DOCSLIB.ORG

Peroxisome Proliferator-Activated Receptor

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Peroxisome Proliferator-Activated Receptor Peroxisome Proliferator-Activated Receptor− δ Supports the Metabolic Requirements of Cell Growth in TCR β-Selected Thymocytes and Peripheral CD4 + T Cells This information is current as of September 24, 2021. Fei Linda Zhao, Jeeyoon Jennifer Ahn, Edward Chen, Tae Joon Yi, Natalie H. Stickle, David Spaner, Juan Carlos Zúñiga-Pflücker and Shannon E. Dunn J Immunol published online 26 September 2018 http://www.jimmunol.org/content/early/2018/09/25/jimmun Downloaded from ol.1800374 Supplementary http://www.jimmunol.org/content/suppl/2018/09/25/jimmunol.180037 http://www.jimmunol.org/ Material 4.DCSupplemental Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 24, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published September 26, 2018, doi:10.4049/jimmunol.1800374 The Journal of Immunology Peroxisome Proliferator-Activated Receptor–d Supports the Metabolic Requirements of Cell Growth in TCRb-Selected Thymocytes and Peripheral CD4+ T Cells Fei Linda Zhao,* Jeeyoon Jennifer Ahn,* Edward Chen,* Tae Joon Yi,*,† Natalie H. Stickle,‡ David Spaner,*,x Juan Carlos Zu´n˜iga-Pflu¨cker,*,x and Shannon E. Dunn*,†,{ During T cell development, progenitor thymocytes undergo a large proliferative burst immediately following successful TCRb rearrangement, and defects in genes that regulate this proliferation have a profound effect on thymus cellularity and output. Although the signaling pathways that initiate cell cycling and nutrient uptake after TCRb selection are understood, less is known about the transcriptional programs that regulate the metabolic machinery to promote biomass accumulation during this process. Downloaded from In this article, we report that mice with whole body deficiency in the nuclear receptor peroxisome proliferator-activated receptor–d (PPARdmut) exhibit a reduction in spleen and thymus cellularity, with a decrease in thymocyte cell number starting at the double-negative 4 stage of thymocyte development. Although in vivo DNA synthesis was normal in PPARdmut thymocytes, studies in the OP9–delta-like 4 in vitro system of differentiation revealed that PPARdmut double-negative 3 cells underwent fewer cell divisions. Naive CD4+ T cells from PPARdmut mice also exhibited reduced proliferation upon TCR and CD28 stimulation in vitro. Growth defects in PPAR-d–deficient thymocytes and peripheral CD4+ T cells correlated with decreases in extracellular http://www.jimmunol.org/ acidification rate, mitochondrial reserve, and expression of a host of genes involved in glycolysis, oxidative phosphorylation, and lipogenesis. By contrast, mice with T cell–restricted deficiency of Ppard starting at the double-positive stage of thymocyte devel- opment, although exhibiting defective CD4+ T cell growth, possessed a normal T cell compartment, pointing to developmental defects as a cause of peripheral T cell lymphopenia in PPARdmut mice. These findings implicate PPAR-d as a regulator of the metabolic program during thymocyte and T cell growth. The Journal of Immunology, 2018, 201: 000–000. he development of ab T cells occurs in the thymus marrow are double negative (DN) for CD4 and CD8. The least through a highly regulated process that is controlled by mature of these cells, termed early T cell progenitors (ETP), can by guest on September 24, 2021 T interactions between thymocyte progenitors and thymic be identified within the DN population by CD252CD44+CD117+ stromal cells (1, 2). T cell progenitors that arrive from the bone expression (3). Once in the thymus, ETP differentiate into DN2 (CD44+CD25+) and then DN3 (CD442CD25+) cells and at the *Department of Immunology, University of Toronto, Toronto, Ontario M5S 1A8, Canada; same time undergo T cell lineage commitment and initiate rear- †Toronto General Hospital Research Institute, Toronto, Ontario M5G 2C4, Canada; rangements at the TCRb locus (2). TCRb rearrangement ceases at ‡Princess Margaret Genomics Center, Toronto, Ontario M5G 1L7, Canada; xSunnybrook { the DN3 stage, at which time thymocytes undergo b-selection, a Research Institute, Toronto, Ontario M4N 3M5, Canada; and Women’s College Health Research Institute, Toronto, Ontario M5G 1N8, Canada process whereby thymocytes are selected based on the productive ORCIDs: 0000-0002-1431-6351 (J.J.A.); 0000-0001-7197-2243 (E.C.); 0000-0003- rearrangement of the TCR b-chain (2, 4). During successful 2538-3178 (J.C.Z.-P.). rearrangement, the nascent TCR b-chain pairs with the pre-T Received for publication March 12, 2018. Accepted for publication August 8, 2018. a-chain and CD3 signaling molecules to form a functional pre- This work was supported by an operating grant and a Don Paty award from the TCR. Signaling via the pre-TCR rescues thymocytes from death Multiple Sclerosis Society of Canada (to S.E.D.). F.L.Z. and J.J.A. are recipients by neglect, initiates allelic exclusion at the TCRb locus, and in- of Multiple Sclerosis Society of Canada studentships. duces thymocytes to proliferate and differentiate into DN4 and The microarray data presented in this article have been submitted to the National then CD4+CD8+ double-positive (DP) thymocytes (4). At the DP Center for Biotechnology Information Gene Expression Omnibus (https://www.ncbi. nlm.nih.gov/geo/query/acc.cgi?acc=GSE117461) under accession number stage, thymocytes initiate TCRa rearrangements and undergo GSE117461. positive and negative selection based on the strength of interac- Address correspondence and reprint requests to Dr. Shannon E. Dunn, Toronto tions of the TCR with self-peptide/MHC class I and II to form General Hospital Research Institute, 67 College Street, Room 4-406, Toronto, ON single-positive (SP) CD4+ and CD8+ T cells (2). M5G 2M1, Canada. E-mail address: [email protected] The greatest expansion of thymocytes during their development The online version of this article contains supplemental material. occurs immediately following b-selection (4, 5). This amplifica- Abbreviations used in this article: AIF, apoptosis-inducing factor; DN, double neg- tion step serves to increase the diversity of the TCR repertoire ative; DP, double-positive; ECAR, extracellular acidification rate; ETC, electron transport chain; ETP, early T cell progenitor; FCCP, fluorocarbonyl cyanide phenyl- because it permits a greater number of pairings of different TCR hydrazone; FSC-A, forward scatter area; LKB1, liver kinase B1; OCR, oxygen con- a-chains with successful TCR b-chains (6). This proliferative sumption rate; OP9-DL4, OP9–delta-like 4; OXPHOS, oxidative phosphorylation; PFA, paraformaldehyde; PPAR-d, peroxisome proliferator-activated receptor–d; burst of TCRb-selected DN3 (also termed DN3b) and DN4 thy- Ppardfl/fl, homozygote for a floxed exon 4 of the PPAR-d gene; SP, single-positive; mocytes is signaled through the pre-TCR and stromal-derived SRC, spare respiratory capacity; TCA, tricarboxylic acid cycle; Treg, regulatory factors (delta-like 4, IL-7, and CXCL12) acting through recep- T cell; WT, wild-type. tors on thymocytes (7–13). In response to these signals, TCRb- Copyright Ó 2018 by The American Association of Immunologists, Inc. 0022-1767/18/$37.50 selected DN3 thymocytes switch from a state of quiescence to that www.jimmunol.org/cgi/doi/10.4049/jimmunol.1800374 2 PPAR-d AND T CELL GROWTH of active cycling and at the same time engage pathways to in- in vitro system of thymocyte differentiation revealed that DN3 and crease nutrient uptake to accumulate the necessary biomass to DN4 thymocytes divided a fewer number of times in culture. Char- support repeated cell divisions (4). The major signaling pathway acterization of the phenotype of peripheral CD4+ T cells in PPARdmut known to spur anabolic processes in thymocytes is the PI3K/ mice revealed even greater deficits in the ability of these cells to 3-phosphoinositide–dependent protein kinase 1/Akt signaling proliferate and survive under conditions of anti-CD3 and anti-CD28 cascade (14, 15). This pathway is activated downstream of the pre- stimulation. These growth defects in PPARdmut thymocytes and TCR, Notch1, and IL-7 receptor signals and promotes thymocyte peripheral CD4+ T cells correlated with reduced extracellular acidi- growth by increasing the expression of nutrient receptors (glucose fication rate (ECAR), mitochondrial reserve, and decreased expres- transporter 1, CD71, and CD98), glycolytic enzyme activity, and sions of genes encoding enzymes involved in glycolysis, the protein translation through phosphorylation of 90 kDa ribosomal tricarboxylic acid cycle (TCA), the electron transport chain (ETC), S6 kinase (RSK) (7, 14–16). The PI3K/Akt pathway is similarly and lipid biosynthesis. By contrast, mice that had T cell–restricted engaged to increase metabolism in peripheral CD4+ T cells deficiency in PPAR-d starting at the DP stage of thymocyte devel- downstream
Load more

Recommended publications
  • The Role of Nuclear Lamin B1 in Cell Proliferation and Senescence
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press The role of nuclear lamin B1 in cell proliferation and senescence Takeshi Shimi,1 Veronika Butin-Israeli,1 Stephen A. Adam,1 Robert B. Hamanaka,2 Anne E. Goldman,1 Catherine A. Lucas,1 Dale K. Shumaker,1 Steven T. Kosak,1 Navdeep S. Chandel,2 and Robert D. Goldman1,3 1Department of Cell and Molecular Biology, 2Department of Medicine, Division of Pulmonary and Critical Care Medicine, Feinberg School of Medicine, Northwestern University, Chicago, Illinois 60611, USA Nuclear lamin B1 (LB1) is a major structural component of the nucleus that appears to be involved in the regulation of many nuclear functions. The results of this study demonstrate that LB1 expression in WI-38 cells decreases during cellular senescence. Premature senescence induced by oncogenic Ras also decreases LB1 expression through a retinoblastoma protein (pRb)-dependent mechanism. Silencing the expression of LB1 slows cell proliferation and induces premature senescence in WI-38 cells. The effects of LB1 silencing on proliferation require the activation of p53, but not pRb. However, the induction of premature senescence requires both p53 and pRb. The proliferation defects induced by silencing LB1 are accompanied by a p53-dependent reduction in mitochondrial reactive oxygen species (ROS), which can be rescued by growth under hypoxic conditions. In contrast to the effects of LB1 silencing, overexpression of LB1 increases the proliferation rate and delays the onset of senescence of WI-38 cells. This overexpression eventually leads to cell cycle arrest at the G1/S boundary.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • (PI3K(P110 )) Directly Regulates Key Components of the Z-Disc And
    THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 35, pp. 30837–30846, September 2, 2011 © 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Phosphoinositide 3-Kinase (PI3K(p110␣)) Directly Regulates Key Components of the Z-disc and Cardiac Structure*□S Received for publication, June 13, 2011, and in revised form, July 7, 2011 Published, JBC Papers in Press, July 11, 2011, DOI 10.1074/jbc.M111.271684 Ashley J. Waardenberg‡§, Bianca C. Bernardo¶, Dominic C. H. Ngʈ, Peter R. Shepherd**‡‡, Nelly Cemerlang¶, Mauro Sbroggio` §§, Christine A. Wells‡¶¶, Brian P. Dalrymple§, Mara Brancaccio§§, Ruby C. Y. Linʈʈ1, and Julie R. McMullen¶1,2 From the ‡Eskitis Institute for Cell and Molecular Therapies, Griffith University, Nathan, Queensland, 4111, Australia, §Commonwealth Scientific and Industrial Research Organisation, Food Futures Flagship, Queensland Bioscience Precinct, St. Lucia, Queensland, 4067, Australia, the ¶Baker IDI Heart and Diabetes Institute, Melbourne, Victoria, 8008, Australia, the ʈDepartment of Biochemistry and Molecular Biology, Bio21 Institute, University of Melbourne, Melbourne, Victoria, 3010, Australia, the **Department of Molecular Medicine, University of Auckland, Grafton, Auckland, 1142, New Zealand, the ‡‡Maurice Wilkins Centre for Molecular Biodiscovery, University of Auckland, Grafton, Auckland, 1142, New Zealand, the §§Department of Genetics, Biology, and Biochemistry, University of Torino, Molecular Biotechnology Center, Torino, 10126, Italy, the ¶¶Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, Queensland, 4072, Australia, and the ʈʈRamaciotti Centre for Gene Function Analysis and the School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, New South Wales, 2052, Australia Downloaded from Maintenance of cardiac structure and Z-disc signaling are key from PI3K transgenic mice.
    [Show full text]
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer
    Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer By Josiah Ewing Hutton, III. Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biochemistry December 2016 Nashville, Tennessee Approved: Daniel C. Liebler, Ph.D. Robert J. Coffey, M.D. Bruce D. Carter, Ph.D. Nicholas J. Reiter, Ph.D. Jamey D. Young, Ph.D. Charles R. Sanders, Ph.D. Acknowledgements I would like to acknowledge my mentor, Dr. Daniel Liebler, for his constant guidance throughout my graduate career. Dan allowed me the freedom to develop as a scientist, and tactfully provided the tutelage and discussion I needed at exactly the right time and not a moment earlier. I will be grateful for his mentorship, insight, and his wit for the rest of my career. I would also like to acknowledge all current and former laboratory members for not only providing insight and guidance with my dissertation, but also for making every single day in lab enjoyable. I wish to acknowledge my committee members, Dr. Bruce Carter, Dr. Robert Coffey, Dr. Nicholas Reiter, Dr. Charles Sanders, and Dr. Jamey Young. Our meetings throughout the years have helped to guide my research to the work that it is today. I am grateful to my friends, who have always been there for me and would quietly, and sometimes not so quietly, listen to me rehearse my dissertation while we were climbing, so long as I would then push them to climb harder. Lastly, I am grateful to my family, who have always supported me and driven me to work harder.
    [Show full text]
  • Progressive Increase in Mtdna 3243A>G Heteroplasmy Causes Abrupt
    Progressive increase in mtDNA 3243A>G PNAS PLUS heteroplasmy causes abrupt transcriptional reprogramming Martin Picarda, Jiangwen Zhangb, Saege Hancockc, Olga Derbenevaa, Ryan Golhard, Pawel Golike, Sean O’Hearnf, Shawn Levyg, Prasanth Potluria, Maria Lvovaa, Antonio Davilaa, Chun Shi Lina, Juan Carlos Perinh, Eric F. Rappaporth, Hakon Hakonarsonc, Ian A. Trouncei, Vincent Procaccioj, and Douglas C. Wallacea,1 aCenter for Mitochondrial and Epigenomic Medicine, Children’s Hospital of Philadelphia and the Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104; bSchool of Biological Sciences, The University of Hong Kong, Hong Kong, People’s Republic of China; cTrovagene, San Diego, CA 92130; dCenter for Applied Genomics, Division of Genetics, Department of Pediatrics, and hNucleic Acid/Protein Research Core Facility, Children’s Hospital of Philadelphia, Philadelphia, PA 19104; eInstitute of Genetics and Biotechnology, Warsaw University, 00-927, Warsaw, Poland; fMorton Mower Central Research Laboratory, Sinai Hospital of Baltimore, Baltimore, MD 21215; gGenomics Sevices Laboratory, HudsonAlpha Institute for Biotechnology, Huntsville, AL 35806; iCentre for Eye Research Australia, Royal Victorian Eye and Ear Hospital, East Melbourne, VIC 3002, Australia; and jDepartment of Biochemistry and Genetics, National Center for Neurodegenerative and Mitochondrial Diseases, Centre Hospitalier Universitaire d’Angers, 49933 Angers, France Contributed by Douglas C. Wallace, August 1, 2014 (sent for review May
    [Show full text]
  • Pyruvate Kinase M2: a Metabolic Bug in Re-Wiring the Tumor Microenvironment
    Cancer Microenvironment (2019) 12:149–167 https://doi.org/10.1007/s12307-019-00226-0 REVIEW Pyruvate Kinase M2: a Metabolic Bug in Re-Wiring the Tumor Microenvironment Mohd Rihan1 & Lakshmi Vineela Nalla1 & Anil Dharavath1 & Amit Shard3 & Kiran Kalia2 & Amit Khairnar1 Received: 18 March 2019 /Accepted: 17 May 2019 /Published online: 10 June 2019 # Springer Nature B.V. 2019 Abstract Metabolic reprogramming is a newly emerged hallmark of cancer attaining a recent consideration as an essential factor for the progression and endurance of cancer cells. A prime event of this altered metabolism is increased glucose uptake and discharge of lactate into the cells surrounding constructing a favorable tumor niche. Several oncogenic factors help in promoting this consequence including, pyruvate kinase M2 (PKM2) a rate-limiting enzyme of glycolysis in tumor metabolism via exhibiting its low pyruvate kinase activity and nuclear moon-lightening functions to increase the synthesis of lactate and macromolecules for tumor proliferation. Not only its role in cancer cells but also its role in the tumor microenvironment cells has to be understood for developing the small molecules against it which is lacking with the literature till date. Therefore, in this present review, the role of PKM2 with respect to various tumor niche cells will be clarified. Further, it highlights the updated list of therapeutics targeting PKM2 pre-clinically and clinically with their added limitations. This upgraded understanding of PKM2 may provide a pace for the reader in developing
    [Show full text]
  • PKM2 Determines Myofiber Hypertrophy in Vitro and Increases
    International Journal of Molecular Sciences Article PKM2 Determines Myofiber Hypertrophy In Vitro and Increases in Response to Resistance Exercise in Human Skeletal Muscle 1, 2,3, , 4 Sander A. J. Verbrugge y , Sebastian Gehlert * y , Lian E. M. Stadhouders , Daniel Jacko 3 , Thorben Aussieker 3, Gerard M. J. de Wit 4, Ilse S. P. Vogel 4, Carla Offringa 4, 1 4, , 1, , Martin Schönfelder , Richard T. Jaspers * z and Henning Wackerhage * z 1 Department for Sport and Health Sciences, Technical University of Munich, Georg-Brauchle-Ring 60/62, 80992 München/Munich, Germany; [email protected] (S.A.J.V.); [email protected] (M.S.) 2 Department for the Biosciences of Sports, Institute of Sports Science, University of Hildesheim, Universitätsplatz 1, 31141 Hildesheim, Germany 3 Department for Molecular and Cellular Sports Medicine, German Sport University Cologne, 50933 Cologne, Germany; [email protected] (D.J.); [email protected] (T.A.) 4 Laboratory for Myology, Department of Human Movement Sciences, Faculty of Behavioural and Movement Sciences, Vrije Universiteit Amsterdam, Amsterdam Movement Sciences, De Boelelaan 1108, 1081 HZ Amsterdam, The Netherlands; [email protected] (L.E.M.S.); [email protected] (G.M.J.d.W.); [email protected] (I.S.P.V.); c.off[email protected] (C.O.) * Correspondence: [email protected] (S.G.); [email protected] (R.T.J.); [email protected] (H.W.); Tel.: +49-5121-883-11951 (S.G.); +31-20-5988463 (R.T.J.); +49-89-289-24480 (H.W.) Joint first authors. y Joint last authors.
    [Show full text]
  • A20 Promotes Melanoma Progression Via the Activation of Akt Pathway
    Ma et al. Cell Death and Disease (2020) 11:794 https://doi.org/10.1038/s41419-020-03001-y Cell Death & Disease ARTICLE Open Access A20 promotes melanoma progression via the activation of Akt pathway Jinyuan Ma1, Huina Wang1,SenGuo1, Xiuli Yi1, Tao Zhao1,YuLiu1,QiongShi1,TianwenGao1,ChunyingLi1 and Weinan Guo1 Abstract Melanoma is the most life-threatening skin cancer with increasing incidence around the world. Although recent advances in targeted therapy and immunotherapy have brought revolutionary progress of the treatment outcome, the survival of patients with advanced melanoma remains unoptimistic, and metastatic melanoma is still an incurable disease. Therefore, to further understand the mechanism underlying melanoma pathogenesis could be helpful for developing novel therapeutic strategy. A20 is a crucial ubiquitin-editing enzyme implicated immunity regulation, inflammatory responses and cancer pathogenesis. Herein, we report that A20 played an oncogenic role in melanoma. We first found that the expression of A20 was significantly up-regulated in melanoma cell lines. Then, we showed that knockdown of A20 suppressed melanoma cell proliferation in vitro and melanoma growth in vivo through the regulation of cell-cycle progression. Moreover, A20 could potentiate the invasive and migratory capacities of melanoma cell in vitro and melanoma metastasis in vivo by promoting epithelial–mesenchymal transition (EMT). Mechanistically, we found that Akt activation mediated the oncogenic effect of A20 on melanoma development, with the involvement of glycolysis. What’s more, the up-regulation of A20 conferred the acquired resistance to Vemurafenib in BRAF-mutant melanoma. Taken together, we demonstrated that up-regulated A20 promoted melanoma progression via the activation of Akt pathway, and that A20 could be exploited as a potential therapeutic target for 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; melanoma treatment.
    [Show full text]
  • Identification of Key Candidate Genes and Molecular Pathways in White Fat
    Pan et al. Human Genomics (2019) 13:55 https://doi.org/10.1186/s40246-019-0239-x PRIMARY RESEARCH Open Access Identification of key candidate genes and molecular pathways in white fat browning: an anti-obesity drug discovery based on computational biology Yuyan Pan, Jiaqi Liu* and Fazhi Qi* Abstract Background: Obesity—with its increased risk of obesity-associated metabolic diseases—has become one of the greatest public health epidemics of the twenty-first century in affluent countries. To date, there are no ideal drugs for treating obesity. Studies have shown that activation of brown adipose tissue (BAT) can promote energy consumption and inhibit obesity, which makes browning of white adipose tissue (WAT) a potential therapeutic target for obesity. Our objective was to identify genes and molecular pathways associated with WAT and the activation of BAT to WAT browning, by using publicly available data and computational tools; this knowledge might help in targeting relevant signaling pathways for treating obesity and other related metabolic diseases. Results: In this study, we used text mining to find out genes related to brown fat and white fat browning. Combined with biological process and pathway analysis in GeneCodis and protein-protein interaction analysis by using STRING and Cytoscape, a list of high priority target genes was developed. The Human Protein Atlas was used to analyze protein expression. Candidate drugs were derived on the basis of the drug-gene interaction analysis of the final genes. Our study identified 18 genes representing 6 different pathways, targetable by a total of 33 drugs as possible drug treatments. The final list included 18 peroxisome proliferator-activated receptor gamma (PPAR-γ) agonists, 4 beta 3 adrenoceptor (β3-AR) agonists, 1 insulin sensitizer, 3 insulins, 6 lipase clearing factor stimulants and other drugs.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Laboratory Genetic Testing in Clinical Practice
    BioMed Research International Laboratory Genetic Testing in Clinical Practice Guest Editors: Ozgur Cogulu, Yasemin Alanay, and Gokce A. Toruner Laboratory Genetic Testing in Clinical Practice BioMed Research International Laboratory Genetic Testing in Clinical Practice Guest Editors: Ozgur Cogulu, Yasemin Alanay, and Gokce A. Toruner Copyright © 2013 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Laboratory Genetic Testing in Clinical Practice,OzgurCogulu,YaseminAlanay,andGokceA.Toruner Volume 2013, Article ID 532897, 1 page Identification and Characterization of DM1 Patients by a NewDiagnostic Certified Assay: Neuromuscular and Cardiac Assessments, Rea Valaperta, Valeria Sansone, Fortunata Lombardi, Chiara Verdelli, Alessio Colombo, Massimiliano Valisi, Elisa Brigonzi, Elena Costa, and Giovanni Meola Volume 2013, Article ID 958510, 6 pages Ultradeep Pyrosequencing of Hepatitis C Virus Hypervariable Region 1 in Quasispecies Analysis, Kamila Caraballo Cortes,´ Osvaldo Zagordi, Tomasz Laskus, Rafal Ploski, Iwona Bukowska-O´sko, Agnieszka Pawelczyk, Hanna Berak, and Marek Radkowski Volume 2013, Article ID 626083, 10 pages Feasibility of a Microarray-Based Point-of-Care CYP2C19 Genotyping Test for Predicting Clopidogrel On-Treatment Platelet
    [Show full text]