sign in sign up
<<
Home , Ammonia, Ammonium, Methane

sustainability

Article - and -Oxidizing : The Abundance, Niches and Compositional Differences for Diverse Layers in Three Flooded Paddy Fields

Jian Zhang 1, Olusanya A. Olatunji 2,* , Kaiwen Pan 3, Xianjun Jiang 1, Yao Meng 1, Jianjun Li 4, Jiabao Li 3, Si Shen 1, Dalu Guo 1 and Hongyan Luo 1,* 1 College of Resources and Environment, SouthWest University, Beibei, Chongqing 400715, China; [email protected] (J.Z.); [email protected] (X.J.); [email protected] (Y.M.); [email protected] (S.S.); [email protected] (D.G.) 2 College of Geographical Science, Fujian Normal University, 32 Shangsan Road, Fuzhou 350007, China 3 Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization & Ecological Restoration Biodiversity Conservation Key Laboratory of Sichuan Province, Chengdu Institute of , Chinese Academy of Sciences, Chengdu 610041, China; [email protected] (K.P.); [email protected] (J.L.) 4 Guangdong Institute of Microbiology, Guangdong 510070, China; [email protected] * Correspondence: [email protected] (O.A.O.); [email protected] (H.L.)

 Received: 3 January 2020; Accepted: 25 January 2020; Published: 28 January 2020 

Abstract: Ammonia oxidizing bacteria (AOB), Ammonia oxidizing (AOA) and methane oxidizing bacteria (MOB) play cogent roles in oxidation and nitrification processes, and hence have important ecological functions in several . However, their distribution and compositional differences in different long-term flooded paddy fields (FPFs) management at different soil depths remains under-investigated. Using qPCR and phylogenetic analysis, this study investigated the abundance, niches, and compositional differences of AOA, AOB, and MOB along with their potential nitrification and oxidation rate in three soil layers from three FPFs (ShaPingBa (SPB), HeChuan (HC), and JiDi (JD)) in Chongqing, China. In all the FPFs, CH4 oxidation occurred mainly in the surface (0–3 cm) and subsurface layers (3–5 cm). A significant difference in potential methane oxidation and nitrification rates was observed among the three FPFs, in which SPB had the highest. The higher amoA genes are the marker for abundance of AOA compared to AOB while pmoA genes, which is the marker for MOB abundance and diversity, indicated their significant role in the nitrification process across the three FPFs. The phylogenetic analysis revealed that AOA were mainly composed of Nitrososphaera, Nitrosospumilus, and Nitrosotalea, while the genus accounted for the greatest proportion of AOB in the three soil layers. MOB were mainly composed of Methylocaldum and Methylocystis genera. Overall, this finding pointed to niche differences as as suitability of the surface and subsurface soil environments for the co-occurrence of ammonia oxidation and methane oxidation in FPFs.

Keywords: AOA; AOB; MOB; q-PCR; Paddy field

1. Introduction

- - Nitrification, through which ammonia (NH3) is converted into (NO2 ) or (NO3 ), is a key process in global (N) cycling and is strongly linked with the release of greenhouse - to the , NO2 leaching into ground and N availability for plant use [1]. The - biological oxidation of NH3 into NO3 is currently considered to be catalyzed by Ammonia oxidizing Bacteria (AOB) within two Proteobacteria subclasses (β and γ subclasses Proteobacteria) and Ammonia oxidizing Archaea (AOA) [2]. Conversely, the oxidation of the second most abundant greenhouse

Sustainability 2020, 12, 953; doi:10.3390/su12030953 www.mdpi.com/journal/sustainability Sustainability 2020, 12, 953 2 of 24

, methane (CH4), is conducted by methane-oxidizing bacteria (MOB) [3]. In paddy fields, MOB minimize the amounts of CH4 emitted into the atmosphere [4]. MOB are -negative bacteria that utilize CH4 as the exclusive and energy source. They oxidize CH4 in the aerobic environments such as the rhizosphere and the soil-water interface before it is transported into the atmosphere [5]. Studies have shown that the rate of oxidation is approximately 50% to 90% of the amount of CH4 produced [6]. Therefore, elucidating on MOB abundance and activity in the aerobic region, particularly in paddy fields, is critical for enhancement of the understanding of CH4 oxidation and the reduction of greenhouse gases from fields. With more than half of the world’s population consuming rice, several hectares of lands are continuously being converted for rice production [7]. In China, paddy field management is widely distributed and remains the main source of N2O and CH4 [3]. Because of the fundamental roles of AOA, AOB, and MOB in the N biogeochemical cycle, the oxidation of CH4, ecological issues and soil health, particularly in paddy field, have attracted considerable attention. According to a previous study, , which is a major , is a by-product of both AOB and AOA activity [8]. In addition, AOB produces nitrogen monoxide, which decreases levels in the [9]. It has also been reported that AOA could possess a genetic capacity to exploit organic carbon and small organic [10,11]. However, several environmental factors, + including soil moisture, temperature, NH4 -N , among others, could influence the abundance and community structure of soil AOA, AOB and MOB [12]. Studies have reported archaeal amoA to be more abundant than bacterial amoA in most [13,14]; however, the differences in the abundance of different types of amoA may be due to their distinct ecological niches. For example, in an agricultural soil with N amendments, bacterial amoA are predicted to be more abundant [15], while in soil where mineralization of organic N influences the nitrification process, archaeal amoA are expected to be more abundant. Soil type, pH, vegetation types, and locations influence both nitrifiers and the nitrification process in soil ecosystems [16]. According to Lehtovirta-Morley et al. (2011) [17], in terrestrial ecosystems, although a specific AOA cluster is likely to occur in neutral environments, Nitrosotalea devanaterra, which is another cluster with an AOA origin, exists in acidic soils, suggesting that different AOA species respond differently to soil or acidity. Similarly, in paddy soils, the coupling of nitrification and denitrification has been reported, with AOA exhibiting higher activity in acidic paddy soils, while AOB are primarily dominant in neutral and alkaline paddy soils, particularly in intensively N-fertilized soil [18,19]. However, the distribution and compositional differences of AOA, AOB, and MOB in long-term nitrogen saturated flooded paddy fields (FPFs) management at different soil depths remains rarely examined. The intensive application of N has increased in recent decades, particularly in paddy fields, which has aggravated soil acidification and accelerated the rate at which most paddy fields become acidic [1]. Generally, N is critical for increasing grain yield in paddy fields. However, intensive N fertilizer application could alter the abundance and composition of AOB in the soil [20]. For example, Shen et al. (2011) [21] observed long-term N stocking considerably influenced the abundance and composition of AOB but not AOA in a semi-arid grassland. In addition, as soil becomes flooded in the course of rice growth, (O2) is depleted at a more rapid rate due to an interface a few millimeters beneath the soil–water [5], suggesting that the abundance of AOA and AOB, which are widespread in paddy fields, varies across soil layers. However, it is unclear how factors associated with soil depth influence AOA, AOB and MOB distribution in FPFs. Therefore, investigating the community responses of AOA, AOB and MOB in different soil layers could enhance our understating of the soil N cycle. In this study, soil samples were collected from three soil layers from three FPFs in Chongqing, China. The aim was to investigate the key microbial mechanisms of NH3 and CH4 oxidation in the FPFs and evaluate changes in AOA, AOB and MOB abundance and composition along the paddy field soil profiles. The study aimed to also evaluate the contributions of AOA, AOB and MOB in different soil layers nitrification and oxidation processes. Sustainability 2020, 12, 953 3 of 24

We applied qPCR techniques to identify AOA, AOB and MOB and compared their abundance and occurrence among three FPFs.

2. Materials and Methods

2.1. Soil Sampling and Site Characteristics The soil samples used in the present study were selected from three different soil layers, including the surface (0–3 cm), the subsurface (3–5 cm) and the bottom (5–20 cm) layers at three FPFs following crop harvest. The three experimental fields are at the Soil Experimental Station of Southwest University (JD) (30◦260N, 106◦260E), Hechuan (HC) (36◦101200N, 118◦59031.200E), and Shapingba (SPB) (29◦4303900N, 106◦1905700E), Chongqing, China. The average annual rainfall in the FPFs were 1105.4 mm, 1100–1300 mm and 1100 mm in JD, HC and SPB, respectively, and the average temperatures were 18.3 ◦C, 18.1 ◦C and 18.2 ◦C, respectively. The management practices in the three 2 FPFs included conventional fertilization treatments. At the JD sites, the application of 190 kg hm− 2 2 human and feces or containing , 500 kg hm− superphosphate, 75 kg hm− 2 2 chloride, 80 kg hm− urea topdressing of rice at the tillering stage and 75 kg hm− were common practices. At the HC and SPB sites, sulfate combined with human waste was applied as a fertilizer. In October 2016, three replicate soil samples were randomly collected at three layers in each of the paddy fields using a ZYA-QY drill soil sampler (70 mm 300 mm, Hangzhou Billion McNair × Tech., Zhejiang, China). The soils were homogenized by using manually mixing and removing visible plant debris, rocks and soil micro-fauna, and were then stored at 4 ◦C. Soil samples for molecular analysis were stored at 20 C. Other soil samples were air-dried and used for the determination of − ◦ basic physical and chemical properties.

2.2. Determination of Soil Properties Soil pH was measured in a 1:2.5 (soil:water) suspension using a pH meter (320-S, Mettler-Toledo Instruments Co., Ltd., Shanghai, China). Soil (SOM) was measured using the dichromate oxidation method [22]. Total nitrogen (TN) was measured using the [23] and bulk using the ring knife method. potential was calculated using the depolarization method (FJA-4 redox depolarization automatic analyzer) [24]. The results for the soil chemical property tests are presented in Table1. Sustainability 2020, 12, 953 4 of 24

Table 1. Soil properties at the experimental sites.

Bei Bei (JD) He Chuan (HC) Sha Pingba (SPB) 0–3 cm 3–5 cm 5–20 cm 0–3 cm 3–5 cm 5–20 cm 0–3 cm 3–5 cm 5–20 cm Average rainfall (mm) 1105.4 1100–1300 1100 Average temperature (◦C) 18.3 18.1 18.2 Average sunshine (h) 1276.7 1300 1150 Frostless (d) 334 331 325 pH 6.6 6.8 6.5 6.7 6.6 6.8 6.7 6.8 6.6 Eh (mV) 361 b 296 d 252 f 375 a 301 d 288 e 344 c 296 d 254 f Bulk density (g/cm3) 1.44 0.02 b 1.46 0.01 b 1.49 0.01 a 1.12 0.01 d 1.13 0.02 d 1.33 0.01 c 1.31 0.03 c 1.33 0.01 c 1.43 0.02 b ± ± ± ± ± ± ± ± ± Organic matter (g/kg) 23.8 0.2 d 25.0 0.3 b 22.9 0.1 e 18.0 0.1 h 19.5 0.2 f 18.5 0.1 g 25.1 0.1 b 25.7 0.2 a 24.3 0.1 c ± ± ± ± ± ± ± ± ± Total N (g/kg) 1.31 0.02 c 1.43 0.03 b 1.34 0.01 c 1.17 0.01 e 1.23 0.01 d 1.11 0.02 f 1.44 0.02 b 1.49 0.01 a 1.46 0.01 b ± ± ± ± ± ± ± ± ± Notes: 0–3 cm: surface layer, 3–5 cm: subsurface layer, 5–20 cm: bottom layer. Different lower-case letters (a–f) indicate significant differences p < 0.05. The differences at a 0.05 significance level were separately checked among soil samples. Sustainability 2020, 12, 953 5 of 24

2.3. Potential Nitrification Rates (PNRs) and Methane Oxidation Potentials (MOP) Potential nitrification rates (PNRs) were tested using the Chlorate ( chlorate) inhibition method [13]. Dry soil samples (5 g) were added into a 50 mL centrifuge tube that contained 20 mL of 1 mM (NH4)2SO4 and 1 mL of . The tube was maintained at 25 ◦C for 24 h in the dark and later retrieved for further analysis. The oxidation rate was calculated as follows:

(S C) 2,510,000  1 1 − · = n Ng− dm 5h− . (1) 5 5 %dm · · · · S—Soil sample value (mg N); C—Control (mg N)

The determination of soil CH4 oxidation potential was carried out according to Lü et al. (2005) [25] with some modifications. Briefly, the CH4 gas initially added to the pre-culture samples was released following the opening of the culture flask. As 1% CH4 gas was added to the samples, 1% difluoromethane was also added to the control treatment as a CH4 oxidation inhibitor. The culture suspensions were carefully shaken after sealing the pinhole. Each treatment had three replicates and was incubated at 25 ◦C in the dark. Sampling and soil CH4 oxidation potential determination were carried out on the first, fourth, seventh and tenth days after the beginning of the culture. The CH4 oxidation rate was calculated based on the slope when the concentration of CH4 in the bottle decreased linearly. The ratio of the difference of the CH4 concentration to the sampling time interval measured based on two consecutive samples during the culture period represented the CH4 oxidation rate during the period, and the oxidation rate was calculated as follows:

d V MW Q = c (2) dt × W × MV

1 1 where: Q: the oxidation rate of CH4 (µg g− h− ); dc/dt: change of CH4 concentration per unit time 1 1 (ppm mol− h− ); V: the volume of gas in the culture flask (L); W: the dry soil weight (g); MW: the molecular weight (g) of CH4; MV: the volume (L) of 1 mol of gas in a standard state.

2.4. Molecular Analyses A FastDNA SPin Kit for Soil (MP Biomedicals, LLC, United States)was used to extract soil DNA. Amplification of the qPCR products for AOA, AOB and MOB was conducted on a CFX-96 Optical Real-Time PCR System (Bio-Rad Inc. Hercules, CA, US). The primer pairs amoA-1F/amoA-2R [26], Arch-amoAF/Arch-amoAR [27], and A189f/682r [28], A189f/mb661 [29] (Table2) were adopted for the quantitative PCR (q-PCR) assays of AOA, AOB and MOB abundance, respectively. The total volume of the PCR reaction system was 20 µL, which was 10 µL of SYBR@ Premix EX TaqTM (TaKaRa), 0.3 µL of 1 the upstream and downstream primers (20 pmol µL− ), 1.0 µL of the sample and 8.4 µL of sterilized double distilled water (ddH2O). The reaction conditions are listed in Table3. The standard curve for quantitative PCR was used to clone an AOA and AOB amoA or an MOB pmoA functional gene into a vector plasmid (from Shanghai Meiji Sequencing Co., Ltd.).

Table 2. Specific primers for functional genes used in the present study.

Target Primer Sets Primer Sequences(5‘-3’) References amoA-1F GGGGTTTCTACTGGTGGT AOB amoA Rotthauwe(1997) amoA-2R CCCCTCKGSAAAGCCTTCTTC Arch-amoAF STAATGGTCTGGCTTAGACG Arch-amoAR GCGGCCATCCATCTGTATGT Beman (2006) AOA amoA A189gc GGNGACTGGGACTTCTGG Liebner (2009) MOB pmoA 682r GAASGCNGAGAAGAASGC Zhou (2008) A189gc GGNGACTGGGACTTCTGG mb661 CCGGMGCAACGTCYTTACC Sustainability 2020, 12, 953 6 of 24

Table 3. PCR reaction conditions for in the present study.

General PCR Reaction Quantitative PCR Reaction Target Conditions Conditions

95 ◦C, 5.0 min; 35 (95 ◦C, 30 s; 56 94 ◦C 5 min; 32 (94 ◦C 45 s, 55 ◦C × × ◦C, 45 s; 72 ◦C, 1 min,); Melt curve AOB amoA 45 s, 72 ◦C, 1 min); 72 ◦C, 10 min, 65.0 ◦C to 95.0 ◦C, increment 0.5 step at 4 ◦C. ◦C, 0:05+ plate read. 94 C 5 min, 32 (94 C 45 s, 53 C ◦ × ◦ ◦ 45 s, 72 ◦C 90 s ); 72 ◦C,10 min, step at 4 ◦C. Round 1: 94.0 C, 3 min; 30 (94.0 C, 30 s; ◦ × ◦ 95.0 C, 90 s; 40 (95.0 C, 10 s; 56.0 C,1 min; 72.0 C, 1 min); 72.0 ◦ × ◦ ◦ ◦ 55.0 C, 30 s; 72.0 C, 30 s; 80.0 C, AOA amoA C, 7 min, step at 4 C. The ◦ ◦ ◦ ◦ ◦ 5 s with plate read; Melt curve 65.0 MOB pmoA product obtained by the first C to 95.0 C, increment 0.5 C, round of PCR amplification is ◦ ◦ ◦ 0:05 + plate read. used as a template. Round 2: 95.0 C, 3 min, 35 (94.0 C, 30 s; ◦ × ◦ 56.0 ◦C, 1 min; 72.0 ◦C,1 min); 72.0 ◦C, 7 min, step at 4 ◦C.

2.5. Cloning, Sequencing, and Phylogenetic Analysis The target gene and were recombined in vitro and then introduced into competent cells for expression and amplification. The positive clones were sent to Shanghai Meiji Company for further sequencing using a pEASY-T3 Cloning Kit (TransGen Biotech, Beijing, China). The result obtained for the cloned sequences was subjected to sequence quality control using Chromas (Technelysium, Helensvale, Queensland, ), and the vector sequences were deleted from the text to obtain the target gene sequences. A Blast comparison was conducted by searching the National Center for Biotechnology Information (NCBI) Gen Bank database to obtain highly similar homologous gene sequences. MEGA v4.0 [30] was used for the analysis and the sequences of all gene clones were classified based on Operating Taxonomic Units (OTUs). The neighbor joining method was used to establish phylogenetic to determine the phylogenetic status of sequencing clones based on their positions and genetic distances in phylogenetic trees.

3. Statistical Analysis Statistical analyses were conducted using IBM SPSS Statistics 19.0 (IBM, Armonk, NY, US). Nitrification potential and microbial abundance were visualized using Origin 8.6 (OriginLab Corp., Northampton. MA, US). Gene sequencing was performed using Chromas, NCBI-Blast (https://www. ncbi.nlm.nih.gov/) and Mega v4.0 analysis and mapping.

4. Results

4.1. Potential Nitrification Rates Potential nitrification rates were different among the FPFs and among the different soil layers. The 1 1 1 1 nitrification activities ranged from 0.0150 µg N g− h− in HC soil to 0.1680 µg N g− h− in SPB soil (Figure1). In all the FPFs, nitrification activity was significantly higher in the subsurface layers (3–5 cm), although at different rates. Compared to the surface soil layer (0–3 cm), the potential nitrification rate in HC soil was significantly lower in the bottom layer (5–20 cm), although it was higher in SPB and JD soil (Figure1). Sustainability 2020, 12, x FOR PEER REVIEW 7 of 23 Sustainability 2020, 12, 953 7 of 24

0.20 0~3 cm

） 3~5 cm a 5~20 cm

0.15 dry soil/h

b μg N/g μg 0.10 c （ d d e f 0.05 g h

0.00 Potentialnitrification HC SPB JD

Figure 1. Nitrification activity in different soil layers in all the flooded paddy fields. Values are the averagesFigure of1. triplicate samples. activity Vertical in different bars indicate soil layers standard in all the deviations. flooded paddy Different fields. letters Values above are the the columnsaverages indicate of triplicate significant samples. differences Verticalp

4.2.The CH CH4 oxidation4 oxidation Potentials rates in different soil layers of the three FPFs are illustrated in Figure2. In all the FPFs, the CH4 oxidation rates were rapid initially and then decreased with an increase in incubation The CH4 oxidation rates in different soil layers of the three FPFs are illustrated in Figure 2. In all time (Figure2). The average CH 4 oxidation capacity of SPB soil was the highest and that of HC soil the FPFs, the CH4 oxidation rates were rapid initially and then decreased with an increase in was the lowest, irrespective of the number of soil layers (Figure2). The net CH 4 oxidation rates in incubation time (Figure 2). The average CH4 oxidation capacity1 of1 SPB soil was the highest and that SPB soil were 0.46 0.40, 0.63 0.46 and 0.43 0.26 µg CH4 g− h− at 0–3 cm, 3–5 cm and 5–20 cm, of HC soil was the± lowest, irrespective± of the± number of soil layers (Figure 2). The net CH1 4 oxidation1 respectively. In addition, the net CH4 oxidation rates in HC soil were 0.43 0.33 µg CH4 g− h− , 0.26 rates in SPB soil were 0.46 ± 0.40, 0.63 ± 0.46 and 0.43 ± 0.26 μg CH4 g-1 h±-1 at 0–3 cm, 3–5 cm and 5–20 0.15 µg CH g 1 h 1 and 0.22 0.19 µg CH g 1 h 1 at 0–3 cm, 3–5 cm and 5–20 cm, respectively. 4 − − 4 − − -1 -1 ± cm, respectively. In addition, the± net CH4 oxidation rates in HC soil were 0.43 ± 0.33 μg CH4 g1 h1 , The net CH4 oxidation rates in JD soil were 0.022 0.018, 0.020 0.79 and 0.91 0.93 µg CH4 g− h− 0.26 ± 0.15 μg CH4 g-1 h-1 and 0.22 ± 0.19 μg CH±4 g-1 h-1 at 0–3 ±cm, 3–5 cm and± 5–20 cm, respectively. at 0–3 cm, 3–5 cm and 5–20 cm. The net CH4 oxidation rates in JD soil were 0.022 ± 0.018, 0.020 ± 0.79 and 0.91 ± 0.93 μg CH4 g-1h-1 at 4.3.0–3 AOA, cm, 3–5 AOB, cm and and MOB 5–20 Abundance cm.

The results of the q-PCR analysis of amoA and pmoA were used to determine the AOA, AOB and MOB abundance in the SPB, HC and JD soils. AOA abundance ranged from 5.28 to 1.09 107 /g dry × soil, 5.36 to 1.59 107 /g dry soil and 3.64 to 1.10 107 /g dry soil archaeal amoA gene copies in the SPB, × × HC and JD soils, respectively (Figure3a). The highest AOA amoA abundance was observed in the bottom (5–20 cm) layer of the SPB and JD soils. AOB abundance ranged from 3.81 to 7.50 106 /g dry × soil, 1.10 to 4.27 106 / g dry soil, and 1.43 to 3.14 106 /g dry soil bacterial amoA gene in the SPB, HC × × and JD soil samples, respectively (Figure3b). The AOB amoA gene copies in the subsurface (3–5 cm) layer of the SPB, HC and JD soils were significantly higher than in the bottom (5–20 cm) layer. MOB abundance ranged from 2.56 to 1.05 106 / g dry soil, 7.46 to 1.02 106 /g dry soil, and 2.92 to 1.04 × × × 106 / g dry soil pmoA gene copies in the SPB, HC and JD soils, respectively (Figure3c). The MOB pmoA gene copies at the SPB site decreased with an increase in soil layer depth; however, no consistent trend in MOB pmoA abundance was observed in the HC and JD sites among the soil layers. The AOA/AOB Sustainability 2020, 12, 953 8 of 24 ratio at 0–3 cm and 5–20 cm was greater than 10 across the three sites (Table4) while the AOB /MOB ratio in all the three sites and at the different layers was much lower than 10.

Figure 2. Methane oxidation rate in different soil layers in all the flooded paddy fields. Values are the Figureaverages 2. Methane of triplicate oxidation samples. rate Vertical in different bars indicatesoil layers standard in all the deviations. flooded paddy fields. Values are the averages of triplicate samples. Vertical bars indicate standard deviations.

1

Sustainability 2020, 12, x FOR PEER REVIEW 9 of 23 soil, 1.10 to 4.27 × 106 / g dry soil, and 1.43 to 3.14 × 106 /g dry soil bacterial amoA gene in the SPB, HC and JD soil samples, respectively (Figure 3b). The AOB amoA gene copies in the subsurface (3–5 cm) layer of the SPB, HC and JD soils were significantly higher than in the bottom (5–20 cm) layer. MOB abundance ranged from 2.56 to 1.05 × 106 / g dry soil, 7.46 to 1.02 × 106 /g dry soil, and 2.92 to 1.04 × 106 / g dry soil pmoA gene copies in the SPB, HC and JD soils, respectively (Figure 3c). The MOB pmoA gene copies at the SPB site decreased with an increase in soil layer depth; however, no consistent trend in MOB pmoA abundance was observed in the HC and JD sites among the soil layers. The Sustainability 2020, 12, 953 9 of 24 AOA/AOB ratio at 0–3 cm and 5–20 cm was greater than 10 across the three sites (Table 4) while the AOB/MOB ratio in all the three sites and at the different layers was much lower than 10. 20

） 0~3 cm a 3~5 cm 5~20 cm 15 /g dry soil dry /g 7

10 b

× b （ 10 c c c

d

gene copies d

oA 5 e am

A O A 0 SPB HC JD

(a) 20 ） 0~3 cm 3~5 cm 5~20 cm /g dry soil dry /g

6 15 10 × （

10 a gene copies b oA b b 5 b

am b

B bc O c c A

0 SPB HC JD

(b) ） 20 0~3 cm 3~5 cm /g dry soil dry /g

6 5~20 cm 15 10 ×

（ a a a a 10 b c gene copies cd 5 oA oA de e pm

B O

M 0 SPB HC JD

(c)

FigureFigure 3. 3. (a()a )AOA, AOA, (b (b) )AOB, AOB, and and (c ()c )MOB MOB community community abundance abundance in in different different soil soil layers layers in in all all the the floodedflooded paddy paddy fields. fields. Values Values are are the the averages averages of of triplicate triplicate samples. samples. Vertical Vertical bars bars indicate indicate standard standard ＜ deviations.deviations. Different Different letters letters above above the the columns columns indicate indicate significant significant differences differences @p p< 0.05.0.05. Sustainability 2020, 12, 953 10 of 24

Table 4. Relative abundances of functional gene copy numbers for different soil layers in flooded paddy fields.

SPB HC JD 0–3 cm 3–5 cm 5–20 cm 0–3 cm 3–5 cm 5–20 cm 0–3 cm 3–5 cm 5–20 cm AOA/AOB 20.7 7.04 28.6 57.2 12.6 68.4 43.5 11.6 76.9 AOA/MOB 7.72 13.1 42.6 17.2 5.25 10.1 7.14 12.5 20.5 AOB/MOB 0.373 1.87 1.49 0.301 0.419 0.147 0.164 1.07 0.647 Notes: 0–3 cm: surface layer, 3–5 cm: subsurface layer, 5–20 cm: bottom layer.

4.4. AOA, AOB, and MOB Community Composition A total of 90 positive sequences were used for AOA, AOB amoA and MOB pmoA functional gene sequencing and the construction of a clone library (Figure4). Phylogenetic analysis revealed that the AOA amoA in the surface layer in HC belonged to 1.1b, while 97% of AOA amoA in the subsurface layer belonged to the subordinates Group 1.1b and 3% to Group 1.1a associated. Sixty-four percent of AOA amoA in the bottom layer belonged to the subordinates Group 1.1b and 36% to Group 1.1a associated (Figure4a). In addition, the phylogenetic analysis revealed that 92% of AOA amoA in the surface layer of SPB belonged to Group 1.1b, while 8% belonged to Group 1.1a. Fifty-six percent of AOA amoA in the subsurface layer of SPB belonged to subordinates Group 1.1b and 44% to Group 1.1a associated; while in the bottom layer, 12% of the AOA amoA belonged to Group 1.1b, and 88% of the subordinates belonged to Group 1.1a associated (Figure4b). At the JD site, 84% of AOA amoA belonged to Group 1.1b and 16% to Group 1.1a, while 36% belonged to Group 1.1b and 64% belonged to Group 1.1a in the subsurface and the bottom layers (Figure4c). Nitrosospira clusters were observed in the surface and bottom layers, accounting for 17% and 14%, respectively. In addition, the community diversity of AOA exceeded that of AOB considerably, and AOB amoA was affiliated only with Nitrosomonas in the HC and SPB sites (Figure5). The phylogenetic analysis of MOB pmoA assigned 69% of the sequences to Type Ia and the residual 31% of the sequences to type II MOB in the HC surface layer. In the HC subsurface layer, MOB pmoA consisted of subordinate Type Ia (18%), Type Ib (37%) and Type II (45%). In the HC bottom layer, 24% of the sequences belonged to Type Ib and 76% belonged to Type II. In the surface layer at the SPB site, only 11% of the sequences were assigned to type II while the rest belonged to Type Ia (30%) and Type Ib (59%). In the SPB subsurface layer, 44% of the sequences were associated with Type Ib, and 56% were associated with Type I methanotrophs. Only 8% of MOB pmoA sequences were classified into Type Ia methanotrophs and the rest were associated with Type II. In the surface layer of the JD site, 17% of the sequences were assigned to Type Ia and the rest of the sequences were type Ib MOBs. The subsurface MOB pmoA belonged to Type Ib bacteria (38%) and Type II bacteria (62%). For the bottom layer soil at the JD site, the sequences belonged to Type Ia (25%), Type Ib (21%) and Type II (54%) (Figure6). SustainabilitySustainability2020 2020, 12, 12, 953, x FOR PEER REVIEW 1111 of of 24 23

70 H-1-OTU1(11)

99 clone NF-J-Seq18(JQ698558.1) H-1-OTU2(3)

72 99 H-2-OTU1(16)

96 H-2-OTU2(2) clone AOA-99(FN562534.1)

97 95 H-3-OTU1(1)

98 clone GHVS-N0-42(KR856771.1)

H-1-OTU3(3)

H-3-OTU2(3) 99 clone A835(KM460392.1) 73 Group 1.1b 99 99 H-1-OTU4(4)-H-2-OTU3(4)-H-3-OTU3(4) 84 DGGE gel band AOA2(HQ012642.1)

99 H-3-OTU4(8) 98 clone GHVS-N0-40(KR856769.1)

hot spring N.gargensis(EU281321)

H-2-OTU4(5) 99 99 clone JXCW-10(KP167670.1)

99 Nitrososphaera sp. EN76(FR773159.1) clone NC-15-16(KP168045.1) 98

99 H-2-OTU5(1) 99 H-1-OTU5(1)

99 clone A YT 47(KJ863827.1) 55 H-3-OTU5(2)

99 soil N.devanaterra(JN227489) Group 1.1a-associated

clone AOA-S2-19(KM117006.1)

89 H-3-OTU6(7)-H-2-OTU6(1)

hot spring N.maritimus(EU239959) Group 1.1a

0.05

(a)

Figure 4. Cont. Sustainability 2020, 12, x FOR PEER REVIEW 12 of 23 Sustainability 2020, 12, 953 12 of 24

73 Q-3-OTU1(18)

41 clone A JX 8(KJ863942.1) Q-3-OTU2(1) 31 17 clone 10-24(HM637854.1)

Q-2-OTU1(4) Group 1.1a 38 71 clone 15C 57(JQ404003.1)

hot spring N.maritimus(EU239959)

20 Q-3-OTU4(3)-Q-2-OTU2(7)-Q-1-OTU1(2) 91 clone AOA-S-BLG-62(KC735184.1)

46 Q-1-OTU2(12)-Q-3-OTU3(3) clone NF-M-Seq14(JQ698537.1)

38 Q-1-OTU3(5)-Q-2-OTU3(14) clone AOA-W-XP-70(KC735556.1)

49 clone SW3-12(KT274872.1) Group 1.1b hot spring N.gargensis(EU281321) 9 Nitrososphaera sp. EN76(FR773159.1) 29

36 Q-1-OTU4(5) 89 clone ACA-4(KU253938.1)

0.05

(b)

Figure 4. Cont. SustainabilitySustainability2020 2020, 12, 12, 953, x FOR PEER REVIEW 1313 of of 24 23

87 J-2-OTU4(5)-J-3-OTU4(1)

45 clone B10(JX827675.1) J-3-OTU3(1) 89 82 clone 350-95DA(JF905710.1)

99 J-1-OTU1(2)-J-2-OTU3(7)-J-3-OTU2(16) 86 clone AL7(KF618633.1) Group 1.1a

89 hot spring N.maritimus(EU239959) clone CH22(KJ005026.1)

clone AOA-S-XP-13(KC735378.1) 97 100 J-1-OTU3(2)

J-2-OTU2(6)-J-3-OTU1(7)

acid soil N.devanaterra(JN227489) Group 1.1a associated

Nitrososphaera sp. EN76(FR773159.1)

98 hot spring N.gargensis(EU281321)

86 J-1-OTU2(5)-J-2-OTU1(10) 67 Group 1.1b DGGE gel band D43(KP400759.1)

82 J-1-OTU1(16)

57 clone A JX 43(KJ863977.1)

hot spring HL4.G09(EU239971)

100 hot spring NyCr.F07(EU239978) ThAOA 96 hot spring N.yellowstonii(EU239961)

0.05 (c)

FigureFigure 4. 4. PhylogeneticPhylogenetic treetree ofof AOAAOA amoAamoA inin didifferentfferent soilsoil layerslayers inin (a(a)) HC,HC, (b(b)) SPB, SPB, and and ( c(c)) JD JD soil soil samples.samples. The The number number in in brackets brackets after after the the gene gene or or clone clone name name represents represents the the sequence sequence number number of of the the OTU.OTU. The The scale scale represents represents the the genetic genetic distance, distance, and and the the number number represents represents five five differences differences in every in every 100 bases.H-1100 bases.H-1 represents represents a 0–3 a cm 0–3 soil cm layer, soil layer, H-2 represents H-2 represents a 3–5 a cm 3–5 soil cm layer soil andlayer H-3 and represents H-3 represents a 5–20 a cm5–20 soil cm layer soil inlayer Figure in Figure4a;Q-1 4a;Q-1 represents represents a 0–3 cma 0–3 soil cm layer, soil Q-2layer, represents Q-2 represents a 3–5 cma 3–5 soil cm layer soil andlayer Q-3and represents Q-3 represents a 5–20 a cm5–20 soil cm layer soil layer in Figure in Figure4b;J-1 4b; representsJ-1 represents a 0–3 a cm 0–3 soil cm layer, soil layer, J-2 represents J-2 represents a 3–5 a cm3–5 soil cm layer,soil layer, and J-3and represents J-3 represents a 5–20 a 5–20 cm soilcm layersoil layer in Figure in Figure4c.The 4c.The scale sc indicatesale indicates the numberthe number of nucleotideof nucleotide substitutions substitutions per per site. site. Sustainability 2020, 12, 953 14 of 24 Sustainability 2020, 12, x FOR PEER REVIEW 14 of 23

75 H-2-OTU1(1) clone AOB-RS-9(HQ202452.1)

isolate DGGE gel band F8(GU377311.1) 95 H-1-OTU1(18)-H-2-OTU2(18)

33 H-3-OTU(23) clone AOB(4-6)14(KR081208.1) 99 H-3-OTU2(3) 31 clone M-G5-AOB-03(KM882059.1) Nitrosomonas

H-2-OTU3(4)-H-3-OTU(2) 49 98 H-2-OTU4(3) GHVS-N0-14(KR856520.1)

28 bacterium clone HZB-15(KC662528.1)

92 H-1-OTU2(6) 88 clone HZB-32(KC662535.1)

Nitrosomonas europaea (AF058692)

Nitrosospira sp(X90821) Nitrosopira

0.05

(a)

Figure 5. Cont. Sustainability 2020, 12, 953 15 of 24 Sustainability 2020, 12, x FOR PEER REVIEW 15 of 23

(b)

Figure 5. Cont. Sustainability 2020, 12, 953 16 of 24 Sustainability 2020, 12, x FOR PEER REVIEW 16 of 23

clone B03(KX036834.1)

clone B04(KX036835.1)

J-2-OTU1(9)

clone TH0110172 1-5-4 M13F(-47)(JQ865... 90 clone GHVS-N0-14(KR856520.1)

J-1-OTU1(8)-J-2-OTU2(3)

100 clone B12(KX036843.1) KX036847.1clone B16(KX036847.1)

J-2-OTU3(12) 95 J-3-OTU1(13) Nitrosomonas J-1-OTU2(15)

100 J-3-OTU2(6) 99 clone OTUF106(EU697785.1)

J-3-OTU3(5) 98

86 clone G4B51(KP783373.1) 84 CU1(KF619111.1)

55 clone SB138(KJ484114.1) J-1-OTU3(5) 77 clone AOB-D2-7(KP197439.1)

Nitrosomonas europaea (AF058692)

65 clone B522(KM460532.1)

98 J-2-OTU4(2) clone YY AOB68(KY074926.1) 98 61 J-2-OTU5(3)-J-3-OTU4(4) 41 Nitrosospirasp. Nsp2 (AJ298719) Nitrosospirasp 76 Nitrosospira briensis (U76553)

Nitrosospira sp.Nsp12 (AY123823)

40 Nitrosospira sp(X90821) 100 72 Nitrosospira sp.CT2F (AY189143)

Nitrosolobus multiformis (X90822)

0.05 (c)

Figure 5. Phylogenetic of AOB amoA in different soil layers in (a) HC, (b) SPB and (c) JD soil Figure 5. Phylogenetic tree of AOB amoA in different soil layers in (a) HC, (b) SPB and (c) JD soil samples. samples. The number in brackets after the gene or clone name represents the sequence number of the The number in brackets after the gene or clone name represents the sequence number of the OTU. The scale OTU. The scale represents the genetic distance, and the number represents five differences in every 100 represents the genetic distance, and the number represents five differences in every 100 bases. H-1 bases. H-1 represents a 0–3 cm soil layer, H-2 represents a 3–5 cm soil layer and H-3 represents a 5–20 represents a 0–3 cm soil layer, H-2 represents a 3–5 cm soil layer and H-3 represents a 5–20 cm soil layer in cm soil layer in Figure5a; Q-1 represents a 0–3 cm soil layer, Q-2 represents a 3–5 cm soil layer, and Figure 5a; Q-1 represents a 0–3 cm soil layer, Q-2 represents a 3–5 cm soil layer, and Q-3 represents a 5–20 Q-3 represents a 5–20 cm soil layer in Figure5b;J-1 represents a 0–3 cm soil layer, J-2 represents a 3–5 cm soil layer in Figure 5b;J-1 represents a 0–3 cm soil layer, J-2 represents a 3–5 cm soil layer, and J-3 cm soil layer, and J-3 represents a 5–20 cm soil layer in Figure5c.The scale indicates the number of representsnucleotide a 5–20 cm substitutions soil layer in per Figure site. 5c.The scale indicates the number of nucleotide substitutions per site.

The phylogenetic analysis of MOB pmoA assigned 69% of the sequences to Type Ia and the residual 31% of the sequences to type II MOB in the HC surface layer. In the HC subsurface layer, Sustainability 2020, 12, x FOR PEER REVIEW 17 of 23

MOB pmoA consisted of subordinate Type Ia (18%), Type Ib (37%) and Type II (45%). In the HC bottom layer, 24% of the sequences belonged to Type Ib and 76% belonged to Type II. In the surface layer at the SPB site, only 11% of the sequences were assigned to type II methanotrophs while the rest belonged to Type Ia (30%) and Type Ib (59%). In the SPB subsurface layer, 44% of the sequences were associated with Type Ib, and 56% were associated with Type I methanotrophs. Only 8% of MOB pmoA sequences were classified into Type Ia methanotrophs and the rest were associated with Type II. In the surface layer of the JD site, 17% of the sequences were assigned to Type Ia and the rest of the sequences were type Ib MOBs. The subsurface MOB pmoA belonged to Type Ib bacteria (38%) and TypeSustainability II bacteria2020, 12 (62%)., 953 For the bottom layer soil at the JD site, the sequences belonged to Type17 of Ia 24 (25%), Type Ib (21%) and Type II (54%) (Figure 6).

94 H-2-OTU2(3) 95 RSM23(AM910106.1)

68 H-2-OTU3(1)

clone I2sMB79(JX184379.1) 46 91 H-2-OTU4(1) 99 H-3-OTU5(3) Type Ib

clone 15(AY355388.1) 16 97 H-3-OTU4(3)

Methylocaldum sp. EU275141

72 clone Rhizo-T-16(KR233444.1) 99 H-2-OTU5(1)

99 clone LP-II158(HQ383729.1) 80 H-1-OTU1(7)

40 Methylosarcina lacus AY007286

H-1-OTU2(11) 99 99 clone YT100-B_11(KF365796.1) Type Ia 86 Methylococcacea EU275121

68 Methylococcaceae EU275101

clone 05-2000yo-B(JN591175.1)

99 H-2-OTU6(4)

87 H-2-OTU7(2) 99 H-3-OTU3(8) 26 clone: NRZ_C04(AB857392.1)

68 H-1-OTU3(3) 97 H-2-OTU9(1)

90 clone 201410MOBS0-37(KR526832.1) 99 clone 63-50B-661r(JN591144.1)

45 H-1-OTU4(1)

88 clone YT30-12(KF823561.1) Type II 62 H-3-OTU2(6) 92 33 Methylocystis sp. SB12 KC878620

clone WP1_BN_91(KF256201.1)

98 H-1-OTU5(3)

28 85 clone BL4(KJ410774.1) H-2-OTU8(7)

99 H-1-OTU6(1)

91 clone: NRZ_D09(AB857407.1) 78 H-2-OTU1(1)

H-3-OTU1(5) Type II 99 Methylocystis sp. SC2 AJ459053

(a)

Figure 6. Cont. Sustainability 2020, 12, 953 18 of 24 Sustainability 2020, 12, x FOR PEER REVIEW 18 of 23

86 Q-3-OTU1(5) clone A36(KJ817940.1)

89 Q-3-OTU2(4) 66 clone C14(KJ817981.1) 99 68 Methylocystis sp. SB12 KC878620

Q-2-OTU1(2)

99 clone 15-50B-661r(JN591105.1)

Type I I 87 65 Q-1-OTU1(2) clone 58-2000B-661r(JN591276.1)

99 Q-3-OTU3(4) 52 clone A7(KJ817911.1)

99 Q-1-OTU2(1) 69 clone 39(JQ990123.1)

15 Q-3-OTU4(1)

98 clone VA19(KP903170.1)

71 Methylocystis sp. SC2 AJ459053 99 Q-3-OTU5(9) Type I I

Q-3-OTU6(1)

99 Q-2-OTU2(6)

69 clone L1sMB51(JX184315.1) Q-2-OTU3(2) 86 99 clone RSM23(AM910106.1)

Q-2-OTU4(1) 99 99 clone 60-19(KC817710.1)

Q-1-OTU3(9) Type I b

clone 44-50B-661r(JN591128.1) 69 99 98 Q-1-OTU4(7) 85 clone 30-2000B-661r(JN591250.1) 34 Q-2-OTU5(3)

99 clone pmoA-116(JQ671319.1) Type I Methylocaldum sp. EU275141 73 99 Q-2-OTU6(3) clone 16-2000yo-B(JN591183.1)

Methylococcaceae EU275101 75 99 Q-2-OTU7(10) 89 clone MD2-12(KX001523.1)

Methylococcacea EU275121 Type I a 93

99 Q-3-OTU7(2) 95 clone pmoA_SY_72 PmoA(KF511698.1)

35 Methylosarcina lacus AY007286

80 Q-1-OTU5(8) 99 clone P8-6-88(JX113163.1)

(b)

Figure 6. Cont. SustainabilitySustainability2020 2020, 12, 12, 953, x FOR PEER REVIEW 1919 of of 24 23

37 J-2-OTU1(3) 88 clone RS-PK57-274(FN649472.1)

45 JN591276.1 Uncultured bacterium clone...

J-3-OTU1(6) 64 95 Uncultured bacterium clone WP1 BN 91(...

J-2-OTU2(2)

57 Uncultured bacterium clone 63-50B-661... Type II 100 77 clone YT100-B 36(KF365818.1) 93 Uncultured bacterium clone YT30-12(KF...

J-2-OTU3(3)-J-3-OTU2(7)

67 Methylocystis sp. SB12 KC878620

12 88 Methylocystis sp. SC2 AJ431386 76 Methylocystis sp. AB683078

73 J-2-OTU4(2) JN591128.1 Uncultured bacterium clone...

97 J-1-OTU1(9)

54 KC817710.1 Uncultured bacterium clone...

58 J-1-OTU2(3)

75 95 clone DG1.5-11(GU056150.1) Type Ib 21 JX184315.1 Uncultured methane-oxidizi...

J-2-OTU5(2) 38 93 AM910106.1 Uncultured bacterium parti...

95 J-2-OTU6(6)

98 clone I2sMB79(JX184379.1) 99 Uncultured methane-oxidizing gamma pr...

98 J-1-OTU3(7) Type Ib Uncultured bacterium clone Rhizo-T-16...

96 Methylocaldum sp. EU275141 13 Methylocaldum sp. JN255568

99 Methylococcaceae type I ... 17 Methylococcaceae type I methanotroph (3)

100 J-1-OTU4(4) 94 KX001523.1 Uncultured bacterium clone...

100 Methylomicrobium pelagicum NOU31652 Type I a 98 Methylococcaceae type I methanotroph (2)

95 Methylosarcina lacus AY007286

89 J-3-OTU3(11) 99 Uncultured methanotrophic bacterium c...

J-3-OTU4(5) Type Ib 96 JQ671319.1 Uncultured methanotrophic ...

Methylocystis sp. SC2 AJ459053

(c)

FigureFigure 6. Phylogenetic 6. Phylogenetic tree of tree MOB of MOBpmoA pmoAin differentin diff soilerent layers soil layersin (a) HC, in ( a(b)) HC, SPB ( band) SPB (c) JD and soil (c) samples. JD soil The samples.number in The brackets number after in bracketsthe gene afteror clone the name gene orrepresents clone name the representssequence number the sequence of the numberOTU. The of scale the representsOTU. Thethe scalegenetic represents distance, the and genetic the distance,number re andpresents the number five differences represents fivein every differences 100 bases. in every H-1 represents100 bases. a 0–3 H-1 cm represents soil layer, aH-2 0–3 represents cm soil layer, a 3–5 H-2 cm represents soil layer and a 3–5 H-3 cm represents soil layer anda 5–20 H-3 cm represents soil layer ain Figure5–20 6a; cm Q-1 soil represents layer in Figurea 0–3 cm6a; soil Q-1 layer, represents Q-2 re apresents 0–3 cm soila 3–5 layer, cm soil Q-2 layer represents and Q-3 a 3–5 represents cm soil layera 5–20 cm soiland layer Q-3 represents in Figure a6b; 5–20 J-1 cm represents soil layer a in 0–3 Figure cm 6soilb; J-1 layer, represents J-2 represents a 0–3 cm a soil 3–5 layer, cm soil J-2 representslayer and aJ-3 represents3–5 cm a soil 5–20 layer cm soil and layer J-3 represents in Figure a6c. 5–20 The cm scale soil indicates layer in Figurethe number6c. The of scalenucleotide indicates substitutions the number per site. ofNumbers nucleotide in parentheses substitutions against per site. each Numbers abbreviation in parentheses indicate the against number each of abbreviationsequences recovered indicate from the eachnumber sample.of sequences recovered from each sample.

5. Discussion

5.1. Spatial Occurrence and Abundance of AOA, AOB and MOB among the FPFs The present study explored the occurrence and niche distribution of AOA, AOB and MOB among three FPFs. Although some studies have suggested that the oxidation of NH3 is mainly Sustainability 2020, 12, 953 20 of 24

5. Discussion

5.1. Spatial Occurrence and Abundance of AOA, AOB and MOB among the FPFs The present study explored the occurrence and niche distribution of AOA, AOB and MOB among three FPFs. Although some studies have suggested that the oxidation of NH3 is mainly attributed to AOA [31,32], the presence of both AOA and AOB in all the three FPFs in the present study indicated - that the two groups could jointly play a role in the transformation of NH3 to NO3 . Consistent with the findings of previous studies across different ecosystems [16,33], we observed that AOA abundance has a more considerable role than AOB and MOB across the three FPFs, with the highest amoA observed in the bottom soil layers, particularly in the SPB and JD sites. Although the results of previous studies have suggested that AOA numerically outnumber AOB in acidic soil, in the present study we observed that despite the soil pH values across the FPFs moving away from being acidic to alkaline (Table1), the AOA abundance was still significantly higher than AOB abundance in all FPFs, and were consistent with the higher potential nitrification rates (PNRs), particularly in the SPB and JD sites. The results indicated a reduced affinity of soil pH and AOA for NH3, which enabled them to utilize low concentrations of NH3 in the acidic soils and thus influenced their abundance in the present study. However, the higher AOA observed in the present study could be attributed to their capacity to adapt to low O2 concentration environments, which is a common phenomenon in paddy fields [34], or the high organic matter concentrations that create NH3 assimilation pathways in all the three sites (Table1 in reference [ 35]). In addition, although the AOA/AOB ratio was higher than 10 in all the three sites, the AOB/MOB ratio was much lower than ten, indicating that the AOA amoA functional gene copy numbers in the three sites were significantly higher than the AOB amoA and MOB pmoA functional gene copy numbers, by at least one order of magnitude. - Since potential nitrifying activity is linked strongly to soil NO2 content, the higher PNRs in the 3–5 cm - soil layer indicated that the risk of NO2 leaching could be higher in the surface soil. Therefore, in all - the studied flooded paddy fields, the surface soil requires more attention with regard to NO2 leaching. Unlike AOA and AOB, approximately 50% to 90% of the CH4 in the soil surface and the rhizosphere is oxidized by MOB prior to being emitted into the atmosphere, thus there is a need to pay further attention to their occurrence and distribution in FPFs [6]. Similar to AOA and AOB, MOB occurred in all the studied FPFs and there was no significant difference in their abundance among the sites. However, the potential CH4 oxidation rates across the FPFs indicated that SPB paddy fields had the capacity to increase CH4 oxidation capacity considerably compared to the other FPFs (Figure2). MOB abundance across the FPFs was low compared to AOA and AOB abundance, which suggests that although MOB might contribute significantly to the nitrification process in all the three FPFs, their specific nitrification rates could be much lower than the AOA and AOB nitrification rates [5].

5.2. Community Structure of AOA, AOB, and MOB at Different Soil Depth among the FPFs The results of the phylogenetic analysis in the present study revealed that the members of three archaea genera, including Nitrososphaera, , and Nitrosotalea were enriched in the three FPFs. Members of bacterial genus Nitrosomonas were the most dominant NH3 oxidizers in all the soils. In addition, genus Nitrososphaera was among the most abundant NH3 oxidizers in the HC and the SPB surface soil. Members of genus Nitrosotalea were highly enriched in the JD subsurface and bottom soil layers, while members of Nitrosopumilus were only dominant in the JD subsurface and bottom soil layers, and Nitrososphaera were still dominant in the surface layer. The results indicated that different NH3 oxidizers occupied different environmental niches in the FPFs. Several factors, including substrate concentration, pH, temperature and O2 have been reported to influence the structural composition of NH3 oxidizers in different ecosystems [36,37]. However, the distinction in the community structure across the FPFs in the present study could not be attributed solely to the environmental drivers because there were no significant differences in either temperature or pH among the FPFs. Sustainability 2020, 12, 953 21 of 24

In the present study, MOB pmoA distribution in the FPFs varied considerably; however, community distribution increased with an increase in the soil layer depth. Type I MOB were enriched in the surface and subsurface layers, although Type II MOB were enriched in the bottom layer. The results indicated that type I MOB abundance was higher than type II MOB, which was consistent with the findings of Steenbergh et al. (2010) [38], who proposed different strategies for type I and type II methanotroph. It has been reported that Type I MOB preferentially grow at high O2 and low CH4 concentration environments, while Type II MOB preferentially grow at low O2 and high CH4 concentration environments [39]. Therefore, Type I and II MOB occupy different niches [40]. The results also demonstrated the uniqueness of each soil environment and the effects of ecological factors on MOB at the species level. The MOB communities in the FPFs were relatively stable. The Type I MOB belong to the Methylococcaceae type I methanotroph genera (Type I a) and the genus Methylocaldum (Type I b), while Type II MOB are the genus Methylocystis. The results are consistent with the findings of a previous study that suggested that the major contributor to CH4 oxidation in the atmosphere is type II MOB, particularly Methylocystis sp [41]. Plant cultivation, moisture content and temperature also influence MOB diversity [42]. In addition, soil moisture could influence soil CH4 absorption [43]. In the present study, the application of fertilizer in paddy fields enhanced CH4 oxidation. The inorganic N concentration in the soil influenced MOB activity. The MOB CH4 oxidation activity is near zero + - when N in the soil are exhausted, with three potential mechanisms: (1) NH4 - or NO2 -nitrogen increase the activity of CH4 oxidizing microorganisms; (2) N participates in the synthesis of involved in CH4 oxidation; and (3) an increase in nitrification bacteria diversity and activity could enhance CH4 oxidation [44,45]. Nevertheless, the specific mechanism of action requires further study.

6. Conclusions This study highlighted that AOA abundance was higher than AOB and MOB abundance in all the FPFs, which was consistent with the potential nitrification rates (PNRs), particularly in the SPB and JD sites. Three AOA genera (Nitrososphaera, Nitrosopumilus, Nitrosotalea) were observed in all the FPFs, and Nitrososphaera were dominant in the surface layers. In addition, Nitrososphaera were among the most abundant NH3 oxidizers in the HC and in the SPB surface soil, while members of genus Nitrosotalea were considerably enriched in the JD subsurface and bottom layers. MOB community distribution increased with an increase in the depths of the soil layers, and Type I MOB were enriched in the surface and subsurface layers, while Type II MOB were enriched in the bottom layers. Overall, this study provides a basis for improving soil nitrogen use efficiency and mitigating soil in flooded paddy fields.

Author Contributions: Conceptualization, J.Z. and H.L.; Data curation, O.A.O. and J.L. (Jiabao Li); Formal analysis, J.Z., O.A.O., K.P., Y.M., J.L.(Jianjun Li), J.L.(Jiabao Li) and S.S.; Funding acquisition, H.L.; Methodology, K.P., S.S. and D.G.; Software, X.J., Y.M., J.L.(Jianjun Li) and D.G.; Supervision, H.L.; Writing – original draft, J.Z. and O.A.O.; Writing–review & editing, O.A.O., K.P., X.J., Y.M. and H.L. All authors have read and agreed to the published version of the manuscript. Acknowledgments: This study was financially supported by the National Natural Science Foundation of China (No.41301315), Fundamental Research Funds for the Central Universities (XDJK 2019B072), and the Natural Science Foundation of Chongqing municipality (Cstc2012JJA80024, cstc2019jcyj-msxmX0304). Conflicts of Interest: Authors declare that they have no conflict of interest.

References

1. Song, H.; Che, Z.; Cao, W.; Huang, T.; Wang, J.; Dong, Z. Changing roles of ammonia-oxidizing bacteria and archaea in a continuously acidifying soil caused by over-fertilization with nitrogen. Environ. Sci. Pollut. Res. 2016, 23, 11964–11974. [CrossRef][PubMed] 2. Leininger, S.; Urich, T.; Schloter, M.; Schwark, L.; Qi, J.; Nicol, G.W.; Prosser, J.I.; Schuster, S.C.; Schleper, C. Archaea predominate among ammonia-oxidizing prokaryotes in soils. Nat. 2006, 442, 806–809. [CrossRef] [PubMed] Sustainability 2020, 12, 953 22 of 24

3. Zheng, Y.; Zhang, L.-M.; Zheng, Y.-M.; Di, H.; He, J.-Z. Abundance and community composition of methanotrophs in a Chinese paddy soil under long-term fertilization practices. J. Soils 2008, 8, 406–414. [CrossRef] 4. Qiu, Q.; Noll, M.; Abraham, W.-R.; Lu, Y.; Conrad, R. Applying stable isotope probing of phospholipid fatty and rRNA in a Chinese rice field to study activity and composition of the methanotrophic bacterial communities in situ. ISME J. 2008, 2, 602–614. [CrossRef][PubMed] 5. Yang, Y.; Shan, J.; Zhang, J.; Zhang, X.; Xie, S.; Liu, Y. Ammonia- and methane-oxidizing microorganisms in high-altitude sediments and adjacent agricultural soils. Appl. Microbiol. Biotechnol. 2014, 98, 10197–10209. [CrossRef] 6. Bodelier, P.L.E.; Roslev, P.; Henckel, T.; Frenzel, P. Stimulation by ammonium-based fertilizers of methane oxidation in soil around rice roots. Nat. 2000, 403, 421–424. [CrossRef] 7. Faostat, F. Agricultural Organization of the United Nations. 2010. Available online: faostat.fao.org (accessed on 2 May 2019). 8. Stieglmeier, M.; Kling, A.; Alves, R.J.E.; Rittmann, S.K.M.R.; Melcher, M.; Leisch, N.; Schleper, C. Nitrososphaera viennensisgen. nov., sp. nov., anaerobic and mesophilic, ammonia-oxidizing archae from soil and a member of the archaeal phylum . Int. J. Syst. Evol. Microbiol. 2014, 64, 2738–2752. [CrossRef] 9. Kampschreur, M.J.; Van Der Star, W.R.; Wielders, H.A.; Mulder, J.W.; Jetten, M.S.; Van Loosdrecht, M.C. Dynamics of and nitrous oxide emission during full-scale reject water treatment. Water Res. 2008, 42, 812–826. [CrossRef] 10. Blainey, P.C.; Mosier, A.C.; Potanina, A.; Francis, C.A.; Quake, S.R. Genome of a Low- Ammonia-Oxidizing Archaeon Determined by Single-Cell and Metagenomic Analysis. PLoS ONE 2011, 6, e16626. [CrossRef] 11. Tourna, M.; Freitag, T.E.; Nicol, G.W.; Prosser, J.I. Growth, activity and temperature responses of ammonia-oxidizing archaea and bacteria in soil microcosms. Environ. Microbiol. 2010, 10, 1357–1364. [CrossRef] 12. Zhang, M.-M.; Alves, R.J.; Zhang, D.-D.; Han, L.-L.; He, J.-Z.; Zhang, L.-M. Time-dependent shifts in populations and activity of bacterial and archaeal ammonia oxidizers in response to liming in acidic soils. Soil Boil. Biochem. 2017, 112, 77–89. [CrossRef] 13. Chen, Y.L.; Xu, Z.W.; Hu, H.W.; Hu, Y.J.; Hao, Z.P.; Jiang, Y.; Chen, B.D. Responses of ammonia-oxidizing bacteria and archaea to nitrogen fertilization and increment in a typical temperate steppe in Inner Mongolia [J]. Appl. Soil Ecol. 2013, 68, 36–45. [CrossRef] 14. Yao, H.Y.; Gao, Y.M.; Nicol, G.W.; Campbell, C.D.; Prosser, J.I.; Zhang, L.M.; Han, W.Y.; Singh, B.K. Links between ammonia oxidizer community structure, abundance, and nitrification potential in acidic soils. Appl. Environ. Microbiol. 2001, 77, 4618–4625. [CrossRef][PubMed] 15. Jia, Z.; Conrad, R.; Jia, Z.J.; Conrad, R. Bacteria rather than Archaea dominate microbial ammonia oxidation in an agricultural soil. Environ Microbiol. 2009, 11, 1658–1671. [CrossRef] 16. Zhang, F.-Q.; Pan, W.; Gu, J.-D.; Xu, B.; Zhang, W.-H.; Zhu, B.-Z.; Wang, Y.-X.; Wang, Y.-F. Dominance of ammonia-oxidizing archaea community induced by land use change from Masson pine to eucalypt plantation in subtropical China. Appl. Microbiol. Biotechnol. 2016, 100, 6859–6869. [CrossRef] 17. Lehtovirta-Morley, L.E.; Stoecker, K.; Vilcinskas, A.; Prosser, J.I.; Nicol, G.W. Cultivation of an obligate acidophilic ammonia oxidizer from a nitrifying acid soil [J]. Proc. Natl. Acad. Sci. USA. 2011, 108, 15892–15897. [CrossRef] 18. Ying, J.-Y.; Zhang, L.-M.; He, J.-Z. Putative ammonia-oxidizing bacteria and archaea in an acidic red soil with different land utilization patterns. Environ. Microbiol. Rep. 2010, 2, 304–312. [CrossRef] 19. Zhang, J.; Liu, B.; Zhou, X.; Chu, J.; Li, Y.; Wang, M. Effects of emergent aquatic plants on abundance and community structure of ammonia-oxidising microorganisms. Ecol. Eng. 2015, 81, 504–513. [CrossRef] 20. Shen, J.-P.; Zhang, L.-M.; Zhu, Y.-G.; Zhang, J.-B.; He, J.-Z. Abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea communities of an alkaline sandy loam. Environ. Microbiol. 2008, 10, 1601–1611. [CrossRef] 21. Shen, X.Y.; Zhang, L.M.; Shen, J.P.; Li, L.H.; Yuan, C.L.; He, J.Z. Nitrogen loading levels affect abundance and com-position of soil ammonia oxidizing prokaryotes in semiarid temper-ate grassland. J. Soil . 2011, 11, 1243–1252. [CrossRef] Sustainability 2020, 12, 953 23 of 24

22. Walkey, A.; Black, I.A. An examination of the Different method for determining soil organic matter, and a proposed modification of the chromic acid method. Soil Sci. 1934, 34, 29–38. [CrossRef] 23. U.S. EPA Method Determination of Total Kjeldahl Nitrogen by Semi-Automated Colorimetry; EPA: Cincinnati, Ohio, USA, August 1993; 351, p. 2. 24. Jiang, X.; Hou, X.; Zhou, X.; Xin, X.; Wright, A.; Jia, Z. pH regulates key players of nitrification in paddy soils. Soil Boil. Biochem. 2015, 81, 9–16. [CrossRef] 25. Lü, Z.-M.; Min, H.; Chen, Z.-Y.; Lü, Q. [Contribution of anaerobic oxidation of methane to whole methane oxidation]. Huan jing ke xue= Huanjing kexue 2005, 26, 13–17. [PubMed] 26. Rotthauwe, J.H.; Witzel, K.P.; Liesack, W. The structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microbiol. 1997, 63, 4704–4712. [CrossRef][PubMed] 27. Liebner, S.; Rublack, K.; Stuehrmann, T.; Wagner, D. Diversity of Aerobic Methanotrophic Bacteria in a Soil of the Lena Delta. . Microb Ecol. 2009, 57, 25–35. [CrossRef] 28. Beman, J.M.; Francis, C.A. Diversity of Ammonia-Oxidizing Archaea and Bacteria in the Sediments of a Hypernutrified Subtropical Estuary: Bahía del Tóbari, MexicoO. Appl. Environ. Microbiol. 2006, 72, 7767–7777. [CrossRef] 29. Zhou, X.Q.; Wang, Y.F.; Huang, X.Z.; Tian, J.Q.; Hao, Y.B. Effect of intensities on the activity and community structure of methane-oxidizing bacteria of grassland soil in inner mongolia. Nutr. Cycl. Agroecosys. 2008, 80, 145–152. [CrossRef] 30. Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Mol. Boil. Evol. 2007, 24, 1596–1599. [CrossRef] 31. Isobe, K.; Koba, K.; Suwa, Y.; Ikutani, J.; Fang, Y.; Yoh, M.; Mo, J.; Otsuka, S.; Senoo, K. High abundance of ammonia-oxidizing archaea in acidified subtropical forest soils in southern China after long-term N deposition. FEMS Microbiol. Ecol. 2012, 80, 193–203. [CrossRef] 32. Zhang, L.M.; Hu, H.W.; Shen, J.P.; He, J.Z. Ammonia-oxidizing archaea have more important role than ammonia-oxidizing bacteria in ammonia oxidation of strongly acidic soils. Isme. J. 2012, 6, 1032–1045. [CrossRef] 33. Strauss, S.; Reardon, C.; Mazzola, M. The response of ammonia-oxidizer activity and community structure to fertilizer amendment of orchard soils. Soil Boil. Biochem. 2014, 68, 410–418. [CrossRef] 34. Bannert, A.; Mueller-Niggemann, C.; Kleineidam, K.; Wissing, L.; Cao, Z.-H.; Schwark, L.; Schloter, M. Comparison of lipid biomarker and gene abundance characterizing the archaeal ammonia-oxidizing community in flooded soils. Boil. Fertil. Soils 2011, 47, 839–843. [CrossRef] 35. Liu, Y.; Zhou, Z.; Pan, J.; Baker, B.J.; Gu, J.-D.; Li, M. Comparative genomic inference suggests mixotrophic lifestyle for Thorarchaeota. ISME J. 2018, 12, 1021–1031. [CrossRef][PubMed] 36. Kemmitt, S.J.; Wright, D.; Goulding, K.W.; Jones, D.L. pH regulation of carbon and nitrogen dynamics in two agricultural soils. Soil Boil. Biochem. 2006, 38, 898–911. [CrossRef] 37. Liu, Z.; Xie, H.; Hu, Z.; Zhang, J.; , H.; Lan, W. Role of Ammonia-Oxidizing Archaea in Ammonia Removal of Wetland Under Low-Temperature Condition. Water, Air, Soil Pollut. 2017, 228, 356–365. [CrossRef] 38. Steenbergh, A.K.; Meima, M.M.; Kamst, M.; Bodelier, P.L.Biphasic kinetics of  a methanotrophic community is a combination of growth and increased activity per cell. FEMS Microbiol. Ecol. 2010, 71, 12–22. [CrossRef] 39. Amaral, J.A.; Archambault, C.; Richards, S.R.; Knowles, R. Denitrification associated with groups i and ii methanotrophs in a gradient enrichment system. Fems. Microbiol. Ecology 2010, 18, 289–298. [CrossRef] 40. Abell, G.C.; Stralis-Pavese, N.; Sessitsch, A.; Bodrossy, L. Grazing affects methanotroph activity and diversity in an alpine meadow soil. Environ. Microbiol. Rep. 2010, 1, 457–465. [CrossRef] 41. Auman, A.J.; Stolyar, S.; Costello, A.M.; Lidstrom, M.E. Molecular Characterization of Methanotrophic Isolates from Freshwater Sediment. Appl. Environ. Microbiol. 2000, 66, 5259–5266. [CrossRef] 42. Einola, J.-K.M.; Kettunen, R.H.; Rintala, J.A. Responses of methane oxidation to temperature and water content in cover soil of a boreal landfill. Soil Boil. Biochem. 2007, 39, 1156–1164. [CrossRef] 43. Stiehl-Braun, P.A.; Powlson, D.S.; Poulton, P.R.; Niklaus, P.A. Effects of N fertilizers and liming on the micro-scale distribution of soil methane assimilation in the long-term Park Grass experiment at Rothamsted. Soil Boil. Biochem. 2011, 43, 1034–1041. [CrossRef] Sustainability 2020, 12, 953 24 of 24

44. Eller, G.; Frenzel, P. Changes in Activity and Community Structure of Methane-Oxidizing Bacteria over the Growth Period of Rice. Appl. Environ. Microbiol. 2001, 67, 2395–2403. [CrossRef][PubMed] 45. Krüger, M.; Frenzel, P. Effects of N-fertilisation on CH4 oxidation and production, and consequences for CH4 emissions from microcosms and rice fields. Glob. Chang. Biol. 2010, 9, 773–784. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, . This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).