Quick viewing(Text Mode)

Potent Lipolytic Activity of Lactoferrin in Mature Adipocytes

Potent Lipolytic Activity of Lactoferrin in Mature Adipocytes

Biosci. Biotechnol. Biochem., 77 (3), 566–571, 2013

Potent Lipolytic Activity of Lactoferrin in Mature

y Tomoji ONO,1;2; Chikako FUJISAKI,1 Yasuharu ISHIHARA,1 Keiko IKOMA,1;2 Satoru MORISHITA,1;3 Michiaki MURAKOSHI,1;4 Keikichi SUGIYAMA,1;5 Hisanori KATO,3 Kazuo MIYASHITA,6 Toshihide YOSHIDA,4;7 and Hoyoku NISHINO4;5

1Research and Development Headquarters, Lion Corporation, 100 Tajima, Odawara, Kanagawa 256-0811, Japan 2Department of Supramolecular Biology, Graduate School of Nanobioscience, Yokohama City University, 3-9 Fukuura, Kanazawa-ku, Yokohama, Kanagawa 236-0004, Japan 3Food for Life, Organization for Interdisciplinary Research Projects, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan 4Kyoto Prefectural University of Medicine, Kawaramachi-Hirokoji, Kamigyou-ku, Kyoto 602-8566, Japan 5Research Organization of Science and Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu, Shiga 525-8577, Japan 6Department of Marine Bioresources Chemistry, Faculty of Fisheries Sciences, Hokkaido University, 3-1-1 Minatocho, Hakodate, Hokkaido 041-8611, Japan 7Kyoto City Hospital, 1-2 Higashi-takada-cho, Mibu, Nakagyou-ku, Kyoto 604-8845, Japan

Received October 22, 2012; Accepted November 26, 2012; Online Publication, March 7, 2013 [doi:10.1271/bbb.120817]

Lactoferrin (LF) is a multifunctional glycoprotein resistance, high blood pressure, and dyslipidemia. To found in mammalian milk. We have shown in a previous prevent progression of metabolic syndrome, lifestyle clinical study that enteric-coated bovine LF tablets habits must be improved to achieve a balance between decreased visceral accumulation. To address the energy intake and consumption. In addition, the use of underlying mechanism, we conducted in vitro studies specific food factors as helpful supplements is attracting and revealed the anti-adipogenic action of LF in pre- increasing attention. adipocytes. The aim of this study was to assess whether Lactoferrin (LF) is an iron-binding glycoprotein LF could increase the lipolytic activity in mature found in a high concentration in mammalian breast adipocytes. Pre-adipocytes were prepared from rat milk. This multifunctional has anti-bacterial, mesenteric fat and differentiated into mature adipocytes anti-viral, immunostimulatory, anti-oxidative, and can- for assays of lipolysis. The addition of LF significantly cer-preventive activities.1–5) Commercially available LF increased the concentration in the medium in a is produced from bovine milk, and it has been approved dose-dependent manner, whereas pepsin-degraded LF as a food additive in Japan and is included in the did not. A DNA microarray analysis demonstrated that generally recognized as safe (GRAS) category in USA. LF decreased the expression of perilipin and affected bLF is currently added to infant formula, yoghurt, skim the cAMP pathway. These findings are supported by the milk and nutraceuticals for the many purposes. We have results of quantitative RT-PCR of perilipin and assays initially focused on the anti-bacterial activities of LF and of cAMP. These data collectively indicate that visceral found that it potently ameliorated periodontal diseases.6) fat reduction by LF may result from the promotion A reduction in visceral fat was subsequently noted in the of lipolysis and the additional anti-adipogenic activity animals of that study, leading to the identification of of LF. the novel function of LF as a treatment for metabolic syndrome. Key words: lactoferrin; ; lipolysis; cAMP; We conducted clinical trials to confirm that LF perilipin supplements could decrease visceral fat and ameliorate metabolic syndrome.7) Using enteric-coated LF (eLF) Metabolic syndrome is a combination of medical tablets that are not degraded in the stomach, we have disorders that increase the risk of developing cardiovas- found that a treatment for 8 weeks resulted in decreased cular disease and other chronic ailments. Dietary excess, abdominal fat accumulation, particularly of visceral fat, lack of exercise, and increasing psychological stress in Japanese men and women with abdominal . have rapidly increased the number of affected individ- Some previous animal studies have provided further uals worldwide. Visceral obesity is central to the evidence of this effect. In particular, Shia et al. have development of metabolic syndrome. Excessive visceral reported the benefits of LF on body weight and fat fat accumulation disrupts the production of adiponectin, content under energy restriction.8) To elucidate the plasminogen activator inhibitor type 1, tumor necrosis mechanism of LF, its distribution in rats has been factor (TNF), and non-esterified fatty acids (NEFA), and investigated after an oral administration.9) We have thus leads to high blood glucose, induction of subsequently detected immunoreactive LF most prom-

y To whom correspondence should be addressed. Tel: +81-465-49-4472; Fax: +81-465-48-4079; E-mail: [email protected] Abbreviations: LF, lactoferrin; GO, ontology Lipolytic Action of Lactoferrin in Mature Adipocytes 567 inently in mesenteric fat tissue, suggesting that LF may used as a negative control. The culture supernatant was collected for a act directly on adipocytes. We then examined the lipolysis assay 24 h and 48 h after the addition treatment. The lipolytic 10) activities of LF against pre-adipocytes derived from rat activity was analyzed by measuring the glycerol concentration in the medium with a commercially available 148270 F- glycerol assay kit mesenteric fat tissue and found that LF inhibited (Roche Diagnostics, Tokyo, Japan) according to the manufacturer’s adipogenic differentiation in a dose-dependent manner. protocol. However, a treatment with pepsin abrogated this activity, indicating the need for enteric-coating of LF Isolation of RNA for the analysis of adipocytes. The to maximize its delivery to adipocytes. gene expression analysis using DNA microarrays was conducted by 2 The balance between synthesis and degradation culturing adipocytes as already described in 25-cm flasks (Sumitomo determines the lipid content of adipocytes. Although we Bakelite Co., Tokyo, Japan). The cells were harvested 24 h after adding 1000 mg/mL of LF. A sample without any additive was used as a found that LF inhibited lipid synthesis, the lipolytic control. Total RNA was extracted by using an RNeasy Mini kit action of LF has not currently been reported. We (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. therefore analysed in the present study the lipolytic The quality of purified total RNA was analyzed with a 2100 action of LF and conducted a DNA microarray analysis Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), and only to investigate the mechanism by which LF affected samples with an 18s:28s ribosomal RNA ratio of 2 or more were used. mature adipocytes. DNA microarray analysis. The DNA microarray analysis was conducted by amplifying and labeling 0.5 mg of total RNA with an Materials and Methods Amino Allyl Message AmpTM II aRNA amplification kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s Materials. Bovine LF was purchased from Friesland Campina instructions. Each sample of aRNA labeled with Cy3, and reference Domo (The Netherlands). The typical protein purity was 98% aRNA labeled with Cy5, was co-hybridized on to a 3D-Gene Rat according to the manufacturer’s data. 12K Oligo chip (Toray Industries, Tokyo, Japan) at 37 C for 16 h. After hybridization, the DNA chips were washed and dried. The Animals and diets. Male Sprague-Dawley rats (eight-week-old) were hybridization signals derived from Cy3 and Cy5 were scanned by using purchased from Japan SLC (Shizuoka, Japan), and were maintained in a Scan Array Express (Perkin Elmer, Waltham, MA, USA), the scanned barrier room at 23 C with a 12-h light/12-h dark cycle (light on 7:00 image being analyzed by using GenePix Pro (Molecular Devices, a.m.–7:00 p.m.). The animals were fed a CE-2 solid laboratory diet Sunnyvale, CA, USA). All the analyzed data were scaled by global (Clea Japan, Tokyo, Japan) and tap water ad libitum. All animal normalization. Affymetrix NetAffix and Ingenuity experiments were performed in accordance with the Guide for Care Pathway analysis systems (Ingenuity Systems, Red Wood City, CA, and Use of Laboratory Animals of Lion Corporation, Japan. USA) were respectively used for the gene ontology (GO) analysis and pathway analysis. Preparation of the LF degradation products by pepsin. The LF products degraded by pepsin were prepared as previously described.9) Confirmation of gene expression by quantitative RT-PCR. Total In brief, 5 g of LF was dissolved in 100 mL of water, and the pH value RNA was reverse transcribed with a Reva-Tra Ace kit (Toyobo, Osaka, was adjusted to 2.5 by using HCl. Pepsin (45,000 units, 1:10000 from Japan). Quantitative real-time RT-PCR analyses of perilipin and porcine stomach mucosa; 162-20752, Wako Pure Chemical Industries, peroxisome proliferator-activated receptor gamma (PPAR) mRNA Tokyo, Japan) was subsequently added, and the solution was incubated were performed with a MyiQ single-color real-time PCR detection at 37 C for 24 h. The degradation products were visualized and system (Bio-Rad Laboratories, Tokyo, Japan), using the SYBR Green quantified by using SDS–PAGE. Real-time PCR Master Mix (Toyobo) according to the manufacturer’s instructions. Hypoxanthine phosphoribosyltransferase 1 (HPRT) was used as an endogenous control to normalize the results, since the gene Preparation of mature adipocytes. Mature adipocytes were obtained expression level of HPRT was not affected by the addition of LF from primary cell cultures of mesenteric fat-derived pre-adipocytes during the culture period (data not shown). The PCR primers for HPRT as previously described.9) Sprague-Dawley rats were euthanized by (QT00365722) were purchased from QuantiTect Primer Assay exsanguination of the abdominal aorta under anesthesia. The mesen- (Qiagen, Hilden, Germany). The primer sequences for perilipin, teric fat pads were removed and washed with ice-cold PBS containing PPAR, and PPAR2 are listed in Table 1. a 1% antibiotic antimycotic (15240-062, Invitrogen Japan, Tokyo, Japan). The fat tissues were minced with scissors, added to PBS Measurement of the intracellular cAMP content. Six days after containing 1 mg/mL of S-1 collagenase (Nitta Gelatin, Tokyo, Japan), differentiating the pre-adipocytes to mature adipocytes, 1000 mg/mL of and incubated at 37 C for 40 min. The digested tissue was sub- LF or 10 mML-isoproterenol was added to the medium. Intracellular sequently filtered through a 100-mm mesh, and DMEM was added, cAMP was extracted after 1 h and 24 h and measured with a 900-163 before centrifuging at 800 rpm for 10 min. The resulting sediment was cyclic AMP complete kit (Assay Designs, Michigan, USA) according collected, washed twice with DMEM, filtered through a 70-mm mesh, to the manufacturer’s protocol. and centrifuged again. The cell pellet was suspended in a VACMR visceral fat differentiation medium (Primary Cell Co., Hokkaido, Statistical analyses. Data are presented as the mean and standard Japan), and the cells were seeded at a density of 1:5 105 cells/cm2 in deviation. Time course analyses of the LF-mediated lipolysis and 24-well plastic culture plates (Sumitomo Bakelite Co., Tokyo, Japan) intracellular cAMP content were analyzed by 2-way ANOVA and coated with Cellmatrix type I-C collagen (Nitta Gelatin, Tokyo, Japan). subsequent Dunnett’s test. The effect of pepsin on the lipolytic activity The pre-adipocytes prepared from one mesenteric fat pad could be of LF was analyzed by 1-way ANOVA and subsequent Dunnett’s test. approximately seeded on one 24-well plate. Mature adipocytes were The effects of LF on the gene expression of perilipin, PPAR, and prepared by culturing the cells in the visceral fat differentiation PPAR2 were analyzed by using unpaired t-tests. The level of medium according to the manufacturer’s protocol in a humidified statistical significance was set at p < 0:05, and data were analyzed by atmosphere of 5% CO in air at 37 C for 6 d. 2 using JMP version 9.0.2 (SAS Institute, Cary, NC, USA). Lipolysis assay of mature adipocytes. Six days after differentiating Results and Discussion the pre-adipocytes to mature adipocytes, 100, 300, and 1000 mg/mL of LF or the pepsin-degraded LF products were separately added to the Lipolytic activity of LF and pepsin-degraded LF in medium. A sample without any additive was used as a control, with 10 mML-isoproterenol (195263, MP Biomedicals Japan, Tokyo, Japan) mature adipocytes being used as a positive control. A4503-50G bovine albumin We adopted the primary culture system that had been (BSA, the Cohn V fraction; Sigma-Aldrich Japan, Tokyo, Japan) was used in previous studies to assay the lipolytic activity of 568 T. ONO et al. Table 1. Primers for qRT-PCR

Gene Forward primer Reverse primer Perilipin GAGGGGCTGATCTGGCTTTG GCATCTTTTGCCGTCCTGAA PPAR TGTCGGTTTCAGAAGTGCCTT TTCAGCTGGTCGATATCACTGGAG PPAR2 GATCCTCCTGTTGACCCAGA AGCTGATTCCGAAGTTGGTG

140 40 control ** ** 120 µ g/well) g/well) 10 M isoproterenol ** µ 30 µ µ ** 100 100 g/mL LF 300 µg/mL LF ** 20 80 1000 µg/mL LF ** ** 10 60 ** ** 40 ** 0 20 g/mL g/mL g/mL g/mL g/mL g/mL g/mL µ µ µ µ µ µ µ Medium glycerol amount ( Medium glycerol amount ( 0 Control 100 300 100 300 1000 24h 48h 1000 1000 LF Pepsin degraded LF BSA Fig. 1. Lypolytic Action of LF against Mature Adipocytes. Pre-adipocytes were isolated from rat mesenteric fat and cultured Fig. 2. Effect of Pepsin Degradation on the Lipolytic Action of LF in a differentiation medium for 6 d to obtain mature adipocytes. The against Mature Adipocytes. amounts of the glycerol medium were analysed 24 h and 48 h after The amounts of the glycerol medium were analysed 24 h after adding each samples to quantify the lipolysis activity. Isoproterenol adding each sample to compare the lipolytic activity of LF and was used as a positive control. The results are presented as the pepsin-degraded LF. Bovine serum albumin was used as a negative mean with the standard deviation, n ¼ 3. p < 0:01 Dunnett’s test control. The results are presented as the mean with the standard compared with the control. deviation, n ¼ 3. p < 0:01 Dunnett’s test compared with the control.

LF.9,11) Pre-adipocytes were isolated from rat mesenteric Changes in the gene expression profiles by LF in fat and cultured in a differentiation medium for 6 d to mature adipocytes obtain mature adipocytes. A 100, 300, or 1000-mg/mL DNA microarray analyses were performed to clarify amount of LF was subsequently added to the culture the mechanism by which LF promoted lipolysis. Mature medium. The lipolytic activity of LF was evaluated in adipocytes were harvested 24 h after adding LF or from mature adipocytes by measuring the changes in glycerol an additive-free medium. A 12K 3D-Gene Rat Oligo concentration in the medium (as a surrogate for chip, including about 12,000 DNA probes, was used in ) after 24 h and 48 h (Fig. 1). The glycerol this analysis. According to the manufacturer’s instruc- concentration increased in a control medium after 24 h tions, this chip would uniquely adopt an uneven and 48 h, indicating basal lipolytic activity. The exper- columnar structure for the detection area and thus imental validity was confirmed by using isoproterenol, achieve higher sensitivity and efficiency in detecting which is known as an agonist and low-expression than that with conventional DNA lipolytic stimulator,12) as a positive control. Interest- chips.14) These DNA microarray analyses, in which the ingly, LF significantly increased the glycerol concen- gene expression ratio threshold was set at 1.5-fold, tration in the medium in a time- and dose-dependent resulted in 1032 genes being increased and 1037 genes manner when compared with that in the control, being decreased after the treatment with LF. indicating that LF activated lipolysis in mature adipo- We performed a GO analysis of these data by using cytes. It is well known that orally administered LF is the Affymetrix NetAffix Gene Ontology analysis sys- degraded by pepsin in the stomach, but exerts several tem. The changes in gene expression profiles of the effects in the as an antibiotic and ‘‘lipid catabolic process’’ are listed in Table 2; 70 genes immunomodulator.13) On the other hand, pepsin-degraded were classified by GO as being involved in the lipid LF had reduced anti-adipogenic activity.9) To clarify catabolic process with NetAffix, and 48 genes were whether or not pepsin-degraded LF retained its lipolytic mounted on the 3D-Gene chip. Among these, three activity, LF and pepsin-degraded LF were evaluated genes were increased and four were decreased by the after 24 h by using BSA as a negative control (Fig. 2). treatment with LF. We focused on perilipin, a protec- LF again significantly increased the glycerol concen- tive-coated protein of lipid droplets from several tration in the medium in a dose-dependent manner in ,15) for which the signal log ratio was decreased these experiments, whereas pepsin-degraded LF and to 1.20. Given that perilipin is transcriptionally BSA did not. regulated by PPAR,16,17) we investigated PPAR and To the best of our knowledge, this is the first report found that its expression was decreased, with a signal of LF increasing lipolysis in adipocytes. The data from log ratio of 0.58. We also focused on lipases which experiments with pepsin-degraded LF suggest that it play a central role in lipid catalysis. There were 25 would quite important to avoid the degradation by genes in the GO category of the lipid catabolic pepsin in the stomach and deliver intact LF to the process. Only two of these, cytosolic A2 . Enteric coating will be a useful formu- and -beta-1, were increased by LF. It is lation for exerting the lipolytic activity of LF. well known that adipocyte triglyceride lipase (ATGL), hormone-sensitive lipase (HSL), and Lipolytic Action of Lactoferrin in Mature Adipocytes 569 Table 2. DNA Microarray Analysis of Gene Expressions in Mature Adipocyte in Response to LF

Ensambl ID Symbol Description Signal log ratio Altered gene expression profiles of ‘‘lipid catabolic process’’ ENSRNOG00000004089 Enpp2 Ectonucleotide pyrophosphatase/ 2 1.88 ENSRNOG00000015086 Plin Perilipin 1.20 ENSRNOG00000003442 Adora1 Adenosine A1 receptor 0.84 ENSRNOG00000014276 Plce1 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilo 0.66 ENSRNOG00000020481 Pafah1b3 -activating factor acetylhydrolase IB subunit gamma 0.63 ENSRNOG00000004810 Plcb1 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta 1 0.80 ENSRNOG00000002657 Pla2g4a Cytosolic 0.99 gene expression of perilipin transcriptional factor ENSRNOG00000008839 Pparg Peroxisome proliferator-activated receptor gamma 0.58 gene expression profiles of lipase ENSRNOG00000010406 Cel salt-activated lipase precursor ND ENSRNOG00000000510 Clps precursor ND ENSRNOG00000015747 Lipc Hepatic precursor 0.30 ENSRNOG00000020538 Lipe Lipase, hormone sensitive ND ENSRNOG00000019448 Lipf Gastric triacylglycerol lipase precursor ND ENSRNOG00000012181 Lp1 lipase precursor 0.04 ENSRNOG00000014508 Mgl1 Monoglyceride lipase 0.83 ENSRNOG00000001153 Pla2g1b Phospholipase A2 precursor ND ENSRNOG00000016945 Pla2g2a Phospholipase A2, membrane associated precursor 0.55 ENSRNOG00000016647 Pla2g2c Group IIC secretory phospholipase A2 precursor ND ENSRNOG00000016826 Pla2g2d Phospholipase A2, group IID 0.02 ENSRNOG00000002657 Pla2g4a Cytosolic phospholipase A2 0.99 ENSRNOG00000016838 Pla2g5 Calcium-dependent phospholipase A2 precursor 0.17 ENSRNOG00000012295 Pla2g6 85 kDa calcium-independent phospholipase A2 0.31 ENSRNOG00000002896 Prdx6 Acidic calcium-independent phospholipase A2 0.22 ENSRNOG00000004810 Plcb1 Phospholipase C-beta-1 0.80 ENSRNOG00000021150 Plcb3 Phospholipase C-beta-3 0.24 ENSRNOG00000033119 Plcb4 Phospholipase C-beta-4 0.29 ENSRNOG00000032238 Plcd1 Phospholipase C-delta-1 0.11 ENSRNOG00000016361 Plcd4 Phospholipase C, delta 4 0.16 ENSRNOG00000014276 Plce1 Phospholipase C-epsilon-1 0.66 ENSRNOG00000016340 Plcg1 Phospholipase C-gamma-1 0.11 ENSRNOG00000013676 Plcg2 Phospholipase C-gamma-2 ND ENSRNOG00000028156 Pld1 0.17 ENSRNOG00000018390 Pld3 family, member 3 0.23 ENSRNOG00000017725 Pnlip Pancreatic triacylglycerol lipase precursor ND

Data are described as the signal log 2 ratio between control (no additive) and lactoferrin ND: no detection lipase (MGL) have important roles in the degradation of then activates ATGL.23) Activated ATGL and HSL into fatty acids and glycerol.18) However, subsequently degrade triglycerides in the lipid droplet. ATGL was not included on the chip, HSL was not We hypothesized from the results of these DNA detected, and MGL was down-regulated by LF. Con- microarray analyses that LF decreased the expression of sidering these results, it is unlikely that the elevated perilipin and increased intracellular cAMP, leading to gene expression of lipases was the main cause for the the observed LF-mediated increase in lipolytic activity. LF-mediated induction of lipolysis. In addition to the GO analysis, we performed a Validating the hypothesis of LF promoting lipolysis pathway analysis by using commercially available To validate this hypothesis, we initially analyzed the Ingenuity Pathway Analysis software. The analysis expression of perilipin and PPAR by quantitative RT- targets included 2069 genes whose expression was PCR (Fig. 3). These experiments confirmed that LF changed by over 1.5-fold following the treatment with caused a decrease in perilipin mRNA expression. As LF, with 77 pathways being significantly altered already described, perilipin is transcriptionally control- (p < 0:05, Table 3). We focused on the cAMP signaling led by PPAR which is the master regulator of pathway (p ¼ 0:0025) that was represented by 142 adipocytes. Since PPAR2, an isoform exclusively genes on the chip. Of these, 25 were changed over 1.5- expressed in adipocytes, is a predominant regulator of fold by the treatment with LF. Adenylate cyclase type 5, the expression of this gene, we constructed primers for which converts ATP to cAMP,19) was increased, and PPAR and PPAR2; the former primer could recognize subunit B isoform 1 and the adenosine A1 the consensus sequence of PPAR1 and PPAR2, and receptor, which are negative regulators of adenylate the latter primer could recognize a sequence specific to cyclases,20,21) were decreased by LF, indicating increased PPAR2. The treatment with LF also decreased the intracellular cAMP. PKAs are activated to phospho- expression of both PPAR and PPAR2. Previous rylate perilipin and HSL when cAMP is increased in reports have shown that LF inhibited adipogenic differ- mature adipocytes.22) Phosphorylated perilipin is then entiation by suppressing PPAR.9,24,25) Hence, the detached from abhydrolase domain containing 5 which down-regulation of PPAR would mediate both the 570 T. ONO et al. Table 3. Alteration of Gene Expression Profiles of cAMP Signaling Pathway in Response to LF

Ensambl ID Symbol Description Signal log ratio ENSRNOG00000010235 Pkig cAMP-dependent protein kinase inhibitor gamma 1.94 ENSRNOG00000003977 Dusp1 Dual specificity protein 1 1.24 ENSRNOG00000019217 Adrb2 Beta-2 adrenergic receptor 0.96 ENSRNOG00000010552 Map2k1ip1 Mitogen-activated protein kinase kinase 1-interacting protein 1 0.89 ENSRNOG00000018260 Hrh2 Histamine H2 receptor 0.86 ENSRNOG00000003442 Adora1 Adenosine A1 receptor 0.84 ENSRNOG00000009495 Src Proto-oncogene tyrosine-protein kinase Src 0.79 ENSRNOG00000022857 Ppp3r1 Calcineurin subunit B isoform 1 0.76 ENSRNOG00000003959 Rgs18 Regulator of G-protein signaling 18 0.75 ENSRNOG00000019783 Akap3 A-kinase anchor protein 3 0.75 ENSRNOG00000013887 Adra2b Alpha-2B adrenergic receptor 0.60 ENSRNOG00000006559 Akap8 A-kinase anchor protein 8 0.60 ENSRNOG00000013048 Pde7a High-affinity cAMP-specific 30,50-cyclic phosphodiesterase 7A 0.60 ENSRNOG00000002229 Adcy5 Adenylate cyclase type 5 0.63 ENSRNOG00000020271 Rgs10 Regulator of G-protein signaling 10 0.63 ENSRNOG00000006899 Akap14 A-kinase anchor protein 14 0.64 ENSRNOG00000019482 Gnao Guanine -binding protein G(o) subunit alpha 1 0.65 ENSRNOG00000011310 Pde10a Phosphodiesterase 10A 0.73 ENSRNOG00000002773 Rgs4 Regulator of G-protein signaling 4 0.80 ENSRNOG00000009987 Akap11 A-kinase anchor protein 11 0.82 ENSRNOG00000019005 Pde8a Phosphodiesterase 8A 0.89 ENSRNOG00000017556 Chrm4 Muscarinic acetylcholine receptor M4 1.02 ENSRNOG00000026319 Akap9 A kinase (PRKA) anchor protein (yotiao) 9 1.44 ENSRNOG00000013042 Htr1b 5-hydroxytryptamine 1B receptor 1.50 ENSRNOG00000010254 Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 1.91

Data are described as the signal log 2 ratio between control (no additive) and lactoferrin

a b c

10 **4 *15 * 8 3 10 6 2 4 5

mRNA/Hprt mRNA/Hprt 1 mRNA/Hprt 2 0 0 0 Control LF ControlLF Control LF

Fig. 3. Effects of LF on the Gene Expression of Perilipin, PPARg and PPARg2 against Mature Adipocytes. LF at a concentration of 1000 mg/mL was added to mature adipocytes, and the cells were harvested 24 h after adding the sample. A sample without any additive was used as the control. The mRNA levels of (a) perilipin, (b) PPARg and (c) PPARg2 were evaluated by RT-PCR. The values are shown as relative values of HPRT mRNA. The results are presented as the mean with the standard deviation (n ¼ 3). p < 0:05. p < 0:01 unpaired t test compared with the control. inhibition of lipid synthesis and the promotion of 40 ** lipolysis following a treatment with LF. Among various control food factors, oligonol, a kind of polyphenol from lychee isoproterenol 30 fruit, has inhibited the accumulation of epididymal white LF adipose tissue in mice fed high-fat diets.26) Oligonol may down-regulate the expression of perilipin, resulting 20 in significantly increased lipolysis, which is a similar 27) ** ** action to that of LF. 10 We quantified intracellular cAMP to further validate the DNA microarray data (Fig. 4). Since isoproterenol is Intracellular cAMP amount [pmol/well] an adrenergic receptor agonist, it rapidly increased 0 intracellular cAMP by directly activating adenylate 1h 24h cyclase which converts AMP to cAMP. Interestingly, Fig. 4. Effect of LF on the Intracellular cAMP Amount in Mature LF also increased intracellular cAMP after 24 h. Adipocytes. remnant receptor LRP1 is a well-known LF at a concentration of 1000 mg/mL was added to mature receptor of LF in visceral fat.28) In addition to its adipocytes, and the cells were harvested 24 h after adding a sample. recognized role in endocytosis, it has been A sample without any additive was used as a control, and isoproterenol was used as a positive control. The results are reported that LRP1 functioned as a signaling receptor. presented as the mean with the standard deviation (n ¼ 3). Tyrosine-phosphorylated LRP1 directly associates with p < 0:01 Dunnett’s test compared with the control. Shc, a PTB and SH2 domain containing the signaling protein that is involved in the activation of Ras.29) This Lipolytic Action of Lactoferrin in Mature Adipocytes 571 pathway is one of the best characterized cascades, Yoshida T, Sugiyama K, and Nishino H, Br. J. Nutr., 104, involving Ras/Raf/MEK/ERK signaling molecules that 1688–1695 (2010). control cell proliferation, differentiation, and apopto- 8) Shia J, Finckenberg P, Martonena E, Ahlroos-Lehmus A, Pilvi 30) TK, Korpela R, and Mervaala EM, J. Funct. Foods, 4, 66–78 sis. Some evidence has suggested that LF activated (2012). the MAPK signaling pathway. Grey et al. have 9) Ono T, Morishita S, Fujisaki C, Ohdera M, Murakoshi M, Iida suggested that mitogenic signaling through LRP1 to N, Kato H, Miyashita K, Iigo M, Yoshida T, Sugiyama K, and ERK1/2 contributed to the anabolic skeletal actions of Nishino H, Br J. Nutr., 105, 200–211 (2011). LF.31) Interestingly, the activation of ERK1/2 has 10) Umekawa T, Yoshida T, Sakane N, Kogure A, Kondo M, and reportedly resulted in the inhibition of PPAR expres- Honjyo H, Diabetes, 48, 117–120 (1999). sion and activity.32,33) Moreover, Raf kinase mediates 11) Shimizu K, Sakai M, Ando M, Chiji H, Kawada T, Mineo H, and Taira T, Cell Biol. Int., 30, 381–388 (2006). the activation of adenylate cyclase through serine 12) Ranjit S, Boutet E, Gandhi P, Prot M, Tamori Y, Chawla A, phosphorylation, this being different from the well- Greenberg AS, Puri V, and Czech MP, J. Lipid Res., 52, 221– known G-protein coupled receptor activation mecha- 236 (2010). nism.34) Considering these reports, we can speculate that 13) Wakabayashi H, Takase M, and Tomita M, Curr. Pharm. Des., LF activated the LRP1 signaling pathway and involved 9, 1277–1287 (2003). such factors as MAPK in regulating the expression of 14) Nagino K, Nomura O, Takii Y, Myomoto A, Ichikawa M, perilipin, intracellular cAMP, and lipolysis in mature Nakamura F, Higasa M, Akiyama H, Nobumasa H, Shiojima S, and Tsujimoto G, J. Biochem., 139, 697–703 (2006). adipocytes. Further studies are required to confirm these 15) Clifford GM, Londos C, Kraemer FB, Vernon RG, and Yeaman transcriptional changes at the protein expression level SJ, J. Biol. Chem., 275, 5011–5015 (2000). and the involvement of LRP1, and to determine the 16) Shimizu M, Takeshita A, Tsukamoto T, Gonzalez FJ, and pathway through which LF is active Osumi T, Mol. Cell. Biol., 24, 1313–1323 (2004). in adipocytes. 17) Arimura N, Horiba T, Imagawa M, Shimizu M, and Sato R, We have demonstrated in this study the lipolytic J. Biol. Chem., 279, 10070–10076 (2004). 18) Zechner R, Kienesberger PC, Haemmerle G, Zimmermann R, activity of LF against mature adipocytes, and suggest and Lass A, J. Lipid Res., 50, 3–21 (2009). the involvement of perilipin and cellular cAMP. It is 19) Watts VJ, J. Pharmacol. Exp. Ther., 302, 1–7 (2002). important to avoid degradation by pepsin in stomach 20) Antoni FA, Palkovits M, Simpson J, Smith SM, Leitch AL, to exploit these properties of LF. Together with the Rosie R, Fink G, and Paterson JM, J. Neurosci., 18, 9650–9661 results from our previous studies, we conclude that (1998). enteric-coated LF decreased visceral fat by inhibiting 21) Dhalla AK, Chisholm JW, Reaven GM, and Belardinelli L, lipid synthesis and promoting lipolysis. Handb. Exp. Pharmacol., 193, 271–295 (2009). 22) Holm C, Biochem. Soc. Trans., 31, 1120–1124 (2003). 23) Lass A, Zimmermann R, Haemmerle G, Riederer M, Acknowledgment Schoiswohl G, Schweiger M, Kienesberger P, Strauss JG, Gorkiewicz G, and Zechner R, Cell Metab., 3, 309–319 (2006). This research received no specific grant from any 24) Yagi M, Suzuki N, Takayama T, Arisue M, Kodama T, Yoda Y, funding agency in the public, commercial or not-for- Numasaki H, Otsuka K, and Ito K, J. Oral Sci., 50, 419–425 profit sector. We are grateful to Dr. Akiyama and Dr. (2008). Ueda of Toray Industries, Inc. for kindly analyzing the 25) Moreno-Navarrete JM, Ortega FJ, Ricart W, and Fernandez-Real JM, Int. J. Obes. (Lond), 33, 991–1000 (2009). DNA microarray data. The authors have no conflict of 26) Sakurai T, Nishioka H, Fujii H, Nakano N, Kizaki T, Radak Z, interest associated with the present study. Izawa T, Haga S, and Ohno H, Biosci. Biotechnol. Biochem., 72, 463–476 (2008). References 27) Ogasawara J, Kitadate K, Nishioka H, Fujii H, Sakurai T, Kizaki T, Izawa T, Ishida H, and Ohno H, Phytother. Res., 23, 1) Tomita M, Bellamy W, Takase M, Yamauchi K, Wakabayashi 1626–1633 (2009). H, and Kawase K, J. Dairy Sci., 74, 4137–4142 (1991). 28) Hofmann SM, Zhou L, Perez-Tilve D, Greer T, Grant E, 2) Harmsen MC, Swart PJ, de Be´thune MP, Pauwels R, De Clercq Wancata L, Thomas A, Pfluger PT, Basford JE, Gilham D, Herz E, The TH, and Meijer DK, J. Infect. Dis., 172, 380–388 (1995). J, Tscho¨p MH, and Hui DY, J. Clin. Invest., 117, 3271–3282 3) Zimecki M, Właszczyk A, Cheneau P, Brunel AS, Mazurier J, (2007). Spik G, and Ku¨bler A, Arch. Immunol. Ther. Exp. (Warsz), 46, 29) Barnes H, Ackermann EJ, and van der Geer P, Oncogene, 22, 231–240 (1998). 3589–3597 (2003). 4) Oguchi S, Shinohara K, Shimizu T, and Yamashiro Y, Pediatr. 30) Chambard JC, Lefloch R, Pouysse´gur J, and Lenormand P, Res., 61, 89–92 (2007). Biochim. Biophys. Acta, 1773, 1299–1310 (2007). 5) Kozu T, Iinuma G, Ohashi Y, Saito Y, Akasu T, Saito D, 31) Grey A, Banovic T, Zhu Q, Watson M, Callon K, Palmano K, Alexander DB, Iigo M, Kakizoe T, and Tsuda H, Cancer Prev. Ross J, Naot D, Reid IR, and Cornish J, Mol. Endocrinol., 18, Res. (Phila), 2, 975–983 (2009). 2268–2278 (2004). 6) Suzuki N, Kigawa H, Ono T, Sekiya D, Murakoshi M, 32) Tanabe Y, Koga M, Saito M, Matsunaga Y, and Nakayama K, Kawakami A, Ogawa N, Kobayashi H, Fukui T, Ohdera M, J. Cell Sci., 117, 3605–3614 (2004). Ujiie T, and Ishikawa R, ‘‘Lactoferrin 2007’’ (in Japanese), eds. 33) Hu E, Kim JB, Sarraf P, and Spiegelman BM, Science, 274, Thuda H, Shimazaki K, and Tanaka K, Nihon Igakukan, Tokyo, 2100–2103 (1996). pp. 68–72 (2007). 34) Ding Q, Gros R, Gray ID, Taussig R, Ferguson SS, and Feldman 7) Ono T, Murakoshi M, Suzuki N, Iida N, Ohdera M, Iigo M, RD, Mol. Pharmacol., 66, 921–928 (2004).

Top View