Different Levels of Hsp70 and Hsc70 Mrna Expression in Iberian Fish Exposed to Distinct River Conditions

Research Article

Different levels of hsp70 and hsc70 mRNA expression in Iberian fish exposed to distinct river conditions

Tiago F. Jesus, Ângela Inácio and Maria M. Coelho Centro de Biologia Ambiental, Faculdade de Ciências, Universidade de Lisboa, Campo Grande, Lisbon, Portugal.

Abstract Comprehension of the mechanisms by which ectotherms, such as fish, respond to thermal stress is paramount for understanding the threats that environmental changes may pose to wild populations. Heat shock proteins are molecular chaperones with an important role in several stress conditions such as high temperatures. In the Iberian Penin- sula, particularly in Portugal, freshwater fish of the genus Squalius are subject to daily and seasonal temperature variations. To examine the extent to which different thermal regimes influence the expression patterns of hsp70 and hsc70 transcripts we exposed two species of Squalius (S. torgalensis and S. carolitertii) to different temperatures (20, 25, 30 and 35 °C). At 35 °C, there was a significant increase in the expression of hsp70 and hsc70 in the southern species, S. torgalensis, while the northern species, S. carolitertii, showed no increase in the expression of these genes; however, some individuals of the latter species died when exposed to 35 °C. These results suggest that S. torgalensis may cope better with harsher temperatures that are characteristic of this species natural environment; S. carolitertii, on the other hand, may be unable to deal with the extreme temperatures faced by the southern species. Keywords: Cyprinidae, heat shock proteins, Squalius, thermal stress. Received: June 18, 2012; Accepted: December 14, 2012.

Introduction nism has a significant ecological and evolutionary role in Many organisms are frequently exposed to stressful natural populations (Sørensen et al., 2003; Fangue et al., environmental conditions, such as temperature variations, 2006; Straalen and Roelofs, 2006). In addition to thermal that pose substantial challenges to their survival and repro- stress, other factors such as insecticides, heavy metals, des- duction (López-Maury et al., 2008). Stressful conditions iccation, diseases and parasites can also induce Hsp may limit the geographical distribution of organisms by (Lindquist and Craig, 1988; Sørensen et al., 2003; Fangue causing them to move to more suitable locations et al., 2006). Heat shock proteins are vital for proper cell (Hoffmann and Sgrò, 2011). Organisms can also deal with functioning since they facilitate the folding and refolding of stressful conditions by adapting to them, either through proteins and the degradation of misfolded, aggregated or changes in the genetic composition of populations as a re- denaturated proteins (Lindquist and Craig, 1988; Ohtsuka sult of selection, and/or by phenotypic plasticity; without and Suzuki, 2000; Sørensen et al., 2003; Wegele et al., this adaptability many species would become extinct 2004). (Sørensen et al., 2003; Dahlhoff and Rank, 2007; Berg et Several closely related hsp genes have been identi- al., 2010; Hoffmann and Sgrò, 2011). Most animal species fied and grouped into families based on their evolutionary (> 99%), including fish, are ecthoterms that cannot regulate relationships (Lindquist and Craig, 1988). The exten- their body temperature and this ultimately affects their me- sively studied 70-kDa heat shock protein (Hsp70) belongs tabolism (Berg et al., 2010). Since increases in temperature to a multi-gene family and its gene expression varies un- are one of the major consequences of climate change it is der different physiological conditions (Lindquist and important to know how organisms, particularly ecthoterms, Craig, 1988). The genes that encode the Hsp70 proteins respond to high temperatures. (hsp70s) are considered the major hsp gene family and Heat shock proteins (Hsp) are part of an important consist of exclusively inducible (hsps), exclusively con- mechanism that helps organisms to cope with adverse envi- stitutive [Heat shock cognates (hscs)] and even simulta- ronmental conditions such as thermal stress. This mecha- neously inducible and constitutive genes (Lindquist and Craig, 1988; Ohtsuka and Suzuki, 2000; Place and Hofmann, 2001; Sørensen et al., 2003). The hsp70 genes Send correspondence to T.F. Jesus. Faculdade de Ciências, Edifício C2, Room 2.3.12, Universidade de Lisboa, Campo Grande, and the genes that encode the Hsc70 protein (hsc70)be- 1749-016 Lisbon, Portugal. E-mail: [email protected]. long to the hsp70 gene family. Whereas hsp70 genes are 62 Jesus et al. induced by several types of stress, hsc70 genes are mainly constitutively expressed under normal (non-stress) conditions (Lindquist and Craig, 1988; Ohtsuka and Suzuki, 2000; Yamashita et al., 2004). Members of the hsp70 gene family have been widely studied in many organisms and distinct expression patterns have been found. Several studies have reported a relationship between the expression patterns of hsp70 and environmental variations throughout a species range (Sørensen et al., 2001; Fangue et al., 2006; Karl et al., 2009; Sørensen et al., 2009; Blackman, 2010; Sarup and Loeschcke, 2010). For example, Fangue et al. (2006) detected significant differences in the gene expression levels of hsp70 between northern and southern populations of Fundulus heteroclitus in North America, with the latter being exposed to higher temperatures. Similarly, Sørensen et al. (2009) found that southern populations of Rana temporaria from Sweden, when exposed to higher temperatures, had the highest lev- Figure 1 - Geographical distribution of S. torgalensis and S. carolitertii in els of Hsp70 protein expression. Portugal, with the respective sampling sites marked with triangles. The hsc70 gene was initially described as being constitutively expressed under normal and stressful conditions The main goal of this study was to gain insights into (Lindquist and Craig, 1988; Place and Hofmann, 2001; Yeh the potentially important molecular mechanism involved in and Hsu, 2002; Yamashita et al., 2004). Fangue et al. the response of S. carolitertii and S. torgalensis to thermal (2006) reported that individuals from southern populations stress, particularly since these species inhabit regions with of F. heteroclitus showed enhanced expression of this gene distinct environmental regimes. Specifically, we examined at higher temperatures. This finding demonstrates the im- the hsp70 and hsc70 gene transcription patterns for each portance of studying the expression of hsp70 genes in species exposed to different temperatures and compared the closely related species or populations exposed to different patterns between the two species; we also tried to correlate temperature regimes in their natural habitats. These find- our findings with the ecological context of each species. ings also suggest that Hsps play an important role in ther- Finally, we examined whether the patterns of transcript ex- mal tolerance and that, despite being occasionally parado- pression (for the genes of interest) were similar to those of xical, the expression patterns of these genes must be muscle, which is the most frequently used tissue in such interpreted according to the ecological context of each spe- studies (Yamashita et al., 2004). The results described here cies (Sørensen et al., 2003). provide useful insights into the roles of hsp70 and hsc70 In the Iberian Peninsula, particularly in Portugal, the gene expression in the response of Iberian Squalius to ther- congeneric freshwater fish species, Squalius carolitertii mal stress. (Cyprinidae) (Doadrio, 1988), a species of least concern (Rogado et al., 2006), and Squalius torgalensis (Coelho et Methods al., 1998), a critically endangered species (Cabral et al., 2006), inhabit distinct regions. Squalius carolitertii inhab- Sampling and maintenance of fish its the northern region whereas S. torgalensis is restricted to a small river basin (the Mira river) in the southwestern re- Adult fish (6-8 cm long) of S. carolitertii and S. gion (Figure 1) (Cabral et al., 2006). In these areas, the two torgalensis were collected from Portuguese rivers by elec- species are exposed to different environmental conditions tro-fishing (300 V, 4 A) (Figure 1). The pulses used were of with distinct seasonal and even daily water temperature low duration to avoid killing juveniles. Sampling was done variations. The northern rivers of Portugal have lower tem- during the spring, when the water temperature in the south- peratures and fewer temperature fluctuations than the ern and northern rivers is ~18-22 °C. Fish of both sexes southern rivers (Henriques et al., 2010; SNIRH). In north- were used since there is no sexual dimorphism in either spe- ern rivers, the maximum temperature usually does not ex- cies. Squalius torgalensis individuals were sampled in the ceed 31 °C (range: 3-31 °C), whereas southern rivers are Mira river basin since this species is endemic to this region characterized by an intermittent regime of floods and and individuals of S. carolitertii were collected in the Mon- droughts in which, during the dry season, freshwater fish dego, Vouga and Douro river basins of the northern region. are trapped in small pools in which temperatures can reach The fish were maintained in ~30 L aquaria at 20 °C (mean 38 °C (range: 4-38 °C) (Magalhães et al., 2003; Henriques temperature observed during sampling) on a 12 h photo- et al., 2010; SNIRH). period and were fed daily with commercial flake fish food. Thermal stress in Iberian cyprinids 63

Experimental design (forward) and TGACCTTCTCCTTCTGAGC (reverse) After two weeks of acclimatization (to reduce the were designed using PerlPrimer software v.1.1.19 (Mar- stress caused by fishing and confinement), individuals of shall, 2004). The resulting amplicons were sequenced and each species were subjected to four temperature regimens: the sequences then checked manually for errors using 20 °C (control temperature) and increases in temperature SEQUENCHER v.4.2 (Gene Codes Corporation, Ann Ar- from 20 °C to 25 °C, 30 °C and 35 °C (testing tempera- bor, MI, USA). The identities of the genes of interest were tures). These increases in temperature were achieved with confirmed by BLAST searches (Zhang et al., 2000). gradual increments of 1 °C per day and, once the testing Multiplex PCRs were used to amplify the temperature was reached, individuals were kept at this tem- glyceraldehyde 3-phosphate dehydrogenase (gapdh) serv- perature for 24 h. Six to seven individuals of each species ing as internal control and the gene of interest, which al- were exposed to each experimental condition, with each in- lowed normalized quantification of the mRNAs of interest dividual being exposed to only one experimental condition. (hsp70 or hsc70). The primers used to amplify gapdh were After acclimatization at the desired test temperature, fish ATCAGGCATAATGGTTAAAGTTGG (forward) (Pala were anesthetized with 300 mg/L tricaine mesylate (MS- et al., 2008) and GGCTGGGATAATGTTCTGAC (re- 222; Sigma-Aldrich, St. Louis, MO, USA) and fin clips verse) (Matos IM, unpublished). Gapdh has been exten- were collected from the pectoral, pelvic and upper caudal sively used as an internal control in several studies and has fins. The fin clips from each fish were pooled and stored at been validated as a good reference gene for gene expression -80 °C until RNA extraction. To compare the expression studies in different experimental conditions (Aoki et al., patterns of fins and muscle and determine whether fin clips 2000; Zhou et al., 2010), including those involving temper- could be used instead of muscle to assess transcript expres- ature changes (Liu et al., 2012). Semi-quantitative RT- sion, four individuals of S. torgalensis (one per test temper- PCRs were optimized to ensure the amplification of both ature) and 16 individuals of S. carolitertii (four per test cDNAs in the exponential phase (Serazin-Leroy et al., temperature) were euthanized with MS-222 and muscle tis- 1998; Breljak and Gabrilovac 2005). The amplification sue was collected. Since S. torgalensis is a critically endan- conditions for the pair hsp70/gapdh were those described in gered species, our study was designed to minimize the the manufacturers instructions (QIAGEN multiplex PCR number of individuals euthanized. kit, Qiagen Inc., Valencia, CA, USA) (final concentration: 1 PCR master mix with 3 mM MgCl2, 0.5 of Q-solution and RNA extraction and cDNA synthesis 0.2 mM of each primer), with an initial denaturation step at For RNA extraction, TRI Reagent (Ambion, Austin, 95 °C for 15 min, followed by 30 cycles at 95 °C for 1 min, TX, USA) was added to fin clips and muscle samples. After 58 °C for 1 min and 30 s and 72 °C for 1 min, with a final homogenization with an Ultra-Turrax homogenizer (IKA, extension at 72 °C for 10 min. For the gene pair Staufen, Germany), RNA was extracted according to the hsc70/gapdh, the PCR conditions were: 1 unit of GoTaq manufacturers protocol and TURBO DNase (Ambion) was Flexi DNA polymerase (Promega, Madison, WI, USA) used to degrade any remaining genomic contaminants, fol- with 0.3 mM of each primer, 0.25 mM of each dNTP and lowed by phenol/chloroform purification and LiCl precipi- 2 mM of MgCl2. The cycling conditions included an initial tation (Cathala et al., 1983). Glycogen was used as a co- denaturation step at 95 °C for 5 min, followed by 35 cycles precipitant in RNA precipitation (Sigma-Aldrich). The at 95 °C for 1 min, 58 °C for 45 s and 72 °C for 1.5 min, with quality of the samples was checked using a Nanodrop-1000 a final extension at 72 °C for 10 min. Controls without tem- spectrophotometer (Thermo Scientific, Waltham, MA, plate and without RT (reverse transcriptase) were included USA) based on the 260/280 nm and 260/230 nm to check for PCR contamination and genomic DNA con- absorbance ratios. The concentrations of the samples were tamination, respectively. determined to ensure a sufficient amount of homogeneous For transcript quantification, 4 mL of each PCR prod- RNA for complementary DNA (cDNA) synthesis. cDNA uct was loaded onto a 1% agarose gel stained with RedSafe was synthesized using a RevertAid H Minus First Strand (Chembio Ltd, Hertfordshire, England) and the gels were cDNA synthesis kit (Fermentas Inc., Glen Burnie, MD, photographed with a DC290 Kodak digital camera for sub- USA), according to the manufacturer’s instructions and sequent image densitometry using ImageJ 1.43 U software stored at -20 °C. (Abramoff et al., 2004). An uncalibrated OD was used (Abramoff et al., 2004) and the band of interest was quanti- Semi-quantitative RT-PCR fied and normalized against the internal control band Sixty-one individuals (31 S. torgalensis and 30 S. (gapdh) present in the same lane. carolitertii) were used for quantification of the target transcripts. The hsp70-specific primers Real-time RT-PCR GGCCCTCATCAAACGC (forward) and To assess whether the results obtained with TTGAAGGCGTAAGACTCCAG (reverse) and the semi-quantitative PCR corresponded to valid transcript ex- hsc70-specific primers GTTCAAGCAGCCATCTTAGC pression patterns, an experiment with real-time PCR was 64 Jesus et al. done. In this experiment, three individuals from each ex- transcript expression patterns across the experimental perimental condition for both species were analyzed with conditions for both genes. Whenever the assumptions of two PCR replicates. The primer pairs homoscedasticity and normality were not met, non- AATTCCACCTGCACCACG (forward) and parametric Kruskal-Wallis analyses were done and the re- TCTCCTCTTTGCTCAGTCTG (reverse) and sults from both analyses were compared. Post-hoc para- TTTGCTGTTGGATGTCACTC (forward) and metric and non-parametric comparisons were performed, GTGGGAATGGTGGTGTTC (reverse) were used to am- using the Tukey test and Dunn’s test, respectively. The plify the hsp70 and hsc70 genes, respectively. These spe- real-time PCR data were analyzed in a manner similar to cific primers were designed based on the sequences that used for semi-quantitative PCR, except that the fold previously obtained from semi-quantitative PCR. The rela- change was calculated by the method of Pfaffl (2001). Prior tive expression levels of the genes of interest were mea- to analysis, the real-time PCR data were transformed as de- sured against gapdh (reference gene). The primers used to scribed by Willems et al. (2008); the statistical tests used amplify the gapdh gene were were the same as those used for semi-quantitative PCR. In GTACAAGGGTGAGGTTAAGGC (forward) and all cases, a value of p < 0.05 indicated significance. All sta- GTGATGCAGGTGCTACATACGT (reverse). All pairs tistical comparisons were done using Statistica 9.0 software of primers used were designed using PerlPrimer software (StatSoft, 2009). v.1.1.19 (Marshall, 2004). Real-time PCRs were done in a final volume of 15 mL Results containing 7.5 mL of SsoFas EvaGreen Supermix (Bio- Survival in the experiments Rad, Hercules, CA, USA) and 0.6 mL of each primer (with a concentration of 0.4 mM). The assay conditions included an Two of seven S. carolitertii individuals did not reach initial denaturation step at 95 °C for 30 s, followed by the 35 °C experimental condition because they died during 40 cycles at 95 °C for 5 s and 55 °C for 5 s. The reactions the increase from 34 °C to 35 °C. In contrast, none of the S. were done in a Bio-Rad CFX96 system (Bio-Rad). Controls torgalensis individuals died or showed signs of loss of without template and without RT were included to check equilibrium during the experiments. In the experiment to for PCR contamination and genomic DNA contamination, compare gene expression in muscle and fins, all individuals respectively. The identities of the amplicons were con- of S. carolitertii died at 34 °C, before reaching 35 °C. firmed by melting curve analysis and Sanger sequencing. Expression pattern of the hsp70 gene The PCR efficiency for each sample was assessed using LinRegPCR 11.1 software, which fits a regression line to a Initially, the identity of each amplicon was confirmed subset of data points in the log-linear phase (Ruijter et al., by sequencing. This showed that the hsp70 primers ampli- 2009). PCR efficiency ranged from 1.91 to 2 for all primer fied a fragment with high homology to the inducible form pairs (1.91 for hsp70 primers and 2 for gapdh and hsc70 of hsp70 from other cyprinids, including Megalobrama primers). The relative amount of the genes of interest was amblycephala (96.5% identity; accession number: calculated by the comparative threshold cycle (CT) method EU884290), Tanichthys albonubes (96% identity; with efficiency correction, using the mean PCR efficiency HQ007352), Cyprinus carpio (95.4% identity; for each amplicon (Ruijter et al., 2009). AY120894), Carassius auratus (94.3% identity; AB092839) and Danio rerio (91.7% identity; BC056709). Statistical analysis The sequences of the hsp70 genes of S. torgalensis and S. In the semi-quantitative PCR analysis, arbitrary val- carolitertii were deposited in GenBank under accession ues for quantification of the band of interest (hsp70 or numbers JQ608477 and JQ608476, respectively. hsc70) were divided by the corresponding value for the In both species, the levels of hsp70 gene expression in control band (gapdh) to obtain a hsp70/gapdh or muscle and fin clips with increasing water temperature hsc70/gapdh ratio. were similar in both tissues (Figure S1, Supplementary ma- In graphs of the fold change in expression for each terial). Consequently, in all subsequent analyses fin clips transcript a temperature of 20 °C was considered the con- were used in order to avoid euthanasia of the fish. trol condition and assigned a value of 1. The fold variation In S. torgalensis exposed to 35 °C there was a 59-fold in the other treatments, relative to the control condition, increase in the hsp70 mRNA levels when compared with = was calculated as follows: Ixnxiiå / 20 , where Ii is the 20 °C (control condition) and an ~53-fold increase when mean fold increase in expression, xi is the observed value, compared with 30 °C. In contrast, in S. carolitertii the cor- x20 is the mean value of observations at 20 °C for each spe- responding expression increased by no more than three- cies and n is the number of individuals of each species per fold, even at the highest temperature (Figure 2). Statistical tested temperature. analyses indicated a significant difference in hsp70 mRNA The data were log transformed [log10(x + 1)] for anal- expression among S. torgalensis exposed to different tem- ysis of variance (ANOVA) in order to test for differences in peratures (F = 29.486, df = 3, p < 0.001), with post-hoc Thermal stress in Iberian cyprinids 65

Figure 2 - Fold change in hsp70 transcript expression in S. torgalensis and Figure 3 - Fold change in hsp70 transcript expression in S. torgalensis and S. carolitertii compared to 20 °C (control condition), as assessed by S. carolitertii compared to 20 °C (control condition), as assessed by semi-quantitative PCR. The columns are the mean ± SD of 6 or 7 fish. real-time PCR. The columns are the mean ± SD of 6 or 7 fish. p < 0.05 p < 0.05 compared to all other treatments. compared to all other treatments. comparisons showing that S. torgalensis exposed to 30 °C The levels of hsc70 gene expression in muscle and fin and 35 °C had a significant increase in hsp70 levels com- clips from S. carolitertii were similar in both tissues, but pared with those observed at 20 °C and 25 °C (Table S1, this was not the case for S. torgalensis (Figure S1, Supple- Supplementary material). Post-hoc comparisons also dem- mentary material); the latter species showed higher expres- onstrated a significant difference between fish exposed to sion in the fins compared to muscle and all subsequent 30 °C and 35 °C (Table S1, Supplementary material). There analyses were done with fins. were no significant differences in the mRNA levels among Individuals of S. torgalensis exposed to 35 °C showed the groups of S. carolitertii exposed to different tempera- a 14-fold increase in hsc70 mRNA levels compared to tures (H = 3.086, df = 3, p > 0.300). As this latter dataset vi- 20 °C (control condition) and an ~12-fold increase com- olated the assumption of homoscedasticity the results were pared to 30 °C (Figure 4). One-way ANOVA indicated sig- also compared with a non-parametric test but the outcome nificant differences in the expression levels of the hsc70 was the same, i.e, there were no differences in the expres- gene among the four temperatures (F = 12.504, df =3, sion of hsp70 in S. carolitertii exposed to different tempera- p < 0.001) and post-hoc comparisons identified a difference tures (F = 1.220, df = 3, p > 0.300). between the 35 °C treatment and the other three tempera- In general, the real-time PCR results showed similar tures (Table S3, Supplementary material). Kruskal-Wallis patterns to those obtained with semi-quantitative PCR for analysis confirmed the presence of significant differences both species, although for S. torgalensis the expression pat- among the experimental conditions (H = 15.351, df =3, tern of the hsp70 gene obtained with real-time PCR differed significantly (F = 92.356, df = 3, p < 0.001) among the experimental conditions (Table S2, Supplementary material) (Figure 3). Since this dataset did not satisfy the assumption of homogeneity of variances a non-parametric test was also applied and showed a significant difference in the mRNA expression levels between 20 °C and 35 °C (H = 9.974, df = 3, p < 0.050) (Table S2, Supplementary material).

Expression pattern of the hsc70 gene The pair of hsc70 primers amplified a fragment with high homology to the hsc70-1 gene from C. carpio (78.2% identity; AY120893), followed by hsc70 from D. rerio (81.5% identity; L77146), M. amblycephala (80.9% identity; EU623471) and Ctenopharyngodon idella (80.1% identity; EU816595). The hsp70 gene sequences of S. Figure 4 - Fold change in hsc70 transcript expression in S. torgalensis and torgalensis and S. carolitertii were deposited in GenBank S. carolitertii compared to 20 °C (control condition), as assessed by under accession numbers JQ608475 and JQ608474, re- semi-quantitative PCR. The columns are the mean ± SD of 6 or 7 fish. spectively. p < 0.05 compared to all other treatments. 66 Jesus et al. p < 0.005). Although the non-parametric post-hoc test 2004; McMillan et al., 2005; Fangue et al., 2006; Karl et showed no significance between the 30 °C and 35 °C treat- al., 2009; Sørensen et al., 2009; Sarup and Loeschcke, ments, a significant difference was still observed between 2010; Waagner et al., 2010). There were significant differ- the 20 °C and 35 °C groups (Table S3, Supplementary ma- ences in the expression of this gene between S. torgalensis terial). In contrast, the increase in mRNA levels in S. exposed to 20 °C and those exposed to other temperatures, carolitertii was not greater than three-fold, with the greatest particularly 35 °C. This result was somewhat expected increase occurring at 30 °C, although this was not statisti- since S. torgalensis inhabits an environment that is suscep- cally significant (F = 1.439, df = 3, p > 0.200) (Figure 4). tible to extreme conditions (such as small ponds that can Real-time PCR confirmed the significant increase in reach high temperatures during the dry season) and should hsc70 expression in S. torgalensis at 35 °C (F = 4.481, therefore be able to deal with protein denaturation. In con- df = 3, p < 0.050), whereas S. carolitertii showed no signifi- trast, S. carolitertii showed no significant increase in hsp70 cant differences among the experimental conditions expression levels, which suggests that this species is unable (F = 1.391, df = 3, p > 0.300) (Table S4, Supplementary ma- to respond to stressful conditions associated with eleva- terial) (Figure 5). tions in temperature. Unlike S. torgalensis, which showed the largest induction of hsp70, some individuals of S. Discussion carolitertii died at 35 °C, possibly because of this species inability to adjust to thermal stress. The failure of S. In this study, we used fin samples (instead of other or- carolitertii to increase the expression of hsp70 may reflect gans) to measure hsp70 transcript expression, thereby its poor ability to adapt to 35 °C; this conclusion agrees avoiding the euthanasia of animals, which is a particularly with the fact that in its natural environment this species relevant consideration when studying endangered species. never experiences temperatures > 31 °C (SNIRH). Our finding agree with those of Yamashita et al. (2004) who found similar patterns of Hsp70 expression in muscle However, other mechanisms may also be involved in and in fibroblasts cultured from caudal fin tissue of the responses to thermal stress, including the hormone Xyphophorus maculatus.InS. carolitertii, fin clips and cortisol, heat shock factors (involved in the regulation of muscle showed similar patterns of hsc70 expression, but the heat shock response), other hsps and even transcripts this similarity was not so evident for S. torgalensis. How- that encode other proteins (such as the protein Wap65) ever, this result needs to be interpreted with caution given (Tomanek and Somero, 2002; Frydenberg et al., 2003; the small number of muscle samples used from the latter Kassahn et al., 2007; Sarropoulou et al., 2010; Tymchuk et species. Nevertheless, there was an increase in hsc70 al., 2010; Celi et al., 2012). To clarify the molecular mech- mRNA expression in fins of S. torgalensis in response to anisms involved, future experiments should examine how higher temperatures. temperature influences cortisol levels in both species since As shown here, there was an increase in hsp70 mRNA interactions between Hsp and cortisol are known to be in- levels in S. torgalensis individuals exposed to higher tem- volved in stress responses (Celi et al., 2012). The divergent peratures, as also reported for hsp70s in other species response between the two species may also reflect the more (Buckley et al., 2001; Yeh and Hsu, 2002; Yamashita et al., stable environment, with less severe temperature variations, in northern rivers compared to southern rivers (SNIRH). The hsc70 gene is often considered to be part of constitutive cell functions in non-stress situations such that an increase in temperature may either decrease or have no effect on the expression of this gene (Yeh and Hsu, 2002; Yamashita et al., 2004; López-Maury et al., 2008). As shown here, there was no significant variation in hsc70 mRNA expression in S. carolitertii at the different temperatures. In contrast, S. torgalensis showed a significant increase in hsc70 expression in fins at 35 °C when compared with the other temperatures. Thus, S. torgalensis can en- hance the mRNA expression of inducible hsp70 and constitutive hsc70 in response to increases in temperature. The latter finding is similar to that of Fangue et al. (2006) who reported an increase in hsc70 mRNA levels during heat stress in F. heteroclitus from southern North America. In Figure 5 - Fold change in hsc70 transcript expression in S. torgalensis and S. carolitertii compared to 20 °C (control condition), as assessed by addition, ATPase activity has been observed in Gillichthys real-time PCR. The columns are the mean ± SD of 6 or 7 fish. p < 0.05 mirabilis Hsc70 at high temperatures, suggesting that this compared to all other treatments. protein can function even at extreme temperatures (Place Thermal stress in Iberian cyprinids 67 and Hofmann, 2001). With regard to our findings, the lack Berg MP, Kiers ET, Driessen G, Heijden M, Kooi BW, Kuenen F, of an increase in mRNA expression levels in muscle makes Liefting M, Verhoef HA and Ellers J (2010) Adapt or dis- it difficult to conclude that hsc70 expression confers pro- perse: Understanding species persistence in a changing tection against thermal stress, although the enhanced ex- world. Glob Change Biol 16:587-598. pression in fins may indicate that the extensive contact Blackman BK (2010) Connecting genetic variation to phenotypic clines. Mol Ecol 19:621-623. surface of this tissue with the external environment might favor this response. Another possible explanation for the Breljak D and Gabrilovac J (2005) Comparison of three RT-PCR based methods for relative quantification of mRNA. Food variation in mRNA levels between these tissues could be Technol Biotechnol 43:379-388. the existence of negative feedback (between Hsp and Buckley BA, Owen ME and Hofmann GE (2001) Adjusting the mRNAs) in the regulation of hsp gene expression (Celi et thermostat: The threshold induction temperature for the al., 2012). heat-shock response in intertidal mussels (genus Mytilus) The increase in hsp70 expression seen at higher tem- changes as a function of thermal history. J Exp Biol peratures in S. torgalensis may be important in the degrada- 204:3571-3679. tion and re-folding of denatured proteins and suggests that Cathala G, Savouret JF, Mendez B, West BL, Karin M, Martial JA these fish are adapted to deal with high temperatures when and Baxter JD (1983) A method for isolation of intact, they are trapped in ponds during the dry season; in contrast, translationally active ribonucleic acid. DNA 2:329-335. S. carolitertii is unable to deal with such high temperatures. Celi M, Vazzana M, Sanfratello MA and Parrinello N (2012) Ele- Magalhães et al. (2003) stated that S. torgalensis has traits vated cortisol modulates Hsp70 and Hsp90 gene expression and protein in sea bass head kidney and isolated leukocytes. typical of species adapted to harsh environments (short life Gen Comp Endocrinol 175:424-431. span, earlier spawning age and small body size compared to Dahlhoff EP and Rank NE (2007) The role of stress proteins in re- other Squalius that inhabit more stable environments). In sponses of a montane willow leaf beetle to environmental addition, species living closer to their thermal tolerance temperature variation. J Biosci 32:477-488. limits may be particularly prone to small changes in their Fangue NA, Hofmeister M and Schulte PM (2006) Intraspecific thermal regime (Dahlhoff and Rank, 2007; Reusch and variation in thermal tolerance and heat shock protein gene Wood, 2007; Sørensen et al., 2009; Somero, 2010; To- expression in common killifish, Fundulus heteroclitus.J manek, 2010; Hoffmann and Sgrò, 2011). In this regard, in- Exp Biol 209:2859-2872. termittent systems such as that of the Mira river basin are Frydenberg J, Hoffmann AA and Loeschcke V (2003) DNA se- particularly vulnerable to environmental changes. Changes quence variation and latitudinal associations in hsp23, hsp26 in the seasonal regime of floods and droughts, with the in- and hsp27 from natural populations of Drosophila creasing occurrence of severe droughts, may pose new melanogaster. Mol Ecol 12:2025-2032. challenges to these fish. Hence, to preserve this species, it Henriques R, Sousa V and Coelho MM (2010) Migration patterns would be advisable to promote habitat conservation with a counteract seasonal isolation of Squalius torgalensis, a criti- particular emphasis on the conservation of refuges (pools) cally endangered freshwater fish inhabiting a typical circum-Mediterranean small drainage. Conserv Genet during the dry season (Sousa-Santos et al., 2009; Henriques 11:1859-1870. et al., 2010). Hoffmann AA and Sgrò CM (2011) Climate change and evolutionary adaptation. Nature 470:479-485. Acknowledgments Karl I, Sørensen JG, Loeschcke V and Fischer K (2009) HSP70 expression in the Copper butterfly Lycaena tityrus across al- We thank Carla Sousa-Santos, Joana Martelo, Maria titudes and temperatures. J Evol Biol 22:172-178. Ana Aboim, Miguel Santos, Miguel Machado and Isa Ma- Kassahn KS, Crozier RH, Ward AC, Alister C, Stone G and Caley tos for help in capturing and maintaining the fish. We also MJ (2007) From transcriptome to biological function: Envi- thank Isa Matos and Diogo Silva who, respectively, de- ronmental stress in an ectothermic vertebrate, the coral reef signed the reverse primer used for gapdh amplification in fish Pomacentrus moluccensis. BMC Genomics 8:e358. semi-quantitative PCR and revised the manuscript. This Lindquist S and Craig EA (1988) The heat-shock proteins. Annu work was supported by the FCT Project PTDC/BIA- Rev Genet 22:631-677. BDE/69769/2006. Fishing licenses were provided by Liu C, Wu G, Huang X, Liu S and Cong B (2012) Validation of Direcção Regional dos Recursos Florestais (DGRF). housekeeping genes for gene expression studies in an ice alga Chlamydomonas during freezing acclimation. Extre- References mophiles 16:419-425. López-Maury L, Marguerat S and Bähler J (2008) Tuning gene Abramoff MD, Magelhães PJ and Ram SJ (2004) Image process- expression to changing environments: From rapid responses ing with ImageJ. Biophotonics Int 11:36-42. to evolutionary adaptation. Nat Rev Genet 9:583-593. Aoki T, Naka H, Katagiri T and Hirono I (2000) Cloning and char- Magalhães MF, Schlosser IJ and Collares-Pereira MJ (2003) The acterization of glyceraldehyde-3-phosphate dehydrogenase role of life history in the relationship between population dy- cDNA of Japanese flounder Paralichthys olivaceus. Fish Sci namics and environmental variability in two Mediterranean 66:737-742. stream fishes. J Fish Biol 63:300-317. 68 Jesus et al.

Marshall OJ (2004) PerlPrimer: Cross-platform, graphical primer kaya, Rodrigues and Collares-Pereira, 1998) (Cyprinidae). design for standard, bisulphite and real-time PCR. Bioin- Environ Biol Fishes 87:123-124. formatics 20:2471-2472. Straalen NM and Roelofs D (2006) An Introduction to Ecological McMillan DM, Fearnley SL, Rank NE and Dahlhoff EP (2005) Genomics. Oxford University Press, New York, pp 208-256. Natural temperature variation affects larval survival, devel- Tomanek L and Somero GN (2002) Interspecific- and acclima- opment and Hsp70 expression in a leaf beetle. Funct Ecol tion-induced variation in levels of heat-shock proteins 70 19:844-852. (hsp70) and 90 (hsp90) and heat-shock transcription factor-1 Ohtsuka K and Suzuki T (2000) Roles of molecular chaperones in (HSF1) in congeneric marine snails (genus Tegula): Impli- the nervous system. Brain Res Bull 53:141-146. cations for regulation of hsp gene expression. J Exp Biol Pala I, Coelho MM and Schartl M (2008) Dosage compensation 205:677-685. by gene-copy silencing in a triploid hybrid fish. Curr Biol Tymchuk VW, O’Reilly P, Bittman J, Macdonald D and Schulte P 18:1344-1348. (2010) Conservation genomics of Atlantic salmon: Varia- Pfaffl MW (2001) A new mathematical model for relative quanti- tion in gene expression between and within regions of the fication in real-time RT-PCR. Nucleic Acids Res 29:e45. Bay of Fundy. Mol Ecol 19:1842-1859. Place SP and Hofmann GE (2001) Temperature interactions of the Tomanek L (2010) Variation in the heat shock response and its molecular chaperone Hsc70 from the eurythermal marine implication for predicting the effect of global climate goby Gillichthys mirabilis. J Exp Biol 204:2675-2682. change on species’ biogeographical distribution ranges and Reusch TBH and Wood TE (2007) Molecular ecology of global metabolic costs. J Exp Biol 213:971-979. change. Mol Ecol 16:3973-3992. Waagner D, Heckmann L, Malmendal A, Nielsen NC, Holmstrup Rogado L, Alexandrino P, Almeida PR, Alves J, Bochechas J, M and Bayley M (2010) Hsp70 expression and metabolite Cortes R, Domingos I, Filipe F, Madeira J and Magalhães F composition in response to short-term thermal changes in (2006) Squalius torgalensis Escalo do Mira. In: Cabral MJ, Folsomia candida (Collembola). Comp Biochem Phys A Almeida J, Almeida PR, Dellinger T, Ferrand de Almeida N, 157:177-183. Oliveira ME, Palmeirim JM, Queiroz AI, Rogado L and Wegele H, Müller L and Buchner J (2004) Hsp70 and Hsp90 - A Santos-Reis M (eds) Livro Vermelho dos Vertebrados de relay team for protein folding. Rev Physiol Biochem Phar- Portugal. 2nd edition. Instituto da Conservação da Natu- macol 151:1-44. reza/Assírio and Alvim, Lisboa, pp 99-100. Willems E, Leyns L and Vandesompele J (2008) Standardization Ruijter JM, Ramakers C, Hoogaars WMH, Karlen Y, Bakker O, of real-time PCR gene expression data from independent bi- Hoff MJB and Moorman AFM (2009) Amplification effi- ological replicates. Anal Biochem 379:127-129. ciency: Linking baseline and bias in the analysis of quantita- Yamashita M, Hirayoshi K andNagata K (2004) Characterization tive PCR data. Nucleic Acids Res 37:e45. of multiple members of the HSP70 family in platyfish cul- Sarropoulou E, Fernandes JMO, Mitter K, Magoulasa A, Muleroc ture cells: Molecular evolution of stress protein HSP70 in V, Sepulcrec MP, Figueras A, Novoa B and Kotoulasa G vertebrates. Gene 336:207-218. (2010) Evolution of a multifunctional gene: The warm tem- Yeh FL and Hsu T (2002) Differential regulation of spontaneous perature acclimation protein Wap65 in the European seabass and heat-induced HSP 70 expression in developing Dicentrarchus labrax. Mol Phylogenet Evol 55:640-649. zebrafish (Danio rerio). J Exp Zool 293:349-359. Sarup P and Loeschcke V (2010) Developmental acclimation af- Zhang Z, Schwartz S, Wagner L and Miller W (2000) A greedy al- fects clinal variation in stress resistance traits in Drosophila gorithm for aligning DNA sequences. J Comput Biol buzzatii. J Evol Biol 23:957-965. 7:203-214. Serazin-Leroy V, Denis-Henriot D, Morot M, de Mazancourt P Zhou RX, Meng T, Meng HB, Cheng DX, Bin SY, Cheng J, Fu and Giudicelli Y (1998) Semi-quantitative RT-PCR for GH, Chu WY and Zhang JS (2010) Selection of reference comparison of mRNAs in cells with different amounts of genes in transcript expression analysis of gene expression of housekeeping gene transcripts. Mol Cell Probe 12:283-291. the Mandarin fish, Siniperca chuasti. Dongwuxue Yanjiu Somero GN (2010) The physiology of climate change: How po- 31:141-146. tentials for acclimatization and genetic adaptation will determine “winners” and “losers”. J Exp Biol 213:912-920. Internet Resources Sørensen JG, Dahlgaard J and Loeschcke V (2001) Genetic varia- SNIRH. Sistema Nacional de Informação de Recursos Hídricos. tion in thermal tolerance among natural populations of http://snirh.pt/ (August 22, 2010). Drosophila buzzatii: Down regulation of Hsp70 expression StatSoft I (2009) STATISTICA data analysis software system, and variation in heat stress resistance traits. Funct Ecol http://www.statsoft.com. 15:289-296. Sørensen JG, Kristensen TN and Loeschcke V (2003) The evolutionary and ecological role of heat shock proteins. Ecol Lett Supplementary Material 6:1025-1037. The following online material is available for this ar- Sørensen JG, Pekkonen M, Lindgren B, Loeschcke V, Laurila A ticle: and Merilä J (2009) Complex patterns of geographic variation in heat tolerance and Hsp70 expression levels in the Table S1 - Semi-quantitative PCR assessment of common frog Rana temporaria. J Therm Biol 34:49-54. hsp70 transcript abundance in S. torgalensis. Sousa-Santos C, Robalo JI and Almada VC (2009) Threatened Table S2 - Real-time PCR assessment of hsp70 tran- fishes of the world: Squalius torgalensis (Coelho, Boguts- script abundance in S. torgalensis. Thermal stress in Iberian cyprinids 69

Table S3 - Semi-quantitative PCR assessment of This material is available as part of the online article hsc70 transcript abundance in S. torgalensis. from http://www.scielo.br/gmb. Table S4 - Real-time PCR assessment of hsc70 tran- Associate Editor: Alexandre Rodrigues Caetano script abundance in S. torgalensis. Figure S1 - hsp70 transcript abundance in fin clips License information: This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and and muscle. reproduction in any medium, provided the original work is properly cited. Table S1 – Semi quantitative PCR post hoc comparisons for hsp70 gene expression between treatments for S. torgalensis, using Tukey HSD test statistics. Each cell represents the p-value in each pairwise comparison. Significant differences (P < 0.050) are marked with *.

20ºC 25ºC 30ºC 35ºC 20ºC 0.958 0.007* 0.000* 25ºC 0.002* 0.000* 30ºC 0.002* 35ºC Table S2 – Real-time PCR post hoc comparisons for hsp70 gene expression between treatments for S. torgalensis, using Tukey HSD test statistics (upper diagonal) and

Dunn’s test (lower diagonal). Each cell represents the p-value in each pairwise comparison. Significant differences (P < 0.050) are marked with *.

20ºC 25ºC 30ºC 35ºC 20ºC 0.004* 0.000* 0.000* 25ºC 1.000 0.046* 0.000* 30ºC 0.249 1.000 0.000* 35ºC 0.013* 0.249 1.000 Table S3 – Semi quantitative PCR post hoc comparisons for hsc70 gene expression between treatments for S. torgalensis, using Tukey HSD test statistics (upper diagonal) and Dunn’s test (lower diagonal). Each cell represents the p-value in each pairwise comparison. Significant differences (P < 0.050) are marked with *.

20ºC 25ºC 30ºC 35ºC 20ºC 0.960 0.593 0.000* 25ºC 1.000 0.309 0.000* 30ºC 1.000 1.000 0.001* 35ºC 0.007* 0.004* 0.139 Table S4 – Real-time PCR post hoc comparisons for hsc70 gene expression between treatments for S. torgalensis, using Tukey HSD test statistics. Each cell represents the p- value in each pairwise comparison. Significant differences (P < 0.050) are marked with

20ºC 25ºC 30ºC 35ºC 20ºC 0.445 0.755 0.031* 25ºC 0.938 0.272 30ºC 0.126 35ºC Figure S1 - hsp70 transcript abundance in fin clips and muscle.