DOCSLIB.ORG

Secreted and Membrane-Bound Isoforms of Protease ADAM9 Have Opposing Effects on Breast Cancer Cell Migration

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Secreted and Membrane-Bound Isoforms of Protease ADAM9 Have Opposing Effects on Breast Cancer Cell Migration Published OnlineFirst August 24, 2010; DOI: 10.1158/0008-5472.CAN-09-4231 Tumor and Stem Cell Biology Cancer Research Secreted and Membrane-Bound Isoforms of Protease ADAM9 Have Opposing Effects on Breast Cancer Cell Migration Jessica L. Fry and Alex Toker Abstract Tumor cell migration is mediated by cell-autonomous signaling mechanisms as well as paracrine and auto- crine factors secreted by activated stromal cells in the tumor microenvironment. Like other members of the ADAM (a disintegrin and metalloproteinase) family, the integrin-binding metalloproteinase ADAM9 modulates cell-cell and cell-matrix interactions as well as ectodomain shedding of cell surface receptors and ligands, thereby modifying intracellular and extracellular signaling. ADAM9 transcripts are alternatively spliced to ex- press a transmembrane protein (ADAM9-L) and a secreted variant (ADAM9-S). In this study, we show that ADAM9-S promotes breast cancer cell migration in a manner requiring its metalloproteinase activity, whereas ADAM9-L suppresses cell migration independent of its metalloproteinase activity. Suppression of migration by ADAM9-L requires a functional disintegrin domain and integrin binding. Expression analysis revealed that both ADAM9 isoforms are expressed in breast cancer cell lines and tissues. Therefore, relative levels of membrane-tethered and secreted variants of ADAM9 are a key determinant in manifestation of aggressive migratory phenotypes associated with breast cancer progression. Cancer Res; 70(20); 8187–98. ©2010 AACR. Introduction growth factor (5, 6). MMPs proteolytically cleave and release the ectodomains of multiple signaling molecules from the cell One of the hallmarks of advanced breast cancer is the abil- membrane in a process known as membrane shedding (7). Shed- ity of the tumor cells to lose their epithelial phenotype, disen- ding of substrates such as transforming growth factor-β (8) and gage from neighboring cells, degrade the basement membrane, tumor necrosis factor-α (9) activates signaling pathways that and invade surrounding tissues, ultimately metastasizing to dis- promote cell migration and survival. The ADAM (a disintegrin tant organs. The interactions between the tumor and its stromal and metalloproteinase) family of proteases has functional microenvironment are a key determinant in breast cancer pro- similarity to the MMPs in their zinc-binding metalloprotei- gression from carcinoma in situ to advanced invasive and nase domains, and is also referred to as the metalloproteinase, metastatic carcinoma. Tumor cells proteolyze the basement disintegrin, cysteine-rich (MDC) family. ADAMs control base- membrane and stroma to invade the vasculature, and also alter ment membrane proteolysis and shedding of proteins from stromal signals to stimulate angiogenesis and alternately re- the cell membrane. Comprising 40 isoforms, the ADAM family lease and tether to the extracellular matrix (ECM) to allow for of proteases also contains an integrin-binding disintegrin do- efficient migration. Tumor cells also release growth factors and main. ADAMs function in cell adhesion through their cysteine- chemokines that alter the stroma, inducing inflammation, rich domains that bind to syndecans (10) and fibronectin (11). angiogenesis, and mechanisms of tissue repair (1, 2). The Src homology-3 (SH3)–binding domain in the cytoplasmic Proteases play a major signaling role at the tumor-stromal regions of some ADAMs mediates signaling by activation of boundary. Enzymes comprising the matrix metalloproteinase Src and Grb proteins (12). Recent studies point to a functional (MMP) family proteolyze basement membrane and function importance for some ADAM family members in cancer. in promigratory signaling mechanisms. Proteolysis by MMPs ADAM12 is expressed in carcinoma and promotes breast can- exposes cryptic sites in ECM constituents such as laminin-5 cer progression by inducing the apoptosis of surrounding stro- and collagen IV that in turn promote tumor cell migration mal cells (13). Consequently, ADAM12 protein levels correlate (3, 4). Proteolysis of the basement membrane also releases with advanced breast cancer (14, 15). In contrast, the disintegrin ECM-boundgrowthfactorssuchasinsulinandfibroblast domain of ADAM15 inhibits angiogenesis and tumor growth (16). Moreover, ADAM15 expression decreases integrin-mediated ovarian cancer cell adhesion and motility (17). Authors' Affiliation: Department of Pathology, Beth Israel Deaconess ADAM9, also known as MDC9 (metalloproteinase/disintegrin/ Medical Center, Harvard Medical School, Boston, Massachusetts cysteine-rich protein 9), MCMP (myeloma cell metalloprotei- Corresponding Author: Alex Toker, Department of Pathology, Beth γ Israel Deaconess Medical Center, 330 Brookline Avenue, EC/CLS- nase), and meltrin- , comprises a subgroup of ADAMs that also 633A, Boston, MA 02215. Phone: 617-735-2482; Fax: 617-735-2480; contains ADAM12 and ADAM15 (18). The ADAM9 metallo- E-mail: [email protected]. proteinase activity cleaves heparin-binding epidermal growth doi: 10.1158/0008-5472.CAN-09-4231 factor (EGF; ref. 19), which binds activates EGF receptor to ©2010 American Association for Cancer Research. promote tumor growth and angiogenesis (20). ADAM9 also www.aacrjournals.org 8187 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2010 American Association for Cancer Research. Published OnlineFirst August 24, 2010; DOI: 10.1158/0008-5472.CAN-09-4231 Fry and Toker cleaves Delta-like 1, a Notch ligand (21), as well as ADAM10 GAATGCGGC-3′ and 5′-GCCGCATTCACACGTCTCTC- (22, 23). The ADAM9 disintegrin domain is a ligand for specific CAGGGTCC-3′. Deletion mutations in mADAM9L.Δcyt.myc integrin heterodimers, including multiple β1 (24, 25), α6β4 and mADAM9L.Δdis.myc were derived as follows: To delete α β Kpn (26), and v 5 integrins (27, 28). the cytoplasmic domain, a 1 restriction site was inserted Recent studies have revealed that ADAM9 message is up- into pcDNA3-mADAM9-L 5′ of the cytoplasmic region with regulated in breast tumors as well as in breast cancer cell primers 5′-GGCTAACTAGAGAACCCACTGGTACCTG‐ lines (29, 30). The chromosomal region of the ADAM9 gene GCTTATCG-3′ and 5′-CGATAAGCCAGGTACCAGTG‐ (8p11-12) is amplified in several breast cancers and cell lines, GGTTCTCTAGTTAGCC-3′. BamHI from the vector backbone and ADAM9 is overexpressed in cell lines encompassing the and the inserted Kpn1 restriction sites were used to isolate the luminal, basal A, and basal B gene expression clusters (31). mADAM9L.Δcyt sequence, which was cloned into digested The ADAM9 transcript is alternatively spliced into membrane- pcDNA4A/TO/myc/his vector in frame with the myc tag. To de- bound and secreted isoforms. Alternative splicing of exon 12 lete the disintegrin domain, Kpn1 sites were inserted 5′ and 3′ of in the ADAM9 message leads to a shorter ADAM9-S (ADAM9- the disintegrin domain in pcDNA3-mADAM9L.myc using site- secreted) transcript that contains eight unique amino acids directed mutagenesis using the following sequences: 5′ Kpn1, not present in ADAM9-L (ADAM9-long). ADAM9-S also lacks 5′-GTGGAGCAAAGAGCGGTACCATGAATTCAGGAGC-3′ and the transmembrane and cytoplasmic domains and is a secreted 5′-GCTCCTGAATTCATGGTACCGCTCTTTGCTCCAC-3′; protein (26). ADAM9 is implicated in cancer cell phenotypes, as 3′ Kpn1, 5′-GAAGGAGTGTGAGGGTACCCCATGCTGTGAAG- secretion of ADAM9-S promotes invasion of breast cancer cells GAAG-3′ and 5′-CTTCCTTCACAGCATGGGGTACCCTCA- in Matrigel assays (26). Furthermore, adhesion of keratinocyte CACTCCTTC-3′. Kpn1 digestion was used to isolate and cells to recombinant ADAM9 disintegrin/cysteine-rich domain discard the disintegrin sequence, and the vector backbone increases cell migration, and overexpression of ADAM9 also Kpn1 sites were ligated. For RNAi, ADAM9 sequences from increases pro-MMP9 expression (25). However, the functional the Mission small interfering RNA (siRNA) project (Sigma- role of ADAM9-L and ADAM9-S in modulating cell migration Aldrich) were cloned into the pLKO.1 vector directing expression and invasion in breast cancer cells has not been evaluated. of short hairpin RNA (shRNA; ref. 32). The following sequences Here, we use specific ADAM9-L and ADAM9-S antibodies were used: ADAM9shRNA.1, 5′-CCGGCCCAGAGAAGTT- to detect expression of both variants in breast cancer cell CCTATATATCTCGAGATATATAGGAACTTCT‐ lines and breast cancer tissues. Using RNA interference CTGGGTTTTTG-3′ (sense) and 5′-AATTCAAAAACCCAGA- (RNAi) and gene replacement, we show that ADAM9-S and GAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGG- ADAM9-L do not function in a redundant manner in the reg- 3′ (antisense); ADAM9shRNA.2, 5′-CCGGGCCAGAATAA- ulation of cell migration, whereby ADAM9-S promotes and CAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTT- ADAM9-L attenuates migration. These studies identify for 3′ (sense) and 5′-AATTCAAAAAGCCAGAATAACAAAGCC- the first time an ADAM as a migration suppressor, and have TATTCTCGAGAATAGGCTTTGTTATTCTGGC-3′ (antisense). implications for the functional roles of ADAM9 proteins in Second-generation lentiviral packaging plasmids pCMV-dR8.2 breast cancer progression. dvpr and pCMV-VSVG were obtained from Addgene for lenti- viral packaging. Materials and Methods Cell lines Antibodies and reagents All cell lines were obtained from the American Type Culture Anti-myc antibody purified from the 9B11 hybridoma was Collection, with the exception of the estrogen-independent purchased from Cell Signaling Technology. Anti–β-actin was human breast cancer SUM-159-PT, which has been described from
Load more

Recommended publications
  • ADAM9: a Novel Player in Vestibular Schwannoma Pathogenesis
    1856 ONCOLOGY LETTERS 19: 1856-1864, 2020 ADAM9: A novel player in vestibular schwannoma pathogenesis MARIA BREUN1, ALEXANDRA SCHWERDTFEGER1, DONATO DANIEL MARTELLOTTA1, ALMUTH F. KESSLER1, CAMELIA M. MONORANU2, CORDULA MATTHIES1, MARIO LÖHR1* and CARSTEN HAGEMANN1* 1Department of Neurosurgery, University Hospital Würzburg; 2Department of Neuropathology, Institute of Pathology, University of Würzburg, D-97080 Würzburg, Germany Received April 27, 2019; Accepted October 2, 2019 DOI: 10.3892/ol.2020.11299 Abstract. A disintegrin and metalloproteinase 9 (ADAM9) is VS samples (n=60). A total of 30 of them were from patients a member of the transmembrane ADAM family. It is expressed with neurofibromatosis. Healthy peripheral nerves from in different types of solid cancer and promotes tumor invasive- autopsies (n=10) served as controls. ADAM9 mRNA levels ness. To the best of our knowledge, the present study was the were measured by PCR, and protein levels were determined first to examine ADAM9 expression in vestibular schwan- by immunohistochemistry (IHC) and western blotting (WB). nomas (VS) from patients with and without neurofibromatosis The Hannover Classification was used to categorize tumor type 2 (NF2) and to associate the data with clinical parameters extension and hearing loss. ADAM9 mRNA levels were of the patients. The aim of the present study was to evaluate 8.8-fold higher in VS compared with in controls. The levels if ADAM9 could be used as prognostic marker or therapeutic were 5.6-fold higher in patients with NF2 and 12-fold higher in target. ADAM9 mRNA and protein levels were measured in patients with sporadic VS. WB revealed two mature isoforms of the protein, and according to IHC ADAM9 was mainly expressed by S100-positive Schwann cells.
    [Show full text]
  • Importance of Β-APP, ADAM9, 10, 17 in Alzheimer Disease
    Available online at www.ijmrhs.com al R edic ese M a of rc l h a & n r H u e o a J l l t h International Journal of Medical Research & a n S ISSN No: 2319-5886 o c i t i Health Sciences, 2019, 8(7): 68-7 e a n n c r e e t s n I • • I J M R H S Importance of β-APP, ADAM9, 10, 17 in Alzheimer Disease: Preliminary Autopsy Study with Immunohistochemical Expression in Human Brain Filiz Eren1, Nursel Turkmen Inanır1,2, Recep Fedakar2, Bulent Eren3*, Murat Serdar Gurses1, Mustafa Numan Ural4, Sumeyya Akyol5, Busra Aynekin5 and Kadir Demircan5 1 Bursa Morgue Department, Council of Forensic Medicine of Turkey, Bursa, Turkey 2 Department of Forensic Medicine, School of Medicine, Uludag University, Bursa, Turkey 5 3 Department of Forensic Medicine, School of Medicine, Tokat Gaziosmanpaşa University Tokat, Turkey 4 5 Bilgemed Work Safety and Security, Bursa, Turkey 5 Independent Researcher, Ankara, Turkey *Corresponding e-mail: [email protected] ABSTRACT Alzheimer’s disease (AD) is encountered as an important health problem. It was exposed that in the pathophysiology of AD, formation, and aggregation of amyloid β from amyloid precursor protein ( APP), was restrained by α-secretase group, ADAM (a disintegrin and metalloproteinase) enzymes. From this perspective, ADAM group of enzymes can be presumably used in the future both as a diagnostic marker, and potential treatment modality. In our study, 9 cases with or without AD in different age groups with various causes of death who were autopsied in the Bursa Morgue Department of the Council of Forensic Medicine of Turkey were included in the study.
    [Show full text]
  • The Positive Side of Proteolysis in Alzheimer's Disease
    Hindawi Publishing Corporation Biochemistry Research International Volume 2011, Article ID 721463, 13 pages doi:10.1155/2011/721463 Review Article Zinc Metalloproteinases and Amyloid Beta-Peptide Metabolism: The Positive Side of Proteolysis in Alzheimer’s Disease Mallory Gough, Catherine Parr-Sturgess, and Edward Parkin Division of Biomedical and Life Sciences, School of Health and Medicine, Lancaster University, Lancaster LA1 4YQ, UK Correspondence should be addressed to Edward Parkin, [email protected] Received 17 August 2010; Accepted 7 September 2010 Academic Editor: Simon J. Morley Copyright © 2011 Mallory Gough et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Alzheimer’s disease is a neurodegenerative condition characterized by an accumulation of toxic amyloid beta- (Aβ-)peptides in the brain causing progressive neuronal death. Aβ-peptides are produced by aspartyl proteinase-mediated cleavage of the larger amyloid precursor protein (APP). In contrast to this detrimental “amyloidogenic” form of proteolysis, a range of zinc metalloproteinases can process APP via an alternative “nonamyloidogenic” pathway in which the protein is cleaved within its Aβ region thereby precluding the formation of intact Aβ-peptides. In addition, other members of the zinc metalloproteinase family can degrade preformed Aβ-peptides. As such, the zinc metalloproteinases, collectively, are key to downregulating Aβ generation and enhancing its degradation. It is the role of zinc metalloproteinases in this “positive side of proteolysis in Alzheimer’s disease” that is discussed in the current paper. 1. Introduction of 38–43 amino acid peptides called amyloid beta (Aβ)- peptides.
    [Show full text]
  • Zinc Metalloproteinases and Amyloid Beta-Peptide Metabolism: the Positive Side of Proteolysis in Alzheimer’S Disease
    Hindawi Publishing Corporation Biochemistry Research International Volume 2011, Article ID 721463, 13 pages doi:10.1155/2011/721463 Review Article Zinc Metalloproteinases and Amyloid Beta-Peptide Metabolism: The Positive Side of Proteolysis in Alzheimer’s Disease Mallory Gough, Catherine Parr-Sturgess, and Edward Parkin Division of Biomedical and Life Sciences, School of Health and Medicine, Lancaster University, Lancaster LA1 4YQ, UK Correspondence should be addressed to Edward Parkin, [email protected] Received 17 August 2010; Accepted 7 September 2010 Academic Editor: Simon J. Morley Copyright © 2011 Mallory Gough et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Alzheimer’s disease is a neurodegenerative condition characterized by an accumulation of toxic amyloid beta- (Aβ-)peptides in the brain causing progressive neuronal death. Aβ-peptides are produced by aspartyl proteinase-mediated cleavage of the larger amyloid precursor protein (APP). In contrast to this detrimental “amyloidogenic” form of proteolysis, a range of zinc metalloproteinases can process APP via an alternative “nonamyloidogenic” pathway in which the protein is cleaved within its Aβ region thereby precluding the formation of intact Aβ-peptides. In addition, other members of the zinc metalloproteinase family can degrade preformed Aβ-peptides. As such, the zinc metalloproteinases, collectively, are key to downregulating Aβ generation and enhancing its degradation. It is the role of zinc metalloproteinases in this “positive side of proteolysis in Alzheimer’s disease” that is discussed in the current paper. 1. Introduction of 38–43 amino acid peptides called amyloid beta (Aβ)- peptides.
    [Show full text]
  • Original Article Tetraspanin CD9 Interacts with Α-Secretase to Enhance Its Oncogenic Function in Pancreatic Cancer
    Am J Transl Res 2020;12(9):5525-5537 www.ajtr.org /ISSN:1943-8141/AJTR0105976 Original Article Tetraspanin CD9 interacts with α-secretase to enhance its oncogenic function in pancreatic cancer Weiwei Lu1*, Aihua Fei1*, Ying Jiang2, Liang Chen1, Yunkun Wang2 1Department of Emergency, Xinhua Hospital, School of Medicine, Shanghai Jiaotong University, Shanghai 200092, PR China; 2Department of Neurosurgery, Shanghai Changzheng Hospital Affiliated to Shanghai Second Military Medical University, 415 Feng Yang Rd, Shanghai 200003, PR China. *Equal contributors. Received December 5, 2019; Accepted June 6, 2020; Epub September 15, 2020; Published September 30, 2020 Abstract: Pancreatic cancer is one of the most lethal cancers and its prognosis remains poor. ADAM family proteins like ADAM10, ADAM9 and ADAM17 function as α-secretase to cleavage cell surface proteins like Notch to facilitate oncogenesis in various tumors. The oncogenic roles of α-secretase in PDAC have been demonstrated but it remains unknown that whether and how α-secretase is regulated in PDAC. Here, we report that the expression of tetraspanin CD9 was increased and strongly associated with poor prognosis in PDAC. CD9 expression was positively associated with α-secretase activity in PDAC tissues and CD9 knock-down inhibited α-secretase activity in PDAC cell lines. Co-immunoprecipitation and GST pull down demonstrates that CD9 directly interacted with ADAM10, ADAM9 and ADAM17, respectively. Cell surface biotin labeling and immunostaining of tagged ADAM proteins show that CD9 promoted cell surface trafficking of ADAM family proteins. In addition, the antibody targeting extracellular domain of CD9 disrupted the interactions between CD9 and ADAM family proteins, reduced cell surface trafficking of ADAM proteins and inhibited α-secretase activity.
    [Show full text]
  • The Factors Present in Regenerating Muscles Impact Bone Marrow
    Kasprzycka et al. Stem Cell Research & Therapy (2019) 10:343 https://doi.org/10.1186/s13287-019-1444-1 RESEARCH Open Access The factors present in regenerating muscles impact bone marrow-derived mesenchymal stromal/stem cell fusion with myoblasts Paulina Kasprzycka1†, Karolina Archacka1†, Kamil Kowalski1, Bartosz Mierzejewski1,Małgorzata Zimowska1, Iwona Grabowska1, Mariusz Piotrowski1, Milena Rafałko1, Agata Ryżko1, Aliksandra Irhashava1, Kamil Senderowski1, Magdalena Gołąbek1,Władysława Stremińska1, Katarzyna Jańczyk-Ilach1, Marta Koblowska2, Roksana Iwanicka-Nowicka2,3, Anna Fogtman3, Mirosław Janowski4,5,6, Piotr Walczak4,7,8, Maria A. Ciemerych1 and Edyta Brzoska1* Abstract Background: Satellite cells, a population of unipotent stem cells attached to muscle fibers, determine the excellent regenerative capability of injured skeletal muscles. Myogenic potential is also exhibited by other cell populations, which exist in the skeletal muscles or come from other niches. Mesenchymal stromal/stem cells inhabiting the bone marrow do not spontaneously differentiate into muscle cells, but there is some evidence that they are capable to follow the myogenic program and/or fuse with myoblasts. Methods: In the present study we analyzed whether IGF-1, IL-4, IL-6, and SDF-1 could impact human and porcine bone marrow-derived mesenchymal stromal/stem cells (hBM-MSCs and pBM-MSCs) and induce expression of myogenic regulatory factors, skeletal muscle-specific structural, and adhesion proteins. Moreover, we investigated whether these factors could induce both types of BM-MSCs to fuse with myoblasts. IGF-1, IL-4, IL-6, and SDF-1 were selected on the basis of their role in embryonic myogenesis as well as skeletal muscle regeneration. Results: We found that hBM-MSCs and pBM-MSCs cultured in vitro in the presence of IGF-1, IL-4, IL-6, or SDF-1 did not upregulate myogenic regulatory factors.
    [Show full text]
  • The Effect of Disintegrin–Metalloproteinase ADAM9 in Gastric Cancer Progression
    Published OnlineFirst October 24, 2014; DOI: 10.1158/1535-7163.MCT-13-1001 Molecular Cancer Cancer Biology and Signal Transduction Therapeutics The Effect of Disintegrin–Metalloproteinase ADAM9 in Gastric Cancer Progression Jeong Min Kim1,2, Hei-Cheul Jeung1,3, Sun Young Rha1,2,3, Eun Jeong Yu1,4, Tae Soo Kim1, You Keun Shin1, Xianglan Zhang1, Kyu Hyun Park1, Seung Woo Park2,3, Hyun Cheol Chung1,2,3, and Garth Powis5 Abstract Advanced gastric cancer is one of the most aggressive gastrointestinal malignancies, and ADAM (A disintegrin and metalloproteinase)-9 is a cell-surface membrane glycoprotein with oncogenic properties that is overexpressed in several cancers. Herein, we investigated the biologic mechanism of ADAM9 in the progression, proliferation, and invasion of gastric cancer. First, we detected ADAM’s expression, proces- sing, and protease activity in gastric cancer cells. Protease activity was moderately correlated with ADAM9 protein expression, but was better related to a processed smaller molecular weight (84 kDa) form of ADAM9. Knockdown of ADAM9 or specifically targeted monoclonal antibody (RAV-18) suppressed cancer cell proliferation and invasion in high ADAM9-expressing cells, not in low ADAM9-expressing cells. RAV- 18 showed in vivo antitumor activity in a gastric cancer xenograft model. Hypoxia (1% oxygen) induced ADAM9 expression and functional activity in low ADAM9-expressing gastric cancer cells that was inhibited by siRNA knockdown or RAV-18 antibody to levels in normoxic cells. Overall, our studies show that ADAM9 plays an important role in gastric cancer proliferation and invasion, and that while expressed in some gastric cancer cells at high levels that are responsive to functional inhibition and antitumor activity of a catalytic site–directed antibody, other gastric cancer cells have low levels of expression and only when exposed to hypoxia do ADAM9 levels increase and the cells become responsive to ADAM9 antibody inhibition.
    [Show full text]
  • Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families
    Page 1 of 65 Diabetes Molecular signatures differentiate immune states in Type 1 diabetes families Yi-Guang Chen1, Susanne M. Cabrera1, Shuang Jia1, Mary L. Kaldunski1, Joanna Kramer1, Sami Cheong2, Rhonda Geoffrey1, Mark F. Roethle1, Jeffrey E. Woodliff3, Carla J. Greenbaum4, Xujing Wang5, and Martin J. Hessner1 1The Max McGee National Research Center for Juvenile Diabetes, Children's Research Institute of Children's Hospital of Wisconsin, and Department of Pediatrics at the Medical College of Wisconsin Milwaukee, WI 53226, USA. 2The Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53211, USA. 3Flow Cytometry & Cell Separation Facility, Bindley Bioscience Center, Purdue University, West Lafayette, IN 47907, USA. 4Diabetes Research Program, Benaroya Research Institute, Seattle, WA, 98101, USA. 5Systems Biology Center, the National Heart, Lung, and Blood Institute, the National Institutes of Health, Bethesda, MD 20824, USA. Corresponding author: Martin J. Hessner, Ph.D., The Department of Pediatrics, The Medical College of Wisconsin, Milwaukee, WI 53226, USA Tel: 011-1-414-955-4496; Fax: 011-1-414-955-6663; E-mail: [email protected]. Running title: Innate Inflammation in T1D Families Word count: 3999 Number of Tables: 1 Number of Figures: 7 1 For Peer Review Only Diabetes Publish Ahead of Print, published online April 23, 2014 Diabetes Page 2 of 65 ABSTRACT Mechanisms associated with Type 1 diabetes (T1D) development remain incompletely defined. Employing a sensitive array-based bioassay where patient plasma is used to induce transcriptional responses in healthy leukocytes, we previously reported disease-specific, partially IL-1 dependent, signatures associated with pre and recent onset (RO) T1D relative to unrelated healthy controls (uHC).
    [Show full text]
  • During Acute Lung Injury Extracellular Matrix Protein Degradation Of
    ADAM9 Is a Novel Product of Polymorphonuclear Neutrophils: Regulation of Expression and Contributions to Extracellular Matrix Protein Degradation This information is current as during Acute Lung Injury of September 30, 2021. Robin Roychaudhuri, Anja H. Hergrueter, Francesca Polverino, Maria E. Laucho-Contreras, Kushagra Gupta, Niels Borregaard and Caroline A. Owen J Immunol 2014; 193:2469-2482; Prepublished online 25 Downloaded from July 2014; doi: 10.4049/jimmunol.1303370 http://www.jimmunol.org/content/193/5/2469 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2014/07/25/jimmunol.130337 Material 0.DCSupplemental References This article cites 66 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/193/5/2469.full#ref-list-1 by guest on September 30, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology ADAM9 Is a Novel Product of Polymorphonuclear Neutrophils: Regulation of Expression and Contributions to Extracellular Matrix Protein Degradation during Acute Lung Injury Robin Roychaudhuri,*,1 Anja H.
    [Show full text]
  • Perkinelmer Genomics to Request the Saliva Swab Collection Kit for Patients That Cannot Provide a Blood Sample As Whole Blood Is the Preferred Sample
    Autism and Intellectual Disability TRIO Panel Test Code TR002 Test Summary This test analyzes 2429 genes that have been associated with Autism and Intellectual Disability and/or disorders associated with Autism and Intellectual Disability with the analysis being performed as a TRIO Turn-Around-Time (TAT)* 3 - 5 weeks Acceptable Sample Types Whole Blood (EDTA) (Preferred sample type) DNA, Isolated Dried Blood Spots Saliva Acceptable Billing Types Self (patient) Payment Institutional Billing Commercial Insurance Indications for Testing Comprehensive test for patients with intellectual disability or global developmental delays (Moeschler et al 2014 PMID: 25157020). Comprehensive test for individuals with multiple congenital anomalies (Miller et al. 2010 PMID 20466091). Patients with autism/autism spectrum disorders (ASDs). Suspected autosomal recessive condition due to close familial relations Previously negative karyotyping and/or chromosomal microarray results. Test Description This panel analyzes 2429 genes that have been associated with Autism and ID and/or disorders associated with Autism and ID. Both sequencing and deletion/duplication (CNV) analysis will be performed on the coding regions of all genes included (unless otherwise marked). All analysis is performed utilizing Next Generation Sequencing (NGS) technology. CNV analysis is designed to detect the majority of deletions and duplications of three exons or greater in size. Smaller CNV events may also be detected and reported, but additional follow-up testing is recommended if a smaller CNV is suspected. All variants are classified according to ACMG guidelines. Condition Description Autism Spectrum Disorder (ASD) refers to a group of developmental disabilities that are typically associated with challenges of varying severity in the areas of social interaction, communication, and repetitive/restricted behaviors.
    [Show full text]
  • Expression Profiles and Clinical Correlations of Degradome Components in the Tumor Microenvironment of Head and Neck Squamous Cell Carcinoma
    Published OnlineFirst March 21, 2010; DOI: 10.1158/1078-0432.CCR-09-2525 Clinical Human Cancer Biology Cancer Research Expression Profiles and Clinical Correlations of Degradome Components in the Tumor Microenvironment of Head and Neck Squamous Cell Carcinoma Angela Stokes1, Juho Joutsa6,7,8,9, Risto Ala-aho6,8, Mark Pitchers1, Caroline J. Pennington1, Craig Martin2, Don J. Premachandra3, Yasunori Okada10, Juha Peltonen4, Reidar Grénman5,7, Helen A. James1, Dylan R. Edwards1, and Veli-Matti Kähäri6,7,8 Abstract Purpose: Head and neck squamous cell carcinomas (HNSCC) are characterized by high morbidity and mortality, largely due to the high invasive and metastatic potential of these tumors, high recurrence rates, and low treatment responses. Proteinases have been implicated in several aspects of tumor growth and metastasis in a broad range of tumors including HNSCC. Experimental Design: Comprehensive expression profiling of proteinases [matrix metalloproteinases (MMPs), A disintegrin and metalloproteinase (ADAMs), and ADAMs with thrombospondin motif (ADAMTSs)] and their inhibitors [tissue inhibitor of metalloproteinases (TIMPs)] was done using quanti- tative real-time reverse transcription-PCR analysis of a large cohort of tissue samples representing the tumor (n = 83), the invasive margin (n = 41), and the adjacent tissue (n = 41) from 83 HNSCC patients, along with normal tissue controls (n = 13), as well as cell lines established from tumors of 34 HNSCC patients. Results: The results show specifically elevated gene expression of several proteinases, including MMP1, MMP3, MMP10, and MMP13 within tumor tissue and peritumoral adjacent tissue. In addition, the results identify several novel HNSCC-associated proteinases, including ADAM8, ADAM9, ADAM17, ADAM28, ADAMTS1, ADAMTS8, and ADAMTS15.
    [Show full text]
  • Metalloproteinases and Their Associated Genes Contribute to the Functional Integrity and Noise-Induced Damage in the Cochlear Sensory Epithelium
    The Journal of Neuroscience, October 24, 2012 • 32(43):14927–14941 • 14927 Neurobiology of Disease Metalloproteinases and Their Associated Genes Contribute to the Functional Integrity and Noise-Induced Damage in the Cochlear Sensory Epithelium Bo Hua Hu,1 Qunfeng Cai,1 Zihua Hu,2 Minal Patel,1 Jonathan Bard,3 Jennifer Jamison,3 and Donald Coling1 1Center for Hearing and Deafness, 2Center for Computational Research, New York State Center of Excellence in Bioinformatics and Life Sciences, Departments of Ophthalmology, Biostatistics, and Medicine, State University of New York Eye Institute, and 3Next-Generation Sequencing and Expression Analysis Core, Center of Excellence in Bioinformatics and Life Sciences, State University of New York at Buffalo, Buffalo, New York 14214 Matrix metalloproteinases (MMPs) and their related gene products regulate essential cellular functions. An imbalance in MMPs has been implicated in various neurological disorders, including traumatic injuries. Here, we report a role for MMPs and their related gene products in the modulation of cochlear responses to acoustic trauma in rats. The normal cochlea was shown to be enriched in MMP enzymatic activity, and this activity was reduced in a time-dependent manner after traumatic noise injury. The analysis of gene expres- sion by RNA sequencing and qRT-PCR revealed the differential expression of MMPs and their related genes between functionally specialized regions of the sensory epithelium. The expression of these genes was dynamically regulated between the acute and chronic phases of noise-induced hearing loss. Moreover, noise-induced expression changes in two endogenous MMP inhibitors, Timp1 and Timp2, in sensory cells were dependent on the stage of nuclear condensation, suggesting a specific role for MMP activity in sensory cell apoptosis.
    [Show full text]