Modern Pathology (2008) 21, 572–582 & 2008 USCAP, Inc All rights reserved 0893-3952/08 $30.00 www.modernpathology.org Classic Kaposi Sarcoma in the United States over the last two decades: A clinicopathologic and molecular study of 438 non-HIV-related Kaposi Sarcoma patients with comparison to HIV-related Kaposi Sarcoma Kim M Hiatt1, Ann M Nelson2, Jack H Lichy2 and Julie C Fanburg-Smith2 1Dermatopathology, University of Arkansas for Medical Sciences, Little Rock, AR, USA and 2Departments of Infectious Disease, Molecular, and Soft Tissue/Orthopaedic Pathology, Armed Forces Institute of Pathology, Washington, DC, USA Classic Kaposi sarcoma is rare and occurs predominantly in Mediterranean and Middle Eastern men. Since the emergence of acquired immune deficiency syndrome (AIDS)-related Kaposi sarcoma, the incidence, clinicopathologic features, and molecular human herpesvirus 8 (HHV-8) association of American Classic Kaposi Sarcoma has not been fully explored. This study compares Classic Kaposi Sarcoma to AIDS-related Kaposi Sarcoma over the same two decade time period. There were 438 histologically and clinically confirmed Classic Kaposi Sarcoma patients. The ethnic/racial distribution included Caucasian/American (56%), Mediterranean (22%), South American Hispanic (18%), Black (10%), western European (4%), Middle East (4%), Scandinavian (2%), and other (2%). Classic Kaposi Sarcoma was more common in men, 7:1, with a mean age of 74 years. The lesions presented in the lower extremity (69%), in the nodular stage (83%), and HHV-8 was detected by PCR in 40/41 randomly selected cases. A second, non-Classic Kaposi Sarcoma, malignancy was present in 42% (n ¼ 45) of the 108 Classic Kaposi Sarcoma patients with complete clinical information, 73% (33 patients) with a higher incidence over the general population. Follow-up of o1–19 years (mean ¼ 4.8 years) revealed that 24% of patients died of second malignancy, 22% died of other medical conditions, 2% died of treatment-related complications, and 2% patients died of widespread disease. Thirty-five percent are alive with no evidence of disease and 15% with persistent disease. Human immunodeficiency virus-related Kaposi Sarcoma was observed in 354 cases. There was a male predominance and more aggressive behavior, with higher rates of visceral and disseminated disease. While Classic Kaposi Sarcoma in the United States is an indolent disease and rarely accounts for patient demise, predominantly affecting Caucasian/American males on the lower extremity in the nodular phase, it more importantly may denote an underlying other malignancy. Current PCR probes detect HHV-8 in 98% of Classic Kaposi Sarcoma cases. In comparison, AIDS-related Kaposi Sarcoma is predominately multicentric, visceral, and disseminated, with more aggressive behavior. Modern Pathology (2008) 21, 572–582; doi:10.1038/modpathol.2008.15; published online 28 March 2008 Keywords: classic Kaposi sarcoma; United States; 1980–2000; AIDS-related Kaposi sarcoma; pathology; HHV-8 Classic Kaposi Sarcoma is traditionally known as an Correspondence: Dr JC Fanburg-Smith, MD, Orthopaedic and indolent disease in elderly men of Mediterranean Soft Tissue Pathology Department, Armed Forces Institute of and Middle Easternern descent. With the emergence Pathology, Building 54, Department of Soft Tissue Pathology, of acquired immune deficiency syndrome (AIDS) in Room G090, 14th Street and Alaska Avenue, NW, Washington, DC 20306-6000, USA. the United States in the early 1980s, Kaposi sarcoma E-mail: [email protected] came to the forefront, because of its association with The opinions and assertions are the expressed views of the human immunodeficiency virus positive (HIV þ ) authors and are not to be construed as official or as a reflection of individuals, particularly in certain risk groups. Cox the views of the Department of Army or Defense. This was and Helwig reported on 50 cases of Kaposi Sarcoma presented in part as an abstract at the USCAP. 1 Received 07 November 2006; revised and accepted 25 June 2007; from our institute in 1959. Those cases included 8 published online 28 March 2008 Italians and 11 Africans, and thus likely represented Classic Kaposi in the United States over the last two decades KM Hiatt et al 573 a combination of classic and endemic forms, as the genders, were evaluated for human herpesvirus 8 AIDS epidemic had not yet begun. In 1999, Smith (HHV-8) status. The AIDS-related Kaposi Sarcoma et al2 reported on 250 women with all subsets of cases were not evaluated for HHV-8 positivity. Kaposi Sarcoma, including women from the United The Surveillance, Epidemiology and End Results States as well as other countries. To our knowledge, (SEER) Cancer Statistic Review4 from National there have been no recent large studies on Classic Institute of Health, for the population over 65 years Kaposi Sarcoma in the United States. old, monitoring cancer incidence in approximately 10% of the US population since 1973, was used to compare the expected incidence of cancers in the Materials and methods general population to the incidence of associated malignancies in this cohort of Classic Kaposi The Soft Tissue Pathology registry at the Armed Sarcoma patients. Forces Institute of Pathology was searched for ‘Classic Kaposi Sarcoma’ patients. Although Classic Kaposi Sarcoma is known to occur in younger Polymerase Chain Reaction patients, to ensure the exclusion of patients who may not yet be seropositive for HIV, only patients DNA was extracted from six 6-m sections of each over the age of 65 years at diagnosis were chosen block by deparaffinization with Hemo-De followed for this study. From a cohort of 682 patients with by protease K digestion, extraction with phenol/ chloroform, and ethanol precipitation, as previously 752 Kaposi Sarcoma lesions, slides were available 5 and diagnostic of Classic Kaposi Sarcoma in 438 described by Lichy et al. The probe and primer patients. All patients known to be HIV þ or have sequences are listed in Table 1. high-risk activity, based on the submitted report or discussion with the clinician, were excluded from the Classic Kaposi Sarcoma group (9/682). Results Information on the AIDS-related Kaposi Sarcoma Patient Demographics patients was obtained from the AIDS Registry at the Armed Forces Institute of Pathology. These actually The original patient list included 446 males and included three patients over the age of 65 who were 183 females, with a ratio of 2.4 males to 1 female. known to be HIV þ. Additionally, patients from The current study group of 438 patients with Africa (25/682) were excluded to avoid confounding available diagnostic material included 385 men the data with specimens that possibly represented (385/446 ¼ 86% of the data bank male patients with endemic/epidemic Kaposi Sarcoma. None of the classic Kaposi Sarcoma) and 53 women (53/ Classic Kaposi Sarcoma patients were known to be 183 ¼ 29.5% of the data bank of female patients transplant recipients and none were reported to be with classic Kaposi Sarcoma), 7 males to 1 female. ‘iatrogenic’ or chemotherapy/immunosuppressive Available data from 354 AIDS-related Kaposi Sarco- therapy induced. Kaposi Sarcoma diagnosis was ma patients diagnosed at our institution between made using previously established criteria.3 1980 and 2000 were compared with the Classic Tumor registries, physicians, and patients were Kaposi Sarcoma cases. Known risk factors for the systematically contacted to obtain information re- AIDS-related cases (n ¼ 97) are the following: 54 garding age, gender, reported nationality or ethni- (56%) homosexual/bisexual, 12 (12%) intravenous city, concurrent malignancies, status of the patient drug users, 21 (22%) African (12 of 13 females were as well as size, location, multicentricity, and from Africa), 4 (4%) transfusion related, and 5 (5%) dissemination of the Kaposi Sarcoma. Except for other. The male:female ratio for the AIDS-related the data on associated malignancies, which were not available for the AIDS-related group, all data were compared to a group of AIDS-related Kaposi Sarco- ma patients (n ¼ 354) at our institute during the Table 1 HHV-8 probe and primer sequences same time period. Kaposi Sarcoma was classified as HHV-8 (putative minor capsid protein) (11) solitary based on clinical presentation of a single 0 0 lesion, multifocal when more than one lesion KS330233 5 -AGCCGAAAGGATTCCACCAT-3 involving the same lymphatic flow was present, (forward): 0 0 multicentric when more than one lesion was present KS330233 5 -TCCGTGTTGTCTACGTCCAG-3 (reverse): that involved different lymphatic drainages, and 0 0 KS330233 5 -TGCAGCAGCTGTTGGTGTACCACAT-3 disseminated when multiple visceral sites were (probe): involved. The contributing pathologist’s diagnosis, HER2-977F 50-ATGCAGATTGCCAAGGTATGC-30 when known, was recorded for the Classic Kaposi (forward): Sarcoma patients; this information was not available HER2-1120R 50-GGAAGCACCCATGTAGACCTTCT-30 (reverse): for the AIDS-related patients. Forty-one lesions, HER2-1012T 50-(VIC)CCGGAGCAAACCCCTATGTCCACAA randomly chosen and representing all stages of (probe): (TAMRA)-30 Classic Kaposi Sarcoma development from both Modern Pathology (2008) 21, 572–582 Classic Kaposi in the United States over the last two decades KM Hiatt et al 574 Kaposi Sarcoma was 29:1. The age of the Classic Table 2 Nationality/racial backgrounds of CKS compared to Kaposi Sarcoma patients ranged from 65 years, by AIDS-KS patients at our institution between 1980 and 2000 our study-defined inclusion criteria, to 94 years Background Number of CKS Number of (median, 74 years). In comparison, AIDS-related patients (%), AIDS-related KS Kaposi Sarcoma patients ranged from 13 to 81 years n ¼ 221 patients (%), (median, 36 years). Only three known AIDS-related n ¼ 199 Kaposi Sarcoma patients were over the age of 65 during this two-decade period. Known demographics Caucasian 85 (38) 97 (49) for Classic Kaposi Sarcoma patients and AIDS-related Mediterranean 49 (22) 0 Hispanic 39 (18) 20 (10) Kaposi Sarcoma patients are compared in Table 2. Black 22 (10) 59 (30) The 438 Classic Kaposi Sarcoma patients had 486 W.