DOCSLIB.ORG

Metabolic Engineering of Deinococcus Radiodurans for the Production of Phytoene Sun-Wook Jeong†, Chang Keun Kang†, and Yong Jun Choi*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Metabolic Engineering of Deinococcus Radiodurans for the Production of Phytoene Sun-Wook Jeong†, Chang Keun Kang†, and Yong Jun Choi* J. Microbiol. Biotechnol. (2018), 28(10), 1691–1699 https://doi.org/10.4014/jmb.1808.08019 Research Article Review jmb Metabolic Engineering of Deinococcus radiodurans for the Production of Phytoene Sun-Wook Jeong†, Chang Keun Kang†, and Yong Jun Choi* School of Environmental Engineering, University of Seoul, Seoul 02504, Republic of Korea Received: August 16, 2018 Revised: August 22, 2018 A metabolically-engineered Deinococcus radiodurans R1 strain capable of producing phytoene, Accepted: August 23, 2018 a colorless C40 carotenoid and a promising antioxidant, has been developed. To make this base First published online strain, first, the crtI gene encoding phytoene desaturase was deleted to block the conversion of August 24, 2018 phytoene to other carotenoids such as lycopene and γ-carotene. This engineered strain *Corresponding author produced 0.413 ± 0.023 mg/l of phytoene from 10 g/l of fructose. Further enhanced production Phone: +82-2-6490-2873; of phytoene up to 4.46 ± 0.19 mg/l was achieved by overexpressing the crtB gene encoding Fax: +82-2-6490-2859; E-mail: [email protected] phytoene synthase and the dxs genes encoding 1-deoxy-D-xylulose-5-phosphate synthase gene, and by deleting the crtD gene. High cell-density culture of our final engineered strain † These authors contributed allowed production of 10.3 ± 0.85 mg/l of phytoene with the yield and productivity of equally to this work. 1.04 ± 0.05 mg/g and 0.143 ± 0.012 mg/l/h, respectively, from 10 g/l of fructose. Furthermore, the antioxidant potential of phytoene produced by the final engineered strain was confirmed pISSN 1017-7825, eISSN 1738-8872 by in vitro DPPH radical-scavenging assay. Copyright© 2018 by The Korean Society for Microbiology Keywords: Metabolic engineering, Deinococcus radiodurans, phytoene, antioxidation and Biotechnology Introduction inhibited by the regular ingestion of phytoene-containing phytonutrients [1-4]. Moreover, considering the critical Isoprenoids, a diverse class of natural organic molecules weaknesses of various carotenoids, such as limited derived from isoprene, are important industrial compounds availability and light sensitivity resulting from the distinctive that have been widely used in various industrial products color that makes carotenoids somewhat unfavorable in such as food additives, pharmaceuticals, biofuels, and cosmetic applications, it also has great advantages over cosmetic ingredients. Especially because of their excellent other colored carotenoids in terms of scalability and antioxidant activity, some isoprenoids such as β-carotene, availability [5]. With this increasing interest in phytoene lycopene, and lutein are getting much attention for their and the rapidly increasing market for carotenoids has come potential use as natural pharmaceutical ingredients. Thus, a greater need for large-scale fermentative production of the size of the global market for antioxidant isoprenoids phytoene through metabolic engineering of microorganisms. has been gradually increasing over the last few decades. There have been several reports on the production of Phytoene (C40H64), one of the colorless carotenoids, is an phytoene by metabolic engineering of the isoprenoid intermediated metabolite of the isoprenoid biosynthetic biosynthetic pathway. Recently, metabolically-engineered pathway as well as a starting metabolite for the biosynthesis Thermococcus kodakarensis strain expressing Saci_1734 from of various carotenoids [1]. Despite the lack of pigment for Sulfolobus acidocaldarius capable of producing up to dissipating the oxidative energy of singlet oxygen, it shares 0.75 mg/l of phytoene was reported [6]. Moreover, 3.4-fold the inherent beneficial efficacies of naturally occurring increased phytoene production was achieved by disruption carotenoids such as anti-oxidation, anti-inflammation, and of acetyl-CoA synthetase I gene followed by double- immune system-boosting ability. Previous studies on the overexpression of Saci_1734. More recently, genetically- effectiveness of phytoene have shown that proliferation of engineered Dunaliella salina V-101 capable of producing human prostate cancer and mammary cells are significantly phytoene up to 108.34 mg/ 100 mg DCW was developed October 2018 ⎪ Vol. 28⎪ No. 10 1692 Jeong et al. by down-regulation of phytoene desaturase using RNAi have been developed [10, 14-18], the metabolic engineering and antisense methods [5]. Another study also reported the of D. radiodurans for the production of high-value carotenoid highest level of phytoene production (up to 10 mg/g DCW) compounds has not yet been reported. These observations using Xanthophyllomyces dendrorhous by deleting the crtI led us to explore the potential of D. radiodurans for the gene together with overexpressing the crtE and crtYB genes production of phytoene by rational metabolic engineering [7, 8]. for the first time. An extremophilic bacterium, Deinococcus radiodurans has To achieve this goal, the crtI and crtD genes encoding been well-known for its inherent biosynthetic pathway for phytoene synthase and carotenoid 3’,4’-desaturase, respectively, the biosynthesis of various carotenoids [9, 10]. It also has were sequentially deleted in D. radiodurans. Then, the crtB an extremely high concentration of intracellular glucose-6- and dxs genes were overexpressed to increase the carbon phosphate and NADP(H), which are essential for the flux towards phytoene. Furthermore, we also evaluated the synthesis of carotenoids [11]. Moreover, the bacterium has antioxidant activity of the produced phytoene by in vitro various genes of particular interest that deserve to be DPPH radical-scavenging assay. engineered for increasing tolerance to external stresses [9]. Significantly enhanced cellular tolerance to external stresses Materials and Methods such as osmotic pressure, high salts, temperature, and pH that can be caused during fermentation was observed by Bacterial Strains and Cultivation heterologous overexpression of those of genes [12, 13]. All bacterial strains and plasmids in this study are listed in Thus, D. radiodurans is of particular interest due to its Table 1. Deinococcus radiodurans strains were routinely cultured at potential to be used as a platform strain and its superiority 30°C in TGY (0.5% tryptone, 0.3% yeast extract, and 0.1% glucose). to other microorganisms such as Saccharomyces cerevisiae, Batch culture was carried out using modified minimal media (per liter) containing 20 mM phosphate buffer (pH 7.0), 15mM (NH) SO , and Corynebacterium glutamicum for the production of a 4 2 4 5 μM MnCl , 0.8 mM MgCl , 0.18 mM CaCl , 10 g fructose, 10 mg/ml variety of carotenoids. However, there has been no report 2 2 2 vitamins mix (Sigma), 50 mg/l L-cysteine, 25mg/l L-histidine, about intensive engineering of D. radiodurans for industrial 25mg/l L-methionine, and 1 g yeast extract [19]. To obtain high application. This situation seems due to the lack of genetic cell density, D. radiodurans were cultured in modified rich medium manipulation tools for the engineering of D. radiodurans. (50 mM HEPES, 10 g/l tryptone, 5 g/l yeast extract, 0.5 g/l MgSO4 Although lots of available metabolic information on • 7H2O, and 5 μM MnCl2) supplemented with 10 g/l fructose [21]. carotenoid pathway together with genetic engineering tools The cell density was measured using a spectrophotometer Table 1. Bacterial strains and plasmids used in this study. Description Reference Strains D. radiodurans R1 Wild type (ATCC13939) ATCC E. coli DH5α Host for plasmid subclones Lab stock Plasmids pAM1 A derivative of pKatAPH3 containing lox66-kmr-lox71 cassette r pAM2 A derivative of p13840 containing PGroES-cre-PGroES-cm [12] pRADZ3 E. coli-D. radiodurans shuttle vector for overexpression of genes controlled by groE promoter pAM41 A derivative of pRADZ3 containing crtB gene This study pAM42 A derivative of pRADZ3 containing crtE gene This study pAM73 A derivative of pRADZ3 containing dxs gene This study pAM74 A derivative of pRADZ3 containing idi gene This study pAM103 A derivative of pAM41 containing crtE gene This study pAM104 A derivative of pAM41 containing dxs gene This study pAM105 A derivative of pAM41 containing idi gene This study J. Microbiol. Biotechnol. Metabolic Engineering of Deinococcus radiodurans for Phytoene Production 1693 (Thermoscientific, USA) with a wavelength of 600 nm and Table 2. Primers used in this study. converted into DCW (g/l) using a standard curve. Escherichia coli Primer Sequence (5’ to 3’)a DH5α was used as the cloning host for propagation of expression crtI knockout plasmid and cultured at 37°C in Luria-Bertani medium (LB). crtI-1 catagtgaaagaaacgtctg When necessary, antibiotics were added at final concentration of 100 μg/ml ampicillin for E. coli, and 3 μg/ml chloramphenicol crtI-2 agcttatcgataccgtcgacgacagtaaacctcggaagtc and 25 μg/ml kanamycin for D. radiodurans. crtI-3 gacttccgaggtttactgtcgtcgacggtatcgataagct crtI-4 ttaagcggaatccgtatgaccatgcctgcaggtcgactct Knockout Mutant Construction crtI-5 agagtcgacctgcaggcatggtcatacggattccgcttaa The construction of all knockout mutants in this study was crtI-6 ttggtccacatgctggtgca carried out using Cre-loxP system as previously described [14]. In brief, the DNA fragment containing lox66-kmr-lox71 cassette flanked dr0810 knockout by approximately 1 kb of both up and downstream nucleotide dr0810-1 gttgtatacgctcgacggcg sequences of target genes (crtI, dr0810, or crtD) was amplified by dr0810-2 agcttatcgataccgtcgacactccacaggcgacttcaca PCR from pAM1 plasmid and D. radiodurans genomic
Load more

Recommended publications
  • The Biosynthesis of Carotenoids
    THE BIOSYNTHESIS OF CAROTENOIDS C. 0. CHICHESTER Department of Food Science and Technology, University of a4fornia, Davis, Galjf 95616, U.S.A. INTRODUCTION Considerable progress has been made in the field of carotenoid bio- chemistry in the last ten to fifteen years. Prior to that very little, if anything, was known about the units which formed the intermediates of the coloured 40—carbon pigments, or the structures of those that were proposed as intermediates. Like all fields of biochemistry, as knowledge is accumulated specific problems are crystallized. These generally concern key areas, which until an understanding is achieved can substantially hinder the unification of a field or problem. The biochemistry of the carotenoids has arrived at this point. INTERMEDIATE COMPOUNDS IN CAROTENOID BIOSYNTHESIS There is general consensus as to the identity of the intermediate com- pounds which form the building blocks of the carotenoids. Studies in Phycornyces blakesleeanus, tomatoes, corn, carrots, Mucor hiemalis, spinach leaves, and bean leaves all coincide to indicate that the common building block of carotenoids is mevalonic acid'—7. Some experiments concerned with carotenoids, and many with sterols, have shown that /3-methyl-/3- hydroxyglutarate-CoA, and/or acetoacetic-CoA, are the normal sources of inevalonic acid" 8 In Phycomyces blalcesleeanus, as well as tomatoes, it has been shown rather unequivocally that the first steps in the conversion of meva- lonic acid to the C—40's are identical to those postulated for the formation of sterols911. The mevalonic acid is converted via the 5-phosphomevalonic acid to the 5-pyrophosphoryl mevalonic acid'2. This compound is then decarboxylated to form the z3-isopentenol pyrophosphate.
    [Show full text]
  • Synthetic Conversion of Leaf Chloroplasts Into Carotenoid-Rich Plastids Reveals Mechanistic Basis of Natural Chromoplast Development
    Synthetic conversion of leaf chloroplasts into carotenoid-rich plastids reveals mechanistic basis of natural chromoplast development Briardo Llorentea,b,c,1, Salvador Torres-Montillaa, Luca Morellia, Igor Florez-Sarasaa, José Tomás Matusa,d, Miguel Ezquerroa, Lucio D’Andreaa,e, Fakhreddine Houhouf, Eszter Majerf, Belén Picóg, Jaime Cebollag, Adrian Troncosoh, Alisdair R. Ferniee, José-Antonio Daròsf, and Manuel Rodriguez-Concepciona,f,1 aCentre for Research in Agricultural Genomics (CRAG) CSIC-IRTA-UAB-UB, Campus UAB Bellaterra, 08193 Barcelona, Spain; bARC Center of Excellence in Synthetic Biology, Department of Molecular Sciences, Macquarie University, Sydney NSW 2109, Australia; cCSIRO Synthetic Biology Future Science Platform, Sydney NSW 2109, Australia; dInstitute for Integrative Systems Biology (I2SysBio), Universitat de Valencia-CSIC, 46908 Paterna, Valencia, Spain; eMax-Planck-Institut für Molekulare Pflanzenphysiologie, 14476 Potsdam-Golm, Germany; fInstituto de Biología Molecular y Celular de Plantas, CSIC-Universitat Politècnica de València, 46022 Valencia, Spain; gInstituto de Conservación y Mejora de la Agrodiversidad, Universitat Politècnica de València, 46022 Valencia, Spain; and hSorbonne Universités, Université de Technologie de Compiègne, Génie Enzymatique et Cellulaire, UMR-CNRS 7025, CS 60319, 60203 Compiègne Cedex, France Edited by Krishna K. Niyogi, University of California, Berkeley, CA, and approved July 29, 2020 (received for review March 9, 2020) Plastids, the defining organelles of plant cells, undergo physiological chromoplasts but into a completely different type of plastids and morphological changes to fulfill distinct biological functions. In named gerontoplasts (1, 2). particular, the differentiation of chloroplasts into chromoplasts The most prominent changes during chloroplast-to-chromo- results in an enhanced storage capacity for carotenoids with indus- plast differentiation are the reorganization of the internal plastid trial and nutritional value such as beta-carotene (provitamin A).
    [Show full text]
  • Genetic Modification of Tomato with the Tobacco Lycopene Β-Cyclase Gene Produces High Β-Carotene and Lycopene Fruit
    Z. Naturforsch. 2016; 71(9-10)c: 295–301 Louise Ralley, Wolfgang Schucha, Paul D. Fraser and Peter M. Bramley* Genetic modification of tomato with the tobacco lycopene β-cyclase gene produces high β-carotene and lycopene fruit DOI 10.1515/znc-2016-0102 and alleviation of vitamin A deficiency by β-carotene, Received May 18, 2016; revised July 4, 2016; accepted July 6, 2016 which is pro-vitamin A [4]. Deficiency of vitamin A causes xerophthalmia, blindness and premature death, espe- Abstract: Transgenic Solanum lycopersicum plants cially in children aged 1–4 [5]. Since humans cannot expressing an additional copy of the lycopene β-cyclase synthesise carotenoids de novo, these health-promoting gene (LCYB) from Nicotiana tabacum, under the control compounds must be taken in sufficient quantities in the of the Arabidopsis polyubiquitin promoter (UBQ3), have diet. Consequently, increasing their levels in fruit and been generated. Expression of LCYB was increased some vegetables is beneficial to health. Tomato products are 10-fold in ripening fruit compared to vegetative tissues. the most common source of dietary lycopene. Although The ripe fruit showed an orange pigmentation, due to ripe tomato fruit contains β-carotene, the amount is rela- increased levels (up to 5-fold) of β-carotene, with negli- tively low [1]. Therefore, approaches to elevate β-carotene gible changes to other carotenoids, including lycopene. levels, with no reduction in lycopene, are a goal of Phenotypic changes in carotenoids were found in vegeta- plant breeders. One strategy that has been employed to tive tissues, but levels of biosynthetically related isopre- increase levels of health promoting carotenoids in fruits noids such as tocopherols, ubiquinone and plastoquinone and vegetables for human and animal consumption is were barely altered.
    [Show full text]
  • Direct Regulation of Phytoene Synthase Gene Expression and Carotenoid Biosynthesis by Phytochrome-Interacting Factors
    Direct regulation of phytoene synthase gene expression and carotenoid biosynthesis by phytochrome-interacting factors Gabriela Toledo-Ortiza, Enamul Huqb, and Manuel Rodríguez-Concepcióna,1 aCentre for Research in Agricultural Genomics, CSIC-IRTA-UAB, 08034 Barcelona, Spain; and bSection of Molecular Cell and Developmental Biology and Institute for Cellular and Molecular Biology, University of Texas, Austin, TX 78712 Edited* by Peter H. Quail, University of California, Albany, CA, and approved May 14, 2010 (received for review December 15, 2009) Carotenoids are key for plants to optimize carbon fixing using the known about the specific factors involved in this coordinated energy of sunlight. They contribute to light harvesting but also control, however. channel energy away from chlorophylls to protect the photosyn- Although the main pathway for carotenoid biosynthesis in plants thetic apparatus from excess light. Phytochrome-mediated light has been elucidated (9, 10), we still lack fundamental knowledge of signals are major cues regulating carotenoid biosynthesis in plants, the regulation of carotenogenesis in plant cells (11). In fact, to date but we still lack fundamental knowledge on the components of this no regulatory genes directly controlling carotenoid biosynthetic signaling pathway. Here we show that phytochrome-interacting gene expression have been isolated. Nonetheless, it is known that factor 1 (PIF1) and other transcription factors of the phytochrome- a major driving force for carotenoid production in different plant interacting factor (PIF) family down-regulate the accumulation of species is the transcriptional regulation of genes encoding phy- carotenoids by specifically repressing the gene encoding phytoene toene synthase (PSY), the first and main rate-determining enzyme synthase (PSY), the main rate-determining enzyme of the pathway.
    [Show full text]
  • Multiplicity of Carotene Patterns Derives from Competition Between
    www.nature.com/scientificreports OPEN Multiplicity of carotene patterns derives from competition between phytoene desaturase diversifcation and biological environments Mathieu Fournié1,2,3 & Gilles Truan1* Phytoene desaturases catalyse from two to six desaturation reactions on phytoene, generating a large diversity of molecules that can then be cyclised and produce, depending on the organism, many diferent carotenoids. We constructed a phylogenetic tree of a subset of phytoene desaturases from the CrtI family for which functional data was available. We expressed in a bacterial system eight codon optimized CrtI enzymes from diferent clades. Analysis of the phytoene desaturation reactions on crude extracts showed that three CrtI enzymes can catalyse up to six desaturations, forming tetradehydrolycopene. Kinetic data generated using a subset of fve purifed enzymes demonstrate the existence of characteristic patterns of desaturated molecules associated with various CrtI clades. The kinetic data was also analysed using a classical Michaelis–Menten kinetic model, showing that variations in the reaction rates and binding constants could explain the various carotene patterns observed. Competition between lycopene cyclase and the phytoene desaturases modifed the distribution between carotene intermediates when expressed in yeast in the context of the full β-carotene production pathway. Our results demonstrate that the desaturation patterns of carotene molecules in various biological environments cannot be fully inferred from phytoene desaturases classifcation but is governed both by evolutionary-linked variations in the desaturation rates and competition between desaturation and cyclisation steps. Carotenoids are organic pigments produced by plants, algae, fungi, and bacteria and can be subdivided into two families of molecules, carotenes and their oxidised counterparts, xanthophylls 1.
    [Show full text]
  • Chemical Inhibition of Lycopene Β-Cyclases Unmask Operation of Phytoene Synthase 2 in 4 Ripening Tomato Fruits
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.19.452896; this version posted July 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Rameshwar Sharma (orcid.org/0000-0002-8775-8986) 2 Yellamaraju Sreelakshmi (orcid.org/0000-0003-3468-9136) 3 Chemical inhibition of lycopene β-cyclases unmask operation of phytoene synthase 2 in 4 ripening tomato fruits 5 Prateek Gupta1, Marta Rodriguez‐Franco2, Reddaiah Bodanapu1,#, Yellamaraju Sreelakshmi1*, 6 and Rameshwar Sharma1* 7 1Repository of Tomato Genomics Resources, Department of Plant Sciences, University of 8 Hyderabad, Hyderabad-500046, India 9 2Department of Cell Biology, Faculty of Biology, University of Freiburg, Freiburg D‐79104, 10 Germany 11 *Corresponding authors: [email protected], [email protected] 12 Short title: Role of PSY2 in tomato fruit carotenogenesis. 13 *Author for Correspondence 14 # Deceased 15 E-mails authors: [email protected] (PG), [email protected] 16 freiburg.de (MR), [email protected] (YS), [email protected] (RS) 17 Date of Submission: July 2021 18 Tables: Nil. 19 Figures: Six. 20 Supplementary figures: Nine. 21 Supplementary tables: Two. 22 Word count: 5602. 23 Highlight: 24 In tomato phytoene synthase 1 mutant fruit, which is bereft of lycopene, the chemical 25 inhibition of lycopene β-cyclases triggers lycopene accumulation. Above lycopene is likely 26 derived from phytoene synthase 2, which is hitherto presumed to be idle in tomato fruits.
    [Show full text]
  • Free Radicals in Biology and Medicine Page 0
    77:222 Spring 2005 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2005) offered by the Free Radical and Radiation Biology Program B-180 Med Labs The University of Iowa Iowa City, IA 52242-1181 Spring 2005 Term Instructors: GARRY R. BUETTNER, Ph.D. LARRY W. OBERLEY, Ph.D. with guest lectures from: Drs. Freya Q . Schafer, Douglas R. Spitz, and Frederick E. Domann The Fine Print: Because this is a paper written by a beginning student as an assignment, there are no guarantees that everything is absolutely correct and accurate. In view of the possibility of human error or changes in our knowledge due to continued research, neither the author nor The University of Iowa nor any other party who has been involved in the preparation or publication of this work warrants that the information contained herein is in every respect accurate or complete, and they are not responsible for any errors or omissions or for the results obtained from the use of such information. Readers are encouraged to confirm the information contained herein with other sources. All material contained in this paper is copyright of the author, or the owner of the source that the material was taken from. This work is not intended as a threat to the ownership of said copyrights. S. Jetawattana Lycopene, a powerful antioxidant 1 Lycopene, a powerful antioxidant by Suwimol Jetawattana Department of Radiation Oncology Free Radical and Radiation Biology The University
    [Show full text]
  • Enzymatic Synthesis of Carotenes and Related Compounds
    ENZYMATIC SYNTHESIS OF CAROTENES AND RELATED COMPOUNDS JOHN W. PORTER Lipid Metabolism Laboratory, Veterans Administration Hospital and the Department of Physiological Chemistry, University of Wisconsin, Madison, Wisconsin 53705, U.S.A. ABSTRACT Data are presented in this paper which establish many of the reactions involved in the biosynthesis of carotenes. Studies have shown that all of the enzymes required for the synthesis of acyclic and cyclic carotenes from mevalonic acid are present in plastids of tomato fruits. Thus, it has been demonstrated that a soluble extract of an acetone powder of tomato fruits converts mevalonic acid to geranylgeranyl pyrophosphate, and isopentenyl pyrophosphate to phytoene, phytofluene, neurosporene and lycopene. Finally, it has been demonstrated that lycopene is converted into mono- and dicyclic carotenes by soluble extracts of plastids of tomato fruits. Whether the enzymes for the conversion of acetyl-CoA to mevalonic acid are also present in tomato fruit plastids has not yet been determined. INTRODUCTION Studies on the enzymatic synthesis of carotenes were, until very recently, plagued by a number of problems. One of these was the fact that the enzymes for the synthesis of carotenes are located in a particulate body, namely chromoplasts or chloroplasts. Hence, a method of solubilization of the enzymes without appreciable loss of enzyme activity was needed. A second problem was concerned with the commercial unavailability of labelled substrate other than mevalonic acid. Thus it became necessary to synthesize other substrates either chemically or enzymatically and then to purify these compounds. Thirdly, the reactions in the synthesis of carotenes appear to proceed much more slowly than many other biochemical reactions.
    [Show full text]
  • Engineering of Geranylgeranyl Pyrophosphate Synthase Levels And
    Engineering of geranylgeranyl pyrophosphate synthase levels and physiological conditions for enhanced carotenoid and astaxanthin synthesis in Jürgen Breitenbach, Hans Visser, Jan C. Verdoes, Albert J. J. Ooyen, Gerhard Sandmann To cite this version: Jürgen Breitenbach, Hans Visser, Jan C. Verdoes, Albert J. J. Ooyen, Gerhard Sandmann. En- gineering of geranylgeranyl pyrophosphate synthase levels and physiological conditions for enhanced carotenoid and astaxanthin synthesis in. Biotechnology Letters, Springer Verlag, 2010, 33 (4), pp.755- 761. 10.1007/s10529-010-0495-2. hal-00653064 HAL Id: hal-00653064 https://hal.archives-ouvertes.fr/hal-00653064 Submitted on 17 Dec 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Section: Microbial and Enzyme Technology Engineering of geranylgeranyl pyrophosphate synthase levels and physiological conditions for enhanced carotenoid and astaxanthin synthesis in Xanthophyllomyces dendrorhous. Jürgen Breitenbach, Hans Visser, Jan C. Verdoes, Albert J.J. van Ooyen, Gerhard Sandmann J. Breitenbach, G. Sandmann* J.W. Goethe Universität, Molecular Biosciences 213, P.O. Box 111932, 60054 Frankfurt, Germany; E-mail:[email protected] Tel.:+49-69-79824746 Fax:+49-69-79824822 J.C. Verdoes** Division of Industrial Microbiology Wageningen University, P.O.
    [Show full text]
  • Sulfur-Containing Compounds: Natural Potential Catalyst for the Isomerization of Phytofluene, Phytoene and Lycopene in Tomato Pulp
    foods Article Sulfur-Containing Compounds: Natural Potential Catalyst for the Isomerization of Phytofluene, Phytoene and Lycopene in Tomato Pulp Lulu Ma 1, Cheng Yang 1, Xin Jiang 1, Qun Wang 1, Jian Zhang 1,2 and Lianfu Zhang 1,2,* 1 School of Food Science and Technology, Jiangnan University, Wuxi 214122, China; [email protected] (L.M.); [email protected] (C.Y.); [email protected] (X.J.); [email protected] (Q.W.); [email protected] (J.Z.) 2 The Food College, Shihezi University, Shihezi 832003, China * Correspondence: [email protected]; Tel.: +86-510-85917025; Fax: +86-510-85917025 Abstract: The effects of some sulfur-containing compounds on the isomerization and degradation of lycopene, phytofluene, and phytoene under different thermal treatment conditions were studied in detail. Isothiocyanates such as allyl isothiocyanate (AITC) and polysulfides like dimethyl trisulfide (DMTS) had the effect on the configuration of PTF (phytofluene), PT (phytoene), and lycopene. The proportion of their naturally occurring Z-isomers (Z1,2-PTF and 15-Z-PT) decreased and transformed into other isomers including all-trans configuration, while Z-lycopene increased significantly after thermal treatment, especially for 5-Z-lycopene. The results showed that increase in heating temper- ature, time, and the concentration of DMTS and AITC could promote the isomerization reaction effectively to some extent. In addition, 15-Z-PT and the newly formed Z4-PTF were the predominant Citation: Ma, L.; Yang, C.; Jiang, X.; isomers in tomato at the equilibrium. Unlike the lycopene, which degraded significantly during Wang, Q.; Zhang, J.; Zhang, L.
    [Show full text]
  • Dimethylallyl Pyrophosphate Is Not the Committed Precursor of Isopentenyl Pyrophosphate During Terpenoid Biosynthesis from 1-Deoxyxylulose in Higher Plants
    Proc. Natl. Acad. Sci. USA Vol. 96, pp. 1309–1314, February 1999 Biochemistry Dimethylallyl pyrophosphate is not the committed precursor of isopentenyl pyrophosphate during terpenoid biosynthesis from 1-deoxyxylulose in higher plants DUILIO ARIGONI*†,WOLFGANG EISENREICH‡,CHRISTOPH LATZEL§,SILVIA SAGNER§,TANJA RADYKEWICZ‡, MEINHART H. ZENK§, AND ADELBERT BACHER‡ *Laboratorium fu¨r Organische Chemie, Eidgeno¨ssische Technische Hochschule, Universita¨tsstrasse16, CH-8092 Zurich, Switzerland; §Lehrstuhl fu¨r Pharmazeutische Biologie, Universita¨t Mu¨nchen, Karlstrasse 29, D-80333 Munich, Germany; and ‡Lehrstuhl fu¨r Organische Chemie und Biochemie, Technische Universita¨t Mu¨nchen, Lichtenbergstrasse 4, D-85747 Garching, Germany Contributed by Duilio Arigoni, December 18, 1998 ABSTRACT Cell cultures of Catharanthus roseus were way to isopentenyl pyrophosphate (IPP) (5) and dimethylallyl supplied with [2-13C,3-2H]-deoxyxylulose or [2-13C,4-2H]1- pyrophosphate (DMAPP) (6) have been identified. deoxyxylulose. Lutein and chlorophylls were isolated from the Phytol (7, Fig. 2), b-carotene, and lutein (8) are biosynthe- cell mass, and hydrolysis of the chlorophyll mixtures afforded sized in Catharanthus roseus from DMAPP and IPP stemming phytol. Isotope labeling patterns of phytol and lutein were largely, if not exclusively, from deoxyxylulose (9). Specifically, determined by 2H NMR and 1H,2H-decoupled 13C NMR. From DMAPP serves as a starter unit, which is converted into the the data it must be concluded that the deuterium atom in common precursor geranylgeranyl pyrophosphate by sequen- position 3 of deoxyxylulose was incorporated into both iso- tial reactions with three IPP units. To obtain information on pentenyl pyrophosphate (IPP) and dimethylallyl pyrophos- the nature and sequence of the unknown steps that lead from 13 phate with a rate of 75% (with respect to the internal C 1-deoxyxylulose to the two C5 building blocks of terpene label).
    [Show full text]
  • The Damage and Tolerance Mechanisms of Pha a Rhodozyma Mutant Strain MK19 Grown at 28 °C
    The damage and tolerance mechanisms of Phaa rhodozyma mutant strain MK19 grown at 28 °C Lili Miao ( [email protected] ) Institute of Microbiology Chinese Academy of Sciences https://orcid.org/0000-0001-8620-2161 Shuang Chi China Agricultural University Ting-Ting Hou Institute of Microbiology Chinese Academy of Sciences Zhi-Pei Liu Institute of Microbiology Chinese Academy of Sciences Ying Li China Agricultural University Research Keywords: Phaa rhodozyma, moderate-temperature strain, astaxanthin, fatty acid, mevalonate pathway Posted Date: November 13th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-48016/v3 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on January 7th, 2021. See the published version at https://doi.org/10.1186/s12934-020-01479-x. Page 1/31 Abstract Background: Phaa rhodozyma has many desirable properties for astaxanthin production, including rapid heterotrophic metabolism and high cell densities in fermenter culture. The low optimal temperature range (17-21 °C) for cell growth and astaxanthin synthesis in this species presents an obstacle to ecient industrial-scale astaxanthin production. The inhibition mechanism of cell growth at > 21 °C in P. rhodozyma have not been investigated. Results: MK19, a mutant P. rhodozyma strain grows well at moderate temperatures, its cell growth was also inhibited at 28 °C, but such inhibition was mitigated, and low biomass 6 g/L was obtained after 100 h culture. Transcriptome analysis indicated that low biomass at 28 °C resulted from strong suppression of DNA and RNA synthesis in MK19.
    [Show full text]