DOCSLIB.ORG

Classic Kaposi Sarcoma in the United States Over the Last Two

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Classic Kaposi Sarcoma in the United States Over the Last Two Modern Pathology (2008) 21, 572–582 & 2008 USCAP, Inc All rights reserved 0893-3952/08 $30.00 www.modernpathology.org Classic Kaposi Sarcoma in the United States over the last two decades: A clinicopathologic and molecular study of 438 non-HIV-related Kaposi Sarcoma patients with comparison to HIV-related Kaposi Sarcoma Kim M Hiatt1, Ann M Nelson2, Jack H Lichy2 and Julie C Fanburg-Smith2 1Dermatopathology, University of Arkansas for Medical Sciences, Little Rock, AR, USA and 2Departments of Infectious Disease, Molecular, and Soft Tissue/Orthopaedic Pathology, Armed Forces Institute of Pathology, Washington, DC, USA Classic Kaposi sarcoma is rare and occurs predominantly in Mediterranean and Middle Eastern men. Since the emergence of acquired immune deficiency syndrome (AIDS)-related Kaposi sarcoma, the incidence, clinicopathologic features, and molecular human herpesvirus 8 (HHV-8) association of American Classic Kaposi Sarcoma has not been fully explored. This study compares Classic Kaposi Sarcoma to AIDS-related Kaposi Sarcoma over the same two decade time period. There were 438 histologically and clinically confirmed Classic Kaposi Sarcoma patients. The ethnic/racial distribution included Caucasian/American (56%), Mediterranean (22%), South American Hispanic (18%), Black (10%), western European (4%), Middle East (4%), Scandinavian (2%), and other (2%). Classic Kaposi Sarcoma was more common in men, 7:1, with a mean age of 74 years. The lesions presented in the lower extremity (69%), in the nodular stage (83%), and HHV-8 was detected by PCR in 40/41 randomly selected cases. A second, non-Classic Kaposi Sarcoma, malignancy was present in 42% (n ¼ 45) of the 108 Classic Kaposi Sarcoma patients with complete clinical information, 73% (33 patients) with a higher incidence over the general population. Follow-up of o1–19 years (mean ¼ 4.8 years) revealed that 24% of patients died of second malignancy, 22% died of other medical conditions, 2% died of treatment-related complications, and 2% patients died of widespread disease. Thirty-five percent are alive with no evidence of disease and 15% with persistent disease. Human immunodeficiency virus-related Kaposi Sarcoma was observed in 354 cases. There was a male predominance and more aggressive behavior, with higher rates of visceral and disseminated disease. While Classic Kaposi Sarcoma in the United States is an indolent disease and rarely accounts for patient demise, predominantly affecting Caucasian/American males on the lower extremity in the nodular phase, it more importantly may denote an underlying other malignancy. Current PCR probes detect HHV-8 in 98% of Classic Kaposi Sarcoma cases. In comparison, AIDS-related Kaposi Sarcoma is predominately multicentric, visceral, and disseminated, with more aggressive behavior. Modern Pathology (2008) 21, 572–582; doi:10.1038/modpathol.2008.15; published online 28 March 2008 Keywords: classic Kaposi sarcoma; United States; 1980–2000; AIDS-related Kaposi sarcoma; pathology; HHV-8 Classic Kaposi Sarcoma is traditionally known as an Correspondence: Dr JC Fanburg-Smith, MD, Orthopaedic and indolent disease in elderly men of Mediterranean Soft Tissue Pathology Department, Armed Forces Institute of and Middle Easternern descent. With the emergence Pathology, Building 54, Department of Soft Tissue Pathology, of acquired immune deficiency syndrome (AIDS) in Room G090, 14th Street and Alaska Avenue, NW, Washington, DC 20306-6000, USA. the United States in the early 1980s, Kaposi sarcoma E-mail: [email protected] came to the forefront, because of its association with The opinions and assertions are the expressed views of the human immunodeficiency virus positive (HIV þ ) authors and are not to be construed as official or as a reflection of individuals, particularly in certain risk groups. Cox the views of the Department of Army or Defense. This was and Helwig reported on 50 cases of Kaposi Sarcoma presented in part as an abstract at the USCAP. 1 Received 07 November 2006; revised and accepted 25 June 2007; from our institute in 1959. Those cases included 8 published online 28 March 2008 Italians and 11 Africans, and thus likely represented Classic Kaposi in the United States over the last two decades KM Hiatt et al 573 a combination of classic and endemic forms, as the genders, were evaluated for human herpesvirus 8 AIDS epidemic had not yet begun. In 1999, Smith (HHV-8) status. The AIDS-related Kaposi Sarcoma et al2 reported on 250 women with all subsets of cases were not evaluated for HHV-8 positivity. Kaposi Sarcoma, including women from the United The Surveillance, Epidemiology and End Results States as well as other countries. To our knowledge, (SEER) Cancer Statistic Review4 from National there have been no recent large studies on Classic Institute of Health, for the population over 65 years Kaposi Sarcoma in the United States. old, monitoring cancer incidence in approximately 10% of the US population since 1973, was used to compare the expected incidence of cancers in the Materials and methods general population to the incidence of associated malignancies in this cohort of Classic Kaposi The Soft Tissue Pathology registry at the Armed Sarcoma patients. Forces Institute of Pathology was searched for ‘Classic Kaposi Sarcoma’ patients. Although Classic Kaposi Sarcoma is known to occur in younger Polymerase Chain Reaction patients, to ensure the exclusion of patients who may not yet be seropositive for HIV, only patients DNA was extracted from six 6-m sections of each over the age of 65 years at diagnosis were chosen block by deparaffinization with Hemo-De followed for this study. From a cohort of 682 patients with by protease K digestion, extraction with phenol/ chloroform, and ethanol precipitation, as previously 752 Kaposi Sarcoma lesions, slides were available 5 and diagnostic of Classic Kaposi Sarcoma in 438 described by Lichy et al. The probe and primer patients. All patients known to be HIV þ or have sequences are listed in Table 1. high-risk activity, based on the submitted report or discussion with the clinician, were excluded from the Classic Kaposi Sarcoma group (9/682). Results Information on the AIDS-related Kaposi Sarcoma Patient Demographics patients was obtained from the AIDS Registry at the Armed Forces Institute of Pathology. These actually The original patient list included 446 males and included three patients over the age of 65 who were 183 females, with a ratio of 2.4 males to 1 female. known to be HIV þ. Additionally, patients from The current study group of 438 patients with Africa (25/682) were excluded to avoid confounding available diagnostic material included 385 men the data with specimens that possibly represented (385/446 ¼ 86% of the data bank male patients with endemic/epidemic Kaposi Sarcoma. None of the classic Kaposi Sarcoma) and 53 women (53/ Classic Kaposi Sarcoma patients were known to be 183 ¼ 29.5% of the data bank of female patients transplant recipients and none were reported to be with classic Kaposi Sarcoma), 7 males to 1 female. ‘iatrogenic’ or chemotherapy/immunosuppressive Available data from 354 AIDS-related Kaposi Sarco- therapy induced. Kaposi Sarcoma diagnosis was ma patients diagnosed at our institution between made using previously established criteria.3 1980 and 2000 were compared with the Classic Tumor registries, physicians, and patients were Kaposi Sarcoma cases. Known risk factors for the systematically contacted to obtain information re- AIDS-related cases (n ¼ 97) are the following: 54 garding age, gender, reported nationality or ethni- (56%) homosexual/bisexual, 12 (12%) intravenous city, concurrent malignancies, status of the patient drug users, 21 (22%) African (12 of 13 females were as well as size, location, multicentricity, and from Africa), 4 (4%) transfusion related, and 5 (5%) dissemination of the Kaposi Sarcoma. Except for other. The male:female ratio for the AIDS-related the data on associated malignancies, which were not available for the AIDS-related group, all data were compared to a group of AIDS-related Kaposi Sarco- ma patients (n ¼ 354) at our institute during the Table 1 HHV-8 probe and primer sequences same time period. Kaposi Sarcoma was classified as HHV-8 (putative minor capsid protein) (11) solitary based on clinical presentation of a single 0 0 lesion, multifocal when more than one lesion KS330233 5 -AGCCGAAAGGATTCCACCAT-3 involving the same lymphatic flow was present, (forward): 0 0 multicentric when more than one lesion was present KS330233 5 -TCCGTGTTGTCTACGTCCAG-3 (reverse): that involved different lymphatic drainages, and 0 0 KS330233 5 -TGCAGCAGCTGTTGGTGTACCACAT-3 disseminated when multiple visceral sites were (probe): involved. The contributing pathologist’s diagnosis, HER2-977F 50-ATGCAGATTGCCAAGGTATGC-30 when known, was recorded for the Classic Kaposi (forward): Sarcoma patients; this information was not available HER2-1120R 50-GGAAGCACCCATGTAGACCTTCT-30 (reverse): for the AIDS-related patients. Forty-one lesions, HER2-1012T 50-(VIC)CCGGAGCAAACCCCTATGTCCACAA randomly chosen and representing all stages of (probe): (TAMRA)-30 Classic Kaposi Sarcoma development from both Modern Pathology (2008) 21, 572–582 Classic Kaposi in the United States over the last two decades KM Hiatt et al 574 Kaposi Sarcoma was 29:1. The age of the Classic Table 2 Nationality/racial backgrounds of CKS compared to Kaposi Sarcoma patients ranged from 65 years, by AIDS-KS patients at our institution between 1980 and 2000 our study-defined inclusion criteria, to 94 years Background Number of CKS Number of (median, 74 years). In comparison, AIDS-related patients (%), AIDS-related KS Kaposi Sarcoma patients ranged from 13 to 81 years n ¼ 221 patients (%), (median, 36 years). Only three known AIDS-related n ¼ 199 Kaposi Sarcoma patients were over the age of 65 during this two-decade period. Known demographics Caucasian 85 (38) 97 (49) for Classic Kaposi Sarcoma patients and AIDS-related Mediterranean 49 (22) 0 Hispanic 39 (18) 20 (10) Kaposi Sarcoma patients are compared in Table 2. Black 22 (10) 59 (30) The 438 Classic Kaposi Sarcoma patients had 486 W.
Load more

Recommended publications
  • Hemangiosarcoma Philip J
    Ettinger & Feldman – Textbook of Veterinary Internal Medicine Client Information Sheet Hemangiosarcoma Philip J. Bergman What is hemangiosarcoma? Hemangiosarcoma (HSA; angiosarcoma or malignant hemangioendothelioma) is an extremely aggressive tumor of blood vessel origin. Because blood vessels are present throughout the body, virtually any site in the body can have HSA. HSA occurs most frequently in dogs (approximately 2% of all tumors) and the most common site is the spleen. However, additional common sites include the heart, liver, muscle, lung skin, bones, kidney, brain, abdomen, and oral cavity. In three large canine splenic disease studies encompassing approximately 2000 dogs, a “rule of two thirds” was found suggesting that approximately two thirds of dogs with a splenic mass have a cancer (therefore one third are not malignant) and two thirds of the malignant tumors of the spleen are HSA. HSA is a disease generally of older dogs and cats with an average onset of 9 to 10 years; however, there are reports of extremely young dogs and cats with this disease (5 to 6 months to a few years of age). German shepherd dogs are most commonly diagnosed with HSA; however, other large breed dogs such as golden retrievers and Labrador retrievers may also be overrepresented. In cats, the most common breed is the domestic shorthair. The cause of HSA in dogs and cats is presently unknown. Exposures to toxins such as chemicals, insecticides, and radiation have been reported in humans to be associated with HSA. Ultraviolet light exposure from the sun may be a potential cause of HSA in dogs, as HSAs of the skin are commonly seen in dogs with light hair and poor pigmentation (e.g., Salukis, Whippets, and white Bulldogs).
    [Show full text]
  • Unusual Multiple Cutaneous Retiform Hemangioendothelioma on Forearm
    Clinical and Diagnostic Pathology Research Article Unusual multiple cutaneous retiform hemangioendothelioma on forearm and neck misdiagnosed as angiosarcoma with metastasis Bin-cai Pan1, Chun-hua Wang1, Gui-fang Huang1, Xiao-ying Tian2 and Zhi Li3* 1Department of Pathology, Guangdong Tongjiang Hospital, Nanguo East Road, Shunde district, Foshan 528300, China 2School of Chinese Medicine, Hong Kong Baptist University 7, Baptist University Road, Kowloon Tong, Hong Kong, China 3Department of Pathology, The First Affiliated Hospital, Sun Yat-sen university.58, Zhongshan Road II,Guangzhou 510080, China Abstract Retiform hemangioendothelioma (RH) is extremely rare, and often involves the skin and subcutaneous tissues of distal extremities in young adults or children. Since its first description by Calonje in 1994, only a few primary multiple cases have been described in the literature. We present a case of unusual primary multiple RH on forearm and neck occurring in a 56 years old female patient. The patient presented with a slow-growing cutaneous plaque-like lesion on her left forearm, followed by another lesion at the site of neck for several years. In the skin biopsy examination, a diagnosis of angiosarcoma with cutaneous metastasis was made based on multiple lesions at different anatomic sites and vasoformative growth pattern with anastomosing channels under the microscopy. However, postoperative histological diagnosis of the lesion was primary multiple RH by thoroughly microscopical inspection and the presence of thin-walled interconnecting vascular channels arranged in a retiform pattern and absence of lymph node metastasis. Despite wide surgical excision with tumor-free margin, the tumor recurred at the neck 3 months after surgery.
    [Show full text]
  • Tumors and Tumor-Like Lesions of Blood Vessels 16 F.Ramon
    16_DeSchepper_Tumors_and 15.09.2005 13:27 Uhr Seite 263 Chapter Tumors and Tumor-like Lesions of Blood Vessels 16 F.Ramon Contents 42]. There are two major classification schemes for vas- cular tumors. That of Enzinger et al. [12] relies on 16.1 Introduction . 263 pathological criteria and includes clinical and radiolog- 16.2 Definition and Classification . 264 ical features when appropriate. On the other hand, the 16.2.1 Benign Vascular Tumors . 264 classification of Mulliken and Glowacki [42] is based on 16.2.1.1 Classification of Mulliken . 264 endothelial growth characteristics and distinguishes 16.2.1.2 Classification of Enzinger . 264 16.2.1.3 WHO Classification . 265 hemangiomas from vascular malformations. The latter 16.2.2 Vascular Tumors of Borderline classification shows good correlation with the clinical or Intermediate Malignancy . 265 picture and imaging findings. 16.2.3 Malignant Vascular Tumors . 265 Hemangiomas are characterized by a phase of prolif- 16.2.4 Glomus Tumor . 266 eration and a stationary period, followed by involution. 16.2.5 Hemangiopericytoma . 266 Vascular malformations are no real tumors and can be 16.3 Incidence and Clinical Behavior . 266 divided into low- or high-flow lesions [65]. 16.3.1 Benign Vascular Tumors . 266 Cutaneous and subcutaneous lesions are usually 16.3.2 Angiomatous Syndromes . 267 easily diagnosed and present no significant diagnostic 16.3.3 Hemangioendothelioma . 267 problems. On the other hand, hemangiomas or vascular 16.3.4 Angiosarcomas . 268 16.3.5 Glomus Tumor . 268 malformations that arise in deep soft tissue must be dif- 16.3.6 Hemangiopericytoma .
    [Show full text]
  • Cutaneous Angiosarcoma: Report of Three Different and Typical Cases Admitted in a Unique Dermatology Clinic*
    CASE REPORT 235 s Cutaneous angiosarcoma: report of three different and typical cases admitted in a unique dermatology clinic* Aline Neves Freitas Cabral1 Rafael Henrique Rocha1 Ana Cristina Vervloet do Amaral1 Karina Bittencourt Medeiros2 Paulo Sérgio Emerich Nogueira1 Lucia Martins Diniz3 DOI: http://dx.doi.org/10.1590/abd1806-4841.20175326 Abstract: Angiosarcoma is a rare and aggressive tumor with high rates of metastasis and relapse. It shows a particular predi- lection for the skin and superficial soft tissues. We report three distinct and typical cases of angiosarcoma that were diagnosed in a single dermatology clinic over the course of less than a year: i) Angiosarcoma in lower limb affected by chronic lymph- edema, featuring Stewart-Treves syndrome; ii) a case of the most common type of angiosarcoma loated in the scalp and face of elderly man and; iii) a skin Angiosarcoma in previously irradiated breast. All lesions presented characteristic histopathological findings: irregular vascular proliferation that dissects the collagen bundles with atypical endothelial nuclei projection toward the lumen. Keywords: Hemangiosarcoma; Lymphangiosarcoma; Lymphedema; Non-Filarial Lymphedema; Sarcoma INTRODUCTION Angiosarcoma (AS) is a rare and aggressive neoplasm, that fibers, formed by endothelium with atypical nuclei, prominent to- originates from endothelial cells of lymphatic and blood vessels. It ac- ward the lumen; The tumoral lesion exhibited cohesive epithelioid counts for 5% of malignant skin tumors and less than 1% of all sarco- masses of atypical, large, rounded cells with acidophilic cytoplasm mas. It is notable for having a predilection for the skin and superficial and frequent mitotic figures. (Figure 2). Immunohistochemical anal- soft tissues.
    [Show full text]
  • The Health-Related Quality of Life of Sarcoma Patients and Survivors In
    Cancers 2020, 12 S1 of S7 Supplementary Materials The Health-Related Quality of Life of Sarcoma Patients and Survivors in Germany—Cross-Sectional Results of A Nationwide Observational Study (PROSa) Martin Eichler, Leopold Hentschel, Stephan Richter, Peter Hohenberger, Bernd Kasper, Dimosthenis Andreou, Daniel Pink, Jens Jakob, Susanne Singer, Robert Grützmann, Stephen Fung, Eva Wardelmann, Karin Arndt, Vitali Heidt, Christine Hofbauer, Marius Fried, Verena I. Gaidzik, Karl Verpoort, Marit Ahrens, Jürgen Weitz, Klaus-Dieter Schaser, Martin Bornhäuser, Jochen Schmitt, Markus K. Schuler and the PROSa study group Includes Entities We included sarcomas according to the following WHO classification. - Fletcher CDM, World Health Organization, International Agency for Research on Cancer, editors. WHO classification of tumours of soft tissue and bone. 4th ed. Lyon: IARC Press; 2013. 468 p. (World Health Organization classification of tumours). - Kurman RJ, International Agency for Research on Cancer, World Health Organization, editors. WHO classification of tumours of female reproductive organs. 4th ed. Lyon: International Agency for Research on Cancer; 2014. 307 p. (World Health Organization classification of tumours). - Humphrey PA, Moch H, Cubilla AL, Ulbright TM, Reuter VE. The 2016 WHO Classification of Tumours of the Urinary System and Male Genital Organs—Part B: Prostate and Bladder Tumours. Eur Urol. 2016 Jul;70(1):106–19. - World Health Organization, Swerdlow SH, International Agency for Research on Cancer, editors. WHO classification of tumours of haematopoietic and lymphoid tissues: [... reflects the views of a working group that convened for an Editorial and Consensus Conference at the International Agency for Research on Cancer (IARC), Lyon, October 25 - 27, 2007]. 4. ed.
    [Show full text]
  • Toxicological Profile for Glyphosate Were
    A f Toxicological Profile for Glyphosate August 2020 GLYPHOSATE II DISCLAIMER Use of trade names is for identification only and does not imply endorsement by the Agency for Toxic Substances and Disease Registry, the Public Health Service, or the U.S. Department of Health and Human Services. GLYPHOSATE III FOREWORD This toxicological profile is prepared in accordance with guidelines developed by the Agency for Toxic Substances and Disease Registry (ATSDR) and the Environmental Protection Agency (EPA). The original guidelines were published in the Federal Register on April 17, 1987. Each profile will be revised and republished as necessary. The ATSDR toxicological profile succinctly characterizes the toxicologic and adverse health effects information for these toxic substances described therein. Each peer-reviewed profile identifies and reviews the key literature that describes a substance's toxicologic properties. Other pertinent literature is also presented, but is described in less detail than the key studies. The profile is not intended to be an exhaustive document; however, more comprehensive sources of specialty information are referenced. The focus of the profiles is on health and toxicologic information; therefore, each toxicological profile begins with a relevance to public health discussion which would allow a public health professional to make a real-time determination of whether the presence of a particular substance in the environment poses a potential threat to human health. The adequacy of information to determine a substance's
    [Show full text]
  • Vascular Tumors and Malformations of the Orbit
    14 Vascular Tumors Kaan Gündüz and Zeynel A. Karcioglu ascular tumors and malformations of the orbit VIII related antigen (v,w,f), CV141 (endothelium, comprise an important group of orbital space- mesothelium, and squamous cells), and VEGFR-3 Voccupying lesions. Reviews indicate that vas- (channels, neovascular endothelium). None of the cell cular lesions account for 6.2 to 12.0% of all histopatho- markers is absolutely specific in its application; a com- logically documented orbital space-occupying lesions bination is recommended in difficult cases. CD31 is (Table 14.1).1–5 There is ultrastructural and immuno- the most often used endothelial cell marker, with pos- histochemical evidence that capillary and cavernous itive membrane staining pattern in over 90% of cap- hemangiomas, lymphangioma, and other vascular le- illary hemangiomas, cavernous hemangiomas, and an- sions are of different nosologic origins, yet in many giosarcomas; CD34 is expressed only in about 50% of patients these entities coexist. Hence, some prefer to endothelial cell tumors. Lymphangioma pattern, on use a single umbrella term, “vascular hamartomatous the other hand, is negative with CD31 and CD34, lesions” to identify these masses, with the qualifica- but, it is positive with VEGFR-3. VEGFR-3 expression tion that, in a given case, one tissue element may pre- is also seen in Kaposi sarcoma and in neovascular dominate.6 For example, an “infantile hemangioma” endothelium. In hemangiopericytomas, the tumor may contain a few caverns or intertwined abnormal cells are typically positive for vimentin and CD34 and blood vessels, but its predominating component is negative for markers of endothelia (factor VIII, CD31, usually capillary hemangioma.
    [Show full text]
  • Glomus Tumor in the Floor of the Mouth: a Case Report and Review of the Literature Haixiao Zou1,2, Li Song1, Mengqi Jia2,3, Li Wang4 and Yanfang Sun2,3*
    Zou et al. World Journal of Surgical Oncology (2018) 16:201 https://doi.org/10.1186/s12957-018-1503-6 CASEREPORT Open Access Glomus tumor in the floor of the mouth: a case report and review of the literature Haixiao Zou1,2, Li Song1, Mengqi Jia2,3, Li Wang4 and Yanfang Sun2,3* Abstract Background: Glomus tumors are rare benign neoplasms that usually occur in the upper and lower extremities. Oral cavity involvement is exceptionally rare, with only a few cases reported to date. Case presentation: A 24-year-old woman with complaints of swelling in the left floor of her mouth for 6 months was referred to our institution. Her swallowing function was slightly affected; however, she did not have pain or tongue paralysis. Enhanced computed tomography revealed a 2.8 × 1.8 × 2.1 cm-sized well-defined, solid, heterogeneous nodule above the mylohyoid muscle. The mandible appeared to be uninvolved. The patient underwent surgery via an intraoral approach; histopathological examination revealed a glomus tumor. The patient has had no evidence of recurrence over 4 years of follow-up. Conclusions: Glomus tumors should be considered when patients present with painless nodules in the floor of the mouth. Keywords: Glomus tumor, Floor of mouth, Oral surgery Background Case presentation Theglomusbodyisaspecialarteriovenousanasto- A 24-year-old woman with a 6-month history of swelling mosisandfunctionsinthermalregulation.Glomustu- in the left floor of her mouth was referred to our institu- mors are rare, benign, mesenchymal tumors that tion. Although she experienced slight difficulty in swal- originate from modified smooth muscle cells of the lowing, she did not experience pain or tongue paralysis.
    [Show full text]
  • Angiofibroma of Soft Tissue: a Newly Described Entity; a Case Report and Review of Literature
    Open Access Case Report DOI: 10.7759/cureus.6225 Angiofibroma of Soft Tissue: A Newly Described Entity; A Case Report and Review of Literature Zafar Ali 1, 2 , Fatima Anwar 1 1. Histopathology, Shifa International Hospital, Islamabad, PAK 2. Pathology, Shifa College of Medicine, Islamabad, PAK Corresponding author: Zafar Ali, [email protected] Abstract Soft tissue angiofibroma is a relatively recent addition to the ever growing list of benign soft tissue tumors. It usually presents as soft tissue mass in the lower extremities in relation to joints and tendons. The tumor is composed of spindle-shaped fibroblastic cells with arborizing capillaries. We report a case of a 55-year-old female with a lump at the dorsum of left foot. Grossly the tumor was well circumscribed with yellow white cut surface. Microscopically the tumor showed typical features of angiofibroma with myxoid areas near the periphery of the lesion. Prominent vasculature is the integral part of the tumor with numerous small, branching, thin-walled blood vessels, accompanied by medium-sized ectatic vessels. Immunohistochemically the tumor cells are positive for epithelial membrane antigen (EMA). The location of the tumor, lack of cytological atypia, mitosis, and infiltrative margins help differentiate it from a sarcoma. Categories: Pathology Keywords: angiofibroma, ema, soft tissue Introduction Angiofibroma of soft tissue is a recently described entity; it was first described in 2012 by Mariño-Enríquez and Fletcher as a benign fibrovascular tumor that resembles a low grade sarcoma [1]. These tumors typically present in the extremities as a slow growing painless lump. There is a slight female predilection.
    [Show full text]
  • Angiosarcomas and Other Sarcomas of Endothelial Origin
    Angiosarcomas and Other Sarcomas of Endothelial Origin a,b a Angela Cioffi, MD , Sonia Reichert, MD , c a,b,d, Cristina R. Antonescu, MD , Robert G. Maki, MD, PhD, FACP * KEYWORDS Angiosarcoma Epithelioid hemangioendothelioma Vascular sarcoma Kaposi sarcoma VEGF KDR FLT4 Translocation Organ transplant KEY POINTS Vascular sarcomas are rare and collectively affect fewer than 600 people a year in the United States (incidence approximately 2/million). Because angiosarcomas, hemangioendotheliomas, and other vascular tumors have unique embryonal derivation, it is not surprising that they have a unique sensitivity pattern to chemotherapy agents. Surgery, when possible, remains the primary treatment for angiosarcomas. Adjuvant radiation for primary disease seems prudent for at least some angiosarcoma, given the high local-regional recurrence rate of these tumors. Angiosarcomas also have a high rate of metastasis, but it is not clear that adjuvant chemotherapy improves survival. Epithelioid hemangioendothelioma is a unique form of sarcoma often presenting as multi- focal disease. Most patients can do well with observation alone, although a fraction of pa- tients have more aggressive disease and have difficulties in both local control and metastatic disease. Continued Disclosures: R.G. Maki receives clinical research support from Morphotek/Eisai, Ziopharm, and Imclone/Lilly. He has also consulted for Eisai, Morphotek/Eisai, Imclone/Lilly, Taiho, Glaxo- SmithKline, Merck, Champions Biotechnology, and Pfizer. He has received speaker’s fees from Novartis. He is an unpaid consultant for the Sarcoma Foundation of America, SARC: Sarcoma Alliance for Research through Collaboration, n-of-one, and 23 & me. C.R. Antonescu, A. Cioffi, and S. Reichert report no conflicts.
    [Show full text]
  • 8.5 X12.5 Doublelines.P65
    Cambridge University Press 978-0-521-87409-0 - Modern Soft Tissue Pathology: Tumors and Non-Neoplastic Conditions Edited by Markku Miettinen Index More information Index abdominal ependymoma, 744 mucinous cystadenocarcinoma, 631 adult fibrosarcoma (AF), 364–365, 1026 abdominal extrauterine smooth muscle ovarian adenocarcinoma, 72, 79 adult granulosa cell tumor, 523–524 tumors, 79 pancreatic adenocarcinoma, 846 clinical features, 523 abdominal inflammatory myofibroblastic pulmonary adenocarcinoma, 51 genetics, 524 tumors, 297–298 renal adenocarcinoma, 67 pathology, 523–524 abdominal leiomyoma, 467, 477 serous cystadenocarcinoma, 631 adult rhabdomyoma, 548–549 abdominal leiomyosarcoma. See urinary bladder/urogenital tract clinical features, 548 gastrointestinal stromal tumor adenocarcinoma, 72, 401 differential diagnosis, 549 (GIST) uterine adenocarcinomas, 72 genetics, 549 abdominal perivascular epithelioid cell tumors adenofibroma, 523 pathology, 548–549 (PEComas), 542 adenoid cystic carcinoma, 1035 aggressive angiomyxoma (AAM), 514–518 abdominal wall desmoids, 244 adenomatoid tumor, 811–813 clinical features, 514–516 acquired elastotic hemangioma, 598 adenomatous polyposis coli (APC) gene, 143 differential diagnosis, 518 acquired tufted angioma, 590 adenosarcoma (mullerian¨ adenosarcoma), 523 genetics, 518 acral arteriovenous tumor, 583 adipocytic lesions (cytology), 1017–1022 pathology, 516 acral myxoinflammatory fibroblastic sarcoma atypical lipomatous tumor/well- aggressive digital papillary adenocarcinoma, (AMIFS), 365–370, 1026 differentiated
    [Show full text]
  • Cutaneous Neurofibromas: Clinical Definitions Current Treatment Is Limited to Surgical Removal Or Physical Or Descriptors Destruction
    ARTICLE OPEN ACCESS Cutaneous neurofibromas Current clinical and pathologic issues Nicolas Ortonne, MD, PhD,* Pierre Wolkenstein, MD, PhD,* Jaishri O. Blakeley, MD, Bruce Korf, MD, PhD, Correspondence Scott R. Plotkin, MD, PhD, Vincent M. Riccardi, MD, MBA, Douglas C. Miller, MD, PhD, Susan Huson, MD, Dr. Wolkenstein Juha Peltonen, MD, PhD, Andrew Rosenberg, MD, Steven L. Carroll, MD, PhD, Sharad K. Verma, PhD, [email protected] Victor Mautner, MD, Meena Upadhyaya, PhD, and Anat Stemmer-Rachamimov, MD Neurology® 2018;91 (Suppl 1):S5-S13. doi:10.1212/WNL.0000000000005792 Abstract RELATED ARTICLES Objective Creating a comprehensive To present the current terminology and natural history of neurofibromatosis 1 (NF1) cuta- research strategy for neous neurofibromas (cNF). cutaneous neurofibromas Page S1 Methods NF1 experts from various research and clinical backgrounds reviewed the terms currently in use The biology of cutaneous fi for cNF as well as the clinical, histologic, and radiographic features of these tumors using neuro bromas: Consensus published and unpublished data. recommendations for setting research priorities Results Page S14 Neurofibromas develop within nerves, soft tissue, and skin. The primary distinction between fi fi Considerations for cNF and other neuro bromas is that cNF are limited to the skin whereas other neuro bromas development of therapies may involve the skin, but are not limited to the skin. There are important cellular, molecular, for cutaneous histologic, and clinical features of cNF. Each of these factors is discussed in consideration of neurofibroma a clinicopathologic framework for cNF. Page S21 Conclusion Clinical trial design for The development of effective therapies for cNF requires formulation of diagnostic criteria that cutaneous neurofibromas encompass the clinical and histologic features of these tumors.
    [Show full text]