US 20070O32404A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0032404 A1 Sweet (43) Pub. Date: Feb. 8, 2007
(54) METHODS FOR TREATING DIABETES AND Publication Classification RELATED DSORDERS USING PDE10A INHIBITORS (51) Int. Cl. A6II 38/28 (2006.01) (75) Inventor: Laurel Sweet, Branford, CT (US) A61K 3 1/7034 (2007.01) A 6LX 3/59 (2007.01) Correspondence Address: A6II 3/55 (2006.01) UEFFREY M. GREENMAN A6II 3/426 (2007.01) BAYER PHARMACEUTICALS A 6LX 3L/I 75 (2006.01) CORPORATION (52) U.S. Cl...... 514/3: 514/25; 514/252.16; 400 MORGANLANE 514/262.1; 514/369; 514/592: WEST HAVEN, CT 06516 (US) 514/635 (73) Assignee: Bayer Pharmaceuticals Corporation, West Haven, CT (US) (57) ABSTRACT
(21) Appl. No.: 10/564,680 The methods of the invention relate to the treatment of diabetes, including type 2 diabetes, and related disorders by (22) PCT Filed: Jul. 27, 2004 administration of a PDE10A inhibitor. Such PDE10A inhibi (86). PCT No.: PCT/USO4/24O73 tors may be administered in conjunction with alpha-glucosi dase inhibitors, insulin sensitizers, insulin secretagogues, S 371(c)(1), hepatic glucose output lowering compounds, B-3 agonist, or (2), (4) Date: Jan. 13, 2006 insulin. Such PDE10A inhibitors may also be administered in conjunction with body weight reducing agents. Further Related U.S. Application Data methods of the invention relate to stimulating insulin release from pancreatic cells, for example, in response to an eleva (60) Provisional application No. 60/491,730, filed on Jul. tion in blood glucose concentration, by administration of a 31, 2003. PDE10A inhibitor. US 2007/0032404 A1 Feb. 8, 2007
METHODS FOR TREATING DABETES AND itary adenylate cyclase activating peptide (PACAP), Vaso RELATED DSORDERS USING PDE10A active intestinal polypeptide (VIP), and glucagon-like pep INHIBITORS tide-1 (GLP-1). 0001. This application claims benefit of U.S. Provisional 0008 PACAP is a potent stimulator of glucose-dependent Application Ser. No. 60/491,730, filed on Jul. 31, 2003, the insulin secretion from pancreatic B-cells. Three different contents of which are incorporated herein by reference in PACAP receptor types (R1,R2, and R3) have been described their entirety. (Harmar, et al., Pharmacol. Rev. 50:265-270, 1998). The insulinotropic action of PACAP is mediated by the GTP FIELD OF THE INVENTION binding protein Gs. Accumulation of intracellular cAMP in 0002 The invention relates to methods of treating dia turn activates nonselective cation channels in B-cells betes and related disorders by administering a compound increasing Ca"), and promoting the exocytosis of insulin that inhibits PDE10A. Such PDE10A inhibitors may be containing secretory granules. administered in combination with other pharmaceutical 0009 Vasoactive intestinal peptide (VIP) is a 28 amino agents, for example, anti-diabetic agents or body weight acid peptide that was first isolated from hog upper Small reducing agents. Further methods of the invention relate to intestine (Said and Mutt, Science 169:1217-1218, 1970; stimulating insulin release from pancreatic cells, for U.S. Pat. No. 3,879,371). The biological effects of VIP are example, in response to an elevation in blood glucose mediated by the activation of membrane-bound receptor concentration, by administration of a PDE10A inhibitor. proteins that are coupled to the intracellular cAMP signaling system. BACKGROUND 0010 GLP-1 is released from the intestinal L-cell after a 0003 Diabetes is characterized by impaired glucose meal and functions as an incretin hormone (i.e., it potentiates metabolism manifesting itself among other things by an glucose-induced insulin release from the pancreatic B-cell). elevated blood glucose level in the diabetic patient. Under It is a 37-amino acid peptide that is differentially expressed lying defects lead to a classification of diabetes into two by the glucagon gene, depending upon tissue type. The major groups: type 1 and type 2. Type 1 diabetes, or insulin clinical data that support the beneficial effect of raising dependent diabetes mellitus (IDDM), arises when patients cAMP levels in B-cells have been demonstrated with GLP-1. lack insulin-producing B-cells in their pancreatic glands. Infusions of GLP-1 in poorly controlled type 2 diabetics Type 2 diabetes, or non-insulin dependent diabetes mellitus normalized their fasting blood glucose levels (Gutniak, et (NIDDM), occurs in patients with impaired B-cell function al., New Eng.J. Med. 326:13.16-1322, 1992) and with longer and alterations in insulin action. infusions improved the B-cell function as compared to 0004 The current treatment for type 1 diabetic patients is normal subjects (Rachman, et al., Diabetes 45:1524-1530, the injection of insulin, while the majority of type 2 diabetic 1996). A recent report has shown that GLP-1 improves the patients are treated with agents that stimulate B-cell function ability of B-cells to respond to glucose in subjects with or with agents that enhance the tissue sensitivity of the impaired glucose tolerance (Byrne, et al., Diabetes 47: 1259 patients towards insulin. The drugs presently used to treat 1265, 1998). type 2 diabetes include alpha-glucosidase inhibitors, insulin 0011 The use of such endogenous secretagogues to treat sensitizers, insulin secretagogues, metformin, and insulin. type 2 diabetes also has some drawbacks. For instance, the 0005 Over time, more than one-third of all type 2 dia peptidyl nature of these compounds requires that they be betic Subjects lose their response to oral agents. Insulin administered by injection. Additionally, the effects of the treatment is instituted after diet, exercise, and oral medica endogenous secretagogues are short-lived because of the tions have failed to adequately control blood glucose. The short half-life of the peptides. drawbacks of insulin treatment include, for example, the 0012 Because of the problems with current treatments, need for drug injection, the potential for hypoglycemia, and new therapies to treat type 2 diabetes are needed. In par Weight gain. ticular, new treatments to maintain normal (glucose-depen 0006 Another strategy for diabetes therapy is based on dent) insulin secretion are needed. Such new drugs should the cyclic adenosine monophosphate (cAMP) signaling have the following characteristics: 1) dependency on glu mechanism and its effects on insulin secretion. Metabolism cose for promoting insulin secretion, that is, compounds that of glucose promotes the closure of ATP-dependent K' stimulate insulin secretion only in the presence of elevated channels, which leads to cell depolarization and Subsequent blood glucose and therefore, low probability for hypogly opening of Ca' channels. This in turn results in the exo cemia; 2) low primary and secondary failure rates; and 3) cytosis of insulin granules. cAMP is a major regulator of preservation of islet cell function. glucose-stimulated insulin secretion. The effect of cAMP is, 0013 The present invention provides a novel treatment however, glucose-dependent, that is, cAMP has little if any for diabetes and related disorders by focusing on regulation effects on insulin secretion at low glucose concentrations of the cAMP signaling system by inhibition of phosphodi (Weinhaus, et al., Diabetes 47: 1426-1435, 1998). The effects esterase 10A PDE10A). Phosphodiesterases (PDEs) are a of cAMP on insulin secretion are thought to be mediated by family of cAMP and/or cGMP-hydrolyzing enzymes that a protein kinase A pathway. cleave 3',5'-cyclic nucleotide monophosphates to 5'-nucle 0007 Endogenous secretagogues utilize the cAMP sys otide monophosphates. PDEs are known to be involved in tem to regulate insulin secretion in a glucose-dependent the regulation of the cAMP system. Specifically, PDE10A is fashion (Komatsu, et al., Diabetes 46:1928-1938, 1997). a phosphodiesterase that hydrolyses cAMP and coMP with Examples of Such endogenous secretagogues include pitu K values of approximately 0.05-14 uM Fujishige, et al., J. US 2007/0032404 A1 Feb. 8, 2007
Biol. Chem. 274 (26): 18438-18445, 1999; Soderling, et al., other aspects of the invention will be more apparent from the PNAS 96:7071-7076, 1999; Loughney, et al., Gene 234:109 following description and claims. 117, 1999). At least three splice variants of PDE10A have been described that are identical in their C-terminal catalytic DETAILED DESCRIPTION OF THE domains, but differ in the size of the N-terminal portion of INVENTION the molecule (Kotera, et al., Biochem. Biophy. Res. Comm. 261:551-557, 1999: Fujishige, et al., Eur. J. Biochem. 0.019 Methods of the invention provide for the treatment 267:5943-5951, 2000). of diabetes and related disorders, particularly type 2 diabe tes, and/or stimulation of insulin release from pancreatic 0014) Thus, by inhibiting PDE10A activity, intracellular cells, by the administration of a PDE10A inhibitor. Such levels of cAMP are increased thereby increasing the release methods provide for treatment of any condition in which of insulin-containing secretory granules and therefore, glucose is elevated in the fasting or post-prandial state, by increasing insulin secretion. The present invention, there administration of a PDE10A inhibitor. PDE10A has been fore, provides a novel treatment for diabetes and related identified in islets of Langerhans. PDE10A hydrolyses disorders, that is, the administration of a PDE10A inhibitor. cAMP to AMP and thereby decreases intracellular concen trations of cAMP. By inhibiting PDE10A activity, intracel SUMMARY OF THE INVENTION lular levels of cAMP are increased, thereby increasing the 0.015 The present invention relates to methods of treating release of insulin-containing secretory granules and there diabetes, including type 2 diabetes, in a mammal by admin fore, increasing insulin secretion. Also as described herein, istering an effective amount of a PDE10A inhibitor. Other a PDE10A inhibitor may be administered for the treatment methods of the invention relate to treatment of other disor of dementia, cardiovascular disease, or urogenital tract dis ders related to diabetes, such as Syndrome X, impaired orders. glucose tolerance, and impaired fasting glucose, by admin Methods of Treatment istering a PDE10A inhibitor. In addition, the present inven tion relates to methods of treating type 1 diabetes, gesta 0020. As used herein, various terms are defined below. tional diabetes, maturity-onset diabetes of the young 0021 When introducing elements of the present inven (MODY), latent autoimmune diabetes adult (LADA), and tion or the preferred embodiment(s) thereof, the articles associated diabetic dyslipidemia and other diabetic compli “a,'an,”“the, and “said are intended to mean that there cations, as well as hyperglycemia, hyperinsulinemia, dys are one or more of the elements. The terms "comprising, lipidemia, hypertriglyceridemia, and insulin resistance. *including,” and “having” are intended to be inclusive and 0016. The invention further relates to methods of stimu mean that there may be additional elements other than the lating insulin release from pancreatic cells in a mammal by listed elements. administering an effective amount of a PDE10A inhibitor. 0022. The term “subject' as used herein includes mam This method of insulin release may be in response to an mals (e.g., humans and animals). elevation of the concentration of glucose in the blood of a mammal. In methods of the invention, the PDE10A inhibitor 0023 The term “treatment includes any process, action, may also be administered in conjunction with other diabetes application, therapy, or the like, wherein a subject, including therapies, such as alpha-glucosidase inhibitors (e.g., acar a human being, is provided medical aid with the object of bose), insulin sensitizers (e.g., thiazolidinediones), com improving the Subjects condition, directly or indirectly, or pounds that reduce hepatic glucose output (e.g., metformin), slowing the progression of a condition or disorder in the insulin secretagogues (e.g., Sulfonylureas), B-3 agonists, and Subject. insulin. Furthermore, the PDE10A inhibitor may be admin 0024. The term “combination therapy’ or “co-therapy' istered in conjunction with one or more weight reduction means the administration of two or more therapeutic agents agents, such as Xenical, Meridia, B-3 agonists, or a CB-1 to treat a diabetic condition and/or disorder. Such adminis antagonist. Finally, in another embodiment, methods of the tration encompasses co-administration of two or more thera invention provide for the administration of a PDE10A peutic agents in a Substantially simultaneous manner, Such inhibitor in combination with an HMG-CoA reductase as in a single capsule having a fixed ratio of active ingre inhibitor, nicotinic acid, a bile acid sequestrant, a fibric acid dients or in multiple, separate capsules for each inhibitor derivative, or an antihypertensive drug. agent. In addition, such administration encompasses use of 0017. In another aspect of the invention, a PDE10A each type of therapeutic agent in a sequential manner. inhibitor may be administered for the treatment of dementia 0.025 The phrase “therapeutically effective” means the or a urogenital tract disorder. Urogenital tract disorders amount of each agent administered that will achieve the goal include, but are not limited to, incontinence, stress inconti of improvement in a diabetic condition or disorder severity, nence, benign prostatic hyperplasia, erectile dysfunction, while avoiding or minimizing adverse side effects associated female sexual dysfunction, and hypertrophy of prostate. In with the given therapeutic treatment. further aspect of the invention, a PDE10A inhibitor may be administered for the treatment of a cardiovascular disorder, 0026. The term “pharmaceutically acceptable” means Such as hypertension, ischemic heart disease, myocardial that the Subject item is appropriate for use in a pharmaceu infarction, stable and unstable angina, peripheral occlusive tical product. disease, and ischemic stroke. 0027 Methods of the invention may be used to treat 0018. The present invention, therefore, provides methods diseases, such as diabetes, including both type 1 and type 2 for the treatment of diabetes by inhibition of PDE10A diabetes. Such methods may also delay the onset of diabetes through the administration of a PDE10A inhibitor. These and and diabetic complications. Other diseases and conditions US 2007/0032404 A1 Feb. 8, 2007 that may be treated or prevented using methods of the inhibitors. Hepatic glucose output lowering compounds that invention include: Maturity-Onset Diabetes of the Young may be useful in treating diabetes when administered with a (MODY) (Herman, et al., Diabetes 43:40, 1994), Latent compound of the invention include, for example, glucagon Autoimmune Diabetes Adult (LADA) (Zimmet, et al., Dia anatgonists and metformin, Such as Glucophage and Glu betes Med. 11:299, 1994), impaired glucose tolerance (IGT) cophage XR. Insulin secretagogues that may be useful in (Expert Committee on Classification of Diabetes Mellitus, treating diabetes when administered with a compound of the Diabetes Care 22 (Supp. 1): S5, 1999), impaired fasting invention include Sulfonylurea and non-sulfonylurea drugs: glucose (IFG) (Charles, et al., Diabetes 40:796, 1991), GLP-1, GIP PACAP, secretin, and derivatives thereof; gestational diabetes (Metzger, Diabetes, 40: 197, 1991), and nateglinide, meglitinide, repaglinide, glibenclamide, glime metabolic Syndrome X. piride, chlorpropamide, and glipizide. For example, GLP-1 includes derivatives of GLP-1 with longer half-lives than 0028 Methods of the invention may also be used to treat native GLP-1, such as, for example, fatty-acid derivatized secondary causes of diabetes (Expert Committee on Classi GLP-1 and exendin. fication of Diabetes Mellitus, Diabetes Care 22 (Supp. 1):S5, 1999). Such secondary causes include glucocorticoid 0032 A PDE10A inhibitor may also be administered in excess, growth hormone excess, pheochromocytoma, and combination with anti-obesity drugs. Anti-obesity drugs drug-induced diabetes. Drugs that may induce diabetes include B-3 agonists; CB-1 antagonists; neuropeptide Y5 include, but are not limited to, pyriminil, nicotinic acid, inhibitors; Ciliary Neurotrophic Factor and derivatives (e.g., glucocorticoids, phenytoin, thyroid hormone, B-adrenergic AXokine); appetite Suppressants, such as, for example, agents, C.-interferon, and drugs used to treat HIV infection. sibutramine (Meridia); and lipase inhibitors, such as, for example, orlistat (Xenical). 0029 cAMP-mediated release of insulin is also depen dent on the presence of stimulatory glucose concentrations. 0033. In addition, a PDE10A inhibitor may also be A method of the invention further relates to stimulating administered in combination with drugs commonly used to insulin release from islet cells by the administration of a treat lipid disorders in diabetic patients. Such drugs include, PDE10A inhibitor. Glucose-dependent stimulation of insulin but are not limited to, HMG-CoA reductase inhibitors, secretion with non-peptide compounds therefore, lowers nicotinic acid, fatty acid lowering compounds (e.g., acipi blood glucose concentrations without causing hypoglyce moX); lipid lowering drugs (e.g., stanol esters, Sterol glyco 18. sides Such as tiqueside, and aZetidinones such as eZetimibe). ACAT inhibitors (such as avasimibe), bile acid sequestrants, 0030 The methods of the present invention may be used bile acid reuptake inhibitors, microsomal triglyceride trans alone or in combination with additional therapies and/or port inhibitors, and fibric acid derivatives. HMG-CoA reduc compounds known to those skilled in the art in the treatment tase inhibitors include, for example, lovastatin, simvastatin, of diabetes and related disorders. Alternatively, a PDE10A pravastatin, fluvastatin, atorvastatin, rivastatin, itavastatin, inhibitor may be used partially or completely, in combina cerivastatin, and ZD-4522. Fibric acid derivatives include, tion therapy. for example, clofibrate, fenofibrate, bezafibrate, ciprofibrate, 0031) For example, a PDE10A inhibitor may be admin beclofibrate, etofibrate, and gemfibrozil. Sequestrants istered in combination with other known therapies for the include, for example, cholestyramine, colestipol, and dialky treatment of diabetes, including PPAR ligands (e.g., ago laminoalkyl derivatives of a cross-linked dextran. nists, antagonists), insulin secretagogues, for example, Sul 0034) Furthermore, a PDE10A inhibitor may also be fonylurea drugs and non-sulfonylurea secretagogues, C-glu administered combination with anti-hypertensive drugs, cosidase inhibitors, insulin sensitizers, hepatic glucose such as, for example, B-blockers and ACE inhibitors. output lowering compounds, insulin and insulin derivatives, Examples of additional anti-hypertensive agents for use in and anti-obesity drugs. Such therapies may be administered combination with the compounds of the present invention prior to, concurrently with, or following administration of include calcium channel blockers (L-type and T-type; e.g., the compounds of the invention. Insulin and insulin deriva diltiazem, Verapamil, nifedipine, amlodipine and mybe tives include both long and short acting forms and formu fradil), diuretics (e.g., chlorothiazide, hydrochlorothiazide, lations of insulin. PPAR ligands may include agonists and/or flumethiazide, hydroflumethiazide, bendroflumethiazide, antagonists of any of the PPAR receptors or combinations methylchlorothiazide, trichloromethiazide, polythiazide, thereof. For example, PPAR ligands may include ligands of benzthiazide, ethacrynic acid tricrynafen, chlorthalidone, PPAR-C, PPAR-Y, PPAR-8 or any combination of two or furosemide, musolimine, bumetanide, triamtrenene, three of the receptors of PPAR. PPAR ligands include, for amiloride, spironolactone), renin inhibitors, ACE inhibitors example, rosiglitaZone, troglitaZone, and pioglitaZone. Sul (e.g., captopril, Zofenopril, fosinopril, enalapril, ceranopril, fonylurea drugs include, for example, glyburide, glime cilaZopril, delapril, pentopril, quinapril, ramipril, lisinopril), piride, chlorpropamide, tolbutamide, and glipizide. C-glu AT-1 receptor antagonists (e.g., losartan, irbesartan, Valsar cosidase inhibitors that may be useful in treating diabetes tan), ET receptor antagonists (e.g., sitaxsentan, atrsentan, when administered with a compound of the invention neutral endopeptidase (NEP) inhibitors, vasopepsidase include acarbose, miglitol, and Voglibose. Insulin sensitizers inhibitors (dual NEP-ACE inhibitors) (e.g., omapatrilat and that may be useful in treating diabetes include PPAR-y agonists such as the glitaZones (e.g., troglitaZone, pioglita gemopatrilat), and nitrates. Zone, englitazone, MCC-555, rosiglitazone, and the like) 0035) Such co-therapies may be administered in any and other thiazolidinedione and non-thiazolidinedione com combination of two or more drugs (e.g., a PDE10A inhibitor pounds; biguanides such as metformin and phenformin; in combination with an insulin sensitizer and an anti-obesity protein tyrosine phosphatase-1B (PTP-1B) inhibitors; dipep drug). Such co-therapies may be administered in the form of tidyl peptidase IV (DPP-IV) inhibitors; and 11 beta-HSD pharmaceutical compositions, as described below. US 2007/0032404 A1 Feb. 8, 2007
0036). Other methods of the invention relate to adminis active Substances can also be present, including other com tration of a PDE10A inhibitor for the treatment of dementia pounds useful in the treatment of a diabetic condition. (Shimamoto, et al., Mech. Aging Dev. 5(4):241-250, 1976: 0041) PDE10A inhibitor(s) for use in methods of the Nicholson, et al., Trend Pharmacol. Sci. 12(1):19-27, 1991). present invention may be administered by any Suitable route, 0037 Still further methods of the invention relate to preferably in the form of a pharmaceutical composition treatment of urogenital tract disorders by the administration adapted to such a route, and in a therapeutically effective of a PDE10A inhibitor. Such urogenital tract disorders dose for the treatment intended. The PDE10A inhibitor(s) include, but are not limited to, incontinence, stress inconti may, for example, be administered orally, Sublingually, nence, benign prostatic hyperplasia, erectile dysfunction, nasally, pulmonary, mucosally, parenterally, intravascularly, female sexual dysfunction (including female sexual arousal intraperitoneally, Subcutaneously, intramuscularly or topi disorder), and hypertrophy of prostate (Ballard, et al., J. cally. Unit dose formulations, particularly orally adminis Urol. 159(6):2164-2171, 1998). trable unit dose formulations such as tablets or capsules, 0038. Other methods of the invention relate to adminis generally contain, for example, from about 0.001 to about tration of a PDE10A inhibitor to treat cardiovascular disor 500 mg, preferably from about 0.005 mg to about 100 mg. ders, such as hypertension, ischemic heart disease, myocar and more preferably from about 0.01 to about 50 mg. of the dial infarction, stable and unstable angina, peripheral active ingredient. In the case of pharmaceutically acceptable occlusive disease, and ischemic stroke. Expression of salts, the weights indicated above for the active ingredient PDE10 can be detected in the heart (Loughney, et al., Gene refer to the weight of the pharmaceutically active ion 234:109-117, 1999: Kotera, et al., Biochem. Biophy. Res. derived from the salt. Comm. 261:551-557, 1999), and coMP and cAMP are 0042. Of course, the specific initial and continuing dos important second messengers that are involved in the regu age regimen to prevent, treat, give relief from, or ameliorate lation of vascular smooth muscle tone. The PDE10 family a diabetic condition or disorder, or to otherwise protect comprises enzymes that are responsible for the degradation against or treat a diabetic condition for each patient will vary of cAMP and coMP in various tissues (Fujishige, et al., J. according to the nature and severity of the condition as Biol. Chem. 274(26): 18438-18445, 1999). The activation of determined by the attending diagnostician, the activity of the soluble and membrane bound guanylate cyclases leads to specific PDE10A inhibitor employed, the age of the patient, increased intracellular cGMP levels and induces vasodila the diet of the patient, time of administration, route of tion. The stimulation of various G protein-coupled receptors administration, rate of excretion of the drug, drug combi (GPCRs) which are expressed in vascular smooth muscle nations, pharmacological considerations such as the activity, cells (e.g., adrenomedulin and CGRP receptors) induces the efficacy, pharmacokinetics and toxicology profiles of the activation of adenylate cyclases, generation of intracellular particular PDE10A inhibitor employed, whether a drug cAMP, and produces vasodilation. 3',5'-cyclic nucleotide delivery system is utilized, and whether the PDE10A inhibi phosphodiesterases (PDEs) catalyze the hydrolysis of 3',5'- tor is administered with other active ingredients, and the cyclic nucleotides to their respective nucleoside 5'-mono like. The desired mode of treatment and number of doses of phosphates. Thus, PDE10A likely plays a role in the car a PDE10A inhibitor may be ascertained by those skilled in diovascular system. the art using conventional treatment tests. Pharmaceutical Compositions 0043. The PDE10A inhibitor(s) may be utilized to 0.039 Based on well known assays used to determine the achieve the desired pharmacological effect by administra efficacy for treatment of conditions identified above in tion to a patient in need thereof in an appropriately formu mammals, and by comparison of these results with the lated pharmaceutical composition. A patient, for the purpose results of known medicaments that are used to treat these of this invention, is a mammal, including a human, in need conditions, the effective dosage of PDE10 inhibitor(s) can of treatment for a particular condition or disease. Therefore, readily be determined for treatment of each desired indica the present invention includes pharmaceutical compositions tion. The amount of the active ingredient (e.g., PDE10 which are comprised of a pharmaceutically acceptable car inhibitor) to be administered in the treatment of one of these rier and a therapeutically effective amount of the PDE10A conditions can vary widely according to Such considerations inhibitor(s). A pharmaceutically acceptable carrier is any as the particular compound and dosage unit employed, the carrier which is relatively non-toxic and innocuous to a mode of administration, the period of treatment, the age and patient at concentrations consistent with effective activity of sex of the patient treated, and the nature and extent of the the active ingredient so that any side effects ascribable to the condition treated. carrier do not vitiate the beneficial effects of the active ingredient. The PDE10A inhibitor(s) may be administered 0040 PDE10A inhibitor(s) for use in methods of the with a pharmaceutically-acceptable carrier using any effec invention may be administered as compound per se. Alter tive conventional dosage unit forms, including, for example, natively, PDE10A inhibitor(s) may be administered with an immediate and timed release preparations, orally, parenter acceptable carrier in the form of a pharmaceutical compo ally, topically, or the like. sition. The pharmaceutically acceptable carrier must be compatible with the other ingredients of the composition and 0044) For oral administration, the PDE10A inhibitor(s) must not be intolerably deleterious to the recipient. The may be formulated into Solid or liquid preparations such as, carrier can be a solid or a liquid, or both, and preferably is for example, capsules, pills, tablets, troches, lozenges, melts, formulated with the compound as a unit-dose composition, powders, solutions, pastes, syrups, Suspensions, or emul for example, a tablet, which can contain from about 0.05% sions, and may be prepared according to methods known to to about 95% by weight of the active compound(s) based on the art for the manufacture of pharmaceutical compositions. a total weight of the dosage form. Other pharmacologically The solid unit dosage forms may be a capsule which can be US 2007/0032404 A1 Feb. 8, 2007 of the ordinary hard- or soft-shelled gelatin type containing, 0050 Oral delivery of the PDE10A inhibitor(s) can for example, Surfactants, lubricants, and inert fillers such as include formulations well known in the art to provide lactose, Sucrose, calcium phosphate, and corn starch. The immediate delivery or prolonged or Sustained delivery of a pharmaceutical composition is preferably made in the form drug to the gastrointestinal tract by any number of mecha of a dosage unit containing a particular amount of the active nisms. Immediate delivery formulations include, but are not ingredient. limited to, oral Solutions, oral Suspensions, fast-dissolving 0045. The PDE10A inhibitor(s) may be tableted with tablets or capsules, Sublingual tablets, disintegrating tablets conventional tablet bases Such as lactose, Sucrose, and and the like. Prolonged or sustained delivery formulations cornstarch in combination with binders such as acacia, include, but are not limited to, pH sensitive release of the cornstarch, or gelatin; disintegrating agents intended to active ingredient from the dosage form based on the chang assist the break-up and dissolution of the tablet following ing pH of the small intestine, slow erosion of a tablet or administration Such as potato starch, alginic acid, corn capsule, retention in the stomach based on the physical starch, and guar gum, lubricants intended to improve the properties of the formulation, bioadhesion of the dosage flow of tablet granulation and to prevent the adhesion of form to the mucosal lining of the intestinal tract, or enzy tablet material to the surfaces of the tablet dies and punches, matic release of the active drug from the dosage form. The for example, talc, Stearic acid, or magnesium, calcium or intended effect is to extend the time period over which an Zinc Stearate; dyes; coloring agents; and flavoring agents active drug molecule is delivered to the site of action by intended to enhance the aesthetic qualities of the tablets and manipulation of the dosage form. Thus, enteric-coated and make them more acceptable to the patient. Suitable excipi enteric-coated controlled release formulations may be used ents for use in oral liquid dosage forms include diluents such in methods of the present invention. Suitable enteric coat as water and alcohols, for example, ethanol, benzyl alcohol, ings include cellulose acetate phthalate, polyvinylacetate and polyethylene alcohols, either with or without the addi phthalate, hydroxypropylmethyl-cellulose phthalate and tion of a pharmaceutically acceptable Surfactant, Suspending anionic polymers of methacrylic acid and methacrylic acid agent, or emulsifying agent. Various other materials may be methyl ester. present as coatings or to otherwise modify the physical form 0051 Pharmaceutical compositions can be prepared by of the dosage unit. For instance tablets, pills or capsules may any suitable method of pharmacy, which includes the step of be coated with shellac, sugar or both. bringing into association, the PDE10A inhibitor(s) and the 0046 Dispersible powders and granules are suitable for carrier (which can constitute one or more accessory ingre the preparation of an aqueous Suspension. They provide the dients). In general, the compositions are prepared by uni active ingredient in admixture with a dispersing or wetting formly and intimately admixing the PDE10A inhibitor(s) agent, a suspending agent, and one or more preservatives. with a liquid or finely divided solid carrier, or both, and then, Suitable dispersing or wetting agents and Suspending agents if necessary, shaping the product. For example, a tablet can are exemplified by those already mentioned above. Addi be prepared by compressing or molding a powder or gran tional excipients, for example, those Sweetening, flavoring ules of the inhibitors, optionally with one or more accessory and coloring agents described above, may also be present. ingredients. Compressed tablets can be prepared by com pressing, in a suitable machine, the compound in a free 0047 The pharmaceutical compositions of this invention flowing form, Such as a powder or granules optionally mixed may also be in the form of oil-in-water emulsions. The oily with a binder, lubricant, inert diluent and/or surface active/ phase may be a vegetable oil Such as liquid paraffin or a dispersing agent(s). Molded tablets can be made, for mixture of vegetable oils. Suitable emulsifying agents may example, by molding the powdered compound in a Suitable be (1) naturally occurring gums such as gum acacia and gum machine. tragacanth, (2) naturally occurring phosphatides such as Soy bean and lecithin, (3) esters or partial esters derived from 0052 Liquid dosage forms for oral administration can fatty acids and hexitol anhydrides, for example, Sorbitan include pharmaceutically acceptable emulsions, Solutions, monooleate, and (4) condensation products of said partial Suspensions, syrups, and elixirs containing inert diluents esters with ethylene oxide, for example, polyoxyethylene commonly used in the art, such as water. Such compositions Sorbitan monooleate. The emulsions may also contain may also comprise adjuvants, such as wetting agents, emul Sweetening and flavoring agents. Sifying and Suspending agents, and Sweetening, flavoring, and perfuming agents. 0.048 Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, 0053 Pharmaceutical compositions suitable for buccal arachis oil, olive oil, Sesame oil, or coconut oil; or in a (Sub-lingual) administration include lozenges comprising a mineral oil such as liquid paraffin. The oily Suspensions may PDE10A inhibitor in a flavored base, usually sucrose, and contain a thickening agent Such as, for example, beeswax, acacia or tragacanth, and pastilles comprising the inhibitors hard paraffin, or cetyl alcohol. The Suspensions may also in an inert base such as gelatin and glycerin or Sucrose and contain one or more preservatives, for example, ethyl or acacia. n-propyl p-hydroxybenzoate; one or more coloring agents; 0054) The PDE10A inhibitor(s) may also be administered one or more flavoring agents; and one or more Sweetening parenterally, that is, Subcutaneously, intravenously, intra agents such as Sucrose or saccharin. muscularly, or interperitoneally, as injectable dosages of the 0049 Syrups and elixirs may be formulated with Sweet compound in a physiologically acceptable diluent with a ening agents such as, for example, glycerol, propylene pharmaceutical carrier which may be a sterile liquid or glycol, Sorbitol, or Sucrose. Such formulations may also mixture of liquids such as water, saline, aqueous dextrose contain a demulcent, and preservative, flavoring and color and related Sugar Solutions; an alcohol Such as ethanol, ing agents. isopropanol, or hexadecyl alcohol; glycols such as propy US 2007/0032404 A1 Feb. 8, 2007
lene glycol or polyethylene glycol, glycerol ketals such as with a partial ester derived from a fatty acid and a hexitol 2,2-dimethyl-1,1-dioxolane-4-methanol, ethers such as anhydride, for example polyoxyethylene Sorbitan poly(ethyleneglycol) 400; an oil; a fatty acid; a fatty acid monooleate. ester or glyceride; or an acetylated fatty acid glyceride with 0059. The sterile injectable preparation may also be a or without the addition of a pharmaceutically acceptable sterile injectable solution or Suspension in a non-toxic Surfactant such as a Soap or a detergent, Suspending agent parenterally acceptable diluent or solvent. Diluents and Such as pectin, carbomers, methycellulose, hydroxypropyl Solvents that may be employed are, for example, water, methylcellulose, or carboxymethylcellulose, or emulsifying Ringer's solution, and isotonic sodium chloride Solution. In agent and other pharmaceutical adjuvants. addition, sterile fixed oils are conventionally employed as Solvents or Suspending media. For this purpose, any bland, 0055 Illustrative of oils which can be used in the fixed oil may be employed including synthetic mono or parenteral formulations of this invention are those of petro diglycerides. In addition, fatty acids such as oleic acid may leum, animal, vegetable, or synthetic origin, for example, be used in the preparation of injectables. peanut oil, soybean oil, sesame oil, cottonseed oil, corn oil, 0060 A composition of the invention may also be admin olive oil, petrolatum, and mineral oil. Suitable fatty acids istered in the form of suppositories for rectal administration include oleic acid, Stearic acid, and isostearic acid. Suitable of the drug. These compositions may be prepared by mixing fatty acid esters are, for example, ethyl oleate and isopropyl the drug (e.g., PDE10A inhibitor) with a suitable non myristate. Suitable soaps include fatty alkali metal, ammo irritation excipient which is solid at ordinary temperatures nium, and triethanolamine salts and Suitable detergents but liquid at the rectal temperature and will therefore melt in include cationic detergents, for example, dimethyl dialkyl the rectum to release the drug. Such material are, for ammonium halides, alkyl pyridinium halides, and alky example, cocoa butter and polyethylene glycol. lamine acetates; anionic detergents, for example, alkyl, aryl, and olefin Sulfonates, alkyl, olefin, ether, and monoglyceride 0061 Another formulation employed in the methods of Sulfates, and SulfoSuccinates; nonionic detergents, for the present invention employs transdermal delivery devices example, fatty amine oxides, fatty acid alkanolamides, and (“patches'). Such transdermal patches may be used to pro polyoxyethylenepolypropylene copolymers; and amphoteric vide continuous or discontinuous infusion of the compounds detergents, for example, alkyl-beta-aminopropionates, and of the present invention in controlled amounts. The con 2-alkylimidazoline quarternary ammonium salts, as well as struction and use of transdermal patches for the delivery of mixtures. pharmaceutical agents is well known in the art (see, e.g., U.S. Pat. No. 5,023,252, incorporated herein by reference). 0056. The parenteral compositions of this invention may Such patches may be constructed for continuous, pulsatile, typically contain from about 0.5% to about 25% by weight or on demand delivery of pharmaceutical agents. of the active ingredient in solution. Preservatives and buffers 0062. It may be desirable or necessary to introduce the may also be used advantageously. In order to minimize or pharmaceutical composition to the patient via a mechanical eliminate irritation at the site of injection, such compositions delivery device. The construction and use of mechanical may contain a non-ionic Surfactant having a hydrophile delivery devices for the delivery of pharmaceutical agents is lipophile balance (HLB) of from about 12 to about 17. The well known in the art. For example, direct techniques for quantity of Surfactant in Such formulation ranges from about administering a drug directly to the brain usually involve 5% to about 15% by weight. The surfactant can be a single placement of a drug delivery catheter into the patients component having the above HLB or can be a mixture of ventricular system to bypass the blood-brain barrier. One two or more components having the desired HLB. such implantable delivery system, used for the transport of 0057 Illustrative of surfactants used in parenteral formu agents to specific anatomical regions of the body, is lations are the class of polyethylene sorbitan fatty acid described in U.S. Pat. No. 5,011,472, incorporated herein by esters, for example, Sorbitan monooleate and the high reference. molecular weight adducts of ethylene oxide with a hydro 0063. The compositions of the invention may also con phobic base, formed by the condensation of propylene oxide tain other conventional pharmaceutically acceptable com with propylene glycol. pounding ingredients, generally referred to as carriers or diluents, as necessary or desired. Any of the compositions of 0.058. The pharmaceutical compositions may be in the this invention may be preserved by the addition of an form of sterile injectable aqueous Suspensions. Such sus antioxidant Such as ascorbic acid or by other Suitable pre pensions may be formulated according to known methods servatives. Conventional procedures for preparing Such using Suitable dispersing or wetting agents and Suspending compositions in appropriate dosage forms can be utilized. agents such as, for example, Sodium carboxymethylcellu lose, methylcellulose, hydroxypropylmethyl-cellulose, 0064 Commonly used pharmaceutical ingredients which Sodium alginate, polyvinylpyrrolidone, gum tragacanth and may be used as appropriate to formulate the composition for gum acacia; dispersing or wetting agents which may be a its intended route of administration include: acidifying naturally occurring phosphatide Such as lecithin, a conden agents, for example, but are not limited to, acetic acid, citric sation product of an alkylene oxide with a fatty acid, for acid, fumaric acid, hydrochloric acid, nitric acid; and alka example, polyoxyethylene Stearate, a condensation product linizing agents such as, but are not limited to, ammonia of ethylene oxide with a long chain aliphatic alcohol, for Solution, ammonium carbonate, diethanolamine, monoetha example, heptadecaethyleneoxycetanol, a condensation nolamine, potassium hydroxide, sodium borate, sodium car product of ethylene oxide with a partial ester derived form bonate, Sodium hydroxide, triethanolamine, trolamine. a fatty acid and a hexitol Such as polyoxyethylene Sorbitol 0065 Other pharmaceutical ingredients include, for monooleate, or a condensation product of an ethylene oxide example, but are not limited to, adsorbents (e.g., powdered US 2007/0032404 A1 Feb. 8, 2007 cellulose and activated charcoal); aerosol propellants (e.g., pregelatinized starch); tablet and capsule diluents (e.g., carbon dioxide, CC1F, F2CIC CCIF and CCIF); air dibasic calcium phosphate, kaolin, lactose, mannitol, micro displacement agents (e.g., nitrogen and argon); antifungal crystalline cellulose, powdered cellulose, precipitated cal preservatives (e.g., benzoic acid, butylparaben, ethylpara cium carbonate, Sodium carbonate, sodium phosphate, Sor ben, methylparaben, propylparaben, Sodium benzoate); anti bitol and starch); tablet coating agents (e.g., liquid glucose, microbial preservatives (e.g., benzalkonium chloride, ben hydroxyethyl cellulose, hydroxypropyl cellulose, hydrox Zethonium chloride, benzyl alcohol, cetylpyridinium ypropyl methylcellulose, methylcellulose, ethylcellulose, cellulose acetate phthalate and shellac); tablet direct com chloride, chlorobutanol, phenol, phenylethyl alcohol, phe pression excipients (e.g., dibasic calcium phosphate); tablet nylmercuric nitrate and thimerosal); antioxidants (e.g., disintegrants (e.g., alginic acid, carboxymethylcellulose cal ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, cium, microcrystalline cellulose, polacrillin potassium, butylated hydroxytoluene, hypophosphorus acid, mono Sodium alginate, sodium starch glycollate and starch); tablet thioglycerol, propyl gallate, sodium ascorbate, sodium glidants (e.g., colloidal silica, corn starch and talc); tablet bisulfite, sodium formaldehyde sulfoxylate, sodium met lubricants (e.g., calcium Stearate, magnesium Stearate, min abisulfite); binding materials (e.g., block polymers, natural eral oil, Stearic acid and Zinc Stearate); tablet/capsule and synthetic rubber, polyacrylates, polyurethanes, silicones opaquants (e.g., titanium dioxide); tablet polishing agents and styrene-butadiene copolymers); buffering agents (e.g., (e.g., carnuba wax and white wax); thickening agents (e.g., potassium metaphosphate, potassium phosphate monobasic, beeswax, cetyl alcohol and paraffin); tonicity agents (e.g., Sodium acetate, sodium citrate anhydrous and sodium citrate dextrose and sodium chloride); Viscosity increasing agents dihydrate); carrying agents (e.g., acacia Syrup, aromatic (e.g., alginic acid, bentonite, carbomers, carboxymethylcel syrup, aromatic elixir, cherry syrup, cocoa syrup, orange lulose sodium, methylcellulose, povidone, Sodium alginate syrup, syrup, corn oil, mineral oil, peanut oil, sesame oil, and tragacanth); and wetting agents (e.g., heptadecaethylene bacteriostatic sodium chloride injection and bacteriostatic oxycetanol, lecithins, polyethylene Sorbitol monooleate, water for injection); chelating agents (e.g., edetate disodium polyoxyethylene Sorbitol monooleate, and polyoxyethylene and edetic acid); colorants (e.g., FD&C Red No. 3, FD&C Red No. 20, FD&C Yellow No. 6, FD&C Blue No. 2, D&C Stearate). Green No. 5, D&C Orange No. 5, D&C Red No. 8, caramel 0.066 Dosage levels of the PDE10A inhibitors for use in and ferric oxide red); clarifying agents (e.g., bentonite); methods of this invention typically are from about 0.001 mg emulsifying agents (but are not limited to, acacia, cetomac to about 10,000 mg daily, preferably from about 0.005 mg rogol, cetyl alcohol, glyceryl monostearate, lecithin, sorbi to about 1,000 mg daily. On the basis of mg/kg daily dose, tan monooleate, polyethylene 50 Stearate); encapsulating either given in a single or divided doses, dosages typically agents (e.g., gelatin and cellulose acetate phthalate); fla range from about 0.001775 mg/kg to about 10,000/75 mg/kg, Vorants (e.g., anise oil, cinnamon oil, cocoa, menthol, preferably from about 0.005/75 mg/kg to about 1,000/75 orange oil, peppermint oil and Vanillin); humectants (e.g., mg/kg. glycerin, propylene glycol and Sorbitol); levigating agents 0067. The total daily dose of each inhibitor can be (e.g., mineral oil and glycerin); oils (e.g., arachis oil, mineral administered to the patient in a single dose, or in multiple oil, olive oil, peanut oil, Sesame oil and vegetable oil); Subdoses. Typically, Subdoses can be administered two to six ointment bases (e.g., lanolin, hydrophilic ointment, polyeth times per day, preferably two to four times per day, and even ylene glycol ointment, petrolatum, hydrophilic petrolatum, more preferably two to three times per day. Doses can be in white ointment, yellow ointment, and rose water ointment); immediate release form or sustained release form suffi penetration enhancers (transdermal delivery) (e.g., monohy ciently effective to obtain the desired control over the droxy or polyhydroxy alcohols, Saturated or unsaturated diabetic condition. fatty alcohols, Saturated or unsaturated fatty esters, Saturated or unsaturated dicarboxylic acids, essential oils, phosphati 0068. The PDE10A inhibitor(s) may be administered as dyl derivatives, cephalin, terpenes, amides, ethers, ketones the Sole pharmaceutical agent or in combination with one or and ureas); plasticizers (e.g., diethyl phthalate and glycerin); more other pharmaceutical agents where the combination Solvents (e.g., alcohol, corn oil, cottonseed oil glycerin, causes no unacceptable adverse effects. For example, the isopropyl alcohol, mineral oil, oleic acid, peanut oil, purified PDE10A inhibitor(s) can be combined with known anti water, water for injection, Sterile water for injection and obesity, or with known antidiabetic or other indication sterile water for irrigation); stiffening agents (e.g., cetyl agents, and the like, as well as with admixtures and com alcohol, cetyl esters wax, microcrystalline wax, paraffin, binations thereof Stearyl alcohol, white wax and yellow wax); Suppository bases (e.g., cocoa butter and polyethylene glycols (mix 0069. The PDE10A inhibitor(s) may also be utilized in tures)); Surfactants (e.g., benzalkonium chloride, nonoxynol compositions, in research and diagnostics, or as analytical 10, oxtoxynol 9, polysorbate 80, sodium lauryl sulfate and reference standards, and the like. Therefore, the present Sorbitan monopalmitate); Suspending agents (e.g., agar, ben invention includes compositions which are comprised of an tonite, carbomers, carboxymethylcellulose Sodium, inert carrier and an effective amount of the PDE10A inhibi hydroxyethyl cellulose, hydroxypropyl cellulose, hydrox tor(s). An inert carrier is any material which does not interact ypropyl methylcellulose, kaolin, methylcellulose, tragacanth with a compound to be carried and which lends Support, and Veegum); Sweetening e.g., aspartame, dextrose, glyc means of conveyance, bulk, traceable material, and the like erin, mannitol, propylene glycol, saccharin sodium, Sorbitol to the compound to be carried. An effective amount of and Sucrose); tablet anti-adherents (e.g., magnesium Stearate compound is that amount which produces a result or exerts and talc); tablet binders (e.g., acacia, alginic acid, carboxym an influence on the particular procedure being performed. ethylcellulose Sodium, compressible Sugar, ethylcellulose, 0070 A PDE10A inhibitor for use in methods of the gelatin, liquid glucose, methylcellulose, povidone and invention may also be administered as the pharmaceutically US 2007/0032404 A1 Feb. 8, 2007 acceptable salt, protected acid, conjugate acid, tautomer, RNA Extraction and cDNA Preparation prodrug or Stereoisomer of a compound found to inhibit the 0077 Total RNA for TaqMan quantitative analysis was activity of PDE10A. Tautomers include, for example, extracted from cells according to the vendor protocol that hydroxy tautomers. Protected acids include, but are not utilizes the RNeasy protocol for isolation of total RNA from limited to, protected acids such as esters, hydroxyamino animal cells (Qiagen, Valencia, Calif.). derivatives, amides and Sulfonamides. Formation of pro drugs is well known in the art in order to enhance the 0078 RNA (100 g) was treated with DNase I using properties of the parent compound; Such properties include RNase free-DNase (Qiagen, Valencia, Calif.). After elution solubility, absorption, biostability and release time (see and quantitation on an Agilent 2100 Bioanalyzer (Agilent "Pharmaceutical Dosage Form and Drug Delivery Systems’ Technologies, Palo Alto, Calif.), each sample was reverse (Sixth Edition), edited by Ansel et al., publ. by Williams & transcribed using the Superscript II First Strand Synthesis Wilkins, pgs. 27-29, (1995) which is hereby incorporated by System for RT-PCR according to the vendor protocol (Invit reference). Commonly used prodrugs are designed to take rogen, Carlsbad, Calif.). The final concentration of RNA in advantage of the major drug biotransformation reactions and the reaction mix was 50 ng/uL. are also to be considered within the scope of the invention. Taq Man Quantitative Analysis Major drug biotransformation reactions include N-dealky lation, O-dealkylation, aliphatic hydroxylation, aromatic 0079 Specific primers and probes were designed accord hydroxylation, N-oxidation, S-oxidation, deamination, ing to Applied Biosystems (Foster City, Calif.) Assays-By hydrolysis reactions, glucuronidation, Sulfation and acety Design service and are listed below: lation (see Goodman and Gilman's The Pharmacological 0080 Taq Man Primer Sequences: Basis of Therapeutics (Ninth Edition), editor Molinoff et al., publ. by McGraw-Hill, pages 11-13, (1996), which is hereby incorporated by reference). PDE10A-forward 5'- (CAGATCCTCCCACCCACAGA)-3' primer: 0071 Besides being useful for human treatment, admin istration of a PDE10A inhibitor may also be useful for PDE10A-reverse 5'-(TCGAATTACCTTCTCCCACTGATT)-3' veterinary treatments of companion animals (e.g., horses, primer: dogs, cats, etc.), exotic animals and farm animals. Even PDE10A-probe: 5'-(FAM) - (TGCAGGGATAACCTC) though the invention is described in terms of human biology, it is understood by those of ordinary skill in the art that the present invention is applicable to other mammals as well. where FAM=6-carboxy-fluorescein and MGB-minor 0072 Formulations suitable for subcutaneous, intrave groove binder. The expected length of the PCR product was nous, intramuscular, and the like; Suitable pharmaceutical 75 bp. carriers; and techniques for formulation and administration 0081 Quantitation experiments were performed on may be prepared by any of the methods well known in the reverse transcribed RNA (25 ng) from each sample. Ribo art (see, e.g., Remington’s Pharmaceutical Sciences, Mack somal RNA (18S) was measured as a control using the Publishing Co., Easton, Pa., 20" edition, 2000). Pre-Developed TaqMan Assay Reagents (PDAR) (Applied 0073. It should be apparent to one of ordinary skill in the Biosystems, Foster City, Calif.). art that changes and modifications can be made to this invention without departing from the spirit or scope of the 0082 The assay reaction mix was as follows: invention as it is set forth herein.
EXAMPLES final 0074. In order that this invention may be better under TaqMan Universal PCR Master Mix (2x) 1x PDAR control - 18S RNA (20x) 1x stood, the following examples are set forth. These examples Forward primer 300 nM are for the purpose of illustration only, and are not to be Reverse primer 300 nM construed as limiting the scope of the invention in any Probe 200 nM manner. All publications mentioned herein are incorporated cDNA 25 ng by reference in their entirety. Water to 25 L 0075 Demonstration of the activity of the compounds of the present invention may be accomplished through in vitro, 0083) PCR Conditions: ex vivo, and in vivo assays that are well known in the art. For example, to demonstrate the efficacy of a pharmaceutical agent for the treatment of diabetes and related disorders, the One cycle: 2 minutes at 50° C. following assays may be used. 10 minutes at 95°C. 40 cycles: 15 Seconds at 95° C. Expression Profiling 1 minute at 60° C. Quantitative PCR Expression Analysis 0076) The expression of PDE10A in INS-1E (44) cell 0084. The experiment was performed on an ABI Prism line and dispersed islets was verified by PCR. 7700 Sequence Detector (Applied Biosystems, Foster City, US 2007/0032404 A1 Feb. 8, 2007
Calif.). At the end of the run, fluorescence data acquired during PCR were processed as described in the ABI Prism -continued 7700 user's manual.
0085 Table 1 shows the PDE10A and 18S housekeeping CT values using the primer combinations described above. The CT value is the threshold cycle which product fluores cence rises above background. CT values>35 indicate the gene is not expressed; CT values of 30 to 35 indicate low expression of the gene; CT values of 25 to 30 indicate expression; and CT values.<25 indicate high expression. Data presented in Table 1 is representative of three deter minations. As shown in Table 1, PDE10A is expressed in the INS-1E (44) cell-line and dispersed islet cells. Expression of PDE10A in islet cells indicates that PDE10A may have a role in regulating insulin release/blood glucose concentra tions. NTC=no template control.
TABLE 1.
PDE10A 18S Sample Name (CT) (CT) INS-1 (E44) 2456 1427 Dispersed islets 29.51 17.1 NTC 40 39.44
PDE10A Inhibition Assay 0.086 Test compounds and PDE10A enzyme in assay buffer are added to 96-well whitewall/clear bottom isoplates (Wallac). The reaction is initiated by the addition of H-cAMP (Amersham) or H-cGMP (Amersham). Follow 0088. These same compounds were run in inhibition ing a 45-minute incubation at room temperature, the reaction assays for PDE2, PDE3A, PDE4B, and PDE5. In these is stopped by the addition of SPA yttrium silicate beads assays, the compounds were found to have ICso values that (Amersham). The samples are incubated for an additional 30 were at least 100-fold greater than the ICs value for minutes, and the plates are read in the Microbeta (Wallac) PDE10A (Table 2). The compounds are therefore selective for 30 seconds in the SPA mode. Data may be expressed as for PDE10A. a percentage of control. To measure PDE2, PDE3A, PDE4B, and PDE10A activity, 3H-cAMP may be used as a substrate; TABLE 2 and to measure PDE5 activity, 3H-cGMP may be used as a PDE10A PDE2 PDE3 PDE4B PDE5 substrate. Compound nM M M M M 0087 Compounds were identified that inhibited the activ A. 30 10 >10 10 10 ity of PDE10A with an ICs value of 0.1 uM or less (see, B 32.7 >10 >10 10 >10 e.g., WO 02/048144 and WO 03/0141 16, incorporated by C 26.3 >10 >10 >10 >10 reference in its entirety). For example, the compounds include the following: Dispersed Islet Assay 0089 Dispersed pancreatic islet isolation. Lean rats (male Sprague-Dawley, 200-250 g) are anesthetized with nembutal (60 mg/kg, i.p.) and the abdomen opened to expose the liver and pancreas. The pancreas is distended by injection of Hank’s solution into the bile duct, and then the pancreas is excised and minced with Scissors while in Hank's solution. After rinsing the tissue with buffer, the pancreas is digested for 10 minutes with collagenase, rinsed, and the islets separated from debris on a Ficoll gradient. The isolated islet fraction is then rinsed with buffer, incubated with EDTA for 8 minutes, followed by incubation with trypsin and DNAase I for an additional 10 minutes. The dispersed islets are transferred to culture media containing 8 mM glucose, seeded in “V-bottom' 96-well plates (2,500 cells per well), and cultured overnight. US 2007/0032404 A1 Feb. 8, 2007
0090 For assaying insulinotropic compounds, the dis administrated via oral gavage (1.5 mL/rat). Two hours later, persed islets are pre-incubated in 3 mM glucose for 30 a glucose solution (30%, 2 g/kg body weight) is injected minutes. The islets are then transferred to media containing intraperitoneally. Tail blood samples are collected at 0, 15, 8 mM glucose, test compounds, and 0.3 uM forskolin; and 30, and 60-minute time points after the glucose injection, incubated for an additional 30 minutes. The media is then and blood glucose is measured using Glucometer (Bayer assayed for insulin content using, for example, a SPA assay. Diagnostics, Mishawaka, Ind.). Insulin secretion is reported as fold over control (FOC), where the control is the amount of insulin secretion in the 0092 All publications and patents mentioned in the presence of 8 mM glucose and 0.3 uM forskolin. Results for above specification are incorporated herein by reference. Compound A, B, and C may be found in Table 3. Various modifications and variations of the described meth ods of the invention will be apparent to those skilled in the TABLE 3 art without departing from the scope and spirit of the Fold-over-Control invention. Although the invention has been described in Compound (FOC) connection with specific preferred embodiments, it should be understood that the invention as claimed should not be A. 1.4 unduly limited to Such specific embodiments. Indeed, vari B 1.44 ous modifications of the above-described modes for carrying C 1.48 out the invention which are obvious to those skilled in the field of diabetes or related fields are intended to be within the scope of the following claims. Those skilled in the art will In Vivo Assay recognize, or be able to ascertain using no more than routine 0091 Lean rats (male Wistar, 250-300 g) are fasted experimentation, many equivalents to the specific embodi overnight and divided into two groups: vehicle and com ments of the invention described herein. Such equivalents pound treatment (8 rats per group). Vehicle or compound is are intended to be encompassed by the following claims.
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 3
<210> SEQ ID NO 1 &2 11s LENGTH 20 &212> TYPE DNA <213> ORGANISM: Artificial &22O > FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 1
cagatcc toc cacco acaga
<210> SEQ ID NO 2 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial &22O > FEATURE <223> OTHER INFORMATION: Primer
<400 SEQUENCE: 2
togaattacc ttctoccact gatt 24
<210> SEQ ID NO 3 &2 11s LENGTH 15 &212> TYPE DNA <213> ORGANISM: Artificial &22O > FEATURE &223> OTHER INFORMATION Probe
<400 SEQUENCE: 3
tgcagggata accitc 15 US 2007/0032404 A1 Feb. 8, 2007
What is claimed is: 15. A method of treating or preventing a urogenital tract 1. A method of treating or preventing a disease or con disorder selected from incontinence, stress incontinence, dition selected from the group consisting of diabetes, matu benign prostatic hyperplasia, erectile dysfunction, female rity-onset diabetes of the young (MODY), latent autoim sexual dysfunction, and prostatic hypertrophy, comprising mune diabetes adult (LADA), impaired glucose tolerance administering to a mammal an effective amount of a (IGT), impaired fasting glucose (IFG), gestational diabetes, PDE10A inhibitor. and metabolic syndrome X, comprising administering to a mammal an effective amount of a PDE10A inhibitor. 16. The method of claim 16, wherein said female sexual 2. The method of claim 1, wherein diabetes is type 2 dysfunction is female sexual arousal disorder. diabetes. 17. A method for identifying compounds which are useful 3. The method of claim 1, further comprising administer for the treatment of diabetes, maturity-onset diabetes of the ing insulin, insulin derivatives, PPAR ligands, sulfonylurea young (MODY), latent autoimmune diabetes adult (LADA), drugs, C-glucosidase inhibitors, biguanides, PTP-1B inhibi impaired glucose tolerance (IGT), impaired fasting glucose tors, DPP-IV inhibitors, 11-beta-HSD inhibitors, GLP-1 and (IFG), gestational diabetes, metabolic syndrome X, demen GLP-1 derivatives, GIP and GIP derivatives, PACAP and tia, cardiovascular disorders, and urogenital tract disorders, PACAP derivatives, or secretin and secretin derivatives in comprising the step of determining whether the compound combination with said PDE10A inhibitor. inhibits PDE10A. 4. The method of claim 3, wherein said PPAR ligand is selected from rosiglitaZone, troglitaZone, and pioglitaZone. 18. A method for the treatment of diabetes, maturity-onset 5. The method of claim 3, wherein said sulfonylurea is diabetes of the young (MODY), latent autoimmune diabetes selected from glibenclamide, glimepiride, chlorpropamide, adult (LADA), impaired glucose tolerance (IGT), impaired glipizide, glyburide, and tolbutamide. fasting glucose (IFG), gestational diabetes, metabolic Syn 6. The method of claim 3, wherein said O-glucosidase drome X, dementia, cardiovascular disorders, and urogenital inhibitor is selected from acarbose, miglitol, and Voglibose. tract disorders, comprising administering to a mammal an 7. The method of claim 1, further comprising administer effective amount of a compound identified by the method of ing HMG-CoA inhibitors, nicotinic acid, fatty acid lowering claim 17. compounds, lipid lowering drugs, ACAT inhibitors, bile 20. A pharmaceutical composition comprising a therapeu sequestrants, bile acid reuptake inhibitors, microsomal trig tically effective amount of a compound which inhibits lyceride transport inhibitors, or fibric acid derivatives in PDE10A in combination with a pharmaceutically acceptable combination with said PDE10A inhibitor. carrier. 8. The method of claim 1, further comprising administer 21. A pharmaceutical composition comprising a therapeu ing an anti-obesity agent selected from the group consisting tically effective amount of a compound which inhibits of B-3 agonists, CB-1 antagonists, neuropeptide Y5 inhibi PDE10A in combination with a pharmaceutically acceptable tors, appetite Suppressants, and lipase inhibitors in combi carrier and one or more pharmaceutical agents. nation with said PDE10A inhibitor. 22. The pharmaceutical composition of claim 21, wherein 9. The method of claim 1, further comprising administer said pharmaceutical agent is selected from the group con ing an anti-hypertensive agent selected from the group sisting of insulin, insulin derivatives, PPAR ligands, sulfo consisting of B-blockers, calcium channel blockers, diuret nylurea drugs, C-glucosidase inhibitors, biguanides, PTP-1B ics, renin inhibitors, ACE inhibitors, AT-1 receptor antago inhibitors, DPP-IV inhibitors, 11-beta-HSD inhibitors, nists, ET receptor antagonists, and nitrates in combination GLP-1 and GLP-1 derivatives, GIP and GIP derivatives, with said PDE10A inhibitor. PACAP and PACAP derivatives, and secretin and secretin 10. A method of treating or preventing secondary causes derivatives. of diabetes selected from glucocorticoid excess, growth 23. The pharmaceutical composition of claim 21, wherein hormone excess, pheochromocytoma, and drug-induced dia said pharmaceutical agent is selected from the group con betes, comprising administering to a mammal an effective sisting of B-3 agonists, CB-1 antagonists, neuropeptide Y5 amount of a PDE10A inhibitor. 11. A method of increasing the sensitivity of pancreatic inhibitors, appetite Suppressants, and lipase inhibitors. B-cells to an insulin secretagogue, comprising administering 24. The pharmaceutical composition of claim 21, wherein to a mammal an effective amount of a PDE10A inhibitor. said pharmaceutical agent is selected from the group con 12. The method of claim 11, wherein said insulin secre sisting of HMG-CoA inhibitors, nicotinic acid, fatty acid tagogue is selected from GLP-1, GIP PAC/VPAC receptor lowering compounds, lipid lowering drugs, ACAT inhibi agonists, secretin, nateglinide, meglitinide, repaglinide, tors, bile sequestrants, bile acid reuptake inhibitors, glibenclamide, glimepiride, chlorpropamide, and glipizide. microsomal triglyceride transport inhibitors, and fibric acid 13. A method of treating or preventing dementia, com derivatives. prising administering to a mammal an effective amount of a 25. The pharmaceutical composition of claim 21, wherein PDE10A inhibitor. said pharmaceutical agent is an anti-hypertensive agent 14. A method of treating or preventing a cardiovascular selected from the group consisting of B-blockers, calcium disorder selected from hypertension, ischemic heart disease, channel blockers, diuretics, renin inhibitors, ACE inhibitors, myocardial infarction, stable and unstable angina, peripheral AT-1 receptor antagonists, ET receptor antagonists, and occlusive disease and ischemic stroke, comprising admin nitrates. istering to a mammal an effective amount of a PDE10A inhibitor.