J. Microbiol. Biotechnol. (2018), 28(10), 1691–1699 https://doi.org/10.4014/jmb.1808.08019 Research Article Review jmb Metabolic Engineering of Deinococcus radiodurans for the Production of Phytoene Sun-Wook Jeong†, Chang Keun Kang†, and Yong Jun Choi* School of Environmental Engineering, University of Seoul, Seoul 02504, Republic of Korea Received: August 16, 2018 Revised: August 22, 2018 A metabolically-engineered Deinococcus radiodurans R1 strain capable of producing phytoene, Accepted: August 23, 2018 a colorless C40 carotenoid and a promising antioxidant, has been developed. To make this base First published online strain, first, the crtI gene encoding phytoene desaturase was deleted to block the conversion of August 24, 2018 phytoene to other carotenoids such as lycopene and γ-carotene. This engineered strain *Corresponding author produced 0.413 ± 0.023 mg/l of phytoene from 10 g/l of fructose. Further enhanced production Phone: +82-2-6490-2873; of phytoene up to 4.46 ± 0.19 mg/l was achieved by overexpressing the crtB gene encoding Fax: +82-2-6490-2859; E-mail: [email protected] phytoene synthase and the dxs genes encoding 1-deoxy-D-xylulose-5-phosphate synthase gene, and by deleting the crtD gene. High cell-density culture of our final engineered strain † These authors contributed allowed production of 10.3 ± 0.85 mg/l of phytoene with the yield and productivity of equally to this work. 1.04 ± 0.05 mg/g and 0.143 ± 0.012 mg/l/h, respectively, from 10 g/l of fructose. Furthermore, the antioxidant potential of phytoene produced by the final engineered strain was confirmed pISSN 1017-7825, eISSN 1738-8872 by in vitro DPPH radical-scavenging assay. Copyright© 2018 by The Korean Society for Microbiology Keywords: Metabolic engineering, Deinococcus radiodurans, phytoene, antioxidation and Biotechnology Introduction inhibited by the regular ingestion of phytoene-containing phytonutrients [1-4]. Moreover, considering the critical Isoprenoids, a diverse class of natural organic molecules weaknesses of various carotenoids, such as limited derived from isoprene, are important industrial compounds availability and light sensitivity resulting from the distinctive that have been widely used in various industrial products color that makes carotenoids somewhat unfavorable in such as food additives, pharmaceuticals, biofuels, and cosmetic applications, it also has great advantages over cosmetic ingredients. Especially because of their excellent other colored carotenoids in terms of scalability and antioxidant activity, some isoprenoids such as β-carotene, availability [5]. With this increasing interest in phytoene lycopene, and lutein are getting much attention for their and the rapidly increasing market for carotenoids has come potential use as natural pharmaceutical ingredients. Thus, a greater need for large-scale fermentative production of the size of the global market for antioxidant isoprenoids phytoene through metabolic engineering of microorganisms. has been gradually increasing over the last few decades. There have been several reports on the production of Phytoene (C40H64), one of the colorless carotenoids, is an phytoene by metabolic engineering of the isoprenoid intermediated metabolite of the isoprenoid biosynthetic biosynthetic pathway. Recently, metabolically-engineered pathway as well as a starting metabolite for the biosynthesis Thermococcus kodakarensis strain expressing Saci_1734 from of various carotenoids [1]. Despite the lack of pigment for Sulfolobus acidocaldarius capable of producing up to dissipating the oxidative energy of singlet oxygen, it shares 0.75 mg/l of phytoene was reported [6]. Moreover, 3.4-fold the inherent beneficial efficacies of naturally occurring increased phytoene production was achieved by disruption carotenoids such as anti-oxidation, anti-inflammation, and of acetyl-CoA synthetase I gene followed by double- immune system-boosting ability. Previous studies on the overexpression of Saci_1734. More recently, genetically- effectiveness of phytoene have shown that proliferation of engineered Dunaliella salina V-101 capable of producing human prostate cancer and mammary cells are significantly phytoene up to 108.34 mg/ 100 mg DCW was developed October 2018 ⎪ Vol. 28⎪ No. 10 1692 Jeong et al. by down-regulation of phytoene desaturase using RNAi have been developed [10, 14-18], the metabolic engineering and antisense methods [5]. Another study also reported the of D. radiodurans for the production of high-value carotenoid highest level of phytoene production (up to 10 mg/g DCW) compounds has not yet been reported. These observations using Xanthophyllomyces dendrorhous by deleting the crtI led us to explore the potential of D. radiodurans for the gene together with overexpressing the crtE and crtYB genes production of phytoene by rational metabolic engineering [7, 8]. for the first time. An extremophilic bacterium, Deinococcus radiodurans has To achieve this goal, the crtI and crtD genes encoding been well-known for its inherent biosynthetic pathway for phytoene synthase and carotenoid 3’,4’-desaturase, respectively, the biosynthesis of various carotenoids [9, 10]. It also has were sequentially deleted in D. radiodurans. Then, the crtB an extremely high concentration of intracellular glucose-6- and dxs genes were overexpressed to increase the carbon phosphate and NADP(H), which are essential for the flux towards phytoene. Furthermore, we also evaluated the synthesis of carotenoids [11]. Moreover, the bacterium has antioxidant activity of the produced phytoene by in vitro various genes of particular interest that deserve to be DPPH radical-scavenging assay. engineered for increasing tolerance to external stresses [9]. Significantly enhanced cellular tolerance to external stresses Materials and Methods such as osmotic pressure, high salts, temperature, and pH that can be caused during fermentation was observed by Bacterial Strains and Cultivation heterologous overexpression of those of genes [12, 13]. All bacterial strains and plasmids in this study are listed in Thus, D. radiodurans is of particular interest due to its Table 1. Deinococcus radiodurans strains were routinely cultured at potential to be used as a platform strain and its superiority 30°C in TGY (0.5% tryptone, 0.3% yeast extract, and 0.1% glucose). to other microorganisms such as Saccharomyces cerevisiae, Batch culture was carried out using modified minimal media (per liter) containing 20 mM phosphate buffer (pH 7.0), 15mM (NH) SO , and Corynebacterium glutamicum for the production of a 4 2 4 5 μM MnCl , 0.8 mM MgCl , 0.18 mM CaCl , 10 g fructose, 10 mg/ml variety of carotenoids. However, there has been no report 2 2 2 vitamins mix (Sigma), 50 mg/l L-cysteine, 25mg/l L-histidine, about intensive engineering of D. radiodurans for industrial 25mg/l L-methionine, and 1 g yeast extract [19]. To obtain high application. This situation seems due to the lack of genetic cell density, D. radiodurans were cultured in modified rich medium manipulation tools for the engineering of D. radiodurans. (50 mM HEPES, 10 g/l tryptone, 5 g/l yeast extract, 0.5 g/l MgSO4 Although lots of available metabolic information on • 7H2O, and 5 μM MnCl2) supplemented with 10 g/l fructose [21]. carotenoid pathway together with genetic engineering tools The cell density was measured using a spectrophotometer Table 1. Bacterial strains and plasmids used in this study. Description Reference Strains D. radiodurans R1 Wild type (ATCC13939) ATCC E. coli DH5α Host for plasmid subclones Lab stock Plasmids pAM1 A derivative of pKatAPH3 containing lox66-kmr-lox71 cassette r pAM2 A derivative of p13840 containing PGroES-cre-PGroES-cm [12] pRADZ3 E. coli-D. radiodurans shuttle vector for overexpression of genes controlled by groE promoter pAM41 A derivative of pRADZ3 containing crtB gene This study pAM42 A derivative of pRADZ3 containing crtE gene This study pAM73 A derivative of pRADZ3 containing dxs gene This study pAM74 A derivative of pRADZ3 containing idi gene This study pAM103 A derivative of pAM41 containing crtE gene This study pAM104 A derivative of pAM41 containing dxs gene This study pAM105 A derivative of pAM41 containing idi gene This study J. Microbiol. Biotechnol. Metabolic Engineering of Deinococcus radiodurans for Phytoene Production 1693 (Thermoscientific, USA) with a wavelength of 600 nm and Table 2. Primers used in this study. converted into DCW (g/l) using a standard curve. Escherichia coli Primer Sequence (5’ to 3’)a DH5α was used as the cloning host for propagation of expression crtI knockout plasmid and cultured at 37°C in Luria-Bertani medium (LB). crtI-1 catagtgaaagaaacgtctg When necessary, antibiotics were added at final concentration of 100 μg/ml ampicillin for E. coli, and 3 μg/ml chloramphenicol crtI-2 agcttatcgataccgtcgacgacagtaaacctcggaagtc and 25 μg/ml kanamycin for D. radiodurans. crtI-3 gacttccgaggtttactgtcgtcgacggtatcgataagct crtI-4 ttaagcggaatccgtatgaccatgcctgcaggtcgactct Knockout Mutant Construction crtI-5 agagtcgacctgcaggcatggtcatacggattccgcttaa The construction of all knockout mutants in this study was crtI-6 ttggtccacatgctggtgca carried out using Cre-loxP system as previously described [14]. In brief, the DNA fragment containing lox66-kmr-lox71 cassette flanked dr0810 knockout by approximately 1 kb of both up and downstream nucleotide dr0810-1 gttgtatacgctcgacggcg sequences of target genes (crtI, dr0810, or crtD) was amplified by dr0810-2 agcttatcgataccgtcgacactccacaggcgacttcaca PCR from pAM1 plasmid and D. radiodurans genomic