Oncogene (1999) 18, 4137 ± 4143 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $12.00 http://www.stockton-press.co.uk/onc Tax protein of HTLV-1 inhibits CBP/p300-mediated transcription by interfering with recruitment of CBP/p300 onto DNA element of E-box or p53 binding site

Takeshi Suzuki1, Masami Uchida-Toita1 and Mitsuaki Yoshida*,1

1Department of Cellular and Molecular Biology, Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan

Tax protein of human T-cell leukemia virus type 1 Tax was originally identi®ed as a transcriptional (HTLV-1) is a potent transcriptional regulator which can activator for viral gene expression and then was shown activate or repress speci®c cellular genes and has been to activate a wide variety of cellular genes (Yoshida et proposed to contribute to leukemogenic processes in al., 1995). Tax was also demonstrated to inhibit adult T-cell leukemia. The molecular mechanism of Tax- expression of several genes. In addition to the mediated trans-activation has been well investigated. transcriptional deregulation, we found that Tax binds However, trans-repression by Tax remains to be studied to p16ink4a protein, a cyclin-dependent kinase (CDK) in detail, although it is known to require a speci®c DNA inhibitor, and suppresses its inhibitory activity pre- element such as E-box or p53 binding site. Examining venting the cell from undergoing growth arrest (Suzuki possible mechanisms of trans-repression, we found that et al., 1996). These pleiotropic functions of Tax a€ect co-expression of E47 and p300 activated E-box multiple regulatory processes of cells and are believed dependent transcription and this activation was eciently to play roles at least in the initial stage of repressed by Tax. In this system, Tax bound to p300 and leukemogenesis induced by HTLV-1 infection. decreased the level of p300 complexed on the E-box Tax has shown to activate transcription through element. Similarly, Tax inhibited transcription directed distinct enhancer DNA elements by interacting with by p53 and CBP, reducing the level of CBP on the p53 speci®c cellular transcription factors including CREB, binding site. These results indicate that Tax interferes NF-kB and SRF (Fujii et al., 1992; Suzuki et al., 1993, with recruitment of CBP/p300 into protein complexes on 1994; Zhao and Giam, 1992). Furthermore, Tax E-box and p53 binding site through its binding to CBP/ interacts with a transcriptional coactivator, CBP, p300. In contrast to these ®ndings, we observed that Tax which binds to the phosphorylated form of CREB increased the level of CBP on the viral 21-bp enhancer (Chrivia et al., 1993). Through these binding capacities, which is trans-activated by Tax. From these observa- Tax functions as a linker between CREB and CBP in a tions, we propose a universal mechanism for Tax- phosphorylation-independent manner on the viral mediated trans-repression and trans-activation of tran- enhancer, the 21-bp element (Giebler et al., 1997; scription in which Tax binds to CBP/p300 and Harrod et al., 1998; Kwok et al., 1996; Lenzmeier et determines the accessibility of CBP/p300 to protein al., 1998). complexes on speci®c DNA element. CBP and p300 belong to a family of coactivators which have a large network of interactions with many Keywords: HTLV-1; Tax; trans-repression; CBP/p300 cellular transcription factors in a signal-dependent and sometimes mutually exclusive fashion (Shikama et al., 1997). To date, steroid and retinoid hormone receptors, CREB, c-Jun, c-Myb, Sap-1a, c-Fos, MyoD, p53, Stat- Introduction 1/2, NF-kB, pp90rsk, TATA-binding protein, and TFIIB have been found to interact with CBP and/or Human T-cell leukemia virus type 1 (HTLV-1) (Poiesz p300 (Shikama et al., 1997). In addition to interactions et al., 1980) is an etiologic agent of adult T-cell with transcription factors, CBP/p300 possess intrinsic leukemia (ATL) (Hinuma et al., 1981; Yoshida et al., histone acetylase (HAT) activity for all four core 1982). The virus-encoded regulatory protein Tax is histones (Bannister and Kouzarides, 1996; Ogryzko et critical for HTLV-1 replication and is thought to al., 1996). For this reason, they are suggested to induce contribute to ATL development (Yoshida, 1993). Tax an alteration of the nucleosomal structure where they has been shown to immortalize T lymphocytes and anchor through DNA binding proteins. The HAT transform rodent cells (Grassmann et al., 1989; activity presumably releases promoter sequences from Yamaoka et al., 1996). Transgenic mice that express the repressive e€ect of the nucleosome and renders Tax in mature T lymphocytes developed large granular them accessible to basal transcription factors and RNA lymphocytic leukemia, showing that Tax has the polymerase II for transcriptional initiation. capacity to induce leukemia (Grossman et al., 1995). On the other hand, recent evidences indicate that interference with normal CBP/p300 function can result in a variety of diseases including cancer (Giles et al., 1998). Alterations of CBP gene have been implicated in *Correspondence: M Yoshida hematological malignancies as well as congenital Received 17 November 1998; revised 2 February 1999; accepted 26 malformation in the Rubinstein-Taybi syndrome February 1999 which is associated with an increased predisposition Tax inhibits CBP/p300 function TSuzukiet al 4138 to cancer (Borrow et al., 1996; Petrij et al., 1995; recruitment of p300 onto E-box. Similar results were Sobulo et al., 1997). Mutations of the p300 gene have obtained for CBP-mediated transcription through the been implicated also in leukemia and gastric and p53 binding site. These data indicate that Tax binds to colorectal carcinoma (Ida et al., 1997; Muraoka et CBP/p300 and interferes with its recruitment onto the al., 1996). Therefore, it can be postulated that binding speci®c DNA element, resulting in transcriptional of Tax to CBP/p300 might cause profound e€ects on repression. cellular gene regulation, cell growth and transforma- tion. In contrast to its transcriptional activation, the Results molecular mechanism of Tax-mediated transcriptional repression has not been elucidated. Tax is reported to Repression of E-box and p53 binding site-dependent repress the transcription of several genes including transcription by Tax DNA polymerase b, lck and bax (Brauweiler et al., 1997; Jeang et al., 1990; Lemasson et al., 1997). It is Previous studies have suggested the involvement of E- also suggested that trans-repression by Tax is mediated box in Tax-mediated trans-repression, and we have by E-box in the promoter regions of these three genes found that Tax repressed transcription of p18ink4c (Brauweiler et al., 1997; Lemasson et al., 1997; gene through the E-box element in the promoter region Uittenbogaard et al., 1994). Recently we found that a of p18ink4c gene (manuscript in preparation). To CDK inhibitor, p18ink4c gene, is also trans-repressed examine whether the E-box element is sucient for by Tax (manuscript in preparation). Deletion and transcriptional repression by Tax, we constructed a mutation analysis of the p18ink4c promoter revealed reporter plasmid containing four copies of p18ink4c E- that E-box element is responsible for Tax trans- box element and the promoter of herpes virus repression, consistent with the previous reports. thymidine kinase (tk) gene. This reporter, p18 E-box- Another cis-regulatory element trans-repressed by Tax tk-Luc, was cotransfected into CV-1 cells with or is the p53 response element. It was reported that p53 without Tax expression plasmid. Increasing amounts of response element showed decreased activity in HTLV-1 Tax expression plasmid repressed luciferase expression, infected cells, and furthermore, that Tax reduced p53- indicating that p18ink4c E-box sequence was sucient dependent transcriptional activity (Akagi et al., 1997; for Tax-mediated repression even in combination with Mulloy et al., 1998; Pise-Masison et al., 1998a). Since a heterologous promoter (Figure 1a). A mutation in DNA polb, lck, p18ink4c, bax and p53 are involved in the E-box sequence abolished the response to Tax DNA repair, the cell cycle and apoptosis, their down- (data not shown). Similar results were obtained using regulation by Tax is thought to contribute to the other cell lines such as HeLa and Jurkat (data not abnormal cell growth of HTLV-1-infected cells leading shown). to transformation. The p53 binding site is reported to be another cis- In this paper, we studied the mechanism of regulatory element trans-repressed by Tax, since the transcriptional repression by Tax, and report here p53 response element has reduced activity in HTLV-1- that expression of Tax inhibited p300-dependent infected cells. Furthermore, Tax was shown to transcriptional activity of E47, interfering with suppress p53-dependent transcriptional activity

Figure 1 Tax-mediated transcriptional repression dependent on E-box and p53 binding site. (a) Repression of transcription directed by E-box element of p18ink4c gene. CV-1 cells were transiently cotransfected with p18 E-box-tk-Luc reporter plasmid (3 mg) and increasing doses of pCG-Tax. (b) Repression of p53-directed transcription. p53 null cell line SaOS2 cells were transiently cotransfected with p53BS-tk-Luc (2 mg), p53 expression plasmid, pCG-p53, and increasing doses of pCG-Tax. Cell extracts were assayed for luciferase activity. Reported values represent mean+standard error (error bars) from three independent experiments Tax inhibits CBP/p300 function TSuzukiet al 4139 (Akagi et al., 1997; Mulloy et al., 1998; Pise-Masison p53 binding site was used (lanes 5 and 7). In et al., 1998a). To con®rm this result, we used a contrast, when wild type 21-bp or NF-kB sequence reporter, p53BS-tk-Luc, which contains four repeats of was used, Tax was detected in protein complexes the p53 binding sequence upstream of the tk promoter (lanes 1 and 3), but mutant probes did not give rise and luciferase gene. This reporter gene was cotrans- complexes with Tax (lanes 2 and 4). These results fected with the p53 expression plasmid into the p53 con®rmed the speci®city of the Tax binding to the null cell line SaOS2 (Figure 1b). Basal expression of complexes and previous results in Tax trans- this reporter construct is very low, and expression of activation (Suzuki et al., 1993, 1994). Therefore, it p53 induced strong upregulation of luciferase expres- was concluded that Tax is not included in protein sion. Co-expression of Tax with p53 expression complexes on E-box and p53 binding site, suggesting plasmid eciently inhibited the ability of p53 to that Tax inhibits transcription without forming a activate transcription in a dose-dependent fashion. stable complex on the speci®c DNA element. This result was not due to reduction of p53 expression, because cells cotransfected with Tax and Inhibition of CBP/p300-directed transcription by Tax p53 expressed almost the same amount of p53 as cells transfected with p53 alone (data not shown). In this It is reported that some E-box binding proteins such as repression, the possibility that Tax inhibited the DNA E47 and MyoD cooperate with coactivator CBP/p300 binding capacity of p53 has been excluded, since Tax to stimulate E-box-directed transcription (Eckner et al., did not a€ect the level of p53 bound to the DNA 1996). p53 was also shown to interact with CBP/p300 element as discussed later (Figure 4d). for potentiation of its transcriptional activity (Avan- taggiati et al., 1997; Gu et al., 1997; Lill et al., 1997). Since Tax is reported to bind to CBP/p300 (Bex et al., Absence of Tax in protein complexes on E-box or p53 1998; Kwok et al., 1996), we examined the possibility binding site that Tax binding to CBP/p300 a€ects its function in Since Tax was shown to associate with DNA these two systems. binding proteins in the trans-activation (Suzuki et To examine this possibility, we examined a al., 1993, 1994), it was suspected that Tax might be transcription factor E47 as a potential E-box binding included in protein complexes on E-box or p53 protein, because it was detected in the DNA binding binding site for trans-repression. To examine such a protein complex of p18ink4c E-box element in a possibility, we performed DNA anity precipitation nuclear extract of HTLV-1-infected cells (data not assay using E-box or p53 binding site as a probe shown). When a reporter plasmid, p18 E-box-tk-Luc, (Figure 2). Biotinylated DNA probe containing was cotransfected into NIH3T3 cells with expression p18ink4c E-box or p53 binding site was incubated vector of E47 or p300, luciferase expression was not with a nuclear extract of Hut102 cells, an HTLV-1- signi®cantly a€ected. However, when both E47 and infected cell line. Protein complexes formed on the p300 were cotransfected, high expression was observed DNA probe were recovered by magnet beads (Figure 3a). When Tax was expressed in this system, an conjugated with streptavidin, and then analysed by ecient reduction of luciferase expression was ob- immunoblotting for the presence of Tax. As shown served, indicating that Tax inhibited the synergistic in Figure 2, Tax was not detected when E-box or activation by E47 and p300 (Figure 3a). We also performed a similar assay using a p53- dependent system with a p53-responsive reporter, p53BS-tk-Luc, and SaOS2 cells (Figure 3b). Expres- sion of p53 alone enhanced luciferase expression to some extent; however, coexpression of CBP with p53 further enhanced the transcriptional activity of p53, con®rming previous reports (Avantaggiati et al., 1997; Gu et al., 1997; Lill et al., 1997). Additional expression of Tax suppressed the elevated expression of luciferase, indicating that Tax interfered with the synergistic activation by p53 and CBP (Figure 3b).

Interference with CBP/p300 recruitment onto E-box and p53 binding site To investigate the molecular mechanism of Tax inhibition of CBP/p300-mediated transcriptional acti- vation, we analysed the amount of CBP/p300 in the DNA binding protein complexes on E-box and p53 binding site by DNA anity precipitation assay Figure 2 Absence of Tax in protein complexes on E-box and p53 binding site. Nuclear extract of HTLV-1-infected cell line, (Figure 4). The expression plasmid for E47 was Hut102, was incubated with biotinylated 21-bp DNA probes transfected into CV-1 cells with p300 or Tax, or both (lanes 1 and 2), NF-kB binding sequence of IL-2Ra gene (lanes 3 expression plasmids, and the nuclear extract prepared and 4), E-box of p18ink4c gene (lanes 5 and 6) or p53 binding site from these cells was tested for protein complex (lanes 7 and 8). Wt and mut represent the wild type and inactive mutant of each DNA element, respectively. The protein formation on E-box of p18ink4c gene. The isolated complexes on each DNA probe were analysed by immunoblot- protein complexes were analysed by immunoblotting ting with anti-Tax antiserum for the presence of E47, p300 and Tax. Tax inhibits CBP/p300 function TSuzukiet al 4140

Figure 3 E€ect of Tax on CBP/p300-directed transcription. (a) Inhibition by Tax of transcriptional activation directed by E47 and p300. NIH3T3 cells were transiently cotransfected with p18 E-box-tk-Luc (3 mg), E47 (2 mg), pCG-p300 (4 mg) and pCG-Tax (0.5 mg) in combination as indicated. (b) Inhibition by Tax of CBP-enhanced p53 transcriptional activity. SaOS2 cells were transiently cotransfected with p53BS-tk-Luc (2 mg), pCG-p53 (0.2 mg), pCG-CBP (4 mg) and pCG-Tax (0.5 mg) in combination as indicated. All results represent mean+standard error (error bars) from three independent experiments

protein complexes (Figure 4c). The recruitment of p300 onto DNA was dependent on the binding of E47 to E-box, since exogenous p300 was not detected in the complexes without expression of E47 (Figure 4a and c, lane 5). These observations suggest that E47 interacts with p300 directly or indirectly and recruits it onto E- box DNA element. Coexpression of Tax signi®cantly reduced the level of p300 in the complex (Figure 4c, lane 4). Since Tax did not reduce the expression of p300 in the cells (data not shown), these results indicate that Tax inhibited recruitment of p300 into protein complexes on E-box. Similar results were obtained with p53 binding site (Figure 4d ± f). In this system, both endogenous and exogenous CBP were detected in protein complexes on the p53 binding site, and the level of CBP in the complexes was reduced by coexpression of Tax (Figure 4f). Furthermore, in the lysates in which the level of Figure 4 Identi®cation of proteins complexed on DNA elements. CBP/p300 on the DNA elements was decreased by Tax Expression plasmids for E47, p53, CREB, p300, CBP and Tax were transfected into CV-1 in combinations as indicated and expression, the complex of Tax and CBP/p300 was nuclear extracts were prepared. The nuclear extracts were detected by coimmunoprecipitation assay (Figure 5a, incubated with a biotinylated DNA probe either of p18ink4c E- lane 4; b, lanes 2 and 4). From these observations, we box (a, b and c) or p53 binding site (d, e and f) or HTLV-1 21-bp concluded that Tax bound to CBP/p300 and interfered element (g, h and i). Protein complexes formed on the DNA probe were isolated and analysed by immunoblotting with anti- with the interaction between E-box binding proteins or E47 (a), anti-p53 (d), anti-CREB (g), anti-Tax (b, e and h), anti- p53 and CBP/p300, resulting in a decrease of CBP/ p300 (c), or anti-CBP (f and i) p300 recruitment onto the DNA elements.

Enhancement of CBP recruitment onto viral 21-bp enhancer As seen in Figure 4, a signi®cant level of E47 was bound to p18ink4c E-box probe, and the level was not As described in the previous section, the binding of a€ected by expression of p300 and Tax. Endogenous Tax to CBP/p300 inhibited the recruitment of CBP/ p300 was not detected in the complexes under the p300 into the protein complex on the E-box and p53 conditions used in these assays, but exogenously binding site, which are trans-repressed by Tax. To expressed p300 was present in the DNA binding substantiate this conclusion, we carried out similar Tax inhibits CBP/p300 function TSuzukiet al 4141 recruits them onto CRE-containing enhancer, for example the 21-bp enhancer, through binding to transcription factors such as CREB and CREM, since Tax has a high anity to CREB and CREM. For trans-repression, on the other hand, Tax binds to CBP/ p300 but can not recruit them onto the responsive elements, since Tax has no anity to p53 and to E47 or E47-associated protein on the DNA elements. Therefore, Tax binding to CBP/p300 results in squelching them from transcription system directed by E-box and p53 binding site. In other words, Tax utilizes CBP/p300 for both transcriptional activation and repression and its ®nal e€ect depends on the capacity of Tax to recruit CBP/p300 onto the DNA element. Since CBP/p300 appear to be present at limiting level in cells and serve as integrators of Figure 5 Binding of Tax to CBP/p300 in nuclear extract used for numerous signaling processes by interacting with analyses of protein complexes on speci®c DNA element. The same nuclear extracts as used in Figure 4 were immunoprecipitated many cellular transcription factors (Shikama et al., (I.P.) with anti-Tax antiserum followed by immunoblotting 1997), targeting by Tax for the intracellular CBP/p300 (W.B.) with anti-p300 (a) or anti-CBP (b) antibodies has potentially global e€ects in the deregulation of gene expression in HTLV-1-infected cells. Other possible mechanisms for trans-repression have experiments with the viral 21-bp enhancer, which is recently been proposed by other groups: In the case of eciently trans-activated by Tax. p53-dependent transcription, it has been reported that As shown in Figure 4i, in contrast to the results of p53 protein is phosphorylated in HTLV-1-transformed p53 binding site, CBP was not detected in the complex cells, possibly leading to p53 inactivation (Pise-Masison on the 21-bp probe even when CBP was expressed et al., 1998b). However, little detailed information has exogenously. On the other hand, in the presence of Tax been reported; therefore, this possibility is worth (Figure 4h), a signi®cant level of CBP was detected in exploring rigorously. Another possibility is that Tax the DNA binding protein complex even with and some transcription factors such as c-Myb bind to endogenous CBP (Figure 4i). The level of CBP in the the same KIX domain of CBP and compete with each complex was further increased with exogenous expres- other, thus resulting in down-regulation of transcrip- sion of CBP. These results clearly indicate that Tax tion (Colgin and Nyborg, 1998). However, our results enhanced the recruitment of CBP into the protein on p53 cannot be explained by a simple model of complex on the 21-bp enhancer. This would be binding site competition, because the p53 binding site mediated by the high anity binding of Tax to CREB on CBP is not located in the KIX domain, but in the bound to the 21-bp enhancer. These results are C-terminal domain (Gu et al., 1997). Thus, our study consistent with previous reports (Giebler et al., 1997; indicates that Tax has more profound e€ects on many Harrod et al., 1998; Lenzmeier et al., 1998) providing CBP-binding transcription factors other than KIX further direct evidence for ecient recruitment of CBP domain binding factors. onto the enhancer. Elucidation of the mechanism of Tax-mediated Furthermore, it was demonstrated that the level of transcriptional repression seems to be important in CBP/p300 in the DNA binding protein complexes understanding the leukemogenic mechanism for ATL seems to be correlated with the transcriptional activities development, since trans-repression of genes such as of the responsive elements including 21-bp, E-box and DNApolb, p18ink4c and bax is suggested to be linked p53 binding sites. From these observations, we to abnormal cell proliferation. Similarly to Tax- therefore propose that Tax binds to CBP/p300, and mediated trans-repression, the interaction of other its ®nal e€ect may be determined by whether Tax oncogenic viral proteins with CBP/p300 has been recruits or sequesters CBP/p300 in the given system of proposed for the adenovirus E1A protein and SV40 transcription. large T antigen. They also bind to CBP/p300 and interfere with CBP/p300-directed transcription (Shika- ma et al., 1997; Yang et al., 1996). These properties of Discussion the DNA viral oncoproteins are thought to play roles in induction of abnormal cell growth and transform- In this report, we analysed the molecular mechanism of ation. These similarities among viral transforming transcriptional repression by Tax through E-box and proteins that are evolutionarily di€erent suggest that p53 binding site. Since E-box binding proteins and p53 interaction of Tax with CBP/p300 may play a role in cooperate with coactivator CBP/p300 for transcription, induction of abnormal cell phenotypes of HTLV-1- we hypothesized that Tax antagonizes CBP/p300 infected T cells. function, and demonstrated that Tax binds to CBP/ A critical role for CBP/p300 in leukemogenesis has p300 and interferes with the recruitment of CBP/p300 also been described recently (Giles et al., 1998). into protein complexes on E-box and p53 binding site. Alterations of CBP/p300 gene by chromosomal Based on this conclusion together with other translocation have been implicated in hematological ®ndings in this study, we propose a universal model malignancies as well as in gastric and colorectal for Tax-mediated transcriptional activation and repres- carcinomas. Tax binding to CBP/p300 and its sion. For trans-activation, Tax binds to CBP/p300 and functional suppression might mimic the genetically Tax inhibits CBP/p300 function TSuzukiet al 4142 induced-deregulation of CBP/p300 genes observed in procedure as described previously (Suzuki et al., 1993). A malignant cells. mixture of DNAs as described in the legend of each ®gure All these comparisons with previous reports suggest was transfected, and the total amount of DNA was equalized that Tax binding to CBP/p300 would e€ectively by adding the control vector plasmid. Luciferase activity was operate to disrupt the transcription regulatory net- assayed 24 h post-transfection according to the manufac- turer's procedure. Brie¯y, cells were collected, washed with works in which CBP/p300 are involved. These Tax- PBS, and solubilized in 100 ml reporter lysis bu€er dependent e€ects on CBP/p300 function might cause (Promega). The 5 ml cell extract was added to 100 ml profound e€ects on cellular gene regulation and cell luciferase substrate (Promega), and luciferase activity was growth, and could be linked with cellular transform- measured with a Bertholdt luminometer. Cotransfection of ation and ATL. Further characterization of the RSV-CAT reporter construct, which was not a€ected by Tax, consequences induced by the interaction of Tax and was performed to normalize for transfection eciency. All CBP/p300 would provide insights into the mechanisms Luc transfection experiments were carried out at least three of Tax-induced cellular transformation. times. Typical results are shown in Figures 1 and 3.

DNA anity precipitation assay Materials and methods Biotinylated DNA probes containing each cis-regulatory element were prepared by the polymerase chain reaction of Plasmid constructs and antibodies the reporter plasmids using 5'-biotinylated primers comple- mentary to the junction regions of the plasmids. Cell extracts The tk-Luc plasmid which expresses the luciferase protein were prepared as described previously (Suzuki et al., 1993) by from the herpes virus thymidine kinase promoter was lysing cells in bu€er containing 0.5% NP-40 and extraction provided by Dr K Umesono, Kyoto University. For of nuclei with 0.4 M NaCl. Biotinylated DNA probe was construction of p18 E-box-tk-Luc reporter, an oligonucleo- mixed with nuclear extract and incubated for 30 min on ice tide of E-box binding site in the human p18ink4c promoter as described previously (Suzuki et al., 1993). All reaction [CATGGATCTGGCAGGTGCGAGGCCGAG] was synthe- mixtures contained double-stranded poly(dI-dC). Then, sized, tandemly ligated four times and cloned into the SalI streptavidin-magnetic beads (Dynal) were added with mixing site of tk-Luc. Similarly, four repeats of p53 responsive by rotation for 30 min. The beads were collected with a element [ACGTTTGCCCTTGCCTGGACTTGCCTGGCC- magnet and washed twice with bu€er. The DNA binding TTGCCTT] were cloned into the same site, generating complexes isolated were subjected to SDS-polyacrylamide gel p53BS-tk-Luc. An expression plasmid for p53 was con- electrophoresis followed by immunoblotting. structed by cloning NcoI±BamHI fragment of human p53 cDNA into pCG vector carrying cytomegalovirus promoter. Tax expression plasmid was described previously (Suzuki et Immunoprecipitation and immunoblotting al., 1994). The expression plasmids for CBP and p300 were Nuclear extracts were prepared as described in the previous obtained from Dr S Ishii, Tsukuba life science center, section and diluted with NETG bu€er (50 mM Tris-HCl, pH RIKEN, and the expression plasmid for E47 from Dr K 7.5/150 mM NaCl/0.1% Nonidet P-40/1 mM EDTA/0.25% Semba, University of Tokyo. The anti-Tax and anti-CREB gelatin/0.02% sodium azide) and treated with anti-Tax antisera were reported previously (Suzuki et al., 1993). The antiserum. The immune complexes were collected on Protein anti-p53 (DO-1, #sc-126), anti-E47 (N-649, #sc-763), anti- A sepharose CL4B (Pharmacia), separated in SDS-polyacry- CBP (C-20, #sc-583) and anti-p300 (C-20, #sc-585) antibodies lamide gel followed by immunoblotting. The proteins were were obtained from SantaCruz Biotech. and were used for transferred to an Immobilon membrane ®lter (Millipore), and immunoblotting. probed with each antibody. Detection was performed with the enhanced chemiluminescence system (Amersham). Cell lines, transfection and luciferase assay HTLV-1-transformed cell line HUT102 was grown in RPMI 1640 medium supplemented with 10% fetal calf serum. Cell Acknowledgements lines HeLa, SaOS2 and CV-1 were maintained in Dulbecco We thank Dr K Umesono, Kyoto University, Dr S Ishii, modi®ed Eagle medium (DMEM) supplemented with 10% Tsukuba Life Science Center, RIKEN, and Dr K Semba, fetal calf serum. The mouse NIH3T3 cell line was grown in University of Tokyo for providing cDNAs and expression DMEM and 10% calf serum. plasmids. This work was supported in part by a special Transient transfection experiments were carried out grant for Advanced Research on Cancer from the Ministry according to the standard calcium phosphate precipitation of Education, Culture, Sports and Science of Japan.

References

Akagi T, Ono H, Tsuchida N and Shimotohno K. (1997). Brauweiler A, Garrus JE, Reed JC and Nyborg JK. (1997). FEBS Lett., 406, 263 ± 266. Virology, 231, 135 ± 140. Avantaggiati ML, Ogryzko V, Gardner K, Giordano A, Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy Levine AS and Kelly K. (1997). Cell, 89, 1175 ± 1184. MR and Goodman RH. (1993). Nature, 365, 855 ± 859. Bannister AJ and Kouzarides T. (1996). Nature, 384, 641 ± Colgin MA and Nybork JK. (1998). J. Virol., 72, 9396 ± 643. 9399. Bex F, Yin M-J, Burny A and Gaynor RB. (1998). Mol. Cell. Eckner R, Yao T-P, Oldread E and Livingston DM. (1996). Biol., 18, 2392 ± 2405. Gene Dev., 10, 2478 ± 2490. Borrow J, Stanton VP, Andresen M, Becher R, Behm FG, Fujii M, Tsuchiya H, Chuhjo T, Akizawa T and Seiki M. Chaganti RSK, Civin CI, Disteche C, Dube I, Frischauf (1992). Genes Dev., 6, 2066 ± 2076. AM, Horsman D, Mitelman F, Volinia S, Watmore AE and Housman DE. (1996). Nat. Genet., 14, 33 ± 41. Tax inhibits CBP/p300 function TSuzukiet al 4143 Giebler HA, Loring JE, Van Orden K, Colgin MA, Garrus Ogryzko VV, Schiltz RL, Russanova V, Howard BH and JE, Escudero KE, Brauweiler A and Nyborg JK. (1997). Nakatani Y. (1996). Cell, 87, 953 ± 959. Mol. Cell. Biol., 17, 5156 ± 5164. Petrij F, Giles RH, Dauwerse HG, Saris JJ, Hennekam Giles RH, Peters DJM and Breuning MH. (1998). Trends RCM, Masuno M, Tommerup N, van Ommen G-JB, Genet., 14, 178 ± 183. Goodman RH, Peters DJM and Breuning MH. (1995). Grassmann R, Dengler C, Muller-Fleckenstein I, Flecken- Nature, 376, 348 ± 351. stein M, McGuire K, Dokhelar MC, Sodroski JC and Pise-MasisonCA,ChoiK-S,RadonovichM,DittmerJ,Kim Haseltine WA. (1989). Proc. Natl. Acad. Sci. USA, 86, S-J and Brady JN. (1998a). J. Virol., 72, 1165 ± 1170. 3351 ± 3355. Pise-Masison CA, Radonovich M, Sakaguchi K, Appella E GrossmanWJ,KimataJT,WongFH,ZutterM,LeyTJand and Brady JN. (1998b). J. Virol., 72, 6348 ± 6355. Ratner L. (1995). Proc. Natl. Acad. Sci. USA, 92, 1057 ± Poeisz BJ, Ruscetti RW, Gazdar AF, Bunn PA, Minna JD 1061. and Gallo RC. (1980). Proc.Natl.Acad.Sci.USA,77, Gu W, Shi X-L and Roeder RG. (1997). Nature, 387, 819 ± 7415 ± 7419. 823. Shikama N, Lyon J and La Thangue NB. (1997). Trends Cell HarrodR,TangY,NicotC,LuHS,VassilevA,NakataniY Biol., 7, 230 ± 236. and Giam C-Z. (1998). Mol. Cell. Biol., 18, 5052 ± 5061. Sobulo OM, Borrow J, Tomek R, Reshmi S, Harden A, Hinuma Y, Nagata K, Hanaoka M, Nakai M, Matsumoto T, Schlegelberger B, Housman D, Doggett NA, Rowley JD Kinoshita KI, Shirakawa S and Miyoshi I. (1981). Proc. and Zeleznik-Le NJ. (1997). Proc. Natl. Acad. Sci. USA, Natl. Acad. Sci. USA, 78, 6476 ± 6480. 94, 8732 ± 8737. Ida K, Kitabayashi I, Taki T, Taniwaki M, Noro K, Suzuki T, Fujisawa J, Toita M and Yoshida M. (1993). Proc. Yamamoto M, Ohki M and Hayashi Y. (1997). Blood, Natl. Acad. Sci. USA, 90, 610 ± 614. 90, 4699 ± 4704. Suzuki T, Hirai H and Yoshida M. (1994). Oncogene, 9, Jeang KT, Widen SG, Semmes OJ and Wison SH. (1990). 3099 ± 3105. Science, 247, 1082 ± 1084. Suzuki T, Kitao S, Matsushime H and Yoshida M. (1996). Kwok RPS, Laurance ME, Lundblad JR, Goldman PS, Shih EMBO J., 15, 1607 ± 1614. H-S, Connor LM, Marriott SJ and Goodman RH. (1996). Uittenbogaard MN, Armstrong AP, Chiaramello A and Nature, 380, 642 ± 646. Nyborg JK. (1994). J. Biol. Chem., 269, 22466 ± 22469. LemassonI,Robert-HebmannV,HamaiaS,DucDodenM, Yamaoka S, Inoue H, Sakurai M, Sugiyama T, Hazama M, Gazzolo L and Devaux C. (1997). J. Virol., 71, 1975 ± Yamada T and Hatanaka M. (1996). EMBO J., 15, 873 ± 1983. 887. Lenzmeier BA, Giebler HA and Nyborg JK. (1998). Mol. Yang XJ, Ogryzko VV, Nishikawa J, Howard BH and Cell. Biol., 18, 721 ± 731. Nakatani Y. (1996). Nature, 382, 319 ± 324. Lill NL, Grossmann SR, Ginsberg D, DeCaprio J and Yoshida M. (1993). Trends Microbiol., 1, 131 ± 135. Livingston DM. (1997). Nature, 387, 823 ± 827. Yoshida M, Miyoshi I and Hinuma Y. (1982). Proc. Natl. Mulloy JC, Kislyakova T, Cereseto A, Casareto L, Acad.Sci.USA,79, 2031 ± 2035. LoMonicoA,FullenJ,LorenziMV,CaraA,NicotC, Yoshida M, Suzuki T, Fujisawa J and Hirai H. (1995). Curr. Giam C and Franchini G. (1998). J. Virol., 72, 8852 ± 8860. Top. Microbiol. Immunol., 193, 79 ± 89. Muraoka M, Konishi M, Kikuchi-Yanoshita R, Tanaka K, Zhao LJ and Giam CZ. (1992). Proc. Natl. Acad. Sci. USA, Shitara N, Chong JM, Iwama T and Miyaki M. (1996). 89, 7070 ± 7074. Oncogene, 12, 1565 ± 1569.