Investigation of the Regulation of Roundabout4 by Hypoxia-Inducible Factor-1A in Microvascular Endothelial Cells

Retina Investigation of the Regulation of Roundabout4 by Hypoxia-Inducible Factor-1a in Microvascular Endothelial Cells

Rui Tian,1 Zaoxia Liu,1 Hui Zhang,1 Xuexun Fang,2 Chenguang Wang,1 Shounan Qi,1 Yan Cheng,1 and Guanfang Su1

1Department of Ophthalmology, Second Hospital of Jilin University, Changchun, Jilin, China 2School of Life Science, Jilin University, Changchun, China

Correspondence: Guanfang Su, De- PURPOSE. We determined if hypoxia-inducible factor-1a (HIF-1a) and Roundabout4 (Robo4) partment of Ophthalmology, Second colocalized in fibrovascular membranes (FVM) from patients with proliferative diabetic Hospital of Jilin University, 218 retinopathy (PDR), and investigated the regulation of HIF-1a on Robo4 in microvascular Ziqiang Street, Changchun, Jilin, endothelial cells under normoxic and hypoxic conditions in vitro. 130021, China; [email protected]. METHODS. Immunofluorescence and confocal laser scanning microscopy were done to analyze Submitted: March 21, 2014 the colocalization of HIF-1a and Robo4 in the FVM. Expression of HIF-1a was knocked down Accepted: February 27, 2015 by small interfering RNA (siRNA) technology to study its effects on Robo4 expression of human retinal endothelial cells (HREC) and human dermal microvascular endothelial cells Citation: Tian R, Liu Z, Zhang H, et al. (HDMEC) under normoxic and/or hypoxic conditions. Full-length human a gene was Investigation of the regulation of HIF-1 Roundabout4 by hypoxia-inducible transfected into HREC and HDMEC using GFP lentivirus vectors to overexpress HIF-1a under factor-1a in microvascular endothelial normoxic conditions. The HIF-1a and Robo4 mRNA and protein expressions were quantified cells. Invest Ophthalmol Vis Sci. by real-time PCR and Western blot. A cell proliferation, migration assay, and flow cytometry 2015;56:2586–2594. DOI:10.1167/ were used to analyze the effect of HIF-1a regulation on Robo4 in HREC under hypoxic iovs.14-14409 conditions.

RESULTS. Colocalization of HIF-1a and Robo4 in vessels of FVM was conﬁrmed by immunoﬂuorescence staining. Knockdown of HIF-1a expression by siRNA in the HREC and HDMEC inhibited Robo4 expression in mRNA and protein level, while overexpressed HIF-1a increased Robo4 mRNA and protein expression. Silencing HIF-1a in endothelial cells under hypoxic conditions inhibited cell invasion and proliferation, which showed that HIF-1a and Robo4 overexpression due to hypoxic conditions correlated with HREC migration and proliferation.

CONCLUSIONS. Both HIF-1a and Robo4 may have a vital role during the formation of FVM. The increased or decreased expression of Robo4 by stimulation or knockdown of HIF-1a suggesting that Robo4 is positively regulated by HIF-1a under normoxic and hypoxic conditions in microvascular endothelial cells in vitro. The HIF-1a gene promotes HREC invasion and proliferation by transcriptionally upregulating Robo4 under hypoxic conditions. Keywords: Robo4, hypoxia-inducible factor-1a, microvascular endothelial cells, ﬁbrovascular membranes, proliferative diabetic retinopathy

iabetic retinopathy is a severe microvascular complication In the conditions of low oxygen, hundreds of proteins D associated with diabetes mellitus, and a hallmark of this related to angiogenesis, cell proliferation, cell survival and complication is the formation of a fibrovascular membrane metabolism were activated through HIF-1 pathway.6 To (FVM) that can greatly threaten patients’ visual function. An stimulate the expression of hypoxia induced-protein, for increasing number of reports demonstrate that chronic retinal example VEGF, erythropoietin, and angiopoietins, HIF-1a has hypoxia and ischemia have important roles in FVM develop- to translocate to the nucleus, dimerizes with HIF-1b, and binds ment. Due to its essential role in systemic responses to hypoxia, to hypoxia response elements within the promoters of several hypoxia-inducible factor 1a (HIF-1a), an oxygen sensitive genes.7–10 transcription factor, has been associated with angiogenesis Roundabout4 (Robo4), the fourth member of the Robo gene and FVM development.1–3 Particularly, an increased expression family, receives the most attention among its gene family, of HIF-1a is found in the vitreous humor and in the because it is expressed specifically in the vasculature and is fibrovascular tissues of eyes of proliferative diabetic retinopathy upregulated at sites of angiogenesis.11–13 It is reported that (PDR) patients. Experimentally and clinically, HIF-1a has a either knockdown or overexpression of Robo4 on zebrafish mediating or contributing role in PDR, and, therefore, it can impairs vessel formation, suggesting Robo4 has a key role in serve as a potential target for therapeutic intervention of retinal embryonic angiogenesis.14 Moreover, in Robo4-knockout mice neovascularization.4,5 vascular leakage was found more severe than normal mice,

Downloaded from jov.arvojournals.org on 09/25/2021 Regulation of Robo4 by HIF-1a IOVS j April 2015 j Vol. 56 j No. 4 j 2587

indicating Robo4 is essential in stabilizing the blood vessels.15 immunostaining procedure. In all cases, negative controls Furthermore, the levels of Robo4 mRNA and the presence, showed only weak staining after incubation at 48C overnight. distribution, and role in retinal cells of Robo4 were studied in Each antibody specimen was immunolabeled twice at least, the FVM from PDR patients. These studies suggest that Robo4 and appropriate Ig controls were included for each experi- may have a role in the formation of FVM and have physiological ment. Slides were mounted in 20% glycerol/PBS, coverslipped, functions in the cells of the retina.16 More recently, Keijiro et and sealed with nail varnish. The observation was carried by an al.17 demonstrated that Robo4 gene downregulation is Olympus FV-1000 laser confocal microscope (Olympus, Center associated with retinal hyperoxia in an oxygen-induced Valley, PA, USA) and image software (FV10-ASW1.7). retinopathy model, which may correspond to the marked regression of the superficial network of vessels that in the Cell Culture central retina and delayed development of the deep plexus. The Robo4 gene was found overexpressed only in The HREC and HDMEC cells were kindly provided by Prof Liu endothelial cells when exposed to hypoxia in vitro,18 Xiaoqing of Tongji University and Prof Pei of the Second consistent with the theory that Robo4 is a gene regulated by Hospital of Jilin University, respectively. The HREC cells were hypoxia. However, the regulatory mechanism has not been cultured in Endothelial Cell Medium (Invitrogen Corp.) in an fully explained to date. Based on the positive expression of HIF- incubator maintained at 378C in an atmosphere containing 5% 1a and Robo4 in FVM in vivo,3,4,16 we hypothesized that HIF- CO2 and air, supplemented with 5% fetal bovine serum (FBS; 1a, a transcriptional regulatory factor, may have a regulatory Gibco, Invitrogen Corp.), 100 units/mL penicillin, 100 lg/mL role on Robo4 expression. To confirm this hypothesis, streptomycin (Sigma-Aldrich Corp.), 1% Endothelial Cell colocalization of HIF-1a and Robo4 in the FVM were analyzed Growth Supplement (Beijing Maichen, Bio Co., China). The by immunofluorescence and confocal laser scanning micros- HDMEC cells were cultured in Dulbecco’s modified eagle copy, and Robo4 expression was quantified during HIF-1a medium (DMEM; Invitrogen Corp.) with 10% FBS, 100 units/ downregulation or overexpression in human retinal endothe- mL penicillin, 100 lg/mL streptomycin at 378C in a humidified lial cells (HREC) and human dermal microvascular endothelial atmosphere containing 5% CO2 and air. cells (HDMEC) under normoxic and/or hypoxic conditions in Hypoxic conditions were gained by culturing cells in a vitro. Our results reveal for the first time to our knowledge that sealed, anaerobic workstation (Concept 400; Ruskin Technol- HIF-1a and Robo4 colocalized in the vessels of FVM and that ogies, Pencoed, Wales, UK), in which the hypoxic environment (1% O , 94% N2, and 5% CO ), temperature (37 C), and Robo4 was positively regulated by HIF-1a under normoxic and 2 2 8 humidity (90%) were kept constant. hypoxic conditions in microvascular endothelial cells in vitro. Small Interfering RNA (siRNA) and Transfection MATERIALS AND METHODS Assays Tissue Samples Using a previously described method,19 the HIF-1a–specific siRNAs were synthesized chemically. The sequence of targeted The study protocol was approved by the Ethics Committee of HIF-1a was CTGGACACAGTGTGTTTGA. Human nonsilencing Jilin University, and informed consent was obtained from all siRNA acted as a negative control (NC) and was used to control patients according to the World Medical Association Declara- for any effects of the siRNA and transfection reagent. The tion of Helsinki. A total of 12 type II diabetes mellitus patients control sequence was AGUCUCCACGUGUACGUTT. Cells were with PDR got involved in this research, four of whom were transfected with siRNAs using Lipofectamine 2000 reagent males and eight were females. All patients were aged 47 to 72 (Invitrogen Corp.) according to the manufacturer’s instruc- years. They accepted pars plana vitrectomy with membrane tions. The HIF-1a siRNA was used to transfect the cells at peeling. The FVM specimens surgically obtained were fixed in different concentrations (such as 10, 20, 50, and 100 nM) for 4% paraformaldehyde (PFA), paraffin embedded, and sections 24, 48, and 72 hours. It was determined that transfection with cut at 4 lm. 100 nM HIF-1a siRNA for 48 hours was the most effective and was selected for the next experiments (data not shown). Under Confocal Immunofluorescence normoxic conditions, HREC and HDMEC were randomly divided into control hypoxia group (N), vector group (NC), Sections were dewaxed and rehydrated through an alcohol to and HIF-1a siRNA group (HIF-1a si). The HREC cells were water gradient, rinsed in 0.01 M PBS for 5 minutes and blocked randomly divided into a normoxia group and hypoxia group. with 10% normal goat serum (Sigma-Aldrich Corp., St. Louis, The hypoxia group was randomly divided into control hypoxia MO, USA) for 30 minutes at 378C. Then, the tissue sections group (N), vector group (NC), and HIF-1a siRNA group (HIF-1a were applied by 1:50 anti-mouse HIF-1a monoclonal antibody si). No transfection was done in the normoxia group and (Cat No.ab1; Abcam, Cambridge, UK) with 1:50 anti-rabbit control hypoxia group. After 6 hours of incubation with the Robo4 polyclonal antibody (Cat No.ab10547; Abcam), 1:50 liposome-DNA complex, the cells were washed and cultured anti-rabbit HIF-1a polyclonal antibody (Boster; Boster Co., for 24 hours and then cultured under normoxia (21% O2)or Wuhan, China) with 1:50 anti-mouse CD34 (Santa Cruz hypoxia (1% O2) for an additional 24 or 48 hours. Biotechnology, Inc., Santa Cruz, CA, USA), 1:50 anti-rabbit Robo4 polyclonal antibody with 1:50 anti-mouse CD34, Recombinant HIF-1a Lentiviral Vector and respectively, at 48C overnight. After washing with PBS, the Production sections were incubated for 1 hour at 378C with 1:100 FITC and Cy3-conjugated goat anti-mouse and goat anti-rabbit Lentiviral plasmid pLenti-V5-D-TOPO-HIF-1a encoding human secondary antibodies (Invitrogen Corp., Camarillo, CA, USA), HIF-1a full length sequence was donated by Prof Niles respectively. After incubation, the slides were washed with PBS (Marshall University, Huntington, WV, USA).20 To construct and cell nuclei were stained with Hoechst33342 (Sigma-Aldrich recombinant lentiviral vector encoding HIF-1a with green Corp.). Negative controls, including omission of the primary fluorescence reporter, pLVX-hHIF1a-IRES-ZSGreen was de- antibody and use of an irrelevant polyclonal or isotype- signed and constructed. Briefly, human HIF-1a full-length matched monoclonal primary antibody, were adopted in each sequence (2.5 kb) was amplified using the template pLenti-

Downloaded from jov.arvojournals.org on 09/25/2021 Regulation of Robo4 by HIF-1a IOVS j April 2015 j Vol. 56 j No. 4 j 2588

TABLE. Gene Subtype Oligonucleotide Primers Real-Time PCR Gene Subtype Oligonucleotide Primers, 50–30 Size, bp The RNAiso kit (TakaRa; TakaRa Biotechnolgical Co., Dalian, China) was used to extract total RNA from cells according to Human HIF-1a the manufacturer’s protocol. All the RNA preparations were Forward TACCCACCGCTGAAACGC 183 measured to have an OD260:OD280 ratio of 1.9:2.0. Total RNA Reverse TAGGCTCAGGTGAACTTTGTCT (2 lg) was reversibly transcribed by aid of the Revertaid first- Human Robo4 strand cDNA Synthesis Kit (lot K1622; Fermentas China, ThermoFisher Scientific, Waltham, MA, USA). No template Forward CCCTGTGCTTGGAACTCAGTG 102 control was included in each set of samples. The real-time PCR Reverse CGCTGATGTACCCATAGGTGG assays were performed in Light Cycler 480II (Hoffmann-La GAPDH Roche, Basel, Switzerland) according to the manufacturer’s Forward TGCACCACCAACTGCTTAGC 70 instructions. Both HIF-1a and Robo4 were normalized to Reverse GGCATGGACTGTGGTCATGAG GAPDH expression and calculated by the Light Cycler 480II software. All primers used were synthesized by Shanghai Sangon Biological Engineering Technology & Services Corpo- V5-D-TOPO-HIF-1a and the following primers: pLVX-hHIF1a- ration (Shanghai, China). See the Table for sequences. XbaI-F: 50-CTAGTCTAGACACCATGGAGGGCGCCGGCG GCGCGA-30, pLVX-hHIF1a-BamHI-R: 50-CGCGGATCCTCAGT Western Blot Analysis TAACTTGATCCAAAGCTCT G-30.ThepLVX-hHIF1a-IRES- ZSGreen was produced by double digestion at the restriction Protein extracts were electrophoresed on 8% SDS polyacryl- enzyme cutting sites XbaI and BamHI. The identity of the gene amide gels, transferred onto a 0.22 mm polyvinylidene was confirmed by sequencing (Sangon, Shanghai, China). difluoride membranes (Invitrogen) and then probed with Lentivirus was produced from cotransfection with four specific antibodies. Primary antibodies were used at the plasmids pLVX-hHIF1a-IRES-ZSGreen or pLVX-IRES-ZsGreen, following dilutions: anti-Robo4 (1:1000), anti-HIF-1a (1:1000; PLP1, PLP2, and PLP-VSVG (pLVX-IRES-ZsGreen and the Abcam) and GAPDH (1:1000; Hangzhou Goodhere Bio Co., additional three plasmids were provided by Prof Liu Xiao-qing China). Immunoreactive bands were visualized with EasySee of Tongji University). The PLVX-IRES-ZsGreen served as Western blot kit (Beijing TransGen Biotech Co., China) negative control. Recombinant lentivirus was harvested 72 according to the manufacturer’s instructions. Band densities hours following cotransfection of the pLVX-hHIF1a-IRES- of HIF-1a and Robo4 proteins were normalized to GAPDH ZSGreen (10 lg) or pLVX-IRES-ZsGreen (10 lg), PLP1 (5 lg), internal control. Western blots were repeated three times and PLP2 (5 lg), and PLP-VSVG (5 lg) into 293T cells cultured in qualitatively similar results were obtained. DMEM with 10% FBS. Transfections were performed using a high efficiency calcium phosphate transfection kit (Beijing HREC Migration Assay Maichen) with the manufacturer’s recommendations. Then, the virus supernatant was purified, and the viral titer was A migration study was performed using a Transwell system detected. (Corning Life Sciences, Costar, Tewksbury, MA, USA). Briefly, HREC were grown for 48 hours after transfection with 100 nM In Vitro Transduction and Analysis of GFP HIF-1a siRNA in ECM containing 5% FBS with 1% Endothelial Cell Growth Supplement. Media were collected and loaded Expression onto the lower chamber. Then, 1 3 105 HREC in 100 uL of ECM The HREC and HDMEC cells were seeded into 96-well plates at (containing 5% FBS with 1% Endothelial Cell Growth Supple- 2 3 103 cells/well, respectively, and incubated in 0.5 mL ment) were loaded into the top chamber. Then, the cells were growth medium for 24 hours before infection. Viral particles cultured under normoxia (21% O2) or hypoxia (1% O2) for an were added to the wells at a multiplicity of infection (MOI) of additional 18 hours at 378C. Migrating cells were fixed and 2, 5, 10, 20, 30, and 50. To improve lentiviral vector stained with crystal violet and counted in five high power transduction, 10 lg/mL hexadimethrine bromide (Polybrene; fields (320). Sigma-Aldrich Corp.) was added simultaneously per well. After 24 hours incubation at 378Cin5%CO2, the virus-containing Bromodeoxyuridine (BrdU) Incorporation Assay medium was removed and replaced with 0.5 mL fresh culture medium per well. An inverted fluorescence microscope (IX71; Cell proliferation was analyzed by a 5-bromo-20-deoxyuridine Olympus) was applied to observe the transduction efficiency (BrdU) incorporation assay. The HREC cells were grown 24 every day. Transduction efficiency was quantified by measuring hours after transfection with 100 nM HIF-1a siRNA in complete the percentage of GFP-expressing cells in total visible cells. The medium under hypoxic conditions and then pulsed with 10 lM following studies were done at the MOI of 20 of the lentivirus. BrdU (Sigma-Aldrich Corp.) for 24 hours. Harvested cells by Then, HREC and HDMEC were seeded into 12-well plates at 1 trypsinization were washed with PBS and fixed in 4% cold 3 104 cells/well, respectively, and incubated in 1 mL growth ethanol for 30 minutes. After washing with PBS, the fixed cells medium for 24 hours before infection. Then, we added viral were permeabilized by incubation in 2 M HCl for 10 minutes at particles (4 lL) into each well. The infection was repeated room temperature and then washed with PBS three times. The three times every 48 hours. The onset and time course of GFP cells were incubated with PBS containing 5% BSA for 30 fluorescence and morphology of GFP-positive cells were minutes at room temperature. Next, the cells were washed observed at days 3, 5, 7, 10, and 14 after infection with the with PBS and incubated with a monoclonal anti-BrdU antibody same settings. The HREC and HDMEC cells were harvested at 7 (1:200 dilution, Sigma-Aldrich Corp.) or PBS as a negative and 14 days, respectively, post infection for quantitative real- control in dark for 1 hour at room temperature. Then, the cells time PCR or for Western blot analysis. Three parallel wells were were washed twice with PBS and resuspended and mixed with performed in identical procedure and repeated at least 3 times FITC-conjugated secondary antibody (1:500 dilution; Thermo- for each viral vector infection, then the data from each Fisher Scientific). Fluorescence signals of FITC-BrdU were infection were summarized and averaged. measured by flow cytometry using a Flow Cytometer (Beck-

Downloaded from jov.arvojournals.org on 09/25/2021 Regulation of Robo4 by HIF-1a IOVS j April 2015 j Vol. 56 j No. 4 j 2589

man Coulter EPICS XL-MCL; Beckman Bioscience, Brea, CA, USA), and the data were analyzed with EXPO32 ADC Analysis software (Beckman Bioscience).

Statistical Analysis All experiments were performed at least three times. Results were presented as the mean 6 SD of three independent experiments. Student’s t-test was used to do statistical evaluation. A value of P < 0.05 was considered to indicate statistical signiﬁcance.

RESULTS Colocalization of HIF-1a and Robo4 in FVM Sections To determine whether HIF-1a colocalizes with Robo4 in the FVM, human FVM sections were double stained with mouse anti-HIF-1a and rabbit anti-Robo4 antibodies. In all FVM specimens, intense staining of HIF-1a and Robo4 was detected and their expression was colocalized (Fig. 1A). To further investigate the distribution of HIF-1a and Robo4 in FVM specifically, the sections were double stained with an endothelial cell marker, CD34 antibody, and either an anti- Robo4 (Fig. 1B) or anti-HIF-1a (Fig. 1C) antibody. Consistent with previous results on the staining patterns of tumors and FVM,12,16 Robo4 was expressed in the vessels of the FVM. Furthermore, HIF-1a also coexpressed with CD34. Quantitative colocalization analysis was performed using Image-Pro Plus Software. Pearson’s correlation coefficient (PCC) and Mander’s overlap coefficient (MOC) were examined (Fig. 1D). Colocalization of HIF-1a and Robo4 was supported by the results of coefficients calculations: PCC was 0.74, while MOC was 0.757. It is important to note that the two coefficients, while revealing different aspects of the colocalization process, showed a similar pattern of change among the study groups, proving the applicability of the calculations to investigate the degree of colocalization of HIF-1a and Robo4. Colocalization of HIF-1a or Robo4 and CD34 was indicated by the results of coefficients calculations: PCC was 0.52 or 0.54, while MOC was 0.661 or 0.634, respectively. The fluorescence of CD34 was stronger than HIF-1a and Robo4 in FVM, so MOC, which represents the true degree of colocalization, was more meaningful. FIGURE 1. Colocalization of HIF-la and Robo4 in FVM from a PDR patient ([A–C], original magnification: 340). (A) Staining of HIF-la and Robo4 by mouse anti-HIF-1a antibody (green) and rabbit anti-Robo4 Effect of HIF-1a Silencing on Robo4 mRNA and antibody (red). Double immunofluorescence staining shows colocal- Protein Expression In Vitro ized expression of HIF-la and Robo4 in the FVM (Robo4/HIF-la, yellow). (B) Staining of Robo4 and CD34 by rabbit anti-Robo4 (red) and To further determine the relationship between HIF-1a and CD34 (green) antibody, respectively. Based on the double immunoflu- Robo4, HIF-1a RNA in both HREC and HDMEC was knocked orescence staining, Robo4 expresses in the vessels of the FVM (Robo4/ down by HIF-1a siRNA under normoxic conditions, and Robo4 CD34, yellow). (C) Staining of HIF-la (red) and CD34 (green) by rabbit mRNA and protein expressions were evaluated by real-time anti-HIF-la and CD34 antibody, respectively. The HIF-la expresses in the PCR and Western blot assays, respectively (Fig. 2). vessels of the FVM (HIF-la/CD34, yellow). The colocalization of HIF-1a and Robo4 on blood vessel was indicated by white arrow.(D) At the mRNA level, real-time PCR demonstrated that HIF-1a Quantitative analysis of colocalization of HIF-la and Robo4 in FVM. siRNA depleted HIF-1a mRNA levels by 67 6 8% in HREC (P < Pearson’s correlation coefficient (PCC) and overlap coefficient 0.01; Fig. 2A) and 48 6 4% in HDMEC (P < 0.01; Fig. 2B). On according to Manders (MOC) indicated a high degree of colocalization the contrary, there was no significant difference between the of HIF-la and Robo4 proteins, and a moderate degree of colocalization cells transfected with control siRNA (negative control, NC) and of HIF-la or Robo4 and CD34. Image-Pro Plus Software was used to nontransfected cells (normal group, N; P > 0.05). Accordingly, calculate colocalization coefficients. An average of MOC and PCC of Robo4 mRNA and protein expressions in HREC and HDMEC three examined samples for each time point is shown. P < 0.05. Error bars indicate standard deviation. were inhibited. The levels of Robo4 mRNA were downregulated by 33 6 3% in HREC and 61 6 4% in HDMEC in the HIF-1a siRNA group when compared to the normal group (P < 0.01; Figs. 2A, 2B), which is consistent with the decreased protein expression in both cell types (Figs. 2C, 2D).

Downloaded from jov.arvojournals.org on 09/25/2021 Regulation of Robo4 by HIF-1a IOVS j April 2015 j Vol. 56 j No. 4 j 2590

FIGURE 2. Inhibition of HIF-1a with siRNA decreases Robo4 expression in HREC and HDMEC under normoxic conditions. Mean and standard deviation of three independent real-time PCR experiments are presented for HIF-1a and Robo4 mRNA (A, B). The HIF-1a siRNA (100 nM) abolished HIF-1a mRNA expression and downregulated Robo4 mRNA expression in HREC (A) and HDMEC (B). Representative Western blot analysis and the mean and standard deviation of densitometric analysis from three independent Western blots in HREC (C) and HDMEC (D) are shown. Robo4 protein levels also decreased after HIF-1a siRNA transfection in both cell types after 48 hours (C, D). Control cells were transfected with scrambled siRNA. *Denote values signiﬁcantly different between HIF-1a siRNA-treated group and control groups (P < 0.01).

Based on the results during normoxia conditions, we Robo4 mRNA expressions were decreased by 61 6 7% and 79 transfected HREC with HIF-1a siRNA to knock down HIF-1a 6 3% in the HIF-1a siRNA group when compared to the normal and cultured cells under hypoxic conditions for 24 and 48 group under hypoxic culture for 24 and 48 hours (P < 0.01, hours. Then, Robo4 mRNA and protein expressions by real- Fig. 3B), which is consistent with the decreased protein time PCR and Western blot assays were analyzed (Figs. 3, 4). expression (Figs. 4A, 4C). At the mRNA level, real-time PCR demonstrated that HIF-1a mRNA in HREC under hypoxic culture for 24 and 48 hours Efficient Transduction by Lentiviral Vector increased by 1.52 6 0.12-fold and 2.11 6 0.21-fold respectively, when compared to the normal group under normoxic Lentiviral vector-mediated HIF-1a transduction efficiency in conditions (P < 0.01, Fig. 3A). The HIF-1a siRNA depleted HIF- HREC and HDMEC by GFP detection was first visualized by 1a mRNA levels by 57 6 6% and 81 6 9% in HREC under fluorescence microscopy three days after transduction. Fluo- hypoxic culture for 24 and 48 hours, respectively (P < 0.01, rescence peak in HREC and HDMEC were detected at 7 and 14 Fig. 3A). On the contrary, there was no significant difference days, respectively (data not shown). between the cells transfected with control siRNA (negative control, NC) and nontransfected cells (normal group, N) under Overexpression of HIF-1a Upregulates Robo4 hypoxic conditions (P > 0.05). At the protein level, HIF-1a Expression in HREC and HDMEC Cells expression was increased under hypoxic culture for 24 and 48 hours when compared to the normal group under normoxic Based on real-time PCR results, relative levels of HIF-1a and conditions, and it decreased in the HIF-1a siRNA group (P < Robo4 mRNA in the study group were markedly increased in 0.01; Figs. 4A, 4B). Accordingly, Robo4 mRNA and protein HREC (1.76 6 0.08-fold and 1.61 6 0.11-fold) and HDMEC expressions were inhibited in the HIF-1a siRNA group under (3.03 6 0.36-fold and 3.32 6 0.48-fold) when compared to the hypoxic conditions. Robo4 mRNA was upregulated by 1.76 6 levels in the GFP-negative control groups (cells transfected 0.14-fold and 2.78 6 0.17-fold in HREC under hypoxic culture with GFP vectors alone, pLVX-ZsGreen) and levels in the for 24 and 48 hours, respectively, when compared to the nontransfected control cells (mock; P < 0.01; Figs. 5A, 5B). normal group under normoxic conditions (P < 0.01; Fig. 3B). The HIF-1a-GFP lentiviral vector transfection also was con-

Downloaded from jov.arvojournals.org on 09/25/2021 Regulation of Robo4 by HIF-1a IOVS j April 2015 j Vol. 56 j No. 4 j 2591

FIGURE 3. Inhibition of HIF-1a with siRNA decreases Robo4 mRNA expression in HREC during hypoxic conditions. Mean and standard deviation of three independent real-time PCR experiments are presented for HIF-1a and Robo4 mRNA. The HIF-1a siRNA (100 nM) abolished HIF-1a mRNA expression (A) and down regulated Robo4 mRNA expression (B) in HREC in culture under hypoxic conditions for 24 and 48 hours. Control cells were transfected with scrambled siRNA. *Denote values signiﬁcantly different between HIF-1a siRNA-treated group and control groups (P < 0.01).

firmed by examination of HIF-1a protein expression via Western blot. Both HIF-1a and Robo4 protein expression levels in the HREC and HDMEC were found significantly higher FIGURE 4. Inhibition of HIF-1a with siRNA decreases Robo4 protein in the study groups than in the control groups (Figs. 5C, 5D). expression in HREC during hypoxic conditions. Representative Western blot analysis and the mean and standard deviation of densitometric analysis from three independent Western blots in HREC Hypoxia/HIF-1a Induces HREC Proliferation and during hypoxic conditions are shown (A). The HIF-1a protein Invasion expression increased under hypoxic conditions in culture for 24 hours, and more significantly for 48 hours, when compared to normal To determine the importance of HIF-1a regulation on Robo4 in cells during normoxic conditions. However, HIF-1a siRNA (100 nM) HREC under hypoxic conditions, we examined the effects of abolished HIF-1a protein expression (B) and downregulated Robo4 HIF-1a siRNA treatments on HREC invasion and cell prolifer- protein expression (C) in HREC under culture in hypoxic conditions ation by an invasion assay using Transwell Matrigel-coated for 24 and 48 hours. Control cells were transfected with scrambled chambers and a BrdU assay, respectively. siRNA. *Denote values significantly different between HIF-1a siRNA- treated group and control groups (P < 0.01). The cell migration assay demonstrated that HIF-1a RNA intervention (HIF-1a siRNA group, 193 6 9.77) markedly (NC, 24.84 6 1.09%, P < 0.01, Fig. 6C). There was no reduced the number of cells that migrated through the significant difference between the N and NC groups (P > chamber compared to the control siRNA-treated cells (NC, 0.05). 444 6 36.36, P < 0.01) and nontransfected cells (N, 517 6 12.16; P < 0.01) under hypoxic conditions, while those two groups’ migration ability was significantly higher than the DISCUSSION normoxic groups (131 6 11.99; P < 0.01; Figs. 6A, 6B). In contrast, there was no significant difference between the N Retinal neovascularization (RNV), a major cause of blindness in and NC groups (P > 0.05, Figs. 6A, 6B). humans, is an abnormal proliferation and migration of new By using a BrdU assay, we found that the growth of cells blood vessels from pre-existing vessels in the retina. This kind transfected with HIF-1a siRNA (HIF-1a siRNA group, 13.11 6 of neovascularization is deficient in tight junctions and, hence, 1.59%) was markedly inhibited compared to the untreated causes plasma to leak into surrounding tissue including the group (N, 27.64 6 0.79%) and the control siRNA-treated group vitreous resulting in vitreous hemorrhage. It attributes to the

Downloaded from jov.arvojournals.org on 09/25/2021 Regulation of Robo4 by HIF-1a IOVS j April 2015 j Vol. 56 j No. 4 j 2592

FIGURE 5. Overexpression of HIF-1a by lentiviral vector transduction upregulates Robo4 expression under normoxic conditions. Real-time PCR analysis (A, B) and Western blot analysis (C, D) of HIF-1a overexpression and the changes in Robo4 levels in HREC and HDMEC after transfection by lentiviral vectors. At 7 (HREC) and 14 (HDMEC) days after transfection, mRNA and protein were extracted from cells of the study groups (transfected with HIF-1a–GFP lentiviral vector pLVX-hHIF1a), cells of the negative GFP control groups (transfected with GFP lentiviral vector pLVX - ZSGreen), and cells of the negative control groups without transfection (mock). Real-time PCR was performed to measure the relative HIF-1a and Robo4 mRNA levels, and readings were normalized to human GAPDH mRNA levels. Each value represented the mean 6 SD of three replicates. The HIF-1a mRNA levels were significantly higher in the study group than the negative GFP control and mock groups (*P < 0.01, [A, B]). Accordingly, Robo4 mRNA levels were significantly higher in the study group than negative GFP control and mock groups (*P < 0.01, [A, B]). Protein expression levels of HIF-1a and Robo4 were assessed by Western blot analysis in HREC (C) and HDMEC (D). The HIF-1a and the Robo4 protein were significantly higher in the study groups (pLVX-hHIF1a) than in both control groups (C, D).

formation of FVM in PDR. The condition of RNV is stimulated In our study of PDR membranes, we demonstrated for the by one or more angiogenic factors released by the retina under first time to our knowledge that HIF-1a and Robo4 were hypoxic or ischemic conditions.21 The HIF-1 signal pathway positively expressed and colocalized. Further, HIF-1a and/or regulates the adaptive responses to O2 tensions at cellular Robo4 and CD34, an endothelial cell marker, were observed to levels, and it controls the expression of many genes involved in colocalize, consistent with previous studies16,21 where HIF-1a angiogenesis, cell survival,22 tumor growth,23 and genetic and Robo4 were closely related with angiogenesis. Robo4 was instability.24 specially expressed in the vascular system, particularly in the The identification of hypoxia-inducible factor-1 (HIF-1) as a vascular endothelial cells.11–13 Several studies have suggested key transcription factor that mediates increased expression of that HIF-1a and Robo4 may have a role in the formation of FVM hypoxia-regulated genes, such as VEGF, significantly aided the and participate in physiological functions within the cells of understanding of RNV pathogenesis. The HIF-1 has two subunits: the retina.2–4,16 Therefore, we studied the role of HIF-1a and HIF-1a expression is induced in hypoxic tissue, while HIF-1b is Robo4 in PDR and notably found that HIF-1a and Robo4 constitutively expressed. Expression of HIF-1a is detected in colocalized in the FVM of PDR patients (Figs. 1A, 1D). FVM of diabetic retinopathy (DR) patients, indicating a potential Therefore, we hypothesized that HIF-1a, as a transcriptional target for therapeutic intervention of RNV.2,3,5 regulatory factor, may have a part in Robo4 synthesis during Recent studies have suggested that Robo4, an endothelial- the formation of FVM. specific member of the roundabout family, is required to To further explore the regulation of HIF-1a on Robo4, HIF- maintain blood vessel integrity by counteracting VEGF and acts 1a expression was controlled by siRNA and stable transfection as a negative regulator of angiogenesis in model system.15 It also in two kinds of microvascular endothelial cells (HREC and has been reported that Robo4-UNC5B signaling maintains HDMEC) under normoxic conditions. The HREC is a type of vascular integrity by counteracting VEGF signaling in endothelial primary cell line, and HDMEC is an immortalized cell line. To cells.25 However, there is no study on how Robo4 is regulated. investigate the relationships between Robo4 and HIF-1a

Downloaded from jov.arvojournals.org on 09/25/2021 Regulation of Robo4 by HIF-1a IOVS j April 2015 j Vol. 56 j No. 4 j 2593

FIGURE 6. Inhibition of HIF-1a with siRNA decreases migration and proliferation ability in HREC during hypoxic conditions. (A) After transfection with 100 nM HIF-1a siRNA for 48 hours, 105 cells were seeded onto Matrigel coated Transwell inserts and allowed to migrate through the filter in normoxia or hypoxia conditions for 18 hours. Migrated cells were fixed, stained, and captured at 3200 magnification using the camera on an inverted microscope. (B) The HIF-1a siRNA significantly decreased the migration ability of HREC. The HIF-1a siRNA group showed a markedly decreased migration ability compared to the control siRNA-treated cells (NC, negative control; *P < 0.01) and nontransfected cells (N, normal; *P < 0.01) under hypoxic conditions, which migrated significantly more than the normoxic groups (#P < 0.01). (C) The BrdU staining assays revealed that HIF-1a siRNA group cell growth was significantly lower than in the control siRNA-treated cells and nontransfected cells under hypoxic conditions (*P < 0.01). Data are presented as the mean 6 SD. Each group experiment was repeated 3 times (n ¼ 3).

accurately, we tested both cells. We demonstrated that HIF-1a cloning and characterization of the human Robo4 promoter, and siRNA specifically knocks down HIF-1a RNA in HREC and confirmed that SP1 bond to the human Robo4 promoter and HDMEC, and Robo4 mRNA and protein levels decreased induced the promoter activity. Several findings suggest that accordingly under normoxic conditions (Fig. 2). hypoxia activates some genes and proteins, such as Redd130 and In this study, we exposed HREC to hypoxic conditions in vitro phenylethanolamine N-methyltransferase (PNMT),31,32 indirectly to mimic the hypoxia experienced by endothelial cells in via HIF-1a stimulation of Sp1. So, the regulation of HIF-1a on ischemic retinal diseases in vivo. We found that Robo4 mRNA Robo4 expression may be mediated by activation of Sp1, but and protein expressions were inhibited in the HIF-1a siRNA detail mechanism requires further exploration. group under hypoxic conditions (Figs. 3B, 4A, 4C). This is To study the importance of HIF-1a regulation on Robo4 in consistent with a previous study that indicated Robo4 expression endothelial cells under hypoxic conditions, we examined the is increased in endothelial cells under hypoxic conditions.18 In effects of HIF-1a siRNA transfection on HREC invasion and summary, we found HIF-1a positively controls the expression of proliferation and found that silencing HIF-1a inhibited cell Robo4 in hypoxic conditions just as it does in normal conditions. invasion and proliferation. Our results show that HIF-1a and According to the research that proves that gene transfer of a Robo4 overexpression due to hypoxic conditions correlates constitutively active form of HIF-1 induced RNV in the absence with HREC migration and proliferation (Figs. 3, 4, 6). As of retinal ischemia,26 we observed that at peak HIF-1a lentiviral illustrated in Figures 3 and 4, the increased expression of transfection in HREC and HDMEC under normoxic conditions, Robo4 induced by hypoxia was attenuated in HIF-1a knock- HIF-1a mRNA and protein levels along with Robo4 mRNA and down cells. These results demonstrated that hypoxia/HIF-1a protein levels were markedly overexpressed (Fig. 5). There- promotes HREC invasion and proliferation by transcriptionally fore, overexpressed HIF-1a is responsible for the upregulation upregulating Robo4. This is consistent with a previous study of Robo4 expression. that found Robo4-specific siRNA was an effective and specific These results suggest that Robo4 is positively regulated by HIF- inhibitor of migration and proliferation of choroid–retina 1a under normoxic and hypoxic conditions in vitro. In vivo endothelial (RF/6A) and human RPE cells.16 Furthermore, relationships between HIF-1a and Robo4 will be conducted in these results indicated that the RNA intervention method used further investigations. We predicted the possible transcription in our study to knock down hypoxia-induced HIF-1a expres- factors of Robo4 by AliBaba 2.1 software, but HIF-1a was not sion also is efficient at inhibiting HREC migration and found, suggesting that there is no direct binding between HIF-1a proliferation. Targeted therapy toward HIF-1a and Robo4 may and Robo4 proteins. The HIF-1a effects on Robo4 expression may have possible therapeutic implications in proliferative diabetic act through another pathway.Okada et al.27–29 firstly reported the retinopathy.

Downloaded from jov.arvojournals.org on 09/25/2021 Regulation of Robo4 by HIF-1a IOVS j April 2015 j Vol. 56 j No. 4 j 2594

In conclusion, our study indicated that HIF-1a and Robo4 13. Huminiecki L, Bicknell R. In silico cloning of novel endothelial- may cooperate in the formation of FVM. Silencing HIF-1a specific genes. Genome Res. 2000;10:1796–1806. expression in HREC and HDMEC cells inhibited Robo4 14. Bedell VM, Yeo SY, Park KW, et al. roundabout4 is essential for expression, while lentiviral vector-mediated overexpression angiogenesis in vivo. Proc Natl Acad Sci U S A. 2005;102: of HIF-1a in HREC and HDMEC cells was associated with 6373–6378. increased Robo4 expression, suggesting Robo4 is positively 15. Jones CA, London NR, Chen H, et al. Robo4 stabilizes the regulated by HIF-1a under normoxic and hypoxic conditions in vascular network by inhibiting pathologic angiogenesis and vitro. The HIF-1a promotes HREC invasion and proliferation by endothelial hyperpermeability. Nat Med. 2008;14:448–453. transcriptionally upregulating Robo4 under hypoxic condi- 16. Huang L, Yu W, Li X, et al. Expression of Robo4 in the tions. The regulatory mechanism and function change remains fibrovascular membranes from patients with proliferative unclear and requires further exploration. diabetic retinopathy and its role in RF/6A and RPE cells. Mol Vis. 2009;15:1057–1069. Acknowledgments 17. Ishikawa K, Yoshida S, Kadota K, et al. Gene expression profile of hyperoxic and hypoxic retinas in a mouse model of oxygen- The authors thank Richard M. Niles for generously providing the induced retinopathy. Invest Ophthalmol Vis Sci. 2010;51: lentiviral plasmid pLenti-V5-D-TOPO-HIF-1a used in this study. 4307–4319. Supported by Key Projects of Science and Technology Develop- 18. Park KW, Morrison CM, Sorensen LK, et al. Robo4 is a vascular- ment Plan of Jilin province (Grant No. 20090453) and Research specific receptor that inhibits endothelial migration. Dev Biol. Fund for Key Specialty-Ophthalmology Construction Program of 2003;261:251–267. Jilin Department of Health. 19. Xu K, Ding Q, Fang Z, et al. Silencing of HIF-1alpha suppresses Disclosure: R. Tian, None; Z. Liu, None; H. Zhang, None; X. tumorigenicity of renal cell carcinoma through induction of Fang, None; C. Wang, None; S. Qi, None; Y. Cheng, None; G. Su, apoptosis. Cancer Gene Ther. 2010;17:212–222. None 20. Mills CN, Joshi SS, Niles RM. Expression and function of hypoxia inducible factor-1 alpha in human melanoma under References non-hypoxic conditions. Mol Cancer. 2009;8:104. 21. Ozaki H, Yu AY, Della N, et al. Hypoxia inducible factor-1alpha 1. Arjamaa O, Nikinmaa M. Oxygen-dependent diseases in the is increased in ischemic retina: temporal and spatial correla- retina: role of hypoxia-inducible factors. Exp Eye Res. 2006;83: tion with VEGF expression. Invest Ophthalmol Vis Sci. 1999; 473–483. 40:182–189. 2. Wang X, Wang G, Wang Y. Intravitreous vascular endothelial 22. Semenza GL. Targeting HIF-1 for cancer therapy. Nat Rev growth factor and hypoxia-inducible factor 1a in patients with Cancer. 2003;3:721–732. proliferative diabetic retinopathy. Am J Ophthalmol. 2009; 23. Zhang X, Kon T, Wang H, et al. Enhancement of hypoxia- 148:883–889. induced tumor cell death in vitro and radiation therapy in vivo 3. Abu El-Asrar AM, Missotten L, Geboes K. Expression of by use of small interfering RNA targeted to hypoxia-inducible hypoxia-inducible factor-1alpha and the protein products of factor-1alpha. Cancer Res. 2004;64:8139–8142. its target genes in diabetic fibrovascular epiretinal membranes. 24. Koshiji M, To KK, Hammer S, et al. HIF-1alpha induces genetic Br J Ophthalmol. 2007;91:822–826. instability by transcriptionally downregulating MutSalpha 4. Lim JI, Spee C, Hinton DR. A comparison of hypoxia-inducible expression. Mol Cell. 2005;17:793–803. factor-alpha in surgically excised neovascular membranes of patients with diabetes compared with idiopathic epiretinal 25. Koch AW, Mathivet T, Larrive’ B, et al. Robo4 maintains vessel membranes in nondiabetic patients. Retina. 2010;30:1472– integrity and inhibits angiogenesis by interacting with UNC5B. 1478. Develop Cell. 2011;20:33–46. 5. Jiang J, Xia XB, Xu HZ, et al. Inhibition of retinal neovascu- 26. Kelly BD, Hackett SF, Hirota K, et al. Cell type-specific larization by gene transfer of small interfering RNA targeting regulation of angiogenic growth factor gene expression and HIF-1alpha and VEGF. J Cell Physiol. 2009;218:66–74. induction of angiogenesis in nonischemic tissue by a constitutively active form of hypoxiainducible factor 1. 6. Wenger RH, Stiehl DP, Camenisch G. Integration of oxygen Circ Res. 2003;93:1074–1081. signaling at the consensus HRE. Sci STKE. 2005;2005:re12. 7. Semenza GL. Regulation of mammalian O2 homeostasis by 27. Okada Y, Yano K, Jin E, et al. A three-kilobase fragment of the hypoxia-inducible factor 1. Annu Rev Cell Dev Biol. 1999;15: human Robo4 promoter directs cell type-specific expression 551–578. in endothelium. Circ Res. 2007;100:1712–1722. 8. Levy AP, Levy NS, Goldberg MA. Post-transcriptional regulation 28. Okada Y. Transcriptional regulation of the endothelial cell- of vascular endothelial growth factor by hypoxia. J Biol Chem. specific receptor, Robo4. Yakugaku Zasshi. 2012;132:1045– 1996;271:2746–2753. 1049. 9. Bunn HF, Gu J, Huang LE, Park JW, Zhu H. Erythropoietin: a 29. Okada Y. Regulation of endothelial cell-specific Robo4 gene model system for studying oxygen-dependent gene regulation. expression by DNA methylation and non-lineage specific J Exp Biol. 1998;201:1197–1201. transcription factors. Yakugaku Zasshi. 2014;134:817–821. 10. Yamakawa M, Liu LX, Date T, et al. Hypoxia-inducible factor-1 30. Jin HO, An S, Lee HC, et al. Hypoxic condition- and high cell mediates activation of cultured vascular endothelial cells by density-induced expression of Redd1 is regulated by activation inducing multiple angiogenic factors. Circ Res. 2003;93:664– of hypoxia-inducible factor-1alpha and Sp1 through the 673. phosphatidylinositol 3-kinase/Akt signaling pathway. Cell 11. Huminiecki L, Gorn M, Suchting S, Poulsom R, Bicknell R. Signal. 2007;19:1393–1403. Magic roundabout is a new member of the roundabout 31. Tai TC, Wong-Faull DC, Claycomb R, et al. Hypoxic stress- receptor family that is endothelial specific and expressed at induced changes in adrenergic function: role of HIF1 alpha. J sites of active angiogenesis. Genomics. 2002;79:547–552. Neurochem. 2009;109:513–524. 12. Grone J, Doebler O, Loddenkemper C, et al. Robo1/Robo4: 32. Wong DL, Tai TC, Wong-Faull DC, et al. Stress and adrenergic differential expression of angiogenic markers in colorectal function: HIF1a, a potential regulatory switch. Cell Mol cancer. Oncol Rep. 2006;15:1437–1443. Neurobiol. 2010;30:1451–1457.

Downloaded from jov.arvojournals.org on 09/25/2021