. Welgevonden] 1 1 gi 499623507 ref WP 011304241.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Ehrlichia canis]

0.74 gi 771517869 ref WP 045170971.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Ehrlichia mineirensis] 0.92 gi 763337173 ref WP 044195501.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Ehrlichia sp. HF] 1 0.75 gi 568197380 ref WP 024071744.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Ehrlichia muris] gi 492856181 ref WP 006010135.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Ehrlichia chaffeensis]

0.6 gi 796978244 ref WP 045809008.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Candidatus Neoehrlichia lotoris] 1 gi 788118172 gb KJV86315.1 riboflavin biosynthesis protein RibD [Anaplasma phagocytophilum str. ApNYW] 1 gi 502643842 ref WP 012880236.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Anaplasma centrale] gi 737022334 ref WP 035017713.1 bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6- 5-phosphoribosylamino uracil reductase [Anaplasma marginale] 0.35 3h) panC (Betaproteobacteria) gi 827201756 ref WP 047193969.1 pantoate--beta-alanine ligase [[Polyangium] brachysporum] 1 0.61 gi 489142153 ref WP 003051920.1 pantoate--beta-alanine ligase [Comamonas testosteroni] 1 gi 947399934 ref WP 056065890.1 pantoate--beta-alanine ligase [Acidovorax sp. Root402] gi 947851802 ref WP 056512520.1 pantoate--beta-alanine ligase [Variovorax sp. Root411] gi 910234820 ref WP 050039949.1 pantoate--beta-alanine ligase [Burkholderia pseudomallei] gi 746159117 ref WP 039219615.1 pantoate--beta-alanine ligase [Burkholderia multivorans]

0.51 Ferrisia virgata 0.81 0.8 gi 749304827 ref WP 040128980.1 pantoate--beta-alanine ligase [Burkholderia cenocepacia] gi 952199754 ref WP 057926209.1 pantoate--beta-alanine ligase [Burkholderia ambifaria] gi 736004842 ref WP 034178759.1 pantoate--beta-alanine ligase [Burkholderia pyrrocinia] 0.72 0.96 gi 499672157 ref WP 011352891.1 pantoate--beta-alanine ligase [Burkholderia lata] gi 817349723 ref WP 046544636.1 pantoate--beta-alanine ligase [Burkholderia contaminans] gi 738082412 ref WP 036041134.1 pantoate--beta-alanine ligase [Burkholderia gladioli] gi 861558946 gb KMQ80434.1 Pantoate--beta-alanine ligase [Candidatus Burkholderia pumila] gi 654860754 ref WP 028313075.1 pantoate--beta-alanine ligase [Derxia gummosa]

1 gi 746355342 ref WP 039400011.1 pantoate--beta-alanine ligase [Pandoraea sputorum] gi 515804295 ref WP 017235049.1 pantoate--beta-alanine ligase [Pandoraea sp. B-6] gi 651372203 ref WP 026484452.1 pantoate--beta-alanine ligase [Alcaligenes faecalis] 0.99 0.73 gi 646375241 ref WP 025515422.1 pantoate--beta-alanine ligase [Bordetella trematum] 0.63 gi 504877820 ref WP 015064922.1 pantoate--beta-alanine ligase [Bordetella bronchiseptica] gi 651248583 ref WP 026383624.1 MULTISPECIES pantoate--beta-alanine ligase [Achromobacter] 1 gi 809276290 ref WP 046329775.1 pantoate--beta-alanine ligase [Polynucleobacter necessarius] 0.81 0.99 gi 502319050 ref WP 012762572.1 pantoate--beta-alanine ligase [Ralstonia pickettii] 0.87 gi 502976803 ref WP 013211779.1 pantoate--beta-alanine ligase [Ralstonia solanacearum]

0.97 gi 493147409 ref WP 006160569.1 pantoate--beta-alanine ligase [Cupriavidus basilensis] gi 501322032 ref WP 012353667.1 pantoate--beta-alanine ligase [Cupriavidus taiwanensis] gi 913713133 ref WP 050464845.1 pantoate--beta-alanine ligase [Herbaspirillum autotrophicum] 0.93 gi 913729566 ref WP 050476842.1 pantoate--beta-alanine ligase [Herbaspirillum rhizosphaerae] gi 492536056 ref WP 005877542.1 pantoate--beta-alanine ligase [Oxalobacter formigenes] gi 740705134 ref WP 038490423.1 pantoate--beta-alanine ligase [Janthinobacterium agaricidamnosum]

0.77 gi 950034106 ref WP 057157958.1 pantoate--beta-alanine ligase [Massilia sp. Root351] gi 518762927 ref WP 019920216.1 pantoate--beta-alanine ligase [Duganella zoogloeoides] gi 503773384 ref WP 014007460.1 pantoate--beta-alanine ligase [Collimonas fungivorans]

0.26

3i) DUR1(PLON) & DUR12 (PCIT) (Gammaproteobacteria)

0.57 Planococcus citri 0.74 gi 291151229 gb ADD75813.1 DUR1 2 [Pantoea ananatis LMG 20103] 1 gi 746341309 ref WP 039386427.1 urea carboxylase [Pantoea agglomerans] gi 498357544 ref WP 010671700.1 urea amidolyase [Pantoea agglomerans] 0.96 gi 658470506 ref WP 029685658.1 urea carboxylase [Tatumella saanichensis] 0.99 gi 746282025 ref WP 039329491.1 urea carboxylase [Pantoea rodasii] 0.65 0.74 gi 736824598 ref WP 034826204.1 urea carboxylase [Enterobacter cancerogenus] 1 gi 495383994 ref WP 008108701.1 urea amidolyase [Pantoea sp. YR343] gi 495160120 ref WP 007884921.1 urea amidolyase [Pantoea sp. GM01] gi 652342320 ref WP 026739522.1 urea carboxylase [Lonsdalea quercina] Pseudococcus longispinus gi 503273130 ref WP 013507791.1 urea amidolyase [Pantoea sp. At-9b] gi 502353847 ref WP 012770427.1 urea amidolyase [Dickeya chrysanthemi] 0.62 1 gi 446405660 ref WP 000483515.1 urea amidolyase [Salmonella enterica] 0.51 1 gi 737923262 ref WP 035888545.1 urea carboxylase [Kosakonia radicincitans] gi 550649930 ref WP 022633631.1 urea carboxylase [Dickeya solani] 0.66 gi 917771371 ref WP 052285375.1 urea carboxylase [Kluyvera cryocrescens] gi 740687201 ref WP 038472490.1 urea carboxylase [Cedecea neteri] 1 0.98 gi 769914138 ref WP 045048782.1 urea carboxylase [Rouxiella chamberiensis] 0.69 gi 504099376 ref WP 014333370.1 urea amidolyase [Rahnella aquatilis] 0.96 1 gi 491080492 ref WP 004942109.1 urea amidolyase [Serratia plymuthica] gi 727176993 ref WP 033641465.1 urea carboxylase [Serratia marcescens] 1 gi 700313489 gb AIU88609.1 urea carboxylase [Pectobacterium carotovorum subsp. odoriferum] gi 499406236 ref WP 011093703.1 urea amidolyase [Pectobacterium atrosepticum] 0.94 gi 891171832 ref WP 048914771.1 urea carboxylase [bacteria symbiont BFo1 of Frankliniella occidentalis] gi 921194962 ref WP 053140396.1 urea carboxylase [Erwinia billingiae] 0.15 3j) dapF (Alphaproteobacteria) gi 526124645 gb AGR65712.1 diaminopimelate epimerase [Planococcus citri] 0.89 Maconellicoccus hirsutus 0.71 Pseudococcus longispinus 0.67 0.69 Ferrisia virgata 0.52 Trionymus perrisii Paracoccus marginatus

1 0.9 gi 490735277 ref WP 004597608.1 diaminopimelate epimerase [Rickettsia prowazekii] gi 499504222 ref WP 011190862.1 diaminopimelate epimerase [Rickettsia typhi] gi 516012453 ref WP 017443036.1 diaminopimelate epimerase [Candidatus Rickettsia gravesii] gi 504205096 ref WP 014392198.1 diaminopimelate epimerase [Candidatus Rickettsia amblyommii]

0.98 gi 502142888 ref WP 012719673.1 diaminopimelate epimerase [Rickettsia africae] gi 503886769 ref WP 014120763.1 diaminopimelate epimerase [Rickettsia japonica] 0.97 gi 501102961 ref WP 012152750.1 diaminopimelate epimerase [Rickettsia massiliae] 0.66 gi 951273564 ref WP 057700133.1 diaminopimelate epimerase [Rickettsia rhipicephali] 0.66 gi 504221468 ref WP 014408570.1 diaminopimelate epimerase [Rickettsia rhipicephali] gi 504223143 ref WP 014410245.1 diaminopimelate epimerase [Rickettsia montanensis] gi 692117270 ref WP 032074179.1 diaminopimelate epimerase [Rickettsia aeschlimannii] gi 499590206 ref WP 011270975.1 diaminopimelate epimerase [Rickettsia felis]

0.7 0.67 gi 796990187 ref WP 045812449.1 diaminopimelate epimerase [Rickettsia hoogstraalii] gi 749657470 ref WP 040257651.1 diaminopimelate epimerase [Rickettsia hoogstraalii] 0.56 0.88 gi 501099668 ref WP 012149545.1 diaminopimelate epimerase [Rickettsia akari] gi 504225704 ref WP 014412806.1 diaminopimelate epimerase [Rickettsia australis] gi 751609631 ref WP 041077697.1 diaminopimelate epimerase [Candidatus Rickettsia asemboensis] gi 692429165 ref WP 032138571.1 diaminopimelate epimerase [Rickettsia tamurae] gi 558630741 ref WP 023507815.1 diaminopimelate epimerase [Rickettsia monacensis] 0.64 gi 796881708 ref WP 045803843.1 diaminopimelate epimerase [Rickettsia endosymbiont of Ixodes pacificus] gi 239921581 gb EER21605.1 diaminopimelate epimerase [Rickettsia endosymbiont of Ixodes scapularis] gi 568197302 ref WP 024071666.1 diaminopimelate epimerase [Ehrlichia muris] 1 0.98 gi 771518157 ref WP 045171230.1 diaminopimelate epimerase [Ehrlichia mineirensis] 0.89 gi 499623421 ref WP 011304155.1 diaminopimelate epimerase [Ehrlichia canis] gi 499771636 ref WP 011452370.1 diaminopimelate epimerase [Ehrlichia chaffeensis]

0.37 3k) lysA (Alphaproteobacteria)

gi 495609130 ref WP 008333709.1 diaminopimelate decarboxylase [Maritimibacter alkaliphilus] gi 737870815 ref WP 035837709.1 diaminopimelate decarboxylase [Defluviimonas sp. 20V17] 0.58 0.76 gi 652982540 ref WP 027235129.1 diaminopimelate decarboxylase [Leisingera caerulea] 0.96 0.99 gi 653004252 ref WP 027256421.1 diaminopimelate decarboxylase [Leisingera aquimarina] gi 654629092 ref WP 028093284.1 diaminopimelate decarboxylase [Pseudodonghicola xiamenensis]

0.91 gi 652988947 ref WP 027241527.1 diaminopimelate decarboxylase [Pseudophaeobacter arcticus] 0.83 gi 746093219 ref WP 039159842.1 diaminopimelate decarboxylase [Leisingera sp. ANG-M1] gi 746062742 ref WP 039131110.1 diaminopimelate decarboxylase [Leisingera sp. ANG-Vp]

1 gi 941807785 ref WP 055187471.1 diaminopimelate decarboxylase [Aliiroseovarius crassostreae] 0.5 0.54 gi 740219916 ref WP 038061701.1 diaminopimelate decarboxylase [Thioclava dalianensis] 0.63 gi 737777634 ref WP 035745522.1 diaminopimelate decarboxylase [Haematobacter missouriensis] gi 738745150 ref WP 036639023.1 diaminopimelate decarboxylase [Paenirhodobacter enshiensis] gi 550957484 ref WP 022705831.1 diaminopimelate decarboxylase [Paracoccus zeaxanthinifaciens] 0.97 gi 651244822 ref WP 026379965.1 diaminopimelate decarboxylase [Afifella pfennigii] 0.58 gi 652896421 ref WP 027153380.1 diaminopimelate decarboxylase [Mesorhizobium sp. WSM2561] gi 780030290 ref WP 045443593.1 diaminopimelate decarboxylase [Tepidicaulis marinus] gi 796977756 ref WP 045808806.1 diaminopimelate decarboxylase [Candidatus Neoehrlichia lotoris] 1 0.95 gi 763336233 ref WP 044194563.1 diaminopimelate decarboxylase [Ehrlichia sp. HF]

1 gi 568197800 ref WP 024072164.1 diaminopimelate decarboxylase [Ehrlichia muris] gi 492855959 ref WP 006009913.1 diaminopimelate decarboxylase [Ehrlichia chaffeensis] 0.99 gi 771518289 ref WP 045171352.1 diaminopimelate decarboxylase [Ehrlichia mineirensis] 1 gi 499623921 ref WP 011304655.1 diaminopimelate decarboxylase [Ehrlichia canis] Planococcus citri 0.71 Ferrisia virgata Pseudococcus longispinus 1 0.98 Paracoccus marginatus Trionymus perrisii Maconellicoccus hirsutus

0.35 3l) b-lact (Gammaproteobacteria)

Planococcus citri (NODE 19161) 1 Paracoccus marginatus (NODE 1286)

0.99 Trionymus perrisii (NODE 27744) Pseudococcus longispinus (NODE 4491) Ferrisia virgata (NODE 5744) Planococcus citri (NODE 9718) Ferrisia virgata (NODE 5744)

1 Trionymus perrisii (NODE 14178) Paracoccus marginatus (NODE 1286) 0.96 Planococcus citri (NODE 41741) 0.83 Trionymus perrisii (NODE 28052) 0.97 Ferrisia virgata (NODE 15550) Paracoccus marginatus (NODE 1286) Pseudococcus longispinus (NODE 2155) 0.63 1 gi 516025199 ref WP 017455782.1 MBL fold metallo-hydrolase [Kosakonia sacchari] gi 521292639 ref WP 020456907.1 hypothetical protein [Enterobacter sp. R4-368] 0.57 1 gi 780192050 ref WP 045508772.1 MBL fold metallo-hydrolase [Kosakonia oryzae] 0.98 gi 496383829 ref WP 009092819.1 MBL fold metallo-hydrolase [Pantoea sp. Sc1] gi 805447658 ref WP 046102777.1 MBL fold metallo-hydrolase [Pantoea anthophila] 1 gi 727277113 ref WP 033735283.1 MBL fold metallo-hydrolase [Pantoea vagans] 0.98 gi 908724136 ref WP 049851671.1 MBL fold hydrolase [Pantoea sp. RIT-PI-b] 0.55 gi 495377347 ref WP 008102058.1 MBL fold metallo-hydrolase [Pantoea sp. YR343] gi 545153718 ref WP 021509015.1 MBL fold metallo-hydrolase [Pantoea dispersa] 0.73 0.86 gi 746284843 ref WP 039332281.1 MBL fold metallo-hydrolase [Pantoea rodasii] 0.93 gi 736822473 ref WP 034824101.1 MBL fold metallo-hydrolase [Enterobacter cancerogenus]

1 gi 895912724 ref WP 049011806.1 MBL fold hydrolase [Citrobacter koseri] gi 391324085 gb EIQ80696.1 metallo-beta-lactamase superfamily protein [Shigella flexneri 1235-66] 0.99 gi 696374571 ref WP 032949152.1 MBL fold metallo-hydrolase [Citrobacter freundii] gi 917770316 ref WP 052284320.1 hypothetical protein [Kluyvera cryocrescens] 1 gi 829958857 ref WP 047371313.1 MBL fold metallo-hydrolase [Kluyvera intermedia] gi 740178410 ref WP 038021252.1 MBL fold metallo-hydrolase [Tatumella morbirosei] 1 0.98 gi 490203504 ref WP 004101956.1 MBL fold metallo-hydrolase [Klebsiella oxytoca] gi 927665443 dbj BAS40656.1 metallo-beta-lactamase family protein [Klebsiella oxytoca] 0.91 gi 345093299 gb AEN64935.1 beta-lactamase domain-containing protein [Enterobacter asburiae LF7a] gi 490786993 ref WP 004649155.1 hypothetical protein [Acinetobacter bohemicus] gi 740688216 ref WP 038473505.1 MBL fold metallo-hydrolase [Cedecea neteri] 1 gi 514233281 ref WP 016535930.1 MBL fold hydrolase [Cedecea davisae] gi 653847686 ref WP 027696806.1 MBL fold metallo-hydrolase [Vibrio litoralis] gi 922031180 ref WP 053308980.1 hypothetical protein [Vibrio alginolyticus]] gi 754639799 ref WP 042025782.1 MBL fold metallo-hydrolase [Aeromonas enteropelogenes] 1 gi 754695120 ref WP 042072420.1 MBL fold metallo-hydrolase [Aeromonas enteropelogenes]

1 gi 759864696 ref WP 043555148.1 MBL fold metallo-hydrolase [Aeromonas bestiarum] 0.99 gi 759411644 ref WP 043135680.1 MBL fold metallo-hydrolase [Aeromonas salmonicida] 0.2

3m) chiA (Gammaproteobacteria, Betaproteobacteria, Amoebozoa)

gi 835665792 ref WP 047605868.1 chitinase [Rahnella aquatilis] 1 gi 696413150 ref WP 032983628.1 chitinase [Cronobacter malonaticus] 0.99 0.69 gi 695834493 ref WP 032747871.1 chitinase [Klebsiella oxytoca] 1 gi 930177561 ref WP 054178309.1 chitinase [Trabulsiella odontotermitis] 1 gi 740318561 ref WP 038155751.1 chitinase [Trabulsiella guamensis] gi 928869332 ref WP 053908322.1 chitinase [Moellerella wisconsensis] gi 544913895 ref WP 021323655.1 exochitinase [Photorhabdus temperata] 1 0.85 gi 898302173 ref WP 049581638.1 chitinase [Photorhabdus luminescens]

1 0.89 gi 935621922 ref WP 054475490.1 chitinase [Photorhabdus heterorhabditis] gi 506314549 ref WP 015834324.1 exochitinase [Photorhabdus asymbiotica] 0.98 gi 289173991 emb CBJ80778.1 conserved hypothetical protein [Xenorhabdus bovienii SS-2004] gi 740404877 ref WP 038238453.1 chitinase [Xenorhabdus szentirmaii] 0.98 gi 835667192 ref WP 047606483.1 chitinase [Rahnella aquatilis] gi 459945685 gb AGD94964.2 chitinase x [Citrobacter freundii] gi 917753512 ref WP 052267565.1 chitinase [Pandoraea pulmonicola] 1 0.95 gi 919210236 ref WP 052765737.1 chitinase [Pandoraea apista] 0.86 gi 917726470 ref WP 052240761.1 chitinase [Pandoraea pnomenusa] 0.75 gi 807229731 gb AKC72435.1 chitinase [Pandoraea oxalativorans] gi 764684932 ref WP 044457990.1 chitinase [Pandoraea vervacti] gi 828157544 ref WP 047248626.1 chitinase [Chromobacterium subtsugae] 1 gi 494312556 ref WP 007175599.1 chitinase [Burkholderia sp. Ch1-1] gi 499806771 ref WP 011487505.1 chitinase [Burkholderia xenovorans] gi 281209671 gb EFA83839.1 glycosyl hydrolase family chitinase [Polysphondylium pallidum PN500]

1 gi 330792429 ref XP 003284291.1 hypothetical protein DICPUDRAFT 96643 [Dictyostelium purpureum] 1 gi 330798160 ref XP 003287123.1 hypothetical protein DICPUDRAFT 91849 [Dictyostelium purpureum] gi 330798150 ref XP 003287118.1 hypothetical protein DICPUDRAFT 151171 [Dictyostelium purpureum]

1 Paracoccus marginatus (NODE 378) Trionymus perrisii (NODE 1934) chiA2 Trionymus perrisii (NODE 1934) chiA1 0.36 3n) amiD gi 497983452 ref WP 010297608.1 N-acetylmuramoyl-L-alanine amidase [Candidatus Odyssella thessalonicensis] Gammaproteobacteria (P. citri) gi 662193093 ref XP 008469435.1 PREDICTED uncharacterized protein LOC103506806 [Diaphorina citri] gi 518060802 ref WP 019231010.1 hypothetical protein [Rickettsiaceae bacterium Os18] Alphaproteobacteria (M. hirsutus) 0.7 0.97 gi 518060991 ref WP 019231199.1 hypothetical protein [Rickettsiaceae bacterium Os18]

1 Maconellicoccus hirsutus gi 641656280 ref XP 008179904.1 PREDICTED uncharacterized protein LOC103308396 [Acyrthosiphon pisum] gi 788086336 gb KJV55785.1 N-acetylmuramoyl-L-alanine amidase family protein [Orientia chuto str. Fuller] 1 gi 799027698 ref WP 045916384.1 N-acetylmuramoyl-L-alanine amidase [Orientia tsutsugamushi] 0.91 0.6 gi 919136079 ref WP 052691711.1 N-acetylmuramoyl-L-alanine amidase [Orientia tsutsugamushi] 0.65 gi 799022947 ref WP 045914911.1 N-acetylmuramoyl-L-alanine amidase [Orientia tsutsugamushi] gi 788102248 gb KJV71203.1 N-acetylmuramoyl-L-alanine amidase family protein [Orientia tsutsugamushi str. UT76] gi 501438532 ref WP 012461981.1 N-acetylmuramoyl-L-alanine amidase [Orientia tsutsugamushi] gi 788129080 gb KJV97041.1 N-acetylmuramoyl-L-alanine amidase family protein [Orientia tsutsugamushi str. Sido] gi 500486478 ref WP 011944253.1 N-acetylmuramoyl-L-alanine amidase [Orientia tsutsugamushi] gi 788119718 gb KJV87828.1 N-acetylmuramoyl-L-alanine amidase family protein [Orientia tsutsugamushi str. UT76] 0.87 gi 674298706 gb AIL13603.1 N-acetylmuramoyl-L-alanine amidase [Candidatus Caedibacter acanthamoebae] gi 501449492 ref WP 012472941.1 hypothetical protein [Candidatus Amoebophilus asiaticus] 1 gi 757601011 ref WP 042848535.1 N-acetylmuramoyl-L-alanine amidase [Providencia rettgeri] gi 496189222 ref WP 008913729.1 N-acetylmuramoyl-L-alanine amidase [Providencia burhodogranariea] gi 836002469 ref WP 047714315.1 N-acetylmuramoyl-L-alanine amidase [Pantoea ananatis] gi 640472072 ref WP 024912646.1 N-acetylmuramoyl-L-alanine amidase [Chania multitudinisentens]

1 gi 652428577 ref WP 026823835.1 N-acetylmuramoyl-L-alanine amidase [Arsenophonus nasoniae] gi 692295506 ref WP 032116515.1 N-acetylmuramoyl-L-alanine amidase [Arsenophonus endosymbiont of Nilaparvata lugens] gi 526124672 gb AGR65725.1 n-acetylmuramoyl-l-alanine amidase [Planococcus citri] gi 499729911 ref WP 011410645.1 N-acetylmuramoyl-L-alanine amidase [Sodalis glossinidius] 0.72 gi 493755565 ref WP 006704428.1 N-acetylmuramoyl-L-alanine amidase [Candidatus Regiella insecticola] 1 gi 595642014 gb AHM74269.1 N-acetylmuramoyl-L-alanine amidase AmiD [Yersinia enterocolitica LC20] 0.69 gi 935626682 ref WP 054478262.1 N-acetylmuramoyl-L-alanine amidase [Photorhabdus heterorhabditis] gi 898307655 ref WP 049582109.1 N-acetylmuramoyl-L-alanine amidase [Photorhabdus luminescens] 0.97 gi 822546967 ref WP 046975875.1 N-acetylmuramoyl-L-alanine amidase [Photorhabdus temperata] gi 738881320 ref WP 036769297.1 N-acetylmuramoyl-L-alanine amidase [Photorhabdus asymbiotica] gi 809012177 gb KKF37887.1 N-acetylmuramoyl-L-alanine amidase [Erwinia tracheiphila] 0.99 0.95 gi 887504833 gb KMV67026.1 N-acetylmuramoyl-L-alanine amidase [bacteria symbiont BFo1 of Frankliniella occidentalis] 1gi 238869683 gb ACR69394.1 N-acetylmuramoyl-L-alanine amidase putative [Edwardsiella ictaluri 93-146] gi 737638793 ref WP 035608824.1 N-acetylmuramoyl-L-alanine amidase [Edwardsiella ictaluri] 0.79 3o) ddlB (Alphaproteobacteria)

1 gi 739471013 ref WP 037330915.1 D-alanine--D-alanine ligase [Anaplasma marginale] 1 gi 502644609 ref WP 012880987.1 D-alanine--D-alanine ligase [Anaplasma centrale] gi 788099829 gb KJV69127.1 D-alanine--D-alanine ligase family protein [Candidatus Neoehrlichia lotoris str. RAC413] gi 655878681 ref WP 028966896.1 D-alanine--D-alanine ligase [Sphingomonas phyllosphaerae] 1 gi 526124649 gb AGR65714.1 d-alanine--d-alanine ligase [Planococcus citri]

0.88 Ferrisia virgata Pseudococcus longispinus Trionymus perissii gi 398649808 emb CCF77978.1 D-alanine-D-alanine ligase [Wolbachia endosymbiont of Onchocerca ochengi] 1gi 751576354 ref WP 041045081.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Cimex lectularius] 0.96 gi 651086969 dbj BAO99427.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Cimex lectularius] gi 499575985 ref WP 011256768.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Brugia malayi] gi 225590810 gb EEH12038.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Muscidifurax uniraptor] 0.52 0.99 gi 753817875 ref WP 041573499.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Drosophila simulans] gi 481068228 gb AGJ99620.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Drosophila simulans wHa] 0.79 0.57 0.68 >gi 42409741 gb AAS13853.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Drosophila melanogaster] 0.68 0.99 gi 549464826 gb ERN56068.1 D-alanine--D-alanine ligase [Wolbachia pipientis wMelPop] gi 225591982 gb ACN95001.1 D-alanine--D-alanine ligase [Wolbachia sp. wRi] gi 58535357 gb EAL59433.1 D-alanine-D-alanine ligase [Wolbachia endosymbiont of Drosophila ananassae] gi 633018632 gb KDB19369.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Glossina morsitans morsitans] 0.78 gi 750472694 ref WP 040754567.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Diaphorina citri]

0.97 gi 740361793 ref WP 038197640.1 D-alanine--D-alanine ligase [Wolbachia pipientis] 0.59 gi 808671985 emb CQD11135.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont wPip Mol of Culex molestus] 0.58 gi 190357101 emb CAQ54511.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Culex quinquefasciatus Pel] 1 0.51 gi 371931925 emb CCE77842.1 D-alanine--D-alanine ligase [Wolbachia pipientis wAlbB] 0.61 gi 917750674 ref WP 052264848.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Operophtera brumata] gi 748291651 ref WP 039833309.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Nasonia vitripennis] gi 505401425 ref WP 015588527.1 D-alanine--D-alanine ligase [Wolbachia endosymbiont of Drosophila simulans] 0.35 3p) murA (Gammaproteobacteria) 1 gi 803442810 gb AKB07786.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Vibrio cholerae] 1 gi 151938211 gb EDN57051.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Vibrio antiquarius] 0.95 gi 857609910 emb CDU00677.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Vibrio diabolicus]

1 gi 386902948 gb EIJ67769.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Pasteurella bettyae CCUG 2042] 1 gi 684176765 gb AIN47947.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Pasteurella multocida] gi 260631535 gb EEX49717.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Pasteurella dagmatis ATCC 43325] gi 873950230 ref WP 048636509.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Brenneria goodwinii] gi 746522464 ref WP 039557856.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Pectobacterium carotovorum] gi 742464574 ref WP 038921414.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Dickeya dadantii]

0.95 0.78 gi 498303202 ref WP 010617358.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Plautia stali symbiont] 0.98 gi 746341862 ref WP 039386951.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Pantoea agglomerans] gi 666662953 ref WP 031375438.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Pantoea sp. 3.5.1]

0.66 gi 516412053 ref WP 017801451.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Erwinia toletana] 0.66 gi 736891445 ref WP 034890456.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Erwinia typographi] 0.48 gi 501408524 ref WP 012440090.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Erwinia tasmaniensis] 0.66 gi 526124654 gb AGR65716.1 UDP-N-acetylglucosamine enolpyruvoyl transferase [Planococcus citri] 0.98 Pseudococcus longispinus 0.91 Ferrisia virgata 1 gi 643651809 ref WP 025243952.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Candidatus Sodalis pierantonius] gi 645052508 ref WP 025423789.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Sodalis praecaptivus]

0.77 gi 765027797 ref WP 044593624.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Cronobacter sakazakii] 0.55 gi 585338482 ref WP 024220115.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Escherichia coli] gi 501084833 ref WP 012135322.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Citrobacter koseri] gi 748799196 ref WP 040047153.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Hafnia alvei] 0.91 gi 493759391 ref WP 006708132.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Serratia symbiotica] gi 755642946 ref WP 042547046.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Yersinia aldovae] 0.67 0.52 gi 738888501 ref WP 036775969.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Photorhabdus luminescens] 0.51 gi 828164216 ref WP 047255216.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Moellerella wisconsensis] 0.89 gi 740380187 ref WP 038215100.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Xenorhabdus bovienii] gi 857776463 emb CRL63372.1 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [Proteus vulgaris] 0.15

3q) murB (Bacteroidetes)

1 gi 404432992 emb CCM10274.1 [Cardinium endosymbiont cEper1 of Encarsia pergandiella] 0.99 gi 916264915 ref WP 050999961.1 [Cardinium endosymbiont of Encarsia pergandiella] 0.68 gi 736564337 ref WP 034576425.1 [Cardinium endosymbiont of Bemisia tabaci] Pseudococcus longispinus 1 gi 526124664 gb AGR65721.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Planococcus citri] gi 501449941 ref WP 012473390.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Candidatus Amoebophilus asiaticus] 0.98 gi 928965651 ref WP 053990169.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Mangrovimonas sp. TPBH4] gi 654414036 ref WP 027885477.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Mesonia mobilis] 0.94 gi 950624533 ref WP 057480229.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Salegentibacter mishustinae] gi 818837438 gb KKU75693.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Parcubacteria Nomurabacteria bacterium] 1 gi 818516859 gb KKR69988.1 UDP-N-acetylenolpyruvoylglucosamine reductase Parcubacteria Nomurabacteria bacterium] 0.71 gi 521070145 ref WP 020402096.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Gracilimonas tropica] gi 516844582 ref WP 018127731.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Balneola vulgaris] 0.93 gi 652558032 ref WP 026951572.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Algoriphagus mannitolivorans] gi 635635465 ref WP 024282360.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Algoriphagus marincola] gi 947616275 ref WP 056279320.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Dyadobacter sp. Leaf189] gi 504842028 ref WP 015029130.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Emticicia oligotrophica] 1 gi 655256803 ref WP 028667322.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Runella zeae] gi 655075924 ref WP 028524060.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Runella limosa] gi 522085466 ref WP 020596675.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Spirosoma panaciterrae] 0.75 gi 817522713 ref WP 046578669.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Spirosoma radiotolerans] 0.64 1 gi 517446965 ref WP 018617794.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Spirosoma luteum] gi 522095549 ref WP 020606758.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Spirosoma spitsbergense] 0.55 gi 283819289 gb ADB41127.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Spirosoma linguale DSM 74] gi 496585166 ref WP 009285005.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Fibrisoma limi] 1 gi 505146932 ref WP 015334034.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Fibrella aestuarina] gi 488781518 ref WP 002693925.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Microscilla marina] gi 763340481 ref WP 044198796.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Dyadobacter tibetensis] gi 595619835 gb AHM63478.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Flammeovirgaceae bacterium 311] 1 gi 496486221 ref WP 009194791.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Cesiribacter andamanensis] 0.97 gi 764943443 ref WP 044513938.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Hymenobacter sp. DG25B] gi 935476901 ref WP 054412462.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Hymenobacter sp. DG25A] 0.92 1 gi 763121926 ref WP 044001838.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Hymenobacter swuensis] gi 651339839 ref WP 026462825.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Adhaeribacter aquaticus] gi 921286599 ref WP 053223200.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Roseivirga sp. D-25] gi 930803060 ref WP 054282636.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Chitinophagaceae bacterium PMP191F] 0.63 gi 652356020 ref WP 026752164.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Sediminibacterium sp. C3] 1 gi 652367231 ref WP 026763257.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Sediminibacterium salmoneum] 0.54 gi 516454204 ref WP 017843116.1 UDP-N-acetylenolpyruvoylglucosamine reductase [Flavobacterium sp. MS220-5C]

0.2 3r) murC Bacteroidetes (P. citri) Alphaproteobacteria (P. longispinus)

Pseudococcus longispinus 1 gi 746415632 ref WP 039456669.1 UDP-N-acetylmuramate--alanine ligase [endosymbiont of Acanthamoeba sp. UWC36] gi 665991541 gb AIF81302.1 UDP-N-acetylmuramate--L-alanine ligase [endosymbiont of Acanthamoeba sp. UWC8] 0.75 gi 753866189 ref WP 041621803.1 UDP-N-acetylmuramate--alanine ligase [Orientia tsutsugamushi]

1 gi 758819282 dbj BAQ36600.1 UDP-N-acetylmuramate--L-alanine ligase [Candidatus Megaira polyxenophila]

1 gi 501102026 ref WP 012151851.1 UDP-N-acetylmuramate--L-alanine ligase [Rickettsia bellii] 0.97 gi 796881872 ref WP 045803913.1 UDP-N-acetylmuramate--alanine ligase [Rickettsia endosymbiont of Ixodes pacificus] gi 692431391 ref WP 032139456.1 UDP-N-acetylmuramate--alanine ligase [Rickettsia tamurae]

1 gi 504158815 ref WP 014364516.1 UDP-N-acetylmuramate--L-alanine ligase [Rickettsia philipii] 0.83 0.64 gi 504222937 ref WP 014410039.1 UDP-N-acetylmuramate--alanine ligase [Rickettsia montanensis] 0.96 gi 504221251 ref WP 014408353.1 UDP-N-acetylmuramate--alanine ligase [Rickettsia rhipicephali] 0.86 gi 796872756 ref WP 045800223.1 UDP-N-acetylmuramate--alanine ligase [Candidatus Rickettsia amblyommii]

0.85 0.56 gi 751609716 ref WP 041077781.1 UDP-N-acetylmuramate--alanine ligase [Candidatus Rickettsia asemboensis] 0.72 gi 499590591 ref WP 011271353.1 UDP-N-acetylmuramate--L-alanine ligase [Rickettsia felis] 0.83 gi 504225925 ref WP 014413027.1 UDP-N-acetylmuramate--alanine ligase [Rickettsia australis] gi 749657016 ref WP 040257197.1 UDP-N-acetylmuramate--alanine ligase [Rickettsia hoogstraalii] gi 504156440 ref WP 014363698.1 UDP-N-acetylmuramate--alanine ligase [Rickettsia canadensis] 1gi 544593378 gb ERL47722.1 Enoyl-acyl-carrier-protein reductase NADH [alpha proteobacterium RS24] gi 740469243 ref WP 038300617.1 UDP-N-acetylmuramate--alanine ligase [alpha proteobacterium RS24] gi 860477642 ref WP 048435635.1 UDP-N-acetylmuramate--alanine ligase [Methylobacterium platani] 0.95 1 1 gi 945573841 gb KQW28850.1 UDP-N-acetylmuramate--alanine ligase [Rhizobium sp. Root1240] 0.62 gi 820889049 ref WP 046795218.1 UDP-N-acetylmuramate--alanine ligase [Rhizobium sp. LC145] gi 756169076 ref WP 042617203.1 UDP-N-acetylmuramate--alanine ligase [Agrobacterium tumefaciens] gi 947792408 ref WP 056454032.1 UDP-N-acetylmuramate--alanine ligase [Brevundimonas sp. Root1279] 0.65 gi 550984810 ref WP 022732904.1 UDP-N-acetylmuramate--alanine ligase [Thalassospira lucentensis] gi 916278867 ref WP 051013913.1 UDP-N-acetylmuramate--alanine ligase [Pararhodospirillum photometricum] 0.97 gi 504747684 ref WP 014934786.1 UDP-N-acetylmuramate--L-alanine ligase [Cardinium endosymbiont of Encarsia pergandiella] 1 gi 736564952 ref WP 034576909.1 UDP-N-acetylmuramate--L-alanine ligase [Cardinium endosymbiont of Bemisia tabaci] 0.63 gi 526124656 gb AGR65717.1 UDP-N-acetylmuramate-alanine ligase [Planococcus citri] gi 501449755 ref WP 012473204.1 UDP-N-acetylmuramate--L-alanine ligase [Candidatus Amoebophilus asiaticus] gi 943601427 ref WP 055431794.1 UDP-N-acetylmuramate--alanine ligase [Candidatus Symbiothrix dinenymphae] 1 gi 648518879 ref WP 026210630.1 UDP-N-acetylmuramate--alanine ligase [Flexithrix dorotheae] gi 504493894 ref WP 014680996.1 UDP-N-acetylmuramate--alanine ligase [Solitalea canadensis] gi 737136075 ref WP 035123386.1 UDP-N-acetylmuramate--alanine ligase [Flavobacterium aquatile]

0.76 gi 836628408 ref WP 047778389.1 UDP-N-acetylmuramate--alanine ligase [Flavobacterium sp. ABG] 0.86 0.99 gi 746043675 ref WP 039114489.1 UDP-N-acetylmuramate--alanine ligase [Flavobacterium sp. KMS] 1 0.88 gi 746048418 ref WP 039118457.1 UDP-N-acetylmuramate--alanine ligase [Flavobacterium sp. JRM] 1 gi 737657847 ref WP 035627631.1 UDP-N-acetylmuramate--alanine ligase [Flavobacterium hydatis] gi 737701317 ref WP 035670165.1 UDP-N-acetylmuramate--alanine ligase [Flavobacterium sp. 83] 1 gi 652595895 ref WP 026979553.1 UDP-N-acetylmuramate--alanine ligase [Flavobacterium suncheonense] gi 559196875 ref WP 023573470.1 murC protein [Flavobacterium enshiense] gi 503220749 ref WP 013455410.1 UDP-N-acetylmuramate--alanine ligase [Marivirga tractuosa] gi 917715127 gb KOF01505.1 UDP-N-acetylmuramate--alanine ligase [Roseivirga sp. D-25]

0.7 gi 748178028 ref WP 039751573.1 UDP-N-acetylmuramate--alanine ligase [Hassallia byssoidea] 0.98 gi 935479336 ref WP 054413618.1 UDP-N-acetylmuramate--alanine ligase [Hymenobacter sp. DG25A] gi 646880151 ref WP 025607078.1 UDP-N-acetylmuramate--alanine ligase [Pontibacter actiniarum]

0.92 gi 516341816 ref WP 017731849.1 UDP-N-acetylmuramate--L-alanine ligase [Nafulsella turpanensis] 1 gi 595615850 gb AHM59493.1 UDP-N-acetylmuramate--L-alanine ligase [Flammeovirgaceae bacterium 311] gi 496486143 ref WP 009194713.1 UDP-N-acetylmuramate--L-alanine ligase [Cesiribacter andamanensis] 1gi 635636779 ref WP 024283674.1 UDP-N-acetylmuramate--alanine ligase [Algoriphagus marincola] gi 652554085 ref WP 026947684.1 UDP-N-acetylmuramate--alanine ligase [Algoriphagus marincola] 0.98 0.5 gi 952926118 ref WP 057939589.1 UDP-N-acetylmuramate--alanine ligase [Algoriphagus sp. NH1] gi 495478455 ref WP 008203142.1 UDP-N-acetylmuramate--alanine ligase [Algoriphagus machipongonensis] gi 652561763 ref WP 026955274.1 UDP-N-acetylmuramate--alanine ligase [Algoriphagus vanfongensis] 1 gi 737488728 ref WP 035468462.1 UDP-N-acetylmuramate--alanine ligase [Algoriphagus mannitolivorans] gi 652575556 ref WP 026967958.1 UDP-N-acetylmuramate--alanine ligase [Algoriphagus terrigena] 0.99 0.47 gi 550094235 ref WP 022582238.1 UDP-N-acetylmuramate--L-alanine ligase [Rhodonellum psychrophilum] gi 504585142 ref WP 014772244.1 UDP-N-acetylmuramate--alanine ligase [Belliella baltica] 0.57 0.91 gi 496474563 ref WP 009183406.1 UDP-N-acetylmuramate--alanine ligase [Cecembia lonarensis] gi 495906693 ref WP 008631272.1 UDP-N-acetylmuramate--alanine ligase [Mariniradius saccharolyticus] gi 496325064 ref WP 009034242.1 UDP-N-acetylmuramate--alanine ligase [Indibacter alkaliphilus] 0.72 0.85 gi 737083197 ref WP 035071642.1 UDP-N-acetylmuramate--alanine ligase [Anditalea andensis] 1 gi 517286755 ref WP 018475573.1 UDP-N-acetylmuramate--L-alanine ligase [Echinicola pacifica] gi 505077065 ref WP 015264167.1 UDP-N-acetylmuramate--L-alanine ligase [Echinicola vietnamensis] gi 499125850 ref WP 010854709.1 UDP-N-acetylmuramate--alanine ligase [Cyclobacteriaceae bacterium AK24] 0.88 1 gi 503786766 ref WP 014020760.1 UDP-N-acetylmuramate--alanine ligase [Cyclobacterium marinum] 0.88 gi 873974851 ref WP 048642340.1 UDP-N-acetylmuramate--alanine ligase [Cyclobacterium amurskyense] gi 527065687 ref WP 020892574.1 UDP-N-acetylmuramate--alanine ligase [Cyclobacterium qasimii] gi 655253680 ref WP 028664265.1 UDP-N-acetylmuramate--alanine ligase [Runella zeae] 0.54 gi 504609821 ref WP 014796923.1 UDP-N-acetylmuramate--alanine ligase [Flexibacter litoralis] 3s) murD (Alphaproteobacteria) gi 516720370 ref WP 018063602.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Martelella mediterranea] gi 501588156 ref WP 012592441.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Methylocella silvestris] 0.7 1 0.99 gi 959936494 ref WP 058194183.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Methylobacterium sp. GXS13] 0.97 gi 518747205 ref WP 019905494.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Methylobacterium sp. 77] 0.79 gi 739149861 ref WP 037014378.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Rhizobiales bacterium YIM 77505] 0.68 gi 821556030 ref WP 046863042.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Microvirga sp. JC119] 1 gi 517518220 ref WP 018688428.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Ahrensia kielensis]

0.71 gi 928973017 ref WP 053997438.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Ahrensia marina] 1 gi 497055317 ref WP 009449586.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Nitratireductor indicus] 0.79 gi 947200776 ref WP 055969715.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Aminobacter sp. Root100] 0.5 0.97 gi 516775862 ref WP 018095457.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Sinorhizobium meliloti] 0.97 gi 506396788 ref WP 015916507.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Agrobacterium vitis] gi 653314798 ref WP 027488042.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Rhizobium undicola] 1 gi 736826662 ref WP 034828232.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Hyphomonas sp. T16B2] 1 gi 736791087 ref WP 034793349.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Hyphomonas beringensis] gi 516889250 ref WP 018149620.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Henriciella marina] gi 740817144 ref WP 038602427.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Rickettsiales bacterium Ac37b] 1 gi 502644589 ref WP 012880967.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Anaplasma centrale] 1 0.82 gi 557701489 ref WP 023441388.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Anaplasma marginale] gi 796978771 ref WP 045809235.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Candidatus Neoehrlichia lotoris]

0.73 gi 751576948 ref WP 041045673.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Wolbachia endosymbiont of Cimex lectularius] gi 499575923 ref WP 011256706.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Wolbachia endosymbiont of Brugia malayi] 0.53 1gi 643861167 ref WP 025264273.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Wolbachia endosymbiont of Onchocerca volvulus] 1 0.52 gi 504681656 ref WP 014868758.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Wolbachia endosymbiont of Onchocerca ochengi] 0.75 gi 526124660 gb AGR65719.1 UDP-N-acetylmuramoyl-L-alanine D-glutamate ligase [Planococcus citri] Pseudococcus longispinus 1 gi 795022433 ref XP 011860593.1 PREDICTED uncharacterized protein LOC105557843 [Vollenhovia emeryi] gi 550546149 ref WP 022626364.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Wolbachia endosymbiont of Drosophila melanogaster] 1gi 501458407 ref WP 012481852.1 MULTISPECIES UDP-N-acetylmuramoylalanine--D-glutamate ligase [Wolbachia] gi 212994889 gb EEB55531.1 UDP-N-acetylmuramoylalanine--D-glutamate ligase [Wolbachia endosymbiont of Culex quinquefasciatus JHB] 0.43 3t) murE (Alphaproteobacteria)

0.95 gi 750183946 ref WP 040488020.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Fodinicurvata sediminis] gi 919039808 ref WP 052657495.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Thalassospira sp. HJ] 1 gi 501588153 ref WP 012592438.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Methylocella silvestris] 1 gi 764967815 ref WP 044536049.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Bradyrhizobium sp. LTSP885] 0.7 gi 951477004 ref WP 057848326.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Bradyrhizobium valentinum] gi 563764375 ref WP 023788579.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Hyphomicrobium nitrativorans] 0.94 gi 754290251 ref WP 041849726.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Bartonella bacilliformis] gi 959967140 gb KSV76886.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Sinorhizobium sp. Sb3] 1 gi 799015027 ref WP 045912731.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Orientia tsutsugamushi] 1 gi 796859005 ref WP 045797373.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Orientia chuto] gi 518060931 ref WP 019231139.1 hypothetical protein [Rickettsiaceae bacterium Os18] Pseudococcus longispinus gi 498107804 ref WP 010421960.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia helvetica] gi 749655798 ref WP 040255979.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia hoogstraalii] 0.74 1 gi 796882081 ref WP 045804000.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia endosymbiont of Ixodes pacificus] 0.91 0.96 gi 796869328 ref WP 045799460.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase partial [Candidatus Rickettsia amblyommii] 0.59 gi 796873302 ref WP 045800441.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Candidatus Rickettsia amblyommii]

0.59 gi 692116426 ref WP 032073348.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia aeschlimannii] 0.78 gi 752757674 ref WP 041404792.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia massiliae] 0.77 0.99 gi 951273396 ref WP 057699965.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia rhipicephali] 1 0.74 gi 516011821 ref WP 017442404.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Candidatus Rickettsia gravesii] gi 504223796 ref WP 014410898.1 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia parkeri] gi 504222302 ref WP 014409404.1 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia montanensis] 0.56 gi 504224649 ref WP 014411751.1 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia prowazekii] gi 504156505 ref WP 014363763.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Rickettsia canadensis] gi 526124662 gb AGR65720.1 UDP-N-acetylmuramoylalanyl-D-glutamate 2 6-diaminopimelate ligase [Planococcus citri] 0.39

3u) murF (Alphaproteobacteria)

gi 737756043 ref WP 035724620.1 hypothetical protein [Fodinicurvata fenggangensis] 1 gi 494149993 ref WP 007089738.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Thalassospira xiamenensis] gi 496165091 ref WP 008889598.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Thalassospira profundimaris] gi 495311829 ref WP 008036577.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Rhodobacterales bacterium HTCC2255] 0.9 1 0.69 gi 655303157 ref WP 028711885.1 MULTISPECIES UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Paracoccus] gi 640176022 ref WP 024811624.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Oceanicola sp. HL-35] gi 495485292 ref WP 008209978.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Roseobacter sp. SK209-2-6] 1 1 gi 746113550 ref WP 039179373.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Leisingera sp. ANG-M7] 0.94 gi 950341135 emb CUH98187.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Leisingera aquaemixtae] gi 652991067 ref WP 027243546.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Leisingera daeponensis] gi 739284745 ref WP 037147519.1 UDP-N-acetylmuramoylalanyl-D-glutamyl-2 6-diaminopimelate--D-alanyl-D-alanine ligase [Rhizobium sp. YS-1r] gi 816201371 gb KKJ78439.1 UDP-N-acetylmuramoylalanyl-D-glutamyl-2 6-diaminopimelate--D-alanyl-D-alanine ligase [Kiloniella sp. P1-1] gi 655497487 ref WP 028878824.1 hypothetical protein [Terasakiella pusilla] 0.99 gi 736844231 ref WP 034844938.1 UDP-N-acetylmuramoylalanyl-D-glutamyl-2 6-diaminopimelate--D-alanyl-D-alanine ligase [Inquilinus limosus] gi 739601168 ref WP 037458625.1 UDP-N-acetylmuramoylalanyl-D-glutamyl-2 6-diaminopimelate--D-alanyl-D-alanine ligase [Skermanella stibiiresistens] 0.52 gi 497226467 ref WP 009540729.1 UDP-N-acetylmuramoylalanyl-D-glutamyl-2 6-diaminopimelate--D-alanyl-D-alanine ligase [Caenispirillum salinarum] gi 568206306 ref WP 024080670.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Magnetospirillum gryphiswaldense] gi 922068449 ref WP 053332784.1 hypothetical protein [endosymbiont of Acanthamoeba sp. UWC36] 0.9 Pseudococcus longispinus gi 526124658 gb AGR65718.1 D-alanyl-D-alanine-adding enzyme [Planococcus citri] gi 746832135 ref XP 011056685.1 PREDICTED uncharacterized protein LOC105147401 [Acromyrmex echinatior] 1 1 gi 505402294 ref WP 015589396.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Wolbachia endosymbiont of Drosophila simulans] 0.9 1 0.71 gi 740415893 ref WP 038249011.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia endosymbiont of Glossina morsitans] 0.61 gi 501933587 ref WP 012673410.1 MULTISPECIES UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia] gi 740363825 ref WP 038199436.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia pipientis] 0.96 1 gi 498089389 ref WP 010403545.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia endosymbiont of Nasonia vitripennis] 1 gi 505401181 ref WP 015588283.1 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Wolbachia endosymbiont of Drosophila simulans] 0.99 gi 516101797 ref WP 017532377.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia endosymbiont of Diaphorina citri] 1gi 643860096 ref WP 025264082.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia endosymbiont of Onchocerca volvulus] 0.61 gi 504682022 ref WP 014869124.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia endosymbiont of Onchocerca ochengi] gi 499575654 ref WP 011256437.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia endosymbiont of Brugia malayi] gi 751576908 ref WP 041045634.1 UDP-N-acetylmuramoylalanyl-D-glutamate--2 6-diaminopimelate ligase [Wolbachia endosymbiont of Cimex lectularius] 1 gi 502644229 ref WP 012880613.1 UDP-N-acetylmuramoylalanyl-D-glutamyl-2 6-diaminopimelate--D-alanyl-D-alanine ligase [Anaplasma centrale] gi 557701553 ref WP 023441452.1 UDP-N-acetylmuramoylalanyl-D-glutamyl-2 6-diaminopimelate--D-alanyl-D-alanine ligase [Anaplasma marginale] 0.40 Supplementary Tables

1a)

COG E.C. number Product TPPAVE TPMHIR TPFVIR TPPLON TPPCIT TPPMAR TPTPER T. princeps shared genes (107) Copies E 4.2.1.33 3-isopropylmalate dehydratase large subunit leuC leuC leuC leuC leuC leuC leuC 0 1 E 4.2.1.33 3-isopropylmalate dehydratase small subunit leuD leuD leuD leuD leuD leuD 0 0 1 E 1.1.1.85 3-isopropylmalate dehydrogenase leuB leuB leuB leuB leuB leuB leuB 0 1 E 1.2.1.11 Aspartate-semialdehyde dehydrogenase asd asd 0 asd 0 0 0 0 1 E 5.3.1.24 N-(5'-phosphoribosyl)anthranilate isomerase trpF 0 0 0 0 0 0 0 1 E 4.2.1.20 tryptophan synthase subunit beta trpB 0 0 0 0 0 0 0 1 E 4.2.1.122 tryptophan synthase, alpha subunit trpA 0 0 0 0 0 trpA 0 1 K RNA polymerase sigma factor RpoD rpoD rpoD rpoD rpoD rpoD rpoD rpoD rpoD 1 J 30S ribosomal protein S21 rpsU rpsU rpsU rpsU rpsU rpsU rpsU rpsU 1 J 2.3.1.- tRNA N6-adenosine threonylcarbamoyltransferase tsaD tsaD tsaD tsaD tsaB tsaD tsaD tsaD 1 E 2.7.1.39 Homoserine kinase thrB thrB thrB thrB thrB thrB thrB 0 1 O ATP-dependent Clp protease ATP-binding subunit clpX clpX clpX clpX clpX clpX clpX clpX 1 O 3.4.21.92 ATP-dependent Clp protease proteolytic subunit clpP clpP clpP clpP clpP clpP clpP 0 1 E 6.3.4.5 Argininosuccinate synthase argG argG argG argG argG argG argG 0 1 J seryl-tRNA synthetase serS 0 serS 0 0 serS serS 0 1 O 1.8.1.9 thioredoxin reductase trxB 0 0 0 0 0 0 0 1 H 2.5.1.78 Riboflavin synthase ribE 0 ribC ribC 0 ribC 0 0 1 IQ Acyl carrier protein 0 acpP acpP acpP acpP acpP acpP acpP 1 J 50S ribosomal protein L32 rpmF rpmF rpmF rpmF rpmF rpmF rpmF rpmF 1 J 5.4.99.24 ribosomal large subunit pseudouridine synthase C rluC 0 0 0 0 0 0 0 1 J 2.5.1.75 tRNA delta(2)-isopentenylpyrophosphatetransferase miaA 0 0 0 0 0 0 0 1 C Ferredoxin 1 0 fdx_1 fdx_1 fdx_1 fdx_1 fdx_1 fdx_1 fdx 2 O Chaperone protein DnaJ dnaJ dnaJ dnaJ dnaJ dnaJ dnaJ dnaJ dnaJ 1 O Chaperone protein DnaK dnaK dnaK dnaK dnaK dnaK dnaK dnaK dnaK 1 O Protein GrpE grpE grpE grpE grpE grpE grpE grpE 0 1 E 2.5.1.54 Phospho-2-dehydro-3-deoxyheptonate aldolase, Phe-sensitaroG aroG aroG aroG aroG aroG aroG aroG 1 J tRNA-specific 2-thiouridylase MnmA mnmA 0 mnmA mnmA mnmA 0 mnmA 0 1 E 2.1.1.14 5-methyltetrahydropteroyltriglutamate-- homocysteine methmetE metE metE metE metE metE metE metE 1 D tRNA uridine 5-carboxymethylaminomethyl modification mnmG mnmG mnmG mnmG mnmG mnmG mnmG 0 1 M 2.1.1.170 Ribosomal RNA small subunit methyltransferase G rsmG rsmG rsmG rsmG rsmG rsmG rsmG rsmG 1 E 2.1.3.3 Ornithine carbamoyltransferase 1, phaseolotoxin-sensitive argF argF 0 0 argF 0 argF 0 1 J 30S ribosomal protein S20 rpsT rpsT rpsT rpsT rpsT rpsT 0 0 1 M putative peptidoglycan biosynthesis protein murJ murJ murJ murJ murJ murJ murJ 0 1 NA RnaseP RnaseP RnaseP RnaseP RnaseP RnaseP RnaseP RnaseP RnaseP 1 J 50S ribosomal protein L13 rplM rplM rplM rplM rplM rplM rplM rplM 1 J 30S ribosomal protein S9 rpsI rpsI rpsI rpsI rpsI rpsI rpsI rpsI 1 O Iron-sulfur cluster insertion protein ErpA erpA_1 erpA_1 erpA_1 erpA_1 erpA_1 erpA_1 erpA_1 erpA 2 E 4.2.1.9 Dihydroxy-acid dehydratase ilvD ilvD ilvD ilvD ilvD ilvD ilvD 0 1 NA tmRNA tmRNA tmRNA tmRNA tmRNA tmRNA tmRNA tmRNA tmRNA 1 NA hypothetical protein hyp1 hyp1 hyp1 hyp1 hyp1 hyp1 hyp1 hyp1 1 E prephenate dehydratase pheA pheA pheA pheA pheA pheA pheA pheA 1 E 2.5.1.19 3-phosphoshikimate 1-carboxyvinyltransferase aroA aroA aroA aroA aroA aroA aroA 0 1 F 2.7.4.25 cytidylate kinase cmk 0 0 0 0 0 0 0 1 J 30S ribosomal protein S1 rpsA rpsA rpsA rpsA rpsA rpsA rpsA rpsA 1 J 30S ribosomal protein S16 rpsP rpsP rpsP rpsP rpsP rpsP rpsP rpsP 1 J 50S ribosomal protein L19 rplS rplS rplS rplS rplS rplS rplS rplS 1 E 1.5.1.20 5,10-methylenetetrahydrofolate reductase metF metF metF metF metF metF metF metF 1 C putative Fe(2+)-trafficking protein yggX yggX yggX yggX yggX yggX yggX yggX 1 J arginyl-tRNA synthetase 0 argS argS argS argS argS argS 0 1 O 60 kDa chaperonin groL groL groL groL groL groL groL groL 1 O 10 kDa chaperonin groS groS groS groS groS groS groS groS 1 L 2.7.7.7 DNA polymerase III subunit alpha dnaE dnaE dnaE dnaE dnaE dnaE dnaE dnaE 1 J Ribosomal silencing factor RsfS rsfS rsfS rsfS rsfS rsfS rsfS rsfS rsfS 1 E 2.2.1.6 Acetolactate synthase isozyme 3 large subunit ilvB ilvB ilvB ilvB ilvB ilvB ilvB ilvB 1 E 1.1.1.86 Ketol-acid reductoisomerase ilvC ilvC ilvC ilvC ilvC ilvC ilvC ilvC 1 E 2.3.3.13 2-isopropylmalate synthase leuA leuA leuA leuA leuA leuA leuA_1 leuA 1 J 30S ribosomal protein S15 rpsO_1 rpsO_1 rpsO_1 rpsO_1 rpsO_1 rpsO_1 rpsO_1 rpsO 2 NA 16S ribosomal RNA 0 16S rRNA 16S rRNA 16S rRNA 16S rRNA 16S rRNA 16S rRNA 16S rRNA 2 NA 23S ribosomal RNA 0 23S rRNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA 2 NA 5S ribosomal RNA 5S rRNA 5S rRNA 5S rRNA 5S rRNA 5S rRNA 5S rRNA 5S rRNA 5S rRNA 2 M 2.1.1.199 Ribosomal RNA small subunit methyltransferase H rsmH_1 rsmH_1 rsmH_1 rsmH_1 rsmH_1 rsmH_1 rsmH_1 rsmH 2 J 50S ribosomal protein L21 rplU plasmid rplU rplU rplU rplU rplU rplU rplU 1 J 50S ribosomal protein L27 rpmA plasmid rpmA rpmA rpmA rpmA rpmA rpmA rpmA 1 L 2.7.7.7 DNA polymerase III subunit epsilon dnaQ (inversion startdnaQ dnaQ dnaQ dnaQ dnaQ dnaQ dnaQ 1 E 6.3.5.5 Carbamoyl-phosphate synthase small chain carA carA 0 carA 0 0 0 0 1 E 6.3.5.5 Carbamoyl-phosphate synthase large chain carB carB carB carB carB carB carB 0 1 J 2.1.1.166 Ribosomal RNA large subunit methyltransferase E rlmE rlmE rlmE rlmE rlmE rlmE rlmE rlmE 1 J 2.1.1.185 23S rRNA 2'-O-ribose G2251 methyltransferase rlmB 0 0 0 0 0 0 0 1 E 4.3.2.1 Argininosuccinate lyase argH argH argH argH argH argH argH 0 1 J 50S ribosomal protein L31 type B rpmE rpmE rpmE rpmE rpmE rpmE rpmE rpmE 1 E 4.2.3.1 Threonine synthase thrC thrC thrC thrC thrC thrC thrC 0 1 E 1.1.1.3 Homoserine dehydrogenase thrA thrA thrA thrA thrA thrA thrA thrA 1 L 3.6.4.12 Replicative DNA helicase dnaB dnaB dnaB dnaB dnaB dnaB dnaB dnaB 1 J 50S ribosomal protein L9 0 rplI rplI rplI rplI rplI rplI rplI 1 J 30S ribosomal protein S18 rpsR rpsR rpsR rpsR rpsR rpsR rpsR rpsR 1 J 30S ribosomal protein S6 rpsF rpsF rpsF rpsF rpsF rpsF rpsF rpsF 1 NA Dihydrolipoyl dehydrogenase 0 lpd lpd lpd lpd lpd lpd 0 1 NA 2-oxoglutarate dehydrogenase 0 0 sucA 0 0 0 0 0 1 J Translation initiation factor IF-2 infB infB infB infB infB infB infB infB 1 NA hypothetical protein hyp 0 0 0 0 0 0 0 1 J 6.1.1.20 phenylalanyl-tRNA synthetase, beta subunit pheT 0 0 0 0 0 0 0 1 J 6.1.1.20 phenylalanyl-tRNA synthetase subunit alpha pheS 0 0 0 0 0 0 0 1 J 50S ribosomal protein L20 rplT rplT rplT rplT rplT rplT rplT rplT 1 J 50S ribosomal protein L35 rpmI rpmI rpmI rpmI rpmI rpmI rpmI rpmI 1 J Translation initiation factor IF-3 infC infC infC infC infC infC infC infC 1 J 6.1.1.3 threonyl-tRNA synthetase thrS 0 0 0 0 0 0 0 1 E 4.2.3.5 Chorismate synthase aroC aroC aroC aroC aroC aroC aroC aroC 1 JF 3.5.4.33 tRNA-specific adenosine deaminase tadA 0 0 0 0 0 0 0 1 J 6.1.1.9 valyl-tRNA synthetase valS 0 0 0 0 0 0 0 1 O SsrA-binding protein smpB smpB smpB smpB smpB smpB smpB 0 1 J ribosome recycling factor frr 0 0 0 0 0 0 0 1 J Elongation factor Ts 0 tsf 0 0 0 0 0 0 1 J 30S ribosomal protein S2 rpsB rpsB rpsB rpsB rpsB rpsB rpsB rpsB 1 E 2.3.1.117 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate dapD dapD dapD dapD dapD dapD dapD dapD 1 NA hypothetical protein hyp 0 0 0 0 0 0 0 1 J glutamyl-tRNA synthetase gltX 0 0 0 0 0 0 0 1 E 2.7.2.4 Aspartokinase lysC lysC lysC lysC lysC lysC lysC lysC 1 J 6.3.4.19 tRNA(Ile)-lysidine synthetase tilS 0 0 0 0 0 0 0 1 J 6.1.1.16 Cysteine--tRNA ligase cysS 0 cysS cysS cysS cysS cysS 0 1 E 4.1.3.27 anthranilate synthase component I trpE 0 0 trpE 0 0 trpE 0 1 E 2.6.1.85 anthranilate synthase component II trpG 0 0 trpG trpG trpG trpG 0 1 E 2.4.2.18 anthranilate synthase component II trpD 0 0 trpD trpD trpD trpD 0 1 E 4.1.1.48 Indole-3-glycerol phosphate synthase trpC trpC 0 0 0 0 trpC 0 1 J Peptide chain release factor 1 prfA prfA 0 0 0 0 0 0 1 J 2.1.1.- Release factor glutamine methyltransferase prmC prmC 0 0 0 0 0 0 1 C 6.2.1.5 succinyl-CoA synthetase subunit alpha sucC 0 0 0 0 0 0 0 1 C 6.2.1.5 succinyl-CoA ligase subunit beta sucD 0 0 0 0 0 0 0 1 J 6.1.1.5 isoleucyl-tRNA synthetase ileS 0 0 0 0 0 0 0 1 J 50S ribosomal protein L28 rpmB rpmB rpmB rpmB rpmB rpmB rpmB rpmB 1 J 50S ribosomal protein L33 rpmG rpmG rpmG rpmG rpmG rpmG rpmG rpmG 1 K Cold shock-like protein CspA cspA cspA cspA cspA cspA cspA cspA cspA 1 NA cspA cspA cspA cspA cspA cspA cspA cspA cspA 1 E 4.3.3.7 4-hydroxy-tetrahydrodipicolinate synthase dapA dapA dapA dapA dapA dapA dapA dapA 1 J Peptide chain release factor 1 prfB prfB prfB prfB 0 prfB prfB 0 1 C 2Fe-2S ferredoxin fdx_2 fdx_2 fdx_2 fdx_2 fdx_2 0 fdx_2 0 2 O Iron-sulfur cluster assembly protein iscA erpA_2 erpA_2 erpA_2 0 erpA_2 erpA_2 0 2 O NifU-like protein iscU iscU iscU iscU iscU iscU iscU iscU 1 E 2.8.1.7 Cysteine desulfurase iscS (inversion end) iscS iscS iscS iscS iscS iscS 0 1 NA hypothetical protein 0 0 hyp2 hyp2 0 0 0 0 1 NA hypothetical protein 0 0 0 hyp3 (SP) 0 0 0 0 1 C dihydrolipoamide acetyltransferase component of pyruvat 0 0 0 0 aceF 0 0 0 1 C pyruvate dehydrogenase 0 0 aceE aceE 0 aceE 0 0 1 O 1.11.1.15 hydroperoxide reductase ahpC 0 0 0 0 0 0 0 1 E 1.1.1.25 shikimate 5-dehydrogenase aroE 0 0 0 0 0 0 0 1 E 4.2.1.10 3-dehydroquinate dehydratase aroD 0 0 0 0 0 0 0 1 J 6.1.1.15 prolyl-tRNA synthetase proS 0 0 0 0 0 0 0 1 J 6.1.1.18 glutaminyl-tRNA synthetase glnS 0 0 0 0 0 0 0 1 E ATP phosphoribosyltransferase regulatory subunit 0 hisZ hisZ hisZ hisZ hisZ hisZ 0 1 J GTPase Der der der der der der der der der 1 J 6.1.1.21 histidyl-tRNA synthetase hisS 0 0 0 0 0 0 0 1 J 2.1.1.- Dual-specificity RNA methyltransferase RlmN 0 rlmN rlmN rlmN rlmN rlmN rlmN rlmN 1 F 2.7.4.6 nucleoside diphosphate kinase ndk 0 ndk ndk ndk ndk ndk 0 1 L 2.7.7.7 DNA polymerase III subunit tau dnaX dnaX dnaX dnaX dnaX dnaX dnaX dnaX 1 L Single-stranded DNA-binding protein ssb ssb ssb ssb ssb ssb ssb 0 1 R Stringent starvation protein B sspB sspB sspB sspB sspB sspB sspB sspB 1 E 3.6.1.31 Phosphoribosyl-ATP pyrophosphatase hisE hisE hisE hisE hisE hisE hisE hisE 1 E 4.1.3.- Imidazole glycerol phosphate synthase subunit hisF hisF hisF hisF hisF hisF hisF hisF 1 E 5.3.1.16 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylid hisA hisA hisA hisA hisA hisA hisA hisA 1 E 2.4.2.- Imidazole glycerol phosphate synthase subunit hisH hisH hisH hisH hisH hisH hisH hisH 1 E 4.2.1.19 Imidazoleglycerol-phosphate dehydratase hisB hisB hisB hisB hisB hisB hisB 0 1 E 2.4.2.17 ATP phosphoribosyltransferase hisG hisG hisG hisG hisG hisG hisG 0 1 E 4.2.3.4 3-dehydroquinate synthase aroB aroB aroB aroB aroB aroB aroB aroB 1 E 2.7.1.71 Shikimate kinase aroK aroK aroK aroK aroK aroK aroK aroK 1 J 50S ribosomal protein L17 rplQ rplQ rplQ rplQ rplQ rplQ rplQ rplQ 1 K 2.7.7.6 DNA-directed RNA polymerase subunit alpha rpoA rpoA rpoA rpoA rpoA rpoA rpoA rpoA 1 J 30S ribosomal protein S4 rpsD rpsD rpsD rpsD rpsD rpsD rpsD rpsD 1 J 30S ribosomal protein S11 rpsK rpsK rpsK rpsK rpsK rpsK rpsK rpsK 1 J 30S ribosomal protein S13 rpsM rpsM rpsM rpsM rpsM rpsM rpsM rpsM 1 J 50S ribosomal subunit protein L36 rpmJ rpmJ rpmJ rpmJ rpmJ rpmJ rpmJ rpmJ 1 J Translation initiation factor IF-1 infA infA infA infA infA infA infA infA 1 NA hypothetical protein hyp4 0 0 0 0 0 0 0 1 J 50S ribosomal protein L15 rplO rplO rplO rplO rplO rplO rplO rplO 1 J 50S ribosomal protein L30 rpmD rpmD rpmD rpmD rpmD rpmD rpmD rpmD 1 J 30S ribosomal protein S5 rpsE rpsE rpsE rpsE rpsE rpsE rpsE rpsE 1 J 50S ribosomal protein L18 rplR rplR rplR rplR rplR rplR rplR rplR 1 J 50S ribosomal protein L6 rplF rplF rplF rplF rplF rplF rplF rplF 1 J 30S ribosomal protein S8 rpsH rpsH rpsH rpsH rpsH rpsH rpsH rpsH 1 J 30S ribosomal protein S14 rpsN rpsN rpsN rpsN rpsN rpsN rpsN rpsN 1 J 50S ribosomal protein L5 rplE rplE rplE rplE rplE rplE rplE rplE 1 J 50S ribosomal protein L14 rplN rplN rplN rplN rplN rplN rplN rplN 1 J 30S ribosomal protein S17 rpsQ rpsQ rpsQ rpsQ rpsQ rpsQ rpsQ rpsQ 1 J putative 50S ribosomal subunit protein L29 rpmC rpmC rpmC rpmC rpmC rpmC rpmC rpmC 1 J 50S ribosomal protein L16 rplP rplP rplP rplP rplP rplP rplP rplP 1 J 30S ribosomal protein S3 rpsC rpsC rpsC rpsC rpsC rpsC rpsC rpsC 1 J 50S ribosomal protein L22 rplV rplV rplV rplV rplV rplV rplV rplV 1 J 30S ribosomal protein S19 rpsS rpsS rpsS rpsS rpsS rpsS rpsS rpsS 1 J 50S ribosomal protein L2 rplB rplB rplB rplB rplB rplB rplB rplB 1 J putative 50S ribosomal subunit protein L23 rplW rplW rplW rplW rplW rplW rplW rplW 1 J 50S ribosomal protein L4 rplD rplD rplD rplD rplD rplD rplD rplD 1 J 50S ribosomal protein L3 rplC rplC rplC rplC rplC rplC rplC rplC 1 J 30S ribosomal protein S10 rpsJ rpsJ rpsJ rpsJ rpsJ rpsJ rpsJ rpsJ 1 J Elongation factor Tu tufA tufA tufA tufA tufA tufA tufA tufA 1 J Elongation factor G fusA fusA fusA fusA fusA fusA fusA fusA 1 J 30S ribosomal protein S7 rpsG rpsG rpsG rpsG rpsG rpsG rpsG rpsG 1 J 30S ribosomal protein S12 rpsL rpsL rpsL rpsL rpsL rpsL rpsL rpsL 1 K 2.7.7.6 DNA-directed RNA polymerase subunit beta' rpoC rpoC rpoC rpoC rpoC rpoC rpoC rpoC 1 K 2.7.7.6 DNA-directed RNA polymerase subunit beta rpoB rpoB rpoB rpoB rpoB rpoB rpoB rpoB 1 J 50S ribosomal protein L7/L12 rplL rplL rplL rplL rplL rplL rplL rplL 1 J 50S ribosomal protein L10 rplJ rplJ rplJ rplJ rplJ rplJ rplJ rplJ 1 J 50S ribosomal subunit protein L1 rplA 0 0 0 0 0 0 0 1 J 50S ribosomal protein L11 rplK rplK rplK rplK rplK rplK rplK rplK 1 M 2.1.1.199 Ribosomal RNA small subunit methyltransferase H rsmH_2 rsmH_2 rsmH_2 rsmH_2 rsmH_2 rsmH_2 rsmH_2 0 2 NA 5S ribosomal RNA 5SrRNA 5SrRNA 5SrRNA 5SrRNA 5SrRNA 5SrRNA 5SrRNA 5S rRNA 2 NA 23S ribosomal RNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA 23S rRNA 2 NA 16S ribosomal RNA 16S rRNA 16S rRNA 16S rRNA 16S rRNA 16S rRNA 16S rRNA 16S rRNA 16S rRNA 2 J 30S ribosomal protein S15 0 0 rpsO_2 rpsO_2 rpsO_2 rpsO_2 rpsO_2 0 2 E 2.3.3.13 2-isopropylmalate synthase 0 0 0 0 0 0 leuA_2 0 2 J 6.3.5.- glutamyl-tRNA(Gln) amidotransferase, B subunit gatB 0 0 0 0 0 0 0 1 J 6.3.5.- putative glutamyl-tRNA(Gln) amidotransferase, A subunit gatA 0 0 0 0 0 0 0 1 NA hypothetical protein hyp 0 0 0 0 0 0 0 1 J 2.1.2.9 methionyl-tRNA formyltransferase fmt 0 0 0 0 0 0 0 1 J 3.5.1.88 peptide deformylase def 0 0 0 0 0 0 0 1 F 2.7.6.1 Ribose-phosphate pyrophosphokinase prs prs prs prs prs prs prs prs 1 J 50S ribosomal protein L25 rplY rplY rplY rplY rplY rplY rplY rplY 1 J tRNA modification GTPase TrmE 0 mnmE mnmE mnmE mnmE 0 mnmE 0 1 J 3.1.26.5 Ribonuclease P protein component 0 rnpA rnpA rnpA rnpA 0 rnpA 0 1 J 50S ribosomal protein L34 0 rpmH rpmH rpmH rpmH rpmH rpmH rpmH 1 L 2.7.7.7 DNA polymerase III subunit beta 0 dnaN dnaN dnaN dnaN dnaN dnaN dnaN 1 J 2.1.1.171 16S rRNA m(2)G966-methyltransferase rsmD 0 0 0 0 0 0 0 1 NA rRNA maturation factor hyp 0 0 0 0 0 0 0 1 J 6.1.1.14 glycyl-tRNA synthetase subunit alpha glyQ 0 0 0 0 0 0 0 1 NA hypothetical protein TPPAVE_204 hyp 0 0 0 0 0 0 0 1 J 2.1.1.182 dimethyladenosine transferase rsmA 0 0 0 0 0 0 0 1 J 6.1.1.12 aspartyl-tRNA synthetase aspS 0 0 0 0 0 0 0 1 G 2.2.1.2 Transaldolase talB talB talB talB talB talB talB talB 1 NA hypothetical protein hyp 0 0 0 0 0 0 0 1 J 6.1.1.4 Leucine--tRNA ligase leuS 0 0 0 0 0 0 0 1 E 1.17.1.8 4-hydroxy-tetrahydrodipicolinate reductase dapB dapB dapB dapB dapB dapB dapB 0 1 C 1.1.1.37 Malate dehydrogenase 0 mdh mdh mdh mdh mdh mdh mdH 1 136(7) 132(13) 134(15) 125(16) 124(17) 116(31) 107(4) 1b)

Pathway Arg Asd Lys Thr Chor Phe Trp Ile/Val Leu His Cys Met Gene carA carB OAT argF|I argG argH lysC asd dapA dapB dapD argD dapE dapF lysA thrA thrB thrC aroG aroB aroD|Q aroE aroK aroA aroC pheA AAT trpE trpG trpD trpC trpA trpB ilvN ilvB ilvC ilvD BCA leuA leuC leuD leuB BCA hisG hisI|E hisA hisF hisH hisB hisC hisB|N hisD cysE cysK CGL metE TPPAVE 11 0 1 1 1 1 1 1 1 1 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 0 1 1 1 0 1 1 1 1 0 1 1 1 1 1 1 0 0 0 0 0 0 1 PAVE 00 4 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 4 0 TPMHIR 110 1 1 1 1 1 1 2 1 0 0 0 0 1 1 1 1 1 0 0 1 1 1 1 0 0 0 0 1 0 0 0 1 1 1 0 1 1 1 1 0 1 1 1 1 1 1 0 0 0 0 0 0 1 DEMHIR 110 2 0 2 0 0 2 1 2 0 0 2 0 0 0 0 0 0 1 0 1 0 0 0 0 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 MHIR 00 4 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 4 0 TPFVIR 02 0 0 1 1 1 0 1 2 1 0 0 0 0 1 1 1 1 1 0 0 1 1 1 1 0 0 0 0 0 0 0 0 1 1 1 0 1 1 1 1 0 1 1 1 1 1 1 0 0 0 0 0 0 1 GEFVIR 11 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 FVIR 00 4 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 3 4 0 TPPLON 220 0 1 1 1 2 1 1 1 0 0 0 0 1 1 1 1 1 0 0 1 1 1 1 0 2 1 1 0 0 0 0 1 1 1 0 1 1 1 1 0 1 1 1 1 1 1 0 0 0 0 0 0 1 PLON 1 & 2111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 PLON 00 4 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 3 4 0 TPPCIT 02 0 2 1 2 1 0 1 2 1 0 0 0 0 1 1 1 1 1 0 0 1 1 1 1 0 0 1 1 0 0 0 0 1 1 1 0 1 1 1 1 0 1 1 1 1 1 1 0 0 0 0 0 0 1 MEPCIT 11 0 1 0 1 0 1 1 1 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 1 1 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 PCIT 00 4 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 3 4 0 TPPMAR020 0 1 1 1 0 1 2 1 0 0 0 0 1 1 1 1 1 0 0 1 1 1 1 0 0 2 1 0 0 0 0 1 1 1 0 1 2 2 2 0 1 1 1 1 1 1 0 0 0 0 0 0 1 MEPMAR110 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 1 0 1 1 1 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 PMAR 00 4 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 3 4 0 TPTPER 020 2 2 1 1 0 1 2 1 0 0 0 0 1 2 2 1 1 0 0 1 2 1 1 0 2 1 1 2 2 0 0 1 1 2 0 1 2 0 2 0 2 1 1 1 1 2 0 0 0 0 0 0 1 HETPER 110 1 1 1 0 1 0 1 0 0 0 0 0 0 1 1 0 0 1 0 1 1 0 0 0 1 1 0 1 1 1 0 0 1 1 0 0 1 1 1 0 1 1 1 0 0 1 0 1 0 0 0 0 0 TPER 00 4 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 3 4 0

Pathway Riboflavin biosynthesis Biotin biosynth. Peptidoglycan metabolism Gene ribA ribD ribB ribE|H ribC bioA bioB bioD murA murB murC murI murD murE alr ddlAB murF mraY murG TPPAVE 00 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 PAVE 33 0 0 0 3 3 3 0 0 0 0 0 0 0 0 0 0 0 TPMHIR 000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 DEMHIR 000 1 1 0 0 0 1 1 1 0 1 1 0 1 1 1 1 MHIR 33 0 0 0 3 3 3 0 0 0 0 0 0 0 0 0 0 0 TPFVIR 00 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 GEFVIR 00 0 1 0 0 0 0 2 1 0 0 0 1 0 0 1 1 1 FVIR 33 0 0 0 3 3 3 3 2 0 0 0 0 0 3 0 0 0 TPPLON 000 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 PLON 1 & 2111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 PLON 33 0 0 0 3 3 3 3 3 3 0 3 3 0 3 3 0 0 TPPCIT 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 MEPCIT 00 0 1 1 0 0 0 0 0 2 0 0 0 0 0 0 1 1 PCIT 33 0 0 0 3 3 3 3 3 3 0 3 3 0 3 3 0 0 TPPMAR000 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 MEPMAR000 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 PMAR 33 0 0 0 3 3 3 0 0 0 0 0 0 0 0 0 0 0 TPTPER 000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HETPER 000 1 1 0 0 0 1 1 1 0 1 1 0 0 1 1 1 TPER 33 0 0 0 3 3 3 0 0 0 0 0 0 0 3 0 0 0

Gene category Translation-related proteins Aminoacyl tRNA synthetases Gene infA infB infC tufA fusA tsf prfA prfB rrf fmt def argS cysS glnS gltX ileS leuS valS alaS asnS aspS tyrS trpS thrS serS proS pheST metG lysS hisS glySQ TPPAVE 11 1 1 1 0 1 1 1 1 1 0 1 1 1 1 1 1 0 0 1 0 0 1 1 1 1 0 0 1 1 PAVE 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TPMHIR 111 1 1 1 1 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 DEMHIR 111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 MHIR 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TPFVIR 11 1 1 1 0 0 2 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 GEFVIR 11 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 FVIR 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TPPLON 111 1 1 0 0 2 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 PLON 1 & 2111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 PLON 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TPPCIT 11 1 1 1 0 0 0 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 MEPCIT 11 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 PCIT 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TPPMAR111 1 1 0 0 2 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 MEPMAR111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 PMAR 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 TPTPER 111 1 1 0 0 2 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 HETPER 111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 TPER 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2)

MHIR FVIR PCIT (reassembly) PLON TPER PMAR Total assembly size (bp) 163,044,544 304,570,832 377,829,872 284,990,201 237,582,518 191,208,351 Total number of scaffolds 12,889 32,723 167,514 66,857 80,386 60,102 Number of scaffolds >= 1000 bp 8,043 21,984 64,930 40,284 58,090 33,617 Largest scaffold (bp) 393,850 322,873 82,122 182,788 54,847 76,575 N50 | N75 47,025 | 22,300 25,562 | 12,551 7,078 | 3,639 10,126 | 4,908 4,681 | 2,689 6,799 | 3,788 G+C (%) 35.3 34.2 34.3 33.7 31.5 36.1 # N's per 100 kbp 97.8 20.7 152.6 26.2 8.8 34.1 CEGMA complete (out of 248) 239 (96.37%) 239 (96.37%) 236 (95.16%) 229 (92.34%) 236 (95.16%) 242 (97.58%) CEGMA complete plus partial 246 (99.19 %) 243 (97.98%) 245 (98.79%) 244 (98.39%) 247 (99.60%) 245 (98.79%) BUSCOs Eukaryota (n:429) C:85% C:84% C:80% C:78% C:77% C:82% [complete, duplicated, [D:7.4%],F:3.0%,M:11% [D:5.1%],F:3.9%,M:11% [D:6.9%],F:7.2%,M:11% [D:3.4%],F:9.0%,M:12% [D:4.1%],F:10%,M [D:5.8%],F:5.5%,M:11% fragmented, missing] :12% BUSCOs Arthropoda (n:2675) C:76% C:76% C:71% C:70% C:66% C:72% [complete, duplicated, [D:3.5%],F:14%,M:9.4% [D:3.3%],F:13%,M:9.9% [D:4.8%],F:16%,M:12% [D:2.3%],F:16%,M:13% [D:2.3%],F:16%,M [D:3.0%],F:15%,M:12% fragmented, missing] :16% 3)

Gene Scaffold name, length, and k-mer coverage (merged k-mers) category HGT MHIR FVIR PCIT PLON TPER PMAR

bioA NODE_1095_length_43437_cov_30.5427_ID_2189 NODE_2692_length_29264_cov_45.8233_ID_5383 NODE_1158_length_22396_cov_21.4066_ID_2315 NODE_13454_length_6321_cov_92.0554_ID_26907 NODE_5755_length_7749_cov_42.2835_ID_11509 NODE_15638_length_3963_cov_48.9007_ID_31275 NODE_3702_length_14332_cov_30.9377_ID_7403

bioB NODE_206_length_103677_cov_26.441_ID_411 NODE_1537_length_39445_cov_37.3168_ID_3073 NODE_1118_length_22642_cov_22.6156_ID_223 NODE_11460_length_7325_cov_111.564_ID_22919 NODE_386_length_19325_cov_14.7471_ID_771 NODE_1524_length_15917_cov_46.9302_ID_3047

bioD NODE_407_length_76514_cov_32.3402_ID_813 NODE_10823_length_7722_cov_46.6698_ID_21645 NODE_17050_length_6003_cov_28.5577_ID_34099 NODE_6031_length_11780_cov_41.4639_ID_12061 NODE_6741_length_7177_cov_24.074_ID_13481 NODE_21598_length_2996_cov_39.4689_ID_43195

ribA NODE_36_length_178330_cov_31.6542_ID_71 NODE_854_length_51798_cov_32.6572_ID_1707 NODE_12118_length_7709_cov_9.0878_ID_24235 NODE_10187_length_8129_cov_45.4534_ID_20373 NODE_22346_length_3461_cov_14.5056_ID_44691 NODE_1442_length_16334_cov_42.4795_ID_2883

ribD NODE_3471_length_11646_cov_37.1715_ID_6941 NODE_4692_length_19496_cov_33.1948_ID_9383 NODE_22359_length_4879_cov_37.4948_ID_44717 NODE_4881_length_13443_cov_38.1156_ID_9761 NODE_10832_length_5498_cov_46.801_ID_21663 NODE_9906_length_5436_cov_52.0394_ID_19811

B-vitamin metabolism panC NA NODE_1895_length_35506_cov_42.1294_ID_3789 NA NA NA NA

cysK NA NODE_1251_length_43541_cov_36.8307_ID_2501 NODE_5169_length_12355_cov_8.40561_ID_10337 NODE_6319_length_11425_cov_96.4325_ID_12637 NODE_5086_length_8195_cov_13.8618_ID_10171 NODE_317_length_27801_cov_43.9358_ID_633 NODE_1576_length_20002_cov_20.754_ID_3151 NODE_28193_length_2829_cov_70.8861_ID_56385 NODE_3332_length_15001_cov_36.8971_ID_6663

dapF NODE_2062_length_24285_cov_26.5533_ID_4123 NODE_5954_length_15883_cov_38.1428_ID_11907 NODE_962_length_23955_cov_17.9039_ID_1923 NODE_20465_length_4268_cov_36.1901_ID_40929 NODE_6454_length_7335_cov_15.475_ID_12907 NODE_28986_length_1694_cov_175.113_ID_57971

lysA NODE_59_length_148786_cov_27.0847_ID_117 NODE_4_length_297799_cov_35.7395_ID_7 NODE_30394_length_3749_cov_14.3249_ID_60787 NODE_8644_length_9224_cov_44.8211_ID_17287 NODE_7424_length_6818_cov_19.9689_ID_14847 NODE_1012_length_18919_cov_46.8622_ID_2023

tms NODE_1166_length_41617_cov_26.8228_ID_2331 NA NODE_6634_length_10945_cov_16.722_ID_13267 NODE_13050_length_6499_cov_55.789_ID_26099 NODE_34438_length_2417_cov_29.2671_ID_68875 NODE_8338_length_6146_cov_45.9414_ID_16675 NODE_5474_length_3263_cov_6.97353_ID_10947 NODE_7749_length_10066_cov_15.9657_ID_15497 NODE_25746_length_3290_cov_140.852_ID_51491 NODE_6297_length_7425_cov_23.0654_ID_12593 NODE_4174_length_9644_cov_62.5393_ID_8347 NODE_11115_length_8160_cov_6.39149_ID_22229 NODE_5435_length_12567_cov_33.0441_ID_10869 NODE_19614_length_3786_cov_320.495_ID_39227 NODE_12227_length_4696_cov_36.585_ID_24453 NODE_3006_length_17561_cov_42.3735_ID_6011 NODE_34895_length_2381_cov_28.3895_ID_69789 Amino acid metabolism

murA NA NODE_460_length_66309_cov_43.1341_ID_919 NODE_11354_length_8054_cov_20.7208_ID_22707 NODE_115_length_61230_cov_35.6962_ID_229 NA NA

murB NA NODE_12758_length_5717_cov_33.0994_ID_25515 NODE_369_length_31461_cov_35.5337_ID_737 NODE_20534_length_4254_cov_49.7111_ID_41067 NA NA [possible pseudogene]

murC NA NA NODE_1601_length_19897_cov_15.255_ID_3201 NODE_22793_length_3812_cov_49.6747_ID_45585 NA NA

murD NA NA NODE_13782_length_7024_cov_6.68302_ID_27563 NODE_24019_length_3587_cov_40.034_ID_48037 NA NA

murE NA NA NODE_6492_length_11057_cov_8.87711_ID_12983 NODE_17363_length_4962_cov_30.2712_ID_34725 NA NA

murF NA NA NODE_594_length_27680_cov_14.487_ID_1187 NODE_4718_length_13704_cov_42.3641_ID_9435 NA NA

amiD NODE_127_length_124060_cov_24.8687_ID_253 NA NODE_37192_length_2984_cov_10.5592_ID_74383 NA NA NA Peptidoglycan metabolism mltB NA NA NODE_19703_length_5383_cov_17.8893_ID_39405 NA NA NA

b-lactamase NA NODE_5744_length_16411_cov_32.7118_ID_11487 NODE_41741_length_2494_cov_87.3403_ID_83481 NODE_4491_length_14129_cov_34.1056_ID_8981 NODE_27744_length_2940_cov_11.9002_ID_55487 NODE_1286_length_17279_cov_50.7695_ID_2571 NODE_15550_length_3679_cov_32.2136_ID_31099 NODE_9718_length_8869_cov_20.8995_ID_19435 NODE_16462_length_5218_cov_33.5475_ID_32923 NODE_14178_length_4665_cov_12.505_ID_28355 NODE_19161_length_5497_cov_22.6318_ID_38321 NODE_27195_length_3022_cov_166.648_ID_54389 NODE_28052_length_2913_cov_15.796_ID_56103 NODE_24154_length_3566_cov_51.4341_ID_48307 NODE_6508_length_7297_cov_15.3206_ID_13015 NODE_2155_length_20606_cov_37.4645_ID_4309

ddlB NA NODE_52_length_125214_cov_31.955_ID_103 NODE_2593_length_16610_cov_22.7297_ID_5185 NODE_7871_length_9825_cov_39.2015_ID_15741 NODE_29017_length_2831_cov_20.6286_ID_58033 NA

DUR1,2 NA NA NODE_1398_length_20965_cov_17.3176_ID_2795 NODE_2264_length_20156_cov_44.516_ID_4527 NA NA [both urea carboxylase and allophanate hydrolase] [only allophanate hydrolase]

Other gshA NA NA NODE_33435_length_3399_cov_30.6965_ID_66869 NA NA NA

Type III effector NA NODE_4508_length_20239_cov_32.5829_ID_9015 NODE_2326_length_17345_cov_10.1749_ID_4651 NODE_935_length_28982_cov_40.2817_ID_1869 NODE_174_length_23133_cov_18.8075_ID_347 NODE_1751_length_14972_cov_78.5305_ID_3501 NODE_932_length_49868_cov_38.3909_ID_1863 [+ more than 10 other copies] [+ more than 10 other copies] [+ more than 10 other copies] NODE_31_length_48312_cov_40.329_ID_61 NODE_955_length_49231_cov_37.1248_ID_1909 NODE_4166_length_9650_cov_48.8279_ID_8331 NODE_444_length_67489_cov_35.7914_ID_887 NODE_6268_length_7513_cov_43.5062_ID_12535 NODE_1448_length_40490_cov_35.3609_ID_2895

chitinase NA NA NA NA NODE_1934_length_11960_cov_15.4634_ID_3867 NODE_378_length_26435_cov_39.2884_ID_755

rlmI NA NA NODE_8054_length_9863_cov_19.3512_ID_16107 NA NA NA

AAA-atpases NODE_36_length_178330_cov_31.6542_ID_71 NODE_854_length_51798_cov_32.6572_ID_1707 NODE_3869_length_14076_cov_36.1782_ID_7737 NODE_3376_length_16544_cov_40.2929_ID_6751 NODE_4822_length_8396_cov_19.8446_ID_9643 NODE_1442_length_16334_cov_42.4795_ID_2883 [+ numerous other hits] [+ numerous other hits] [+ numerous other hits] [+ numerous other hits] [+ numerous other hits] [+ numerous other hits]

Ankyrin repeat protein NA NODE_942_length_49564_cov_41.7943_ID_1883 NODE_1287_length_21600_cov_20.3177_ID_2573 NODE_1876_length_21872_cov_38.6857_ID_3751 NODE_2986_length_10256_cov_23.7463_ID_5971 NODE_1130_length_18092_cov_47.7632_ID_2259 (likely opposite HGT [+ numerous other hits to ankyrin proteins] [+ numerous other hits to ankyrin proteins] [+ numerous other hits to ankyrin proteins] [+ numerous other hits to ankyrin proteins] [+ numerous other hits to ankyrin proteins] direction, i.e. from insects to Wolbachia) 4)

HGT Phylogenetic origin Present in several Other bacterial Insect genes on the Overall HGT evidence (does not necessarily mean donor) mealybug species and genes on the insect scaffolds forms a single clade scaffold bioA Alphaproteobacteria: Rickettsiales Yes No Yes strong support bioB Alphaproteobacteria: Rickettsiales Yes No Yes strong support bioD Alphaproteobacteria: Rickettsiales Yes No Yes strong support ribA Gammaproteobacteria: Enterobacteriales Yes AAA atpase HGT Yes strong support ribD Alphaproteobacteria: Rickettsiales Yes No Yes strong support panC Betaproteobacteria No, only FVIR No Yes moderate support cysK Gammaproteobacteria: Enterobacteriales Yes No Yes strong support dapF Alphaproteobacteria: Rickettsiales Yes No Yes strong support lysA Alphaproteobacteria: Rickettsiales Yes No Yes strong support tms Gammaprotobacteria or Betaproteobacteria Yes No Yes strong support murA Gammaproteobacteria: Enterobacteriales Yes No Yes strong support murB Bacteroidetes Yes No Yes strong support murC Bacteroidetes (PCIT) Yes, but different origin No Yes moderate support Alphaproteobacteria: Rickettsiales (PLON) murD Alphaproteobacteria: Rickettsiales Yes No Yes strong support murE Alphaproteobacteria: Rickettsiales Yes No No moderate support murF Alphaproteobacteria: Rickettsiales Yes No Yes strong support amiD Gammaproteobacteria: Enterobacteriales (PCIT) Yes, but different origin No Yes moderate support Alphaproteobacteria: Rickettsiales (MHIR) mltB Gammaproteobacteria: Enterobacteriales No, only PCIT No No weaker support b-lactamase Gammaproteobacteria: Enterobacteriales Yes No Yes strong support ddlB Alphaproteobacteria: Rickettsiales Yes No Yes strong support DUR1,2 Gammaproteobacteria: Enterobacteriales Yes, but different origin No No moderate support gshA Gammaproteobacteria: Enterobacteriales No, only PCIT No No weaker support Type III effector Gammaprotobacteria or Betaproteobacteria Yes No Yes strong support chitinase Gammaprotobacteria or Betaproteobacteria Yes No Yes strong support rlmI Gammaproteobacteria: Enterobacteriales No, only PCIT No No weaker support AAA-atpases Alphaproteobacteria: Rickettsiales NA ribA HGT Yes moderate support Ankyrin repeat Alphaproteobacteria: Rickettsiales NA No Yes moderate support proteins

5)

Genome region Forward primer Reverse primer(s) leuA_fwd ↔ rpsO_rRNA_fwd_rev CTAAGGGCTGAGGACGTTGG CCCCTACGCAGCCTGTTTAT rpsO_rRNA_fwd_rev ↔ prs_rev CCCCTACGCAGCCTGTTTAT GGGTAGCTCAGCGGTAAGAG tRNA_Gly_fwd ↔ rsmH_rev GCCTAGTGCAGGGATAGAAGG CACTGAGGCTCTGAGTTGGC tRNA_Gly_fwd ↔ 23S_rRNA_rev1 CGTTGATAGGCTGGGTGTGT tRNA_Gly_fwd ↔ 23S_rRNA_rev2 AAGTTCCGACCTGCACGAAT argG_fwd ↔ rib_pseudo_rev CCCTGGCCTATGCTTCTGAC GGAGGTCAGATTCGAGGCAG ilvD_fwd ↔ hypothetical_protein_rev ATAAGGAGGAGGGTGCCTGT GTGATGGTGTTAGGTTGCGG