Homeodomain POU and Abd-A Proteins Regulate the Transcription of Pupal Genes During Metamorphosis of the Silkworm, Bombyx Mori

Homeodomain POU and Abd-A proteins regulate the transcription of pupal genes during metamorphosis of the silkworm, Bombyx mori

Huimin Denga, Jialing Zhanga, Yong Lia, Sichun Zhenga, Lin Liua, Lihua Huanga, Wei-Hua Xub, Subba R. Pallic, and Qili Fenga,1

aGuangdong Provincial Key Laboratory of Biotechnology for Plant Development, School of Life Sciences, South China Normal University, Guangzhou 510631, China; bState Key Laboratory of Biocontrol, School of Life Sciences, Sun-Yat Sen University, Guangzhou 510275, China; and cDepartment of Entomology, University of Kentucky, Lexington, KY 40546

Edited by Lynn M. Riddiford, Howard Hughes Medical Institute Janelia Farm Research Campus, Ashburn, VA, and approved June 20, 2012 (received for review February 26, 2012)

A cascade of 20-hydroxyecdysone–mediated gene expression and processes (4, 5). POU proteins contain both a homeodomain and repression initiates larva-to-pupa metamorphosis. We recently an additional POU-specific domain that function together as a bi- showed that two transcription factors, BmPOUM2 and BmβFTZ-F1, partite DNA-binding domain (5). The POU family of genes is bind to the cis-regulatory elements in the promoter of the gene common in vertebrates and invertebrates and plays critical roles fi coding for cuticle protein, BmWCP4, and regulate its expression in cell-type-speci c gene expression and cell fate determination – during Bombyx mori metamorphosis. Here we show that down- (6). POU homeobox domains have been divided into six classes regulation of BmPOUM2 expression by RNA interference during (POU-I to -VI) (7). In mammals, POU transcription factors reg- the wandering stage resulted in failure to complete metamorphosis. ulate the development of the central nervous and neuroendocrine systems as well as the expression of some neurohormones (3). A The thorax epidermis of RNA interference-treated larvae became POU family factor, Pit1, is capable of transactivating the pro- transparent, wing disc growth and differentiation were arrested, moters of the growth hormone prolactin and thyroid-stimulating and the larvae failed to spin cocoons. Quantitative real-time PCR hormone gene in mammals (8). In insects such as Drosophila, BIOLOGY analysis showed that expression of the genes coding for pupal-spe- several members of this family of transcription factors were initially DEVELOPMENTAL fi ci c wing cuticle proteins BmWCP1, BmWCP2, BmWCP3, BmWCP4, characterized as essential for the expression of embryonic pattern BmWCP5, BmWCP6, BmWCP8, and BmWCP9 were down-regulated formation genes. The POU transcription factor drifter in Dro- in BmPOUM2 dsRNA-treated animals, whereas overexpression sophila plays a critical role in development of the neuroendocrine of BmPOUM2 protein increased the expression of BmWCP4, system (3); neuronal lineage and wiring (9); cell fate determination BmWCP5, BmWCP6, BmWCP7,andBmWCP8. Pull-down assays, of imaginal discs (10); regulation of sericin1 (11), fibroin (12), and far-Western blot, and electrophoretic mobility shift assay showed dopa decarboxylase (DDC) (13); and differentiation and migration that the BmPOUM2 protein interacted with another homeodo- of tracheal cells and neurons (14, 15). Drifter binds to a neuron- main transcription factor, BmAbd-A, to induce the expression specific regulatory element of the DDC gene in Drosophila (13, 16). of BmWCP4. Immunohistochemical localization of BmPOUM2, In Helicoverpa armigera, HarPOU responds to ecdysone by binding BmAbd-A, and BmWCP4 proteins revealed that BmAbd-A and to regulatory elements of the diapause hormone and pheromone BmPOUM2 proteins are colocalized in the wing disc cell nuclei, biosynthesis activating neuropeptide (DH-PBAN) gene to regulate whereas BmWCP4 protein is localized in the cytoplasm. Together pupal development (17). The POU domain containing cDNA, these data suggest that BmPOUM2 interacts with the homeodo- POUM1, was cloned from the silk gland of Bombyx mori and was main transcription factor BmAbd-A and regulates the expression found to bind to the octamer element of the sericin-1 gene and of BmWCP4 and probably other BmWCPs to complete the larva-to- regulate its transcription (11). POUM2 is a homolog of POUM1, and it regulates the expression of B. mori gene coding for DH- pupa transformation. Although homeodomain proteins are known PBAN neuropeptide (18). to regulate embryonic development, this study showed that these The Abdominal-A (Abd-A) gene codes for a homeodomain proteins also regulate metamorphosis. protein and is a member of the Drosophila bithorax complex con- sisting of three genes, Ultrabithorax, abdominal-A,andAbdominal- ecdysone | juvenile hormone | molt | pupation B, each of which is required for setting the segmental pattern during embryogenesis (19). This complex is required for specifying reviously, we reported that 20-hydroxyecdysone (20E) induced the identity of abdominal segments two to eight (A2–A8) during Pthe expression of the transcription factors BmβFTZ-F1 and embryonic development in Drosophila (20). Abd-A is also involved BmPOUM2 that bind the cis-response elements (CREs) of the in the differentiation of the anterior and the rear somite axis (21), wing disc cuticle protein gene, BmWCP4, and activate its expres- cardiac tube organogenesis (22), heart cell fate in the dorsal vessel sion, resulting in the synthesis of the cuticle protein in the pupal (23), genesis of the nervous system and fat body (24), gonad for- wing discs during metamorphosis (1). However, the mechanism of mation and development (25, 26), midgut formation (27), and regulation of the pupal- and epidermis-specificexpressionofgene muscle patterning (28) during early embryogenesis of Drosophila coding for BmWCP4 by BmPOUM2 is not known. and other insects. However, there is no information on the role of Homeotic or Hox genes determine segment morphology and appendage number in arthropods. These genes also regulate ver- tebra morphology as well as limb and central nervous system pat- Author contributions: Q.F. designed research; H.D., J.Z., Y.L., and S.Z. performed research; terning in vertebrates (2, 3). A major characteristic of Hox genes is S.Z., L.L., L.H., W.-H.X., S.R.P., and Q.F. contributed new reagents/analytic tools; H.D. and the presence of a highly conserved 180-base pair DNA binding Q.F. analyzed data; and H.D., S.R.P., and Q.F. wrote the paper. motif (homeodomain). The majority of the Hox gene research The authors declare no conflict of interest. focused on embryonic patterning in the fruit fly, Drosophila mela- This article is a PNAS Direct Submission. nogaster. In this insect, Hox genes regulate the identity of body Freely available online through the PNAS open access option. segments during embryogenesis. POU is a subclass of Hox genes 1To whom correspondence should be addressed. E-mail: [email protected]. and consists of three eukaryotic nuclear transcription factors (Pit, This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. Oct, and Unc) that regulate many ubiquitous developmental 1073/pnas.1203149109/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1203149109 PNAS Early Edition | 1of6 Downloaded by guest on October 2, 2021 Abd-A and other Hox genes in organ differentiation during larva- the thoracic region became transparent (Fig. 1Ca, c, and f). to-pupa metamorphosis of holometabolous insects. Growth and differentiation of the wing discs were retarded after In this study, we investigated the regulatory function of BmPOUM2 dsRNA injection (Fig. 1D). In contrast to control BmPOUM2 on BmWCP4, as well as other metamorphosis-re- larvae (Fig. 1Eb), the silk gland did not degenerate by 72 h after lated genes, and its interaction with BmAbd-A in the regulation injection of BmPOUM2 dsRNA. Furthermore, 87% of the of Bombyx metamorphosis. The data suggest a role of a homeo- BmPOUM2 dsRNA-treated larvae died 72 h after injection, domain protein (BmAbd-A) in the regulation of the expression of compared with 7% for the GFP dsRNA-treated control larvae wing disc cuticle protein genes and metamorphosis. (Fig. 1F and Table 1). In addition, 3–4% of the larvae did not complete pupation but did not immediately die at 72 h for either Results BmPOUM2 or dsRNA treatment. Effects of BmPOUM2 Down-Regulation on the Completion of Larva- To determine the effects of BmPOUM2 down-regulation, the expression of several of the genes involved in the development to-Pupa Transformation. To examine the role of BmPOUM2 in of wing discs and the silk gland, including BmWCP1 to 11 (29), the process of the larva-to-pupa transformation in B. mori, DDC (13), and Sericin-1 (11), was examined in BmPOUM2 BmPOUM2 dsRNA was injected into the larvae at day 1 of the dsRNA-treated larvae. qRT-PCR and Western blot analyses wandering stage. Quantitative real-time PCR (qRT-PCR) and fi fi showed that expression of BmPOUM2 and the pupal-speci cwing Western blot analyses showed that the BmPOUM2 dsRNA ef - cuticle protein gene BmWCP4 were down-regulated by BmPOUM2 ciently reduced BmPOUM2 transcript (Fig. 1A) and protein (Fig. dsRNA both at the mRNA and the protein levels (Figs. 1 A and B 1B) abundance. Only 10% of BmPOUM2 dsRNA-treated larvae and 2D), suggesting that BmPOUM2, is involved in the regulation developed to the pupal stage, whereas 90% of the control larvae of BmWCP4, as reported (1). Furthermore, the expression of injected with GFP dsRNA pupated (Fig. 1 C and F and Table 1). the other genes coding for pupal-specific wing cuticle proteins, Starting at 48 h after treatment, the control larvae began to BmWCP1, 2, 3, 5, 6, 8,and9, in the wing discs from BmPOUM2 undergo metamorphosis by spinning a cocoon (Fig. 1Cd, e, and dsRNA-treated larvae was also reduced compared with the con- g), but the BmPOUM2 dsRNA-treated larvae remained in the trols at 48 h after dsRNA injection (Fig. 2 A–C and E–H). Ex- larval stage and failed to spin cocoons (Fig. 1Ccand f). These pression of BmWCP10 was suppressed at 24 h after injection (Fig. larvae emptied their guts and did not feed, and the epidermis in 2I), but increased again at 48 h. Expression of BmWCP11 was not

Fig. 1. Effects of RNAi-mediated silencing of the gene coding for BmPOUM2 on the metamorphosis of B. mori. A total of 10 μg of dsRNA per larva was injected into the intersegmental region between the second and third thoracic segments of ﬁfth-instar larvae at day 0 of the wandering stage. Total RNA and proteins were extracted from the epidermis of the wing discs of the dsRNA-injected larvae. (A) qRT-PCR analysis of BmPOUM2 mRNA was performed with wild-type and dsRNA-treated larvae, and β-actin ampliﬁed from the same RNA samples was used as the internal control. *P < 0.05 (BmPOUM2 dsRNA treatment vs. GFP dsRNA control; t test). (B) Western blot analysis of BmPOUM2 and BmWCP4 proteins in wild-type and dsRNA-treated larvae. Protein (50 μg) was loaded per lane and probed with anti-BmPOUM2 and -BmWCP4 antibodies, respectively. WT, wild type; GFP, EGFP dsRNA; POUM2, BmPOUM2 dsRNA. (C) Phenotypes of dsRNA-treated larvae. (D) Developmental stage of the wing discs in EGFP dsRNA-treated (Upper) and BmPOUM2 dsRNA-treated (Lower) larvae at different times after dsRNA treatment. (E) Development of the silk gland of the RNAi-treated larvae at 24 and 72 h after the treatment. (F) Larval and pupal phenotypes at 24 h (A and B), 48 h (C), and 72 h (D) after EGFP dsRNA and BmPOUM2 dsRNA treatments. hpt, hours postinjection.

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1203149109 Deng et al. Downloaded by guest on October 2, 2021 Table 1. Effects of dsRNA interference of BmPOUM2 or EGFP on B. mori larvae Phenotypic variation Arrested as incomplete Transparent thorax Failed to spin Mortality rate Pupation rate pupa Total no. of dsRNA larvae treated No. % No. % No. % No. % No. %

EGFP (control) 162 0 0 0 0 12 7.4 ± 1.4 145 89.6 ± 6.8 5 3.0 ± 0.8 BmPOUM2 152 123 80.6 ± 5.5** 123 80.6 ± 5.5** 131 86.6 ± 4.0** 15 9.5 ± 1.4** 6 3.9 ± 1.1

The phenotypic variation includes those insects that showed the phenotypes of transparent integument in the thorax and failure to spin and form cocoons, which occurred simultaneously in the same animals. Mortality rate is expressed as the total number of insects divided by the number that died 72 h after the injection of dsRNA. Pupation rate is expressed as the total numbers of insects divided by the number of pupae that survived after dsRNA treatment. Arrested as incomplete pupa is for those insects that did not immediately die 72 h after treatment and did not pupate completely but were arrested with larval features and partial pupal epidermis. **P < 0.01 (t test).

affected (Fig. 2J). Thus, the silencing of the BmPOUM2 gene factor in the 20E and JH signal pathways in the regulation of the resulted in suppression of most pupal-speciﬁc wing cuticle protein expression of BmWCP4. genes tested, causing a failure in wing disc differentiation (Fig. 1D) and pupation (Fig. 1 C and F). BmPOUM2 RNAi also down-reg- Increase in Expression of BmWCP Genes After Overexpressing ulated the expression of BmDDC (Fig. 2K), which is known to be BmPOUM2. To further explain the role of BmPOUM2 in the reg- involved in melanization (30). This down-regulation is probably the ulation of BmWCP genes, the promoter regions of the 11 cuticle – reason why the thoracic epidermis in the BmPOUM2 dsRNA- genes, BmWCP1 11, were analyzed in silico by using bio- C F informatics method. A total of 141 POU CREs with a length of treated larvae became transparent (Fig. 1 and ). Expression of – – BmSerine-1 was also suppressed in BmPOUM2 dsRNA-treated 8 25 nucleotides were found in the BmWCP1 11 promoter regions larvae (Fig. 2L), and this suppression, among other genes affected (Table S1 and Fig. S2), suggesting that POU could be a main regulator of the genes coding for BmWCP genes.

by the RNAi, may have led to a failure of spinning and cocoon BIOLOGY Direct regulation of BmWCP genes by the transcription factor formation (Fig. 1 C, E,andF). All these data together suggest that BmPOUM2 predicts that overexpression of this protein would DEVELOPMENTAL the BmPOUM2 is a critical metamorphic transcription factor that increase the expression of the luciferase reporter gene placed regulates larva-to-pupa transformation in Bombyx. under the control of the BmWCPs POU CREs. To test this hy- As previously shown (1), the expression of BmPOUM2 and pothesis, the promoter sequences of the genes coding for BmWCP4 is induced by 20E, and the effect of 20E is suppressed BmWCP1–11, except BmWCP2 and BmWCP9 (whose 5′-end up- by juvenile hormone (JH III). To determine the effects of downstream regulatory region were also cloned but failed to transfer regulation of BmPOUM2 on the genes involved in 20E and JH them into the pGL3 vector), were cloned and inserted into the cascades, the expression of a number of genes, including BmE74A, pGL3-basic vector upstream to the luciferase gene. The constructs BmE74B, BmβFTZ-F1, BmHR39, BmBR-C Z4, and BmMet, was were used to cotransfect BmN cells along with the BmPOUM2– examined in the wild-type, BmPOUM2, and GFP dsRNA-treated EGFP expression vector. As shown in Fig. S3, the expression larvae at 24 and 48 h after injection (Fig. S1). All of these genes levels of the luciferase gene under the control of BmWCP4, 5, 6, 7, were not signiﬁcantly changed by down-regulation of BmPOUM2 and 8 promoters increased by 1.5- to 2.0-fold over the controls mRNA. This ﬁnding suggests that BmPOUM2 is a downstream in cells overexpressing BmPOUM2. However, the levels of the

Fig. 2. qRT-PCR analysis of BmWCPs DDC,andser- icin-1 in the wing disc epidermis of the dsRNA-treated larvae. In the qRT-PCR analysis, both quantitative and relative expression levels of BmWCP1-6 (A–F), BmWCP8–11 (G–J), DDC (K), and sericin-1 (L) were calculated after normalizing with β-actin expression as an internal control using the same RNA samples. Each data point represents mean ± SE (n = 3).

Deng et al. PNAS Early Edition | 3of6 Downloaded by guest on October 2, 2021 luciferase gene expressed under the control of BmWCP1, 3, 10, and 11 promoters did not increase. These data suggest that BmPOUM2 could directly up-regulate the expression of BmWCP4, 5, 6, 7, and 8, but probably not BmWCP1, 3, 10, and 11. This result is consistent with the results obtained with BmPOUM2 RNAi, where BmWCP 10 and 11 were not suppressed in the BmPOUM2 dsRNA-injected larvae at 48 h after the treatment (Fig. 2 I and J). Although BmPOUM2 RNAi suppressed the expression of BmWCP1 and BmWCP3,overexpression of BmPOUM2 did not signiﬁcantly increase their expression. One possible explanation is that these two BmWCP genes may require other cofactors that may not be present in the BmN cells. This hypothesis needs to be investigated further.

BmPOUM2 Interacts with BmAbd-A and Binds to the POU-CRE Present in the BmWCP4 Promoter. To determine whether or not the transcription factor BmPOUM2 interacts with other nuclear transcription factor(s) in the regulation of BmWCP4 expression, pull- down assays and far-Western blot analyses were performed. Recombinant BmPOUM2 protein with a 6× His tag at the N terminus (His–BmPOUM2) was incubated with nuclear proteins isolated from wing disc tissues, and bound protein(s) were isolated by His-tag affinity chromatography. As shown in Fig. 3A (lane 2), a 43-kDa protein that bound to His–BmPOUM2 (44 kDa) was detected in the pull-down assay. Far-Western blot analysis showed Fig. 3. Interaction analysis of BmPOUM2 with BmAbd-A. (A) His-tag pull- that the two protein bands (44 and 43 kDa) immunologically down assay of BmPOUM2 and other proteins. Proteins were extracted from the wing discs of fifth-instar larvae at the prepupal stage. Lane 1 shows that reacted with the anti-BmPOUM2 antibody (Fig. 3Ba). The band BmPOUM2 protein incubated with PBS as control. Lane 2 shows that with a molecular mass of 43 kDa was excised from the gel and – BmPOUM2 protein incubated with the protein extracted from wing disc tis- subjected to liquid chromatography mass spectrometry (LC-MS) sues. The arrowhead indicates the pull-down protein of ∼43 kDa (lane 2) that analysis. The LC-MS analysis showed that one of the protein binds with BmPOUM2, and arrows indicate the BmPOUM2 protein. (B)Far- components in this band is an Abdominal-A protein, which is Western blot analysis of BmPOUM2 and BmAbd-A protein. The protein required during embryonic development to specify the identity of extracts from the wing discs (50 μg) (a)andtheHis-tagaffinity-purified abdominal segments two to eight (A2–A8) in Drosophila (19). recombinant BmAbd-A protein (1 μg) (b) were separated by using 12% (wt/vol) To confirm the interaction of BmPOUM2 protein with SDS/PAGE and transferred to nitrocellulose membranes. The membranes were BmAbd-A protein, the ORF of BmAbd-A was cloned by RT- either used for direct immunoblots using anti-BmPOUM2 antibody (−) or used PCR, and a recombinant His–BmAbd-A protein was expressed for far-Western blot analysis, where the recombinant BmPOUM2 protein and purified. Far-Western blot analysis with BmPOUM2 and was incubated with the membrane before adding the anti-BmPOUM2 anti- BmAbd-A proteins showed that BmAbd-A could interact with body (+). Positive bands were observed only when BmPOUM2 or BmPOUM2/ His–BmPOUM2 (Fig. 3Bb). The purified His–BmAbd-A protein BmAbd-A complex was present. (C)Pull-downassaywithHis–BmAbd-A. Puri- fi – was incubated with the nuclear proteins isolated from the wing ed recombinant His BmAbd-A protein was incubated with the protein – – extracts from the wing discs, and then the His–BmAbd-A bound protein was disc tissues. After incubation, His BmAbd-A bound protein(s) fi fi – – were purified by affinity chromatography. Samples were sepa- puri ed with Ni-NTA beads. The puri ed His BmAbd-A bound protein was eluted and separated on SDS/PAGE (lanes 2 and 5). The purified His–BmAbd-A rated by SDS/PAGE (Fig. 3C, lanes 1–3) and probed with anti- – fi – protein that was incubated with PBS buffer was used as a negative control BmPOUM2 antibody (Fig. 3C, lanes 4 6). The puri ed His (lanes 1 and 4). Another negative control, Ni-NTA beads alone incubated with BmAbd-A protein that was incubated with PBS buffer was used the proteins, was used to exclude the possibility of any nuclear proteins directly as a negative control (Fig. 3C, lane 1), and another negative interacting with the NTA resin (lanes 3 and 6). The protein was transferred to control, Ni–nitrilotriacetic acid (NTA) beads, was used to ex- the membrane and probed with anti-BmPOUM2 antibody (lanes 4–6). clude the possibility of any nuclear proteins directly interacting with the NTA resin (Fig. 3C, lane 3). Among the His–BmAbd-A pull-down products, a 38-kDa protein (Fig. 3C, lane 2), equiva- nucleotides of the conserved core octamer motif were changed lent to the molecular mass of BmPOUM2, was detected by the from CTTTGCAT to TGCTGCAT) (Fig. 4B, lanes 2 and 3), anti-BmPOUM2 antibody (Fig. 3C, lane 5). The results of these but not to mutant 2 or 3 where the first five (TGCCCCAT) or all assays confirmed the interaction of BmPOUM2 and BmAbd-A. nucleotides (CAGATTGC) had been changed, respectively To determine whether BmAbd-A protein directly binds to the (Fig. 4B, lanes 4 and 5). Similarly, addition of BmAbd-A further POU CRE of the BmWCP4 promoter, the recombinant His– retarded BmPOUM2 and wild-type and mutant 1 POU CRE BmAbd-A and His–BmPOUM2 proteins were purified and in- complex (Fig. 4B, lanes 6 and 7). No binding of BmPOUM2 to cubated in vitro with the POU CRE DNA probe, and then an- mutants 2 and 3 was detected even in the presence of BmAbd-A alyzed by electrophoretic mobility shift assay (EMSA). As shown (Fig. 4B, lanes 8 and 9). These results suggest that the binding in Fig. 4A, recombinant His–BmAbd-A protein alone could not of BmPOUM2 or BmPOUM2/BmAbd-A complex with the directly bind to the POU CRE probe of the BmWCP4 gene POU CRE is specific. Determining whether or not BmAbd-A promoter (Fig. 4A, lane 2). In contrast, BmPOUM2 alone was canbindtootherregion(s)oftheBmWCP4 promoter requires able to bind to the POU CRE probe (Fig. 4A, lane 3). In- further studies. terestingly, His–BmAbd-A protein interacted with BmPOUM2 bound to the POU CRE of BmWCP4 and retarded the mobility Expression and Colocalization of BmPOUM2, BmAbd-A, and BmWCP4 of this complex (Fig. 4A, lane 4). These data show that BmAbd- in Wing Discs. RT-PCR analysis of BmAbd-A mRNA during fifth- A interacts with BmPOUM2, which is able to bind to POU CRE. instar larval, wandering, as well as pupal stages showed that To test the specificity of DNA binding by BmAbd-A/ mRNA levels increased from day 2 to 4 of fifth-instar stage and BmPOUM2 protein complex, the three mutant versions of the then decreased and became undetectable by day 7 (Fig. S4). POU CRE changing the first three, five, and all nucleotides BmAbd-A mRNA levels increased again beginning on day 3 after were prepared and tested. As shown in Fig. 4B,BmPOUM2 entering the wandering stage and continued to be detected bound to the wild-type and mutant 1 POU CRE (the first three throughout the pupal stage (Fig. S4). The expression of the

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1203149109 Deng et al. Downloaded by guest on October 2, 2021 transcription factors are known to play key roles in embryo patterning during embryonic development (20). Abd-A is a member of the Drosophila bithorax complex, which belongs to the homeobox gene superfamily (19) and is required for early embryonic development and differentiation in Drosophila.Hereweshowed that BmAbd-A interacts with BmPOUM2 (Figs. 3 and 4 and Figs. S4 and S5)toregulatepupal-stage-specificexpressionofthe metamorphosis-associated BmWCP4 and probably other BmWCP genes in response to 20E increase. However, attempts to knock down the expression of the gene coding for BmAbd-A by RNAi were not successful, and therefore detailed functional analysis of BmAbd-A is not possible at this time. In holometabolous insects, most larval organs differentiate Fig. 4. EMSA for binding of BmPOUM2 and BmPOUM2/BmAbd-A complex during embryonic development, but many adult organs, including to the POU-CRE of the BmWCP4 promoter. (A) EMSA for the detection of wings, genitalia, and adult legs, are present in an undifferentiated the interaction between BmPOUM2 and BmAbd-A and the ensuing complex binding to the POU CRE of the BmWCP4 promoter. (B) Mutation analysis of state as imaginal discs. These organs develop and differentiate the BmPOUM2 binding to the POU CRE of BmWCP4 gene. Wild-type se- beginning at the pupal stage and become fully functional in the quence of the POU CRC is CAATAACCTTTACATTAGATGCCTTC (the con- adult stage. The homeodomain transcription factor gene Abd-A served core octamer motif is underlined). Mutant 1, the first three bases of has long been known to be involved in differentiation of larval the motif were changed to TGCTGCAT (lanes 3 and 7); mutant 2, the first five organs during embryogenesis (20). In this study, we show that this bases were changed to TGCCCCAT (lanes 4 and 8); mutant 3, all of the bases gene is also involved in the regulation of the cuticle protein syn- of the motif were changed to CAGATTGC (lanes 5 and 9). thesis in the pupal wing disc by interacting with the homeodomain transcription factor POU. Among other things, this result suggests that the differentiation of the wing imaginal discs during meta- BmAbd-A gene at the end of the wandering stage and during morphosis requires the involvement of Abd-A. It also suggests that midpupal stage correlated well with the expression of the organogenesis during embryogenesis and metamorphosis may BmPOUM2 and BmWCP4 genes. The location of the BmAbd- share, at least in part, similar mechanisms of gene regulation. This

A, BmPOUM2, and BmWCP4 proteins was examined by im- work demonstrates Abd-A homeodomain transcription factor in- BIOLOGY munohistochemistry of wing discs dissected from the larvae at volvement in gene regulation during insect metamorphosis. the prepupal (wandering) stage. As shown in Fig. S5, when ex- DEVELOPMENTAL pression of the three genes was high, the three proteins were Model for Regulation of the Pupal-Specific Expression of BmWCP simultaneously expressed in the wing discs (Fig. S5 A–C), and Genes and Metamorphosis in B. mori. Based on the data presented their intracellular distribution was similar, but not identical. The in this work and in our previous studies (1), we propose an BmAbd-A and BmPOUM2 proteins were localized evenly in the nuclei, especially near the nuclear membrane (Fig. S5 E, F, and I), whereas the BmWCP4 protein was mainly localized in the cytoplasm (Fig. S5 G and I). Discussion BmPOUM2 Is a Vital Transcription Factor for Regulation of Metamor- phosis. In a previous study, we found that during metamorphosis the expression of BmWCP4 was up-regulated by BmPOUM2 binding to the POU CRE of the gene (1). In this study, down- regulation of BmPOUM2 reduced the expression of BmWCP4 both at the mRNA and protein levels (Figs. 2D and 1B) and disrupted larva-to-pupa transformation and wing disc development (Fig. 1 C and D). BmPOUM2 not only regulates the expression of the BmWCP4 gene, but also regulates several other genes involved in the larva-to-pupa transformation. A large number of POU CREs was found in the regulatory regions of BmWCP genes (Table S1). Overexpression of BmPOUM2 activated transcription of some of the genes coding for wing disc cuticle proteins, including BmWCP4, 5, 6, 7,and8 (Fig. S3). RNAi of BmPOUM2 reduced the expression of BmWCP1–9 (except 7, which was not tested), Fig. 5. Schematic representation of the model of molecular regulation of BmDDC,andBmsericin-1 (Fig. 2). When the expression of these the expression of BmWCP4 as well as other BmWCP genes by nuclear tran- genes was suppressed by silencing BmPOUM2, the integument in scription factors in response to 20E and JH during metamorphosis in B. mori. the thoracic region became transparent, growth and differentia- 20E binds to the heterodimer of the USP/ecdysone receptor, which either tion of the wing discs were retarded, and the BmPOUM2 dsRNA- directly or indirectly activates the expression of the transcription factors treated larvae failed to spin and form cocoons. Together, these BmPOUM2 and BmβFTZ-F1. While BmβFTZ-F1 binds to the corresponding data suggest that BmPOUM2 regulates the expression of not only BmβFTZ-F1 CRE, the nuclear homeodomain transcription factor BmPOUM2 BmWCP4, but also some BmWCPs as well as other genes involved interacts with another homeodomain transcription factor, BmAbd-A, to in larva-to-pupa metamorphosis. Thus, BmPOUM2 is a critical form a complex, which binds to the corresponding POU CRE in the BmWCP4 homeodomain transcription factor that regulates an array of genes regulatory region to activate the expression of BmWCP4, as well as other coding for proteins required for the metamorphic transformation genes coding for pupal wing disc cuticle proteins (pathway 1). BmPOUM2 may also indirectly activate expression of the genes coding for other BmWCP of larvae into pupae in the silkworm. proteins by activating other unidentified transcription factor(s) that interact with CREs in the promoter of these genes (pathway 2). Activation of other BmPOUM2 Interacts with Another Homeodomain Transcription Factor, BmWCP genes may not act through the direct (pathway 1) or indirect BmAbd-A. The major finding of this work is the discovery that two (pathway 2) action of BmPOUM2 but through unknown transcription factor homeodomain transcription factors, BmPOUM2 and BmAbd-A, (s) in the regulation of the expression of BmWCP genes (pathway 3). All regulate the expression of a number of genes coding for cuticle these pathways work together, leading to the postlarval development and proteins during larva-to-pupa metamorphosis. Homeodomain differentiation of the wing disc during metamorphosis.

Deng et al. PNAS Early Edition | 5of6 Downloaded by guest on October 2, 2021 updated model for the regulation of genes coding for wing disc Construction of Expression Vectors, Recombinant Expression, and Antibody cuticle proteins during metamorphosis in B. mori (Fig. 5). The Preparation. Construction of expression vectors, recombinant expression, and molting hormone, 20E, binds to the heterodimer of EcR–USP, antibody preparation are shown in SI Materials and Methods. which in turn directly or indirectly activates the expression of the transcription factors POUM2 and βFTZ-F1. The transcription Cell Culture and Transfection. The B. mori cell line, BmN was used in trans- factor βFTZ-F1 binds to the βFTZ-F1 CRE of BmWCP4 (1), fection and cotransfection in this study. Vector construction, transfection procedure, and data presentation are shown in SI Materials and Methods. BmWCP2 (31), BmWCP5 (32), and BmWCP10 (33). The nuclear homeodomain transcription factor BmPOUM2 interacts with EMSA. The probe preparation, DNA-binding reactions, and signal detection of another homeodomain transcription factor, BmAbd-A, and this EMSA are shown in SI Materials and Methods. heterodimer binds to the POU CRE in the promoter of BmWCP4 and some of the other BmWCP genes coding for pupal wing disc Protein Isolation, Western Blot, Far-Western Blot, and Pull-Down Assay. The cuticle proteins (Pathway 1). Alternatively, BmPOUM2 may ac- epidermis containing wing disc tissues were dissected from the larvae and tivate other unidentiﬁed transcription factor(s) that interact with used in these studies. The detailed procedures of far-Western blot and pull- CREs in the promoter of the genes coding for other BmWCP down assays are described in SI Materials and Methods. proteins (Pathway 2). It is also possible that activation of some other BmWCP genes is not through the direct (Pathway 1) or Immunohistochemistry. Immunohistochemical colocalization of BmPOUM2, indirect (Pathway 2) action of BmPOUM2 but through other BmWCP4, and BmAbd-A proteins were performed as described in SI Materials unknown transcription factor(s) (Pathway 3). All these pathways and Methods. would work together, leading to the postembryonic development and differentiation of the wing discs during metamorphosis. dsRNA Synthesis and RNA Interference. Preparation of BmPOUM2 and GFP dsRNA, dsRNA injection, and data presentation are described in Table S2 and Materials and Methods SI Materials and Methods. Experimental Insects. Silkworm B. mori strain Dazao was used in this study. ACKNOWLEDGMENTS. We thank Dr. Fuquan Wu (Research and Develop- Rearing conditions and stages of the insect are described in SI Materials ment Center, Sericulture Research Institute, Academy of Agricultural Sci- and Methods. ences of Guangdong Province, China) for providing the silkworms; Dr. Erjun Ling (Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Bioinformatics Analysis. Bioinformatics analysis is shown in SI Materials China) for his assistance in immunohistochemisty analysis; and Dr. Arthur and Methods. Retnakaran (Canadian Forest Service) and Dr. Marcelo Jacobs-Lorena (The Johns Hopkins Bloomberg School of Public Health) for helpful comments during preparation of this manuscript. This work was supported by National RT-PCR and qRT-PCR. RNA extraction, PCR procedure, and the sequences of Basic Research Program of China Grant 2012CB114602, Chinese National the primers used in this study are described in Table S2 and SI Materials Natural Science Foundation Grant 31172265, and National High-Tech Re- and Methods. search and Development Program Grant 2006AA10A119.

1. Deng HM, Zheng SC, Yang XH, Liu L, Feng QL (2011) Transcription factors BmPOUM2 18. Zhang TY, Kang L, Zhang ZF, Xu WH (2004) Identification of a POU factor involved in and BmβFTZ-F1 are involved in regulation of the expression of the wing cuticle pro- regulating the neuron-specific expression of the gene encoding diapause hormone tein gene BmWCP4 in the silkworm, Bombyx mori. Insect Mol Biol 20:45–60. and pheromone biosynthesis-activating neuropeptide in Bombyx mori.. Biochem J 2. McGinnis W, Krumlauf R (1992) Homeobox genes and axial patterning. Cell 68: 380:255–263. 283–302. 19. Sánchez-Herrero E, Vernós I, Marco R, Morata G (1985) Genetic organization of 3. Andersen B, Rosenfeld MG (2001) POU domain factors in the neuroendocrine system: Drosophila bithorax complex. Nature 313:108–113. Lessons from developmental biology provide insights into human disease. Endocr Rev 20. Karch F, Bender W, Weiffenbach B (1990) abdA expression in Drosophila embryos. 22:2–35. Genes Dev 4:1573–1587. 4. Ruvkun G, Finney M (1991) Regulation of transcription and cell identity by POU do- 21. Ponzielli R, et al. (2002) Heart tube patterning in Drosophila requires integration of main proteins. Cell 64:475–478. axial and segmental information provided by the Bithorax Complex genes and – 5. Herr W, et al. (1988) The POU domain: a large conserved region in the mammalian pit-1, oct- hedgehog signaling. Development 129:4509 4521. 1, oct-2, and Caenorhabditis elegans unc-86 gene products. Genes Dev 2(12A):1513–1516. 22. Perrin L, Monier B, Ponzielli R, Astier M, Semeriva M (2004) Drosophila cardiac tube – 6. Ryan AK, Rosenfeld MG (1997) POU domain family values: Flexibility, partnerships, organogenesis requires multiple phases of Hox activity. Dev Biol 272:419 431. and developmental codes. Genes Dev 11:1207–1225. 23. Lovato TL, Nguyen TP, Molina MR, Cripps RM (2002) The Hox gene abdominal-A fi – 7. Bürglin TR (1994) A comprehensive classification of homeobox genes. Guidebook to speci es heart cell fate in the Drosophila dorsal vessel. Development 129:5019 5027. the Homeobox Genes, ed Duboule D (Oxford Univ Press, Oxford), pp 25–71. 24. Marchetti M, Fanti L, Berloco M, Pimpinelli S (2003) Differential expression of the 8. Cohen LE, Wondisford FE, Radovick S (1996) Role of Pit-1 in the gene expression of growth Drosophila BX-C in polytene chromosomes in cells of larval fat bodies: A cytological approach to identifying in vivo targets of the homeotic Ubx, Abd-A and Abd-B pro- hormone, prolactin, and thyrotropin. Endocrinol Metab Clin North Am 25:523–540. teins. Development 130:3683–3689. 9. Komiyama T, Johnson WA, Luo L, Jefferis GS (2003) From lineage to wiring specificity. 25. Cumberledge S, Szabad J, Sakonju S (1992) Gonad formation and development re- POU domain transcription factors control precise connections of Drosophila olfactory quires the abd-A domain of the bithorax complex in Drosophila melanogaster.. De- projection neurons. Cell 112:157–167. velopment 115:395–402. 10. Certel K, Hudson A, Carroll SB, Johnson WA (2000) Restricted patterning of vestigial 26. Foronda D, Estrada B, de Navas L, Sánchez-Herrero E (2006) Requirement of Ab- expression in Drosophila wing imaginal discs requires synergistic activation by both dominal-A and Abdominal-B in the developing genitalia of Drosophila breaks the Mad and the drifter POU domain transcription factor. Development 127:3173–3183. posterior downregulation rule. Development 133:117–127. 11. Fukuta M, et al. (1993) Molecular cloning of a POU domain-containing factor involved 27. Mathies LD, Kerridge S, Scott MP (1994) Role of the teashirt gene in Drosophila in the regulation of the Bombyx sericin-1 gene. J Biol Chem 268:19471–19475. midgut morphogenesis: Secreted proteins mediate the action of homeotic genes. 12. Takiya S, Kokubo H, Suzuki Y (1997) Transcriptional regulatory elements in the up- Development 120:2799–2809. fi fi stream and intron of the broin gene bind three speci c factors POU-M1, Bm Fkh and 28. Michelson AM (1994) Muscle pattern diversification in Drosophila is determined by – FMBP-1. Biochem J 321:645 653. the autonomous function of homeotic genes in the embryonic mesoderm. De- 13. Johnson WA, Hirsh J (1990) Binding of a Drosophila POU-domain protein to a se- velopment 120:755–768. fi quence element regulating gene expression in speci c dopaminergic neurons. Nature 29. Takeda M, et al. (2001) Mass isolation of cuticle protein cDNAs from wing discs of – 343:467 470. Bombyx mori and their characterizations. Insect Biochem Mol Biol 31:1019–1028. 14. Anderson MG, Perkins GL, Chittick P, Shrigley RJ, Johnson WA (1995) drifter, a Dro- 30. Andersen SO (2010) Insect cuticular sclerotization: A review. Insect Biochem Mol Biol sophila POU-domain transcription factor, is required for correct differentiation and 40:166–178. migration of tracheal cells and midline glia. Genes Dev 9:123–137. 31. Nita M, et al. (2009) Analysis of ecdysone-pulse responsive region of BMWCP2 in wing 15. Anderson MG, et al. (1996) Function of the Drosophila POU domain transcription disc of Bombyx mori.. Comp Biochem Physiol B Biochem Mol Biol 153:101–108. factor drifter as an upstream regulator of breathless receptor tyrosine kinase ex- 32. Wang HB, Nita M, Iwanaga M, Kawasaki H (2009) betaFTZ-F1 and Broad-Complex pression in developing trachea. Development 122:4169–4178. positively regulate the transcription of the wing cuticle protein gene, BMWCP5, in 16. Johnson WA, McCormick CA, Bray SJ, Hirsh J (1989) A neuron-specific enhancer of the wing discs of Bombyx mori. Insect Biochem Mol Biol 39:624–633. Drosophila dopa decarboxylase gene. Genes Dev 3:676–686. 33. Wang HB, Iwanaga M, Kawasaki H (2009) Activation of BMWCP10 promoter and 17. Zhang TY, Xu WH (2009) Identification and characterization of a POU transcription regulation by BR-C Z2 in wing disc of Bombyx mori.. Insect Biochem Mol Biol 39: factor in the cotton bollworm, Helicoverpa armigera.. BMC Mol Biol 25:10–25. 615–623.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1203149109 Deng et al. Downloaded by guest on October 2, 2021