Bioprospecting for Anti- Tuberculosis Endophytic Natural Products from Indonesian Traditional Medicinal Plants

A DISSERTATION SUBMITTED

BY Alfonsus Alvin

B.SC. HONS (UNSW)

IN PARTIAL FULFILMENT OF THE REQUIREMENTS

FOR THE AWARD OF

DOCTOR OF PHILOSOPHY (Ph.D.)

AT THE

SCHOOL OF BIOTECHNOLOGY AND BIOMOLECULAR SCIENCES

THE UNIVERSITY OF NEW SOUTH WALES

SYDNEY, AUSTRALIA

April 2016

Bioprospecting for Anti- Tuberculosis Endophytic Natural Products from Indonesian Traditional Medicinal Plants

A DISSERTATION SUBMITTED

BY Alfonsus Alvin

B.SC. HONS (UNSW)

IN PARTIAL FULFILMENT OF THE REQUIREMENTS

FOR THE AWARD OF

DOCTOR OF PHILOSOPHY (Ph.D.)

AT THE

SCHOOL OF BIOTECHNOLOGY AND BIOMOLECULAR SCIENCES

THE UNIVERSITY OF NEW SOUTH WALES

SYDNEY, AUSTRALIA SUPERVISORS PROFESSOR BRETT ANTHONY NEILAN SUPERVISOR DR. JOHN ALEXANDER KALAITZIS CO-SUPERVISOR SCHOOL OF BIOTECHNOLOGY AND BIOMOLECULAR SCIENCES THE UNIVERSITY OF NEW SOUTH WALES SYDNEY, AUSTRALIA

THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or family name: Alvin First name: Alfonsus Other name/s: - Abbreviation for degree as given in the University calendar: PhD School: Biotechnology and Biomolecular Sciences Faculty: Science Title: Bioprospecting for Anti-Tuberculosis Endophytic Natural Products from Indonesian Traditional Medicinal Plants

Abstract 350 words maximum:

The rapid emergence of antibiotic-resistant pathogens has driven the discovery of new drug leads from natural sources. Traditional medicinal plants have long been investigated as sources of bioactive molecules due to their rich ethnobotanical history. The vast biodiversity and empirical medicinal history of Indonesia make their flora an attractive target for the discovery of novel therapeutic compounds. A large proportion of bioactive natural products are non- ribosomal peptides and polyketides. Many of these compounds, which were originally isolated from plants, have since been found to be produced by their microbial endophytes. It is also understood that the genes encoding the biosynthesis of these bioactive molecules are useful for dereplication. Therefore, genetic and bioactivity screening of culturable endophytes from twelve traditional Indonesian medicinal plants used to treat symptoms of tuberculosis was conducted to identify strains capable of producing potential antitubercular polyketides and peptides.

Phylogenetic analysis of the endophytes revealed a rich community of bacteria from the phyla Firmicutes, Actinobacteria, and Proteobacteria, and fungi from the phylum Ascomycota. A high proportion of these endophytes (83% of bacteria and 94% of fungi) contained either non-ribosomal peptide or polyketide biosynthetic genes. Preliminary antibacterial screening of the fungi against Gram-positive, Gram-negative, and mycobacterial strains showed most isolates exhibited antiproliferative activity against at least one of the test strains, and suggested a correlation between the biosynthetic genes and bioactivity. Two isolates which exhibited bactericidal activity against M. tuberculosis were selected for active compound isolation. Bioassay- and NMR-guided fractionation resulted in the discovery of four anti-M. tuberculosis polyketides: javanicin and anhydrofusarubin from Fusarium sp. 9RF2 (MIC of 25 μg mL-1 and 50 μg mL-1, respectively), and acropyrone and compound 11UF1.S-5D6B from Endothia sp. 11UF1 (MIC of 50 μg mL-1 and 100 μg mL-1, respectively).

This investigation confirmed the hypothesis that traditional medicinal plants are valuable sources of endophytes that produce bioactive compounds. As the world continues to search for novel pharmaceuticals, prospecting of genetic resources, as described in this thesis, is a viable and productive approach that has the potential to be adapted in the context of exploiting traditional medicinal plants from around the world.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

...... Signature Witness Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for Award:

THIS SHEET IS TO BE GLUED TO THE INSIDE FRONT COVER OF THE THESIS

ORIGINALITY STATEMENT

I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.

Signed ...... Date ......

I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International.

I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.

Signed ...... Date ......

AUTHENTICITY STATEMENT

I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.

Signed ...... Date ......

ABSTRACT

The vast biodiversity and empirical medicinal history of Indonesia make their flora an attractive target for the discovery of novel therapeutic compounds. A large proportion of bioactive natural products are non-ribosomal peptides and polyketides. Many of these compounds, which were originally isolated from plants, have since been found to be produced by their microbial endophytes. It is also understood that the genes encoding the biosynthesis of these bioactive molecules are useful for dereplication. Therefore, genetic and bioactivity screening of culturable endophytes from twelve traditional

Indonesian medicinal plants used to treat symptoms of tuberculosis was conducted to identify strains capable of producing potential antitubercular polyketides and peptides.

Phylogenetic analysis of the endophytes revealed a rich community of bacteria from the phyla Firmicutes, Actinobacteria, and Proteobacteria, and fungi from the phylum

Ascomycota. A high proportion of these endophytes (83% of bacteria and 94% of fungi) contained either non-ribosomal peptide or polyketide biosynthetic genes. Preliminary antibacterial screening of the fungi against Gram-positive, Gram-negative, and mycobacterial strains showed most isolates exhibited antiproliferative activity against at least one of the test strains, and suggested a correlation between the biosynthetic genes and bioactivity. Two isolates which exhibited bactericidal activity against M. tuberculosis were selected for active compound isolation. Bioassay- and NMR-guided fractionation resulted in the discovery of four anti-M. tuberculosis polyketides: vii

javanicin and anhydrofusarubin from Fusarium sp. 9RF2 (MIC of 25 μg mL-1 and 50 μg mL-1, respectively), and acropyrone and compound 11UF1.S-5D6B from Endothia sp.

11UF1 (MIC of 50 μg mL-1 and 100 μg mL-1, respectively).

viii

DEDICATION

This thesis is firstly dedicated to my late father John and my mother Sisca. Mum and

Dad, you have supported me financially, emotionally, and spiritually throughout my life. Father, I know you are watching me from up there. I finally made it.

This thesis is also dedicated to my partner in crime Inez. Your patience and selflessness have helped me through my arduous journey. My dearest, I forever owe you my life.

From the bottom of my heart, I sincerely thank all of you. I love you all.

ACKNOWLEDGMENTS

I would like to firstly thank my supervisor Professor Brett Neilan for allowing me to work in his laboratory, giving me freedom to choose my project, funding my research, and guiding me throughout my PhD. Thank you for the mentorship and friendship we have built over the years. Aside from all the know-how about PKS and NRPS, without doubt, the highlight of our interaction would be when you brought Eddy to visit my hometown for the conference. On one of those very rare occasions of talking to you sober on the bus to Herbarium Bogoriense, I finally understood your philosophy of opening our eyes and minds in searching for scientific ideas from anyone around the world without exception. I really hope and look forward to future collaborations with you when I return to Indonesia. My mum and I are also proud for introducing you and Eddy to Indonesian cuisine, particularly from our cultural heritage West Sumatra. Apologies for the petai beans though.

I also thank my co-supervisor Dr. John Alexander Kalaitzis for imparting his scientific knowledge to me throughout my degree, and for the friendship we have built especially since I joined him as a cave dweller, or as I prefer to call it Wandercave. Thank you for your patience in helping me to understand the chemistry side of my project. Thank you also for sharing your hobbies and proud history of your family. You have inspired me to uphold my family values and I shall forever treasure your quote, “The more lies they say about me, the more truth I shall say about them”. And also perhaps one day, I will be able to witness Parramatta Eels lift the Provan-Summons Trophy again. I think the Wanderers will lift the A-League trophy again before that happens though.

I would also thank Dr. Rocky Chau, my unofficial co-supervisor. Your contribution to my project, especially near my thesis submission, is immense. Your knowledge in science technology is superb and your patience is admirable. Thank you for showing me how to operate the NMR apparatus and how to interpret the data, and thank you for checking my thesis chapters. Just to let you know, I still have those Albert Park Circuit rocks you and John gave me two years ago and I am still not sure what to do with them. At least I will remember the both of you whenever I see them. x

Thank you to the staff members at Mark Wainwright Analytical Centre who have personally assisted me with NMR and MS. In particular I would like to thank Dr. Adele Amoore, Dr. James Hook, Dr. Doug Lawes, Dr. Chowdury Sarowar, Dr. Russell Pickford, and Dr. Donald Thomas. I would like to specially thank Don for spending much of his spare time, including on his train trips, in assisting me to interpret the NMR data for my Fusarium compounds. Thank you to people at Ramaciotti Centre for Genomics (previously Ramaciotti Centre for Gene Function Analysis) who have assisted me in all my sequencing analyses.

I would like to thank the Tuberculosis Research Group at the Centenary Institute, University of Sydney for gifting us the mycobacterial test strains Mycobacterium tuberculosis H37Ra and Mycobacterium smegmatis, and for allowing me to present at their TB-Drug Workshop. In particular I would like to acknowledge A/Prof. James Triccas and Angel Pang.

I thank all other members of BGGM, past and present, who I have been privileged to collaborate with. In particular, I would like to acknowledge: Dr. Kristin Miller and Dr. Dasari Sreekanth for their contributions as co-authors of my publications; Dr. Maria Wiese and A/Prof. Shauna Murray for giving me an opportunity to take part in their project and publications; Dr. Jason Woodhouse and Dr. Sarah Ongley for their scientific inputs especially in molecular biology techniques; Toby Mills for his help with my HPLC runs and for running MS analysis on my samples; Fiona D’Mello for meticulously drawing Figure 1; and Dr. Verlaine Timms for donating the M. phlei and M. avium strains, for all the knowledge in mycobacteria, and for kindly sparing her valuable time to critically analyse my thesis chapters.

I would also like to thank the students were assigned to help me: Blandine Sasia with the bioassays, Daniela Lee-Smith, Justin Snyder, and Sharbel Zahran with bacterial endophyte PCR screening. I would like to specially acknowledge Sharbel for doing the bulk of this work independently, and still manage to binge drink and bully his supervisors.

I would also like to thank Emeritus Professor Peter Rogers who guided me through my transition period from working on Zymomonas mobilis with Charles Svenson and Dr. Young Jae Jeon to working on my current PhD project. Your letter to the then MP Peter Garrett was pivotal in me getting started on my PhD on time.

I would like to extend my greatest gratitude to the persons involved in the establishment of the Collaborative Research Agreement between UNSW and Atma Jaya Catholic University of Indonesia (AJCU) regarding my project, particularly UNSW lawyers Helen Brown and Zeynep Yaltirakli, AJCU representatives Professor Antonius Suwanto and Yogiara, and fellow signatories Janice Besch, David Owens, and Professor Florentinus Winarno. My greatest appreciation also for the people I personally interacted with at the Faculty of Biotechnology at AJCU throughout my time I worked there. Thank you for the professional network and personal friendships I have built with you all. Thank you for the academic staff members for allowing me to carry out my experiments in the Faculty, for giving me valuable inputs to my project, and for inviting me as a speaker in two conferences they organised: Dr. Diana Elizabeth Waturangi, Dr. Susan Soka, Dr. Yanti, Listya Utami Wanasurya, Professor Bibiana Lay, Professor Maggy Thenawidjaja Suhartono, Dr. Rory Hutagalung, Dr. Erwin Sentausa, Agustin Gunawan, Dr. Emannuel Ramli, Dr. Vivitri Dewi Prasasty, Dr. Noryawati Mulyono, Tan Watumesa Agustina, Stella Magdalena, and Dr. Tresnawati Purwadaria. I would also like to thank the administrative and technical officers from whom I received valuable assistance in their facilities: Ignatius Subandi, Ronny Samsulhadi, Anastasia Tatik Hartanti, Mukti Wahyuningjati, Sarif Hidayat, Jamillah, Nurdin, Bambang Setiawan, Ridwan, Darul Kutni, Dahni Sipahutar, and Arhad Kamahayanikan Vratyastoma. In addition, I would like to thank my fellow visiting scientists at the Faculty’s Research Laboratory, in particular Dr. Caecilia Anna Seumahu, Devi Iskandar, and Elizabeth Theresia Yuanita, for the advice they gave, stories they shared, and motivational words they imparted on me while our lives crossed path at the institution. I would like to thank Atma Jaya students whom I was privilege to share workplace and make friendship with. I would like to specially mention the 10 tutors of the DNA Technology subject I was supposed to give lecture for on the day my dad passed away: Lusiani, Jessica Wiludjaja, Arild Ranlym Arifin, Nikodemus Steven Suria, Marcella Widjaja, Fanny Ng, Melysa Delizea, Metta Sari, Evalin, and Kartika Sari xii

Henry. I still have the commemorative towel all of you gave me, and I thank you all for considering me a part of the team.

I also thank Ismunasih, Maman, and staff members at Karyasari nursery for their assistance in providing the plant materials for this project. I also thank the scientists at Herbarium Bogoriense for the confirmation of my plant species.

Throughout this degree, I realised that PhD is far beyond mere science learning. It is also a character building exercise. It is a life lesson. Each of the following people has played a significant role in this journey.

I thank once again Ismunasih and Maman for their immense support to me and my family, particularly surrounding my dad’s illness and death. It is because of you that I feel safe leaving my mum alone in Jakarta while I am pursuing this degree. I shall forever consider the both of you parts of our family.

I would like to thank Dr. Nico Wanandy, Dr. Donna Lee-Marçal, and Dr. Helder Marçal, for their mental and financial support to me. Thank you all for allowing me to take part in your research and business projects, thank you for keeping me afloat, and most importantly, thank you for your trust. Thank you also to Donna for managing to find time in the middle of her busy activities at work and at home to check some of my thesis chapters.

I would like to thank Professor Andrew Brown and Michele Potter for employing me and allowing me to work until I submited my thesis. This means a lot to me and hopefully the School has its money well-spent on yours truly. Thank you to my work colleagues and friends Dr. Jeff Welch, Dr. Rohan Singh-Panwar, Terry Law, Geoff Kornfeld, Kylie Jones, Elizabeth Gazzard, William Whitfield, Jenny Campbell, Avril Clarkson, and Theresa Kahwati.

My special thanks to aunty Veronica Elias, uncle Charles Elias, auntie Kumala Dewi, uncle Ignatius Widjaja, auntie Endang Heriwati, and uncle Hartono Soeleman for their continuing support to me and my partner Inez. I thank them for their understanding of

xiii

my situations, for their moral support particularly during tough times, and for imparting their wisdom on how to survive life’s mighty challenges.

I would like to thank Dr. Samantha Ellis, who has quietly supported me at the lowest point of my journey, who has since guided me to see and walk to the light at the end of the tunnel. I also thank Elizabeth Gazzard for her silent contribution in all this. I would like to acknowledge Tim Ryan for his calming support and advices to me, particularly in the last fortnight prior to my thesis submission. I would also like to thank my spiritual mentors Paul Hilder, Jerzy Chrzczonowicz, Emmanuel Yoon Jae Seo, Anthony Simari, and Terry Brady.

I would like to thank the following people for their unique contributions and support to me throughout my degree. Some have been previously mentioned, some have shared their scientific knowledge on me, some have imparted their wisdom upon me, and some have simply been good listeners for me. One thing they all have in common is that they are all my mentors, friends, and family for life: Dr. Sophie Octavia, Vikneswari Mahendran, Dr. Rati Sinha, Dr. Verlaine Timms, Toby Mills, Angela Chilton, Avril Clarkson, Donna Cherie, Latife Koker, Alexandra Devina Japar, Livia Lukman, Petra Ferani, Catherine Renate Surlia Yusmita, Vania Widjaja, Jimmy Gunawan, Joseph “Patrick” Khuong An Nguyen, Blandine Sasia, Theodorus Legowo, Rendy Ruvindy, Joannita Dharmawan, John Lia (late), John Heaney (late), Arnold Djohan, Magdalena Soka, Thu Nguyen, Vivia Khosasih, Stephanie Pranawijaya, Angela Francisca, Evan Hartono, Ave Jonathan Cahyadi, Rachel Ling Ling Yong, Cidy Alvin, Ettin Rubijanto, Liana Liswojo, Alexander Ruspandy, Tim Ryan, Leena Koop, Dr. Phaik Ee Lim, Dr. Nico Wanandy, Davina Kurnia, Marceline Jessica, Priskila Sweetta Marlyn Rumondor, Kathy Lim, Randy Adrian, Rosita Himawan, Reinilda Delima-Froyland, Dian Angeline, Marsha Danuta Harmani, Donna Gracia, Josanna Busuttil, Dr. Pauline Chen, Aditya Wardhana, Dianna Cucu Haryono, Damien Locke, Maria Widyamanta Santoso-Oei, Dr. Donna Lee-Marçal, Dr. Helder Marçal, Sharbel Zahran, Dr. Ralitza Alexova, Dr. Jeffrey Clifford Nokia Noro, Fiona D’Mello, Louisa Enestina, Dr. Ridwan Setiawan Khouw, and Ruth Deby Cynthia Arifin.

xiv

I would like to offer my deepest gratitude to my late father John Rinaldy Tanumiharja and my mother Fransisca Luanita Arifin for their support to me throughout the entire journey. I know I would not be here without the both of you. While you may not understand exactly what I am going through, one of the reasons why I keep persevering with my PhD despite all the trials and tribulations is to thank you for everything you have given me. While I shall never be able to repay you, the best I can offer is to make you proud.

The last but certainly not least, I would like to express my biggest appreciation to my beloved partner in life, Inez Augustine. I thank her for her immense support to me throughout this big chapter of my life. Thank you for continuously standing by me. Your determination to see me succeed is immeasurable, your selflessness and sacrifice are second to none. I cannot thank you enough.

This, no doubt, is a team effort and I am forever indebted to all of you. Thanks for the memories.

“Assiduus usus uni rei deditus et ingenium et artem saepe vincit” (Constant practice devoted to one subject often outdoes both intelligence and skill) - Cicero

xvi

TABLE OF CONTENTS

ORIGINALITY STATEMENT ...... v

AUTHENTICITY STATEMENT ...... vi

ABSTRACT ...... vii

DEDICATION ...... ix

ACKNOWLEDGMENTS ...... x

TABLE OF CONTENTS ...... xvii

ABBREVIATIONS ...... xxi

LIST OF PUBLICATIONS AND PROCEEDINGS ...... xxiv

LIST OF FIGURES ...... xxvi

LIST OF TABLES ...... xxviii

INTRODUCTION ...... 1

1.1 Natural Product Drug Discovery ...... 2

1.1.1 The ethnobotanical approach to drug discovery ...... 3 1.1.2 Endophytes as sources of natural products ...... 7 1.2 Biosynthesis of Natural Product Secondary Metabolites...... 11

1.2.1 Non-ribosomal peptides ...... 11 1.2.2 Polyketides ...... 16 1.2.3 Hybrid non-ribosomal peptide/polyketide ...... 20 1.3 Tuberculosis ...... 24

1.3.1 Background and occurrence ...... 24 1.3.2 Current anti-tuberculosis therapies...... 25 1.3.3 The search for new anti-tuberculosis natural products ...... 30 1.3.4 Indonesian traditional medicine for the treatment of tuberculosis ...... 36 1.4 Study Rationale and Aims ...... 38

xvii

BIOLOGICAL DIVERSITY AND BIOACTIVITY PROFILE OF CULTURABLE

ENDOPHYTES ISOLATED FROM TRADITIONAL INDONESIAN

MEDICINAL PLANTS ...... 40

Summary ...... 41

2.1 Introduction ...... 43

2.2 Materials and Methods ...... 46

2.2.1 Plant collection ...... 46 2.2.2 Endophyte isolation ...... 47 2.2.3 Material transfer ...... 48 2.2.4 Genomic DNA extraction from endophytes ...... 49 2.2.5 Genetic analysis of bacterial endophytes ...... 50 2.2.6 Genetic analysis of fungal endophytes ...... 51 2.2.7 Phylogenetic tree construction of the fungal and bacterial endophytes ...... 52 2.2.8 Biosynthesis gene screening via PCR ...... 53 2.2.9 Chemical extraction of fungal cultures ...... 54 2.2.10 Determination of antibacterial activity using the broth dilution ...... 55 2.2.11 Determination of antimycobacterial activity using the agar dilution ...... 56 2.3 Results and Discussion ...... 57

2.3.1 Plant surface sterilisation and endophyte isolation ...... 57 2.3.2 16S and 18S rRNA gene amplification and sequence analysis ...... 59 2.3.3 Phylogenetic relationship of the bacterial and fungal endophytes ...... 72 2.3.4 PKS and NRPS screening of the endophytes ...... 84 2.3.5 Overall bioactivity profile of the fungal endophytes ...... 90 2.3.6 Fungal endophyte antibacterial activity against E. coli, P. aeruginosa, and S. aureus ...... 103 2.3.7 Fungal endophyte antimycobacterial activity profile ...... 108 2.3.8 Prioritising the fungal strains for active compound isolation ...... 113 2.4 Conclusion ...... 113

ISOLATION AND CHARACTERISATION OF ANTIMYCOBACTERIAL

COMPOUNDS FROM FUSARIUM sp...... 117 xviii

Summary ...... 118

3.1 Introduction ...... 119

3.2 Materials and Methods ...... 123

3.2.1 Large scale culture of Fusarium sp...... 123 3.2.2 Chemical extraction of Fusarium sp...... 123 3.2.3 Fractionation of crude extracts ...... 123 3.2.4 HPLC purification ...... 124 3.2.4.1 Compound 9RF2.S-6I...... 124 3.2.4.2 Compound 9RF2.S-6G ...... 125 3.2.5 NMR and mass spectometry analysis of the pure compounds ...... 125 3.2.6 Determination of bioactivity and minimal inhibitory concentration of the pure compounds ...... 126 3.3 Results and Discussion ...... 127

3.3.1 Isolation of compound 9RF2.S-6I ...... 127 3.3.2 Structure elucidation of compound 9RF2.S-6I ...... 128 3.3.3 Isolation of compound 9RF2.S-6G ...... 132 3.3.4 Structure elucidation of compound 9RF2.S-6G ...... 133 3.3.5 Antibacterial activity of the isolated compounds ...... 138 3.4 Conclusion ...... 142

ISOLATION AND CHARACTERISATION OF ANTIMYCOBACTERIAL

COMPOUNDS FROM ENDOTHIA sp...... 143

Summary ...... 144

4.1 Introduction ...... 145

4.2 Materials and Methods ...... 146

4.2.1 Large scale culture of Endothia sp...... 146 4.2.2 Chemical extraction of Endothia sp...... 146 4.2.3 Antitubercular bioassay on Endothia sp. fractions...... 147 4.2.4 Fractionation of crude extract ...... 147 4.2.5 HPLC separation and purification ...... 148 4.2.5.1 Fractions 11UF1.S-5D5 and 11UF1.S-5DB...... 148

xix

4.2.5.2 Compound 11UF1.S-5D5D ...... 148 4.2.5.3 Compound 11UF1.S-5D6B ...... 149 4.3 Results and Discussion ...... 149

4.3.1 Fractionation of Endothia sp. crude extract ...... 149 4.3.2 Structure elucidation of compound 11UF1S-5D5D ...... 152 4.3.3 Structure elucidation of compound 11UF1S-5D6B ...... 156 4.3.4 Antibacterial activity of the isolated compounds ...... 161 4.4 Conclusion ...... 163

GENERAL DISCUSSION ...... 165

5.1 Research Motivation and Objectives ...... 166

5.2 Key Findings ...... 167

5.2.1 Biological diversity of the bacterial and fungal endophytes ...... 167 5.2.2 Biosynthetic potential of the bacterial and fungal endophytes ...... 167 5.2.3 Bioactivity profile of the fungal endophytes ...... 168 5.2.4 Antitubercular compounds from Fusarium sp...... 169 5.2.5 Antitubercular compounds from Endothia sp...... 170 5.3 Future Directions ...... 170

5.3.1 Determining the active compounds’ mode of action ...... 170 5.3.2 Whole genome sequencing of the bioactive isolates ...... 171 5.3.3 Exploring uncultured microorganisms from the medicinal plants ...... 172 5.4 Concluding Remarks ...... 173

APPENDICES ...... 175

Appendix 1: Antimicrobial assay results of the fungal endophyte extracts from

Indonesian traditional medicinal plants (for Chapter 2) ...... 176

Appendix 2: NMR data comparison of the proposed chemical structures isolated in

this study (for Chapters 3 and 4) ...... 186

REFERENCES ...... 187

ABBREVIATIONS

A adenylation ACP acyl carrier protein aLRT SH-like approximate Likelihood-Ratio Test based on a Shimodaira- Hasegawa-like procedure AMP adenosine monophosphate AT acyltransferase ATCC American type culture collection ATP adenosine triphosphate BHIA brain heart infusion agar BLAST basic local alignment search tool bp base pairs C condensation CBD convention on biological diversity CFU colony forming units

CO2 carbon dioxide CoA coenzyme A COSY correlation spectroscopy CTAB cetyltrimethylammonium bromide d doublet DCM dichloromethane DH dehydratase

DH2 dehydrogenation DMAPP dimethylallyl diphosphosphate DMSO dimethyl sulfoxide DNA deoxyribonucleic acid dNTP deoxyribonucleotide triphosphate E epimerisation

EC50 half maximal effective concentration EDTA ethylenediaminetetraacetate ER enoyl reductase GTR generalised time reversible

xxi

HCl hydrochloric acid HGT horizontal gene transfer HIA heart infusion agar HMBC heteronuclear multiple bond coherence HPLC high performance liquid chromatography HSQC heteronuclear single quantum correlation

IC50 half maximal inhibitory concentration IPP isopentenyl diphosphate JC Jukes-Cantor KR ketoreductase KS ketosynthase LB Luria-Bertaini medium LPS lipopolysaccharide m multiplet m/z mass-to-charge ratio MDR-TB multidrug resistant tuberculosis MeOH methanol

MgSO4 magnesium sulphate MIC minimum inhibitory concentration MS mass spectrometry NCBI National Centre for Biotechnology Information NCTC national collection of type cultures NMR nuclear magnetic resonance NRP non-ribosomal peptide NRPS non-ribosomal peptide synthetase OADC oleic albumin dextrose catalase OD optical density PCP peptidyl carrier protein PCR polymerase chain reaction PDA potato dextrose agar PK polyketide PKS polyketide synthase RCF relative centrifugal force RDBE ring or double-bond equivalent xxii

rRNA ribosomal ribonucleic acid s singlet SDS sodium dodecyl sulphate SEM standard error of the mean sp. species (singular) spp. species (plural) subsp. subspecies t triplet TA transaminase TAE tris-acetate EDTA buffer TB tuberculosis TE thioesterase TFA trifluoroacetic acid TLC thin layer chromatography Tris tris(hydroxymethyl)aminomethane UV ultra violet XDR-TB extensively drug resistant tuberculosis XS xanthogenate

xxiii

LIST OF PUBLICATIONS AND

PROCEEDINGS

Peer-reviewed publications related to PhD work:

Alvin A, Miller KI, Neilan BA (2014). Exploring the potential of endophytes from medicinal plants as sources of antimycobacterial compounds. Microbiological Research, 169:483-495.

Miller KI, Ingrey SD, Alvin A, Sze MYD, Roufogalis BD, Neilan BA (2010). Endophytes and the microbial genetics of traditional medicines. Microbiology Australia, 31:60-63.

Alvin A, Kalaitzis JA, Sasia B, Neilan BA (2016). Combined genetic and bioactivity- based prioritization leads to the isolation of an endophyte-derived antimycobacterial compound. Journal of Applied Microbiology, 120:1229-1239.

Conference proceedings related to PhD work:

Alvin A, Kalaitzis JA, Neilan BA (2010). Bioprospecting for novel bioactive compounds from the endophytes isolated from Indonesian traditional medicinal plants. International Seminar of Indonesian Society for Microbiology, Bogor, Indonesia.

Alvin A, Sreekanth D, Kalaitzis JA, Neilan BA (2012). Bioactive natural products from traditional Indonesian medicinal plant-associated microbes. International Seminar on Advances in Molecular Genetics and Biotechnology for Public Education, Jakarta, Indonesia.

Alvin A, Kalaitzis JA, Sreekanth D, Neilan BA (2012). Bioactive natural products from traditional Indonesian medicinal plant-associated fungi. International Congress on Natural Product Research, New York, USA.

Alvin A, Smith DL, Kalaitzis JK, Neilan BA (2013). Endophytes from traditional medicinal plants as potential sources for antibacterial and antimycobacterial xxiv

compounds. Royal Australian Chemical Institute: Natural Products Chemistry Group Annual One-Day Symposium, Sydney, Australia.

Alvin A, Kalaitzis JA, Neilan BA (2015). Bioprospecting the endophytes from traditional Indonesian medicinal plants for novel anti‐tuberculosis compounds. Tuberculosis Centre of Reseach Excellence: Tuberculosis Drug Development Workshop, Sydney, Australia.

Publications outside PhD work:

Murray, SA, O'Connor WA, Alvin A, Mihali TK, Kalaitzis JA, Neilan BA (2009). Differential accumulation of paralytic shellfish toxins from Alexandrium minutum in the pearl oyster, Pinctada imbricata. Toxicon, 54: 217-223.

Wiese, M, Murray, SA, Alvin A, Neilan BA (2014). Gene expression and molecular evolution of sxtA4 in a saxitoxin producing dinoflagellate Alexandrium catenella. Toxicon, 92: 102-112.

Conference proceedings and presentations outside PhD work:

Alvin A. 2010. Overproducing gluconolactone from ethanol-producing Zymomonas mobilis. Faculty of Biotechnology Journal Club Meeting, Atma Jaya Catholic University of Indonesia.

Alvin A. 2010. Communications in Science. Faculty of Biotechnology Journal Club Meeting, Atma Jaya Catholic University of Indonesia.

xxv

LIST OF FIGURES

Figure 1 Pictorial representation of the natural product drug discovery approach used

in this thesis...... 4

Figure 2 Graphical representation of taxol biosynthesis in Taxus spp...... 11

Figure 3 Graphical representation of biosynthesis of natural bioactive compounds

showing non-ribosomal peptide synthetase (NRPS) ...... 14

Figure 4 Graphical representation of biosynthesis of natural bioactive compounds

showing polyketide synthase (PKS) ...... 18

Figure 5 Modular organisation of a hypothetical hybrid NRPS/PKS and hybrid

PKS/NRPS ...... 22

Figure 6 Phylogenetic relationship of bacterial endophytes and reference bacteria

based on 16S rRNA gene sequences...... 73

Figure 7 Phylogenetic relationship of fungal endophytes and reference fungi based

on 18S rRNA gene sequences...... 76

Figure 8 Venn diagram illustrating the distribution of fungal crude extracts exhibiting

antiproliferative activity against Gram-positive, Gram-negative, and

mycobacterial strains...... 98

Figure 9 Growth inhibition of E. coli by fungal endophytic crude extracts...... 104

Figure 10 Growth inhibition of P. aeruginosa by fungal endophytic crude extracts. .. 104

Figure 11 Growth inhibition of S. aureus by fungal endophytic crude extracts...... 105

Figure 12 Two 24-well plate photos displaying significant results of the agar dilution

assay against M. tuberculosis H37Ra ...... 111

Figure 13 Examples of fungal anti-tuberculosis compounds ...... 121

Figure 14 Isolation and purification of compound 9RF2.S-6I...... 128 xxvi

Figure 15 Partial structures of 9RF2.S-6I determined from HSQC and HMBC...... 129

Figure 16 Structure of javanicin...... 131

Figure 17 Isolation and purification of compound 9RF2.S-6G...... 133

Figure 18 Partial structures of 9RF2.S-6G determined from HSQC and HMBC...... 134

Figure 19 Structure of anhydrofusarubin...... 136

Figure 20 Isolation and purification of compounds from Endothia sp...... 151

Figure 21 Partial structures of 11UF1.S-5D5D determined from HSQC and HMBC. 153

Figure 22 Structure of acropyrone...... 154

Figure 23 Structure comparison between acropyrone (13) and convolvulopyrone

(14)...... 155

Figure 24 Partial structures of 11UF1.S-5D6B determined from HSQC and HMBC. . 157

Figure 25 Proposed partial structures of 11UF1.S-5D6B determined from HSQC and

HMBC...... 159

Figure 26 Proposed structure of 11UF1.S-5D6B ...... 160

Figure 27 Structures of paecilin A (16) and paecilin B (17)...... 161

xxvii

LIST OF TABLES

Table 1 Mechanism of action and causes of resistance development of various anti-

tuberculosis chemotherapeutic agents ...... 27

Table 2 Anti-tuberculosis drug candidates in clinical trials ...... 30

Table 3 Novel microbial antitubercular compounds between 2008-2012 ...... 32

Table 4 Indonesian plants that were traditionally used to treat symptoms of

tuberculosis ...... 37

Table 5 Locations of Indonesian medicinal plants collected for isolation and

culturing of endophytes ...... 47

Table 6 PCR primers used in the DNA screening of bacterial and fungal endophyte

isolates ...... 52

Table 7 Number of potentially distinct culturable fungal and bacterial endophytes

from Indonesian traditional medicinal plants ...... 58

Table 8 BLASTn analysis of 16S rRNA gene sequences from isolated bacterial

endophytes ...... 61

Table 9 BLASTn analysis of 18S rRNA gene sequences from isolated fungal

endophytes ...... 67

Table 10 Qualitative PKS and NRPS screening results of the isolated endophytes,

classified based on the host plant ...... 86

Table 11 Summary of the bacterial antiproliferative activity spectrum of the fungal

endophytes from Indonesian traditional medicinal plants ...... 94

Table 12 Number of endophyte isolates with culture broth extracts showing

antiproliferative activity against mycobacteria at 100 µg mL-1 ...... 109

Table 13 NMR data for javanicin (11) acquired in CDCl3 at 30°C ...... 131 xxviii

Table 14 NMR data for anhydrofusarubin (12) acquired in CDCl3 at 30°C ...... 137

Table 15 Minimal inhibitory concentration (MIC) of the isolated compounds against

five bacterial test strains...... 139

Table 16 NMR data for acropyrone (13) acquired in CDCl3 at 30°C ...... 155

Table 17 NMR data for 11UF1.S-5D6B (15) acquired in CDCl3 at 30°C ...... 160

Table 18 Dry yield of the chemical extracts from the fungal endophytes ...... 176

Table 19 Bioactivity assay results of the fungal crude extracts against E. coli ...... 178

Table 20 Bioactivity assay results of the fungal crude extracts against P. aeruginosa 180

Table 21 Bioactivity assay results of the fungal crude extracts against S. aureus ...... 182

Table 22 Bioactivity assay results of the fungal crude extracts against Mycobacteria . 184

xxix

xxx

Chapter 1

INTRODUCTION

Parts of this chapter have been published as:

Alvin A, Miller KI, Neilan BA, Exploring the Potential of Endophytes from Medicinal

Plants as Sources of Antimycobacterial Compounds, Microbiological Research (2014),

169:483-495.

1 Introduction

1.1 Natural Product Drug Discovery

The need for novel chemical compounds to treat human diseases is ever increasing. The rapid development of drug-resistant microbes, the discovery of new cases of life- threatening infections, and the constant recurrence of diseases have driven advances in the field of drug discovery (1, 2). In principle, there are three pathways for discovering new pharmacologically significant compounds: rational drug design, where the drug is purposefully tailored towards specific targets in the microbial cell (3); combinatorial chemistry, which involves synthesis of a combinatorial library of compounds, which are then tested against the cellular target to determine the most potent compounds (4); and natural product discovery, by isolating bioactive compounds from biological sources

(5). Of late, pharmaceutical companies have shifted their interest towards rational drug design. It utilises the latest advances in three-dimensional X-ray crystallography, drug- docking tools, and other computer-aided methodologies (6) which significantly cut the development time of a compound, from compound synthesis to market delivery. There are, however, downfalls with the rational drug design and combinatorial chemistry, including the high cost to discover novel compounds and for production. Moreover, until the detailed mechanisms of targeted cellular death and survival are comprehensively elucidated, it will remain difficult to select potential targets for structure-guided drug design (7). Furthermore, being laboratory-synthesised compounds, combinatorial compounds are often insufficiently complex, possessing limited structural rigidity, and require extensive purification steps and bioactivity testing to conclusively characterise the bioactive compounds (8). In addition, there has been a steady increase in the negative public perception regarding the use of synthetic drugs

2 Introduction

due to their long-term safety and environmental concerns (9). Consequently, efforts are being made to re-explore the potential of natural products as sources of novel drugs.

1.1.1 The ethnobotanical approach to drug discovery

Natural products, generally secondary metabolites, are produced by an organism in response to external stimuli such as nutritional changes or foreign infection (5). They constitute almost 50% of the new drugs introduced to the market between 1981-2010, and approximately 75% of anti-infective agents are natural products or natural product derivatives (10). Most bioactive natural products have the ability to target specific proteins coded by essential genes (11). While it is understood that this property cannot be fully utilised for human genetically-linked diseases due to the more complex human protein-protein interactions (12), this attribute has been widely explored for the treatment of infectious diseases, as these compounds are able to specifically target the infective agents (11). For example, beta-lactam antibiotics, such as the penicillins and the cephalosporins, are largely used for their broad antibacterial spectrum and outstanding safety profile for human use (13).

Of all possible sources of natural products, plants have been viewed as one of the most promising. The plant kingdom provides a plethora of biologically active compounds, and it is estimated that only 10-15% of existing species of higher plants have been investigated (14). Of this, only approximately 6% have been screened for biological activity (15). Medicinal plant use can be traced to ancient agricultural societies, where indigenous populations have utilised them as therapies for many diseases (16). Even in the modern era, approximately 80% of the world’s population, particularly those in the

3 Introduction

developing countries, still rely on herbal medicines for their primary healthcare (17).

Historically, plants with healing properties have been discovered and utilised even before the cause of the disease has been fully identified. Not surprisingly, the trial and error approach has been utilised for generations in these cultures to discover plants of medicinal value.

Traditional Polyketides and Ethnobotanical Medicinal Endophyte Isolation Small Knowledge Plants Peptides

Figure 1 Pictorial representation of the natural product drug discovery approach used in this thesis.

Unfortunately, while most traditional cultures have utilised plants for medicinal purposes, this precious knowledge has generally been kept secret by traditional healers or the information is kept within their own community. The information transfer between these traditional healers and modern society is largely the result of the work by ethnobotanists, who study plant-human inter-relationships in natural and social contexts

(18). Since its inception, the field of ethnobotany has evolved from merely a collection of information regarding plants utilised by a particular community into a more complex,

4 Introduction

interdisciplinary research area of understanding the biological and socio-economic impacts of using the plants to the development of a particular culture.

One example is an ethnobotanical investigation on a cult in southern Mexico, which glorified the use of the so-called sacred mushrooms (19). Having made contacts with the local tribe, two ethnobotanists Jean Bassett Johnson and Richard Evans Schultes were able to obtain, gave a botanical description, and identified a mushroom used in this cult

(20, 21). Following this finding, two mycologists Robert Gordon Wasson and Valentina

Pavlovna carried out systematic analysis on the mushroom and confirmed its hallucinogenic effects (22). Further investigations resulted in the identification of similar psychedelic mushrooms, where the vast majority belong to the genus Psilocybe

(23). Chemical analysis on these mushrooms identified the active components as psilocybin (4-phosphoryloxy-N,N-dimethyltryptamine) and an alkaloid psilocin (4- hydroxy-N,N- dimethyltryptamine) (24), and soon after their chemical synthesis was characterised (25). A synthetic chemist Franz Troxler then used this information to artificially develop novel substances to regulate cardiac function using 4-hydroxyindole, the backbone of psilocybin and psilocin, as the lead compound (19). The drug, under the commercial name Visken, is currently on the market for the treatment of hypertension

(19).

Ethnobotanical knowledge has provided sufficient basis for further investigation of traditional plants for their medicinal properties. Modern scientists have revisited these traditional uses of the plants and carried out bioprospecting, which involves screening for natural products with biological activity (9, 26) in order to isolate and identify the chemical entities responsible for treating diseases. Since the discovery of penicillin in

5 Introduction

1928 (27) and its mass production during World War II, modern medicine has utilised natural products as single, pharmaceutical entities. Concerted efforts have been made to isolate and identify these individual bioactive compounds.

In the recent past, isolating biologically active natural products was not a preferred pathway of drug discovery as it was time consuming and resource inefficient.

Nonetheless, the rate of bioassay-guided fractionation has recently been significantly improved with advances in instrumentation, such as high-performance liquid chromatography (HPLC), mass spectrometry (MS), higher magnetic field-strength nuclear magnetic resonance (NMR) instruments, and high throughput screening technology (28). Compounds of limited availability in their organisms of origin are now detectable with the introduction of capillary NMR spectroscopy (29) and cryogenic probe technology (30, 31), while the development of automated high-throughput screening techniques have replaced bioassays as a rate-limiting step of drug discovery

(32). These advances have made the list of natural products with therapeutic value ever increasing and an abundance of new compounds are continually being isolated.

Ethnobotanical knowledge has led to the isolation of novel bioactive compounds.

However, plant availability is viewed to be the limiting factor in the commercial success of some natural products. At times, a large quantity of plant is required to produce sufficient amounts of the bioactive compounds for clinical use. Compounds have also been isolated from endangered or highly endemic plants. A prime example is that it takes three tons of endangered Taxus leaves to produce only one kilogram of paclitaxel

(33), an amount which would only provide treatment for approximately 500 patients

(34). This raises major concerns regarding biodiversity conservation. Plant tissue culture

6 Introduction

offers a solution (35), although the cost of such production methods is high. One of the advances in addressing these issues is the discovery that microorganisms residing inside the plant tissues may produce similar, if not the same, bioactive compounds as their plant hosts. From a commercial point of view, it is relatively easier to scale up the fermentation process of microbes, enabling large-scale production of biologically active compounds to meet industrial demands. These microorganisms present the opportunity to discover a plethora of compounds and offer a renewable source of natural products.

1.1.2 Endophytes as sources of natural products

Endophytes refer to the microorganisms (mostly fungi and bacteria) colonising the intercellular and intracellular regions of healthy plant tissues at a particular time, whose presence is unobtrusive and asymptomatic (36-38). All plant species that have been previously studied host at least one endophytic microbe (39), with plants growing in unique environmental settings generally hosting novel endophytic microorganisms (38).

Endophytes form a symbiotic relationship with their plant host. It is believed that in many cases the microbes function as the biological defence for the plant against foreign phytopathogens. The protection mechanism of the endophytes are exerted directly, by releasing metabolites to attack any antagonists or lyse affected cells, and indirectly, by either inducing host defence mechanisms or promoting growth.

Evidence suggests that endophytes have evolved from plant pathogens (40, 41). It is hypothesised that the endophytes manage to enter and survive inside the plant tissues as a consequence of balanced antagonism, where the effects of the virulence factors

7 Introduction

released by the endophytes are cancelled out by the defence mechanisms of the plant host (36). It is highly possible that the virulence genes of both the endophytes and the host are lost over time. The proposed balance antagonism mechanism is highly plastic, depending not only on the physiological state of both the host and the endophytes, but also on their tolerance to environmental factors (41). If the balance antagonism is disrupted, the endophytes may become plant pathogens or the microbes are killed.

Antibiotics or hydrolytic enzymes can be released by endophytes to prevent colonisation of microbial plant pathogens (38, 42), or prevent insects (43) and nematodes (44) from infecting plants. In other cases endophytes release metabolites which activate host defence mechanisms against other pathogenic organisms, in a process known as induced systemic resistance (45). Similarly, endophytes can also promote plant growth in an attempt to outcompete cell apoptosis induced by infecting pathogens (42). Plant growth promotion by endophytes may be exerted by several mechanisms, such as production of phytohormones (46), synthesis of siderophores (47), nitrogen fixation, solubilisation of minerals such as phosphorus (48), or via enzymatic activities, such as ethylene suppression by 1-aminocyclopropane-1-carboxylate deaminase (49). The plant host also benefits from the endophytes by their natural resistance to soil contaminants (50), their ability to degrade xenobiotics, or their action as vectors to introduce degradative traits to plants, which substantially assist phytoremediation (39).

Endophytes can produce the same or similar secondary metabolites as their host.

Bioactive compounds which are co-produced by the plants as well as their associated endophytes include the anticancer drug camptothecin (51), the anticancer drug lead

8 Introduction

compound podophyllotoxin (52), and the natural insecticide azadirachtin (53). There are several mechanisms proposed for the simultaneous production of these biological compounds. In some cases, such as that of gibberellin, the biosynthetic mechanism of the same compound evolves independently in plants and their microbial counterparts

(54). On the other hand, horizontal gene transfer between the plant host and its endophytes has long been hypothesised, although so far this process has only been shown to occur between microbial endophytes (55). It has been strongly suggested, however, that interactions between endophytes and their respective plant host contributes to the co-production of these bioactive molecules (56).

Endophytes have recently generated significant interest in the microbial chemistry community due to their immense potential to contribute to the discovery of new bioactive compounds. It has been suggested that the close biological association between endophytes and their plant host results in the production of a greater number and diversity of biological molecules compared to epiphytes or soil-related microbes

(38). Moreover, the symbiotic nature of this relationship indicates that endophytic bioactive compounds are likely to possess reduced cell toxicity, as these chemicals do not kill the eukaryotic host system. This is of significance to the medical community as potential drugs may not adversely affect human cells.

One of the most successful stories of natural products from endophytes is the multibillion-dollar anticancer drug Taxol (paclitaxel). The compound was initially isolated from the Pacific yew tree, Taxus brevifolia (57), a traditional medicinal plant used by Native Americans (58). Since then, several other plants from the genus Taxus have been reported to produce Taxol. Nonetheless, these plants are slow-growing with

9 Introduction

generally isolated geographical distribution. Investigations of endophytes from this plant revealed that some fungi, such as Taxomyces andreanae, also produced the exact same compound (59). The biological production of this compound in Taxus plants has been characterised (Figure 2). While horizontal gene transfer has long been proposed for the biosynthesis of Taxol in endophytes, it has been recently showed that the endophyte genomes did not contain any sequences with significant homology to the

Taxol biosynthetic genes from Taxus spp. (56), indicating Taxol biosynthesis in endophytes might have developed independently from its plant host. Nevertheless, this example supports the rationale that traditional medicinal plants can be used as the starting point to investigate endophytes for their production of biologically active compounds.

As mentioned earlier, approximately three quarters of anti-infectives are natural products or natural-product derived structures. However, rather than using combinatorial chemistry to synthesise these derivatives, the biosynthesis of these natural products has been elucidated at the genetic level. As the synthesis of most of these natural products is regulated by single gene clusters, numerous research groups have attempted to isolate these clusters and utilise genetic engineering to biologically synthesise the native compounds as well as their derivatives. Two of the most studied and largest classes of secondary metabolites are the polyketides and non-ribosomal peptides (60).

10 Introduction

geranylgeranyl cytochrome disphosphate taxadiene P450 taxadiene synthase synthase 5α-hydroxylase farnesyl diphosphate

geranylgeranyl taxa-4(5),11(12)- taxa-4(20),11(12)-dien- disphosphate diene 5α-ol

isopentenyl diphosphate taxa-4(20),11(12)- dien-5α-ol-O- acetyltransferase

taxane 2α-O- cytochrome benzoyl- P450 taxane transferase 10β-hydroxylase

taxadien-5α,10β-diol taxa-4(20),11(12)-dien- 2-debenzoyltaxane monoacetate 5α-yl acetate 10-deacetylbaccatin III 10-deacetyl baccatin III-10-O- acetyltransferase

baccatin III β-phenylalanoylbaccatin III Taxol

phenylalanine aminomutase

β-phenylalanine α-phenylalanine

Figure 2 Graphical representation of taxol biosynthesis in Taxus spp. (adapted from Walker and Croteau (61)). Multiple arrows indicate several as yet undefined steps.

1.2 Biosynthesis of Natural Product Secondary Metabolites

1.2.1 Non-ribosomal peptides

Peptide antibiotics constitute some of the most important anti-infective drugs on the market, most notably the β-lactams such as the penicillins and the cephalosporins (62).

These oligopeptides are synthesised by large, multimodular enzyme complexes called non-ribosomal peptide synthetases (NRPSs), which use proteinogenic and non- proteinogenic amino acids as their building blocks. A conventional NRPS module consists of a minimum of three distinct domains arranged in the following order: the condensation domain (C), adenylation domain (A), and the peptidyl carrier protein

(PCP). The A domain is responsible for the recognition of specific amino acid substrate 11 Introduction

and catalyses the synthesis of aminoacyl-AMP, the preferred form of the monomer, by transferring AMP from ATP into the amino acid (63). The serine side chain of the PCP domain is activated by the action of dedicated phosphopantetheinyl transferases (64), allowing the aminoacyl group of the activated monomer to bind to the terminal sulfhydryl group of the 4'-phosphopantetheine carrier, releasing AMP (65). Peptide bond formation takes place between two activated amino acid in the C domain, whereby the amino acid covalently bound to the first PCP is joined to the downstream PCP- bound amino acid (66).

The initiation module often consists of two domains, A and PCP, which select the first amino acid and attaches it covalently on the first PCP. The peptidyl chain then extends, keeping the free amino group of the N-terminal residue (67). At the termination stage, the oligopeptide is released from the system using two possible pathways: thioesterase- dependent or thioesterase-independent. The final domain thioesterase can be hydrolytic, releasing the linear product or cyclising (68), whereas thioesterase-independent chain termination can be carried out by reductase-catalysed thioester reduction to yield an aldehyde (69). Optional tailoring domains give rise to further structural diversity. These may include epimerase (70) or racemase (71), heterocyclisation (72), oxidase (73), and methyltransferase domains (74).

12 Introduction TE PCP A Module Module 13 C dptD PCP A Module Module 12 C + Ser + 11 + Gly + - + Asp+ + Ala+ dptBC + Asp+ Modules Modules 6 + Orn + Cyclisation PCP A Module Module 5 C PCP A Module Module 4 C PCP A Module Module 3 dptA C E PCP Daptomycin A Module Module 2 C PCP A Module Module 1 C ACP dptF Loading Loading module Ad

(A)

13 Introduction

vlm1 vlm2

Module 2 Module 4 Module 1 Module 3

A TA DH2 PCP C A PCP E C A DH2 PCP C A PCP TE

Cleavage and cyclisation 3 Valinomycin

(B)

cmnF cmnA cmnI cmnJ cmnG

Module 2 Module 4 Module 1 Module 3 Module 5

A PCP C X A PCP C A PCP C PCP C A PCP C*

CmnL

CmnM CmnO

Capreomycin (C)

Figure 3 Graphical representation of biosynthesis of natural bioactive compounds showing non- ribosomal peptide synthetase (NRPS): (A) Biological production of daptomycin using type A NRPS (adapted from Miao et al. (75)); (B) Biological production of valinomycin using type B NRPS (adapted from Cheng (76)); (C) Biological production of capreomycin using type C NRPS (adapted from Felnagle et al. (77)). Individual NRPS domains are noted as circles with the appropriate abbreviation to indicate their function: Ad = adenylating enzyme, PCP = peptidyl carrier protein, C = condensation domain, A = adenylation domain, E = epimerisation domain, TE = thioesterase domain, TA = transaminase domain, DH2 = dehydrogenation domain, X = domain with no known function, C* = modified condensation domain. The genes or protein responsible for a particular process are noted as boxes.

14 Introduction

The possible inclusion of these tailoring reactions, combined with variable arrangement of the modules, has resulted in a vast array of non-ribosomal peptide scaffolds in nature.

High versatility of the modules and domains in terms of both catalytic potential and interaction within the multifunctional protein templates has led to the classification of

NRPS systems: linear (type A), iterative (type B), and nonlinear (type C) (78).

In linear (type A) NRPSs, the multiple modules are arranged in a sequential fashion, where each module incorporates one monomer in to the growing chain during each production cycle. This means the sequence of the resulting linear peptide chain is entirely depended upon the number and order of the modules.

In contrast, in iterative (type B) NPRS system the modules or domains are used multiple times in the assembly of a single product, thus creating a multimeric peptide consisting of repeated smaller sequences. As a consequence, the system contains a reduced number of modules which corresponds to only one set of the repeated sequences. The number of iterative cycles and the chemical nature of the bonds between the monomer chains are determined by the terminal PCP and/or thioesterase domain.

An example of a type A NRPS product is daptomycin, a cyclic lipopeptide which represented the first new class of antibiotics introduced in 30 years when it was approved by the Food and Drug Administration (FDA) in 2003 (79). Naturally produced by the actinomycete Streptomyces roseosporus NRRL11379, daptomycin consists of a cyclic core of 13 amino-acids, six of which are non-proteinogenic, and an N-terminal decanoyl lipid (Figure 3A) (75). Valinomycin, a potent antibiotic against severe acute respiratory syndrome coronavirus, provides a good model of the type B (iterative)

15 Introduction

NRPS system. Produced by several Streptomyces isolates, the biosynthetic gene cluster has been isolated from Streptomyces tsusimaensis ATCC15141 (Figure 3B) (76). The third type, non-linear (type C) NRPSs, is responsible for biosynthesis of the potent anti- tuberculosis compound capreomycin. Isolated from Saccharothrix mutabilis subsp. capreolus, analysis of the capreomycin biosynthetic gene cluster revealed that the compound was not assembled by a typical linear or iterative NRPS mechanisms (Figure

3C) (77).

1.2.2 Polyketides

In addition to non-ribosomal peptides, polyketides also constitute a large proportion of commercial antibiotics. Among the most prominent examples are the polyene macrolide antibiotics, such as amphotericin B and nystatin (80), as well as the tetracyclines (62).

Polyketides are natural products synthesised by polyketide synthases (PKS) which are also large multimodular enzyme complexes that function similarly to a fatty acid synthase (FAS) (67). The monomers for this system are acyl-CoA thioesters (such as acetyl-CoA, malonyl-CoA, and methylmalonyl-CoA), readily available from the pool of primary metabolites in the microbial cells. Resembling the NRPS system, there are three core domains in a typical PKS system: acyltransferase (AT), which acts as the gatekeeper for substrate specificity, selecting and activating the monomers and the intermediate acyl chain; acyl carrier proteins (ACPs), whose phosphopantetheine arm covalently attaches the growing intermediate acyl chain; and ketosynthase (KS) which catalyses C–C bond formation via Claisen condensation in the elongation of the polyketide chain (67). Termination is achieved by the action of the thioesterase (TE) domain.

16 Introduction

TE ACP KR Module Module 6 AT KS eryAIII ACP KR Module Module 5 AT KS ACP KR ER Module Module 4 DH dEB) - (6 AT eryAII deoxyerythronolide B - KS 6 ACP KR Module Module 3 AT KS ACP KR AT Module Module 2 KS A ACP eryAI KR Module Module 1 AT Erythromycin KS ACP Loading Loading module AT

(A)

17 Introduction

DspC DspD DspG DspG DspA DspB DspG

KSα KSβ ACP ACP KSα KSβ ACP ACP Starter unit: Propionyl-CoA

Extender unit: Malonyl-CoA 8 ×

Doxorubicin Daunorubicin (B)

KS PhID PhID

2 CO2 CO2 2 HSCoA 3 × 3,5-diketoheptanedioate PhID

PhIABC PhIABC

2,4-DAPG MAPG phloroglucinol

(C)

Figure 4 Graphical representation of biosynthesis of natural bioactive compounds showing polyketide synthase (PKS): (A) Biological production of erythromycin, highlighting Type I PKS in the formation of 6-deoxyeryhtronolide B, its precursor (adapted from Cane (81)); (B) Biological production of doxorubicin using Type II PKS (adapted from Chan et al. (82)); (C) Biological production of 2,4-diacetylphloroglucinol using Type III PKS (adapted from Gross and Loper (83)). The individual PKS domains are noted as curved rectangles with the appropriate abbreviation to indicate their function: AT = acyltransferase domain, ACP = acyl carrier protein, KS = ketosynthase domain, KR = ketoreductase domain, DH = dehydratase domain, ER = enoylreductase domain, KSα = ketosynthase domain which catalyses decarboxylative Claisen condensation of the precursors, KSβ = ketosynthase domain which controls the polyketide length. The genes or protein responsible for a particular process are noted as boxes.

18 Introduction

There are several types of PKS systems. Type I PKSs are multifunctional enzymes linearly arranged into modules, each of which consists of a set of non-iteratively acting domains responsible for the catalysis of one cycle of chain elongation (84). The elongation modules contain all three core domains, but the initial module only possesses

AT and ACP domains. The KS domain often exists in a modified form which functions to decarboxylate (methyl)malonyl-ACP, releasing CO2 and resulting in an acetyl- or propionyl-ACP to provide starting acyl group on the assembly line (84). The KS domain can also be completely absent, which means an acyl-CoA (other than malonyl or methylmalonyl-CoA) is selected by the AT domain and loaded to the first ACP domain (85). Erythromycin, a broad spectrum macrolide antibiotic, is one of the most well-studied compounds of this type (86). First discovered from Saccharopolyspora erythraea, the compound consists of a 14-membered macrolactone ring and two glucose derived deoxysugar moieties desosamine and cladinose (3-O-methylmycarose). The construction of its precursor, 6-deoxyerythronolide B (6-deB) is controlled by a large modular protein known as 6-deB synthase (DEBS) (Figure 4A).

Type II PKSs consist of several monofunctional enzymes acting iteratively, resulting in the production of polyphenols or other aromatic polyketides (87). A minimal PKS consists of two ketosynthase subunits (KSα and KSβ) and an acyl carrier protein (ACP), which tethers the growing polyketide chain (88). Additional PKS subunits, including ketoreductases, cyclases and aromatases determine the folding pattern of the growing poly-β-keto intermediate (87). Other subunits, such as methyltransferases, oxygenases, and glycosyltransferases assist in tailoring the polyphenols (87). An example of this type is the anti-tumour antibiotic doxorubicin, which is produced by the actinomycete

Streptomyces peucetius ATCC29050 (Figure 4B) (89).

19 Introduction

Type III PKSs, also known as chalcone synthase-like PKSs, are homodimeric enzymes consisting of multiple ACP-independent modules which essentially are iterative condensing enzymes. They are the smallest and simplest PKS enzyme complexes, normally involved in the production of aromatic compounds (90). This type is distinguished from the first two types as the system is independent of ACP, meaning the enzyme acts directly on the acyl-CoA substrates (91). Following the linear chain elongation, there are pathways which release and cyclise the peptide resulting in the production of a compound with a 6-membered ring (90). Biosynthesis of 2,4- diacetylphloroglucinol, an antibiotic against plant pathogens, from endophytic

Pseudomonas fluorescens Q2-87 is known to involve a type III polyketide synthase

(Figure 4C) (92).

Three sequential catalytic domains may be present in the Type I and II PKSs: ketoreductase (KR), dehydratase (DH), and enoylreductase (ER). The action of these domains affects the four-electron reduction of the β-C=O to the β-CH2 and completes the chain elongation process initially carried out by the AT and KS domains.

Nonetheless, as is the case for type II PKSs and some type I PKSs, some components of these β-carbon processing may be missing or non-functional, resulting in even more diverse chemical moieties (67).

1.2.3 Hybrid non-ribosomal peptide/polyketide

Non-ribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) employ highly similar strategies to biosynthesise two distinct classes of natural products. Both

NRPSs and PKSs are modular in nature, contain similar catalytic domains for monomer

20 Introduction

selection, activation, and chain elongation (67). The two enzymatic systems use carrier proteins to tether the growing chain and a thioesterase domain which releases the peptide/polyketide product from its biosynthetic proteins (67). The modularity and versatility of NRPS and PKS assembly lines have enabled integration of the two biosynthetic machineries to produce hybrid compounds with even more structural diversity.

Analysis on the biosynthetic gene clusters of these hybrid natural products have revealed that most are assembled by hybrid NRPS-PKS enzymes which allows direct transfer of a NRPS-bound peptidyl intermediate to a PKS module or a PKS-bound acyl intermediate to a NRPS module (Figure 5) (93). In a NRPS-PKS interface, the ketosynthase domain catalyses the transfer of the growing peptide intermediate of peptidyl-S-PCP from the upstream NRPS module to the active site of the ketosynthase to form a peptidyl-S-KS moiety, followed by similar decarboxylative condensation with the subsequent malonyl-S-ACP, resulting in the carboxylic acid being added into the peptide chain (Figure 5A) (93). Similarly, in a PKS-NRPS interface, the condensation domain catalyses the nucleophilic substitution between the acyl group of the growing polyketide intermediate of acyl-S-ACP from the upstream PKS module and the amino group of the following aminoacyl-S-PCP, causing the amino acid to be incorporated into the polyketide chain (Figure 5B) (93).

21 Introduction

Module n+1 Module n+1

Module n Module n

C A PCP KS AT ACP C A PCP KS AT ACP

n n+1 n+1

(A)

Module n+1 Module n+1

Module n Module n

KS AT ACP C A PCP KS AT ACP C A PCP

n n+1 n+1

(B)

Figure 5 Modular organisation of a hypothetical hybrid NRPS/PKS and hybrid PKS/NRPS: (A) C–C bond formation for hybrid non-ribosomal peptide-polyketide biosynthesis; (B) C–N bond formation for hybrid polyketide-non-ribosomal peptide biosynthesis (adapted from Du et al. (93)).

The biosynthesis of yersiniabactin conveniently illustrates these concepts. The biosynthetic enzyme complex HMWP2-HMWP1 assembles salicylate, three cysteines, a malonyl linker group, and three methyl groups to form a four-ring structure consisting of salicylate, two thiazolines, and one thiazolidine, with the malonyl linking the thiazolidine with one of the thiazoline (94). The first complex HMWP2 consists of two

NRPS modules, and these modules add and modify the salicylate and two cysteines to synthesise the partial peptide chain containing the salicylate and two thiazoline rings

(94). The second complex HMWP1 has a PKS module and an NRPS module (94). The ketosynthase domain initially accepts this peptide chain and PKS portion of HMWP1 then catalyses the addition of a malonate unit (94). The resulting product is then reduced by a ketoreductase and methylated by a methyltransferase to form the methylmalonyl

22 Introduction

linking group (94). Another reductase in this PKS module also reduces one thiazoline ring to thiazolidine, and the entire enzyme-tethered product is transferred to the NRPS portion of HMWP1, where the final cysteine is added, cyclised, and condensed to form the last thiazoline ring (94).

Furthermore, the integration of PKS and NRPS systems could occur via two different mechanisms. First, the biosynthetic enzymes are arranged in linear, sequential order.

This type is more common in bacteria, where the fusion takes place between type I PKS and linear NRPS (95). In these multimodular systems, the distribution of the PKS and

NRPS modules can vary greatly. Some systems contain mostly PKS modules, as in the case of ascomycin biosynthesis, where 11 PKS modules (96) are combined with only 1

NRPS module (97). Some others have more NRPS modules, as in the case of bleomcyin assembly line, where 10 NRPS modules integrate with 1 PKS module (98). The second mechanism is where a single PKS module and a single NRPS module act in an iterative manner to synthesise the final compound. This type is more frequently encountered in fungi (99), and the PKS domain organisation is similar to that for fungal highly reducing PKS (100). An example of this system is found in the biosynthesis of pseurotin

A (101), an immunosuppressant from Aspergillus fumigatus (102). The PKS-NRPS complex of the compound’s biosynthetic gene cluster consists of one set of PKS and

NRPS module each (101). In the assembly of pseurotin A, the iterative hybrid PKS-

NRPS module incorporates four malonyl-CoA units to the propionate starter unit to form a pentaketide, which is then fused to a phenylalanine (101).

In addition, hybrid NRPS-PKS products could be a result of two separate NRPS and

PKS moieties coupled by a ligase. An example of this is coronatine, a plant phytotoxin

23 Introduction

which is the bacterial equivalent of the plant hormone jasmonic acid (103). The biosynthetic gene cluster of this compound in Pseudomonas syringae is composed of two separate loci encoding for PKS and NRPS enzymes, each with its own thioesterase

(104), and a gene encoding for ligase (105), indicating that the polyketide component coronafacic acid and the peptide component coronamic acid were independently synthesised prior to the coupling of the two moieties.

The NRPS and PKS biosynthetic pathways are the hallmarks of secondary metabolism.

The modular versatility of the natural product assembly lines gives rise to a variety of cyclic, linear, and branched chemical compounds with a wide range of bioactivity profiles, including as antibiotics. The clustering and modularity of these biochemical pathways have offered possibilities for genetic engineering to create novel antibiotics to combat drug-resistant infectious pathogens such as Mycobacterium tuberculosis.

1.3 Tuberculosis

1.3.1 Background and occurrence

Tuberculosis (TB) is a potentially deadly infectious disease caused by Mycobacterium sp., mainly Mycobacterium tuberculosis. Often infecting the lungs, it can also attack the central nervous system, the lymphatic system, as well as skeletal tissue. Common symptoms of TB include a chronic cough with blood-tinged sputum, fever, night sweats, and weight loss. TB is transmitted through the air when infected individuals cough, sneeze, or spit, spreading the bacteria from their throat or lungs.

24 Introduction

There are three stages of tuberculosis: (1) exposure, when metabolically active

M. tuberculosis infects the human, (2) latent TB infection, when the infecting M. tuberculosis is in dormancy and switches to a low metabolic activity state in the human cells, preventing host immune responses, and (3) active TB disease, when the infecting

M. tuberculosis is metabolically active and vigorously replicating, triggering host immune responses (106, 107).

One–third of the world's current population have been infected with M. tuberculosis

(106). Approximately one tenth of the infected people will develop the disease while on the rest the bacterial infections remain in a latent stage (108). There were approximately

8.8 million reported cases of active TB in 2010, 5.7 million of which were new or relapsed cases. The disease caused approximately 1.5 million deaths (109). While the absolute number of TB cases has been falling since 2006, and its incidence rates have been falling by 1.3% per year since 2002, TB remains the second leading cause of death from an infectious disease worldwide after HIV (109). Though TB incidence is more common in developing and under-developed countries (109), the rising frequency of population migration has resulted in increased occurrences in developed countries.

1.3.2 Current anti-tuberculosis therapies

In most cases, TB is curable, provided that the drug regime is followed diligently (108).

An anti-TB drug regime is considered successful if all mycobacteria are killed, preventing patient relapse after cessation of treatment, and avoiding the development of drug resistant mycobacteria. Unfortunately, proper drug therapy is not accessible to most of the sufferers, particularly those in the high burden countries in Asia and Africa.

25 Introduction

Inadequate treatment of the disease causes the development of drug-resistant tuberculosis. Multidrug-resistant tuberculosis (MDR-TB), a specific form of drug- resistant tuberculosis, is characterised by a strain which is resistant to at least two of the most powerful first-line drugs. There were an estimated 650,000 cases of MDR-TB in

2010 [57]. MDR-TB takes longer to treat with second-line drugs, which are generally more expensive and cause more side-effects. Mismanagement of this second-line drug treatment causes the development of extensively drug-resistant tuberculosis (XDR-TB), where the bacteria are resistant to at least three of the six classes of available second- line drugs, in addition to MDR-TB.

As there are naturally occurring drug-resistant mycobacteria at any stage of the infection, it is currently impossible to treat the disease with a single drug (110). Drugs that are commonly used to treat TB are listed in Table 1. A typical drug regime comprises a combination of bactericidal and bacteriostatic drugs. Since the 1950s, the standard first-line therapy for TB involves a two month treatment with a combination of rifampicin, isoniazid, ethambutol, and pyrazinamide, followed by treatment with a combination of rifampicin and isoniazid for an additional four months (110).

26 Introduction

Table 1 Mechanism of action and causes of resistance development of various anti-tuberculosis chemotherapeutic agents Chemotherapeutic Mechanism of Action Resistance Development agent

Acquisition of aminoglycoside- Aminoglycosides: Inhibition of protein synthesis, inactivating enzymes (112), amikacin, particularly in translational initiation mutational alteration of target kanamycin (111) structural gene rrs (113) or streptomycin ribosomal protein (114)

D-cycloserine Inhibition of cell wall biosynthesis Overexpression of target gene (cyclic analogue of (115) alrA (116) D-alanine)

Mutation in the target operon Inhibition of cell wall biosynthesis Ethambutol embCAB, particularly the gene (117, 118) embB (119)

Ethionamide and Mutation in the target gene inhA prothionamide Inhibition of cell wall, particularly (120); overexpression of EthR, a (structural analog mycolic acid, biosynthesis (120, 121) repressor of ethionamide of isoniazid) activator (122)

Fluoroquinolones: ciprofloxacin, gatifloxacin, Mutation in target genes gyrA levofloxacin, Inhibition of DNA replication (123) (123, 124) and gryB (125) moxifloxacin, ofloxacin, sparfloxacin

Mutation in katG gene to Inhibition of fatty acid biosynthesis prevent drug activation (128) Isoniazid (120, 126, 127) and mutation in the target structural gene inhA (129, 130)

Mutation in the target gene Inhibition of mycolic acids, oleic etaA, and possible cross- acid, tuberculostrearic acid, and other Isoxyl resistance between short-chain fatty acids biosynthesis thiocarbonyl-containing (131) antibiotics (132)

Point mutations in the target Macrolides: Inhibition of protein synthesis, 23S rRNA gene (134, 135); erythromycin, particularly in translational initiation increased expression of ermMT clarithromycin, (133) gene resulting in substantial loss roxithromycin of drug binding (136)

27 Introduction

Table 1 (continued) Chemotherapeutic Mechanism of Action Resistance Development agent

Oxazolidinones: linezolid, Inhibition of protein synthesis, Alteration in the efflux pump or eperezolid, DA- particularly in translational initiation drug transport mechanism (138) 7157, DA-7218, (137) DA-7867

Inhibition of folate (139) and Mutations in the target gene p-aminosalicylic thymine nucleotides (140) thyA, though the major cause is acid biosynthetic pathways yet to be identified (140)

Pyrazinamide Mechanism not fully understood, (synthetic though it is thought to be inhibiting Mutation in the gene pncA, analogue of vital enzyme activities and disrupting preventing drug activation (144) nicotinamide) membrane transport (141-143)

Rifamycins: Inhibition of protein synthesis, rifampin, particularly in transcriptional Mutation in the target structural rifabutin, rifalazil, initiation (145) and induction of gene rpoB (147) rifapentine programmed cell death (146)

Riminophenazines: Disruption to potassium transport clofazimine, B746, (148) and electron transport involved Yet to be identified (150) B4157 in cellular respiration (149)

Mutation in the gene ethA (132); Disruption of cell envelope possible cross-resistance Thiacetazone permeability and host between thiocarbonyl-containing immunomodulation (151) antibiotics (132)

Tuberactinomycin: Inhibition of protein synthesis, enviomycin/ Single and double mutations in particularly in post-transcriptional tuberactinomycin target ribosomal subunit genes modification and translational N, viomycin, (77, 155, 156) initiation (152-154) capreomycin

M. tuberculosis has intrinsic drug resistance mechanisms that render most antimicrobials ineffective. Its unique lipid-rich cell envelope structure has low permeability to most clinical antibiotics (157), and it is equipped with drug efflux pumps (158). Provided that the drug is able to penetrate the cell wall, mycobacteria have another complementary system that coordinates resistance to antibiotics inhibiting cytoplasmic targets.

28 Introduction

On the other hand, M. tuberculosis is known to possess genomic plasticity (159). Most cases of drug resistance in M. tuberculosis develop via mutations of the target genes, such as rpoB against rifampicin, rrs against kanamycin, and gyrA against the fluoroquinones. Multidrug resistance occurs via the accumulation of independent mutations in more than one of these genes (160).

One of the major issues in antimycobacterial research is the absence of new drugs with novel mechanisms of action, while resistance has been observed with all current therapeutics. Cutting-edge technologies and more advanced screening processes have resulted in several drug candidates with novel activities currently being tested in later stage clinical trials (Table 2). From these new drug candidates, the semi-synthetic

TMC207 has received FDA approval, specifically for patients with MDR-TB, through its accelerated approval program which based its decision on Phase II trials (161-163).

Commercialised under the name bedaquiline, it is the first anti-TB therapy with a novel mechanism of action in more than 40 years (164).

29 Introduction

Table 2 Anti-tuberculosis drug candidates in clinical trials Clinical In vitro Drug Sponsor Class Mode of Action Trial Potency Status

III, FDA- Targeting ATP 30-120 approved TMC 207 synthase, inhibition Janssen Diarylquinoline ng mL-1 (accelerated (Bedaquiline) of proton pumping (165, 166) program) activity (167) (161)

Prevention of cell 150-300 wall mycolic acid PA-824 TB Alliance Nitroimidazole ng mL-1 II (173) biosynthesis (169- (168) 172)

6-24 Prevention of cell OPC 87863 Otsuka Nitroimidazole ng mL-1 wall mycolic acid III (173) (Delamanid) (174) biosynthesis (175)

Inhibition of 200-780 mycolic acid SQ109 Sequella Ethylenediamine ng mL-1 II (176) transport to the cell (176) wall (149, 177)

Targeting 23S PNU-100480 120 ng mL-1 rRNA, inhibition of Pfizer Oxazolidinone II (173) (Sutezolid) (178) bacterial protein synthesis (179)

undisclosed AZD5847 AstraZeneca Oxazolidinone undisclosed data II (173) data

1.3.3 The search for new anti-tuberculosis natural products

Natural products have played crucial roles in the treatment of TB. The global effort to decrease the incidence of TB, combined with the rapid development of resistant strains, has increased interest in natural products as sources of novel anti-tubercular compounds.

Development of in vitro whole organism reporter bioassays (180), purified target

(biochemical) bioassays (181, 182), and in vivo bioassays (183) have accelerated the

30 Introduction

assessment process for drug candidates, and thus considerably increased the discovery rate of new compounds.

More than 300 novel anti-tubercular agents were identified and characterised from biological sources between 2003-2005 (184), while there were a further 450 novel entities identified from 2006-2009 (185). Furthermore, there have been 28 novel compounds isolated from microbial sources between 2008 and 2012, as listed in Table

3. Of these, 11 were polyketides or polyketide-derived, and 10 were small peptides, further highlighting the significance of these classes of natural products.

Natural product drug discovery works on the basis that biological diversity is the key to chemical diversity (186). One prerequisite for the discovery of novel bioactive compounds is choosing suitable source material which significantly increases the chance of discovering new leads. Plants have long been viewed as a common source of remedies, either in the form of traditional preparations or as pure active principles. This forms a strong basis to utilise local plants that have been traditionally used as medicine and investigate them for their active chemical constituents. In fact, Norman R.

Farnsworth, one of the pioneers in the field of pharmacognosy (study of traditional medicines), highlighted that in 1985, there were 119 compounds isolated from 90 plants which were utilised as single entity medicinal agents (187). Most importantly, 77% of these compounds were obtained as a result of examining the plant based on an ethnomedical use, and were utilised in a manner similar to their traditional use. This emphasises the rationale of investigating traditional medicinal plants for chemical discovery.

31 Introduction

Table 3 Novel microbial antitubercular compounds between 2008-2012 Microbial Active Compound Class MICa Ref Producer Against

M. Phomopsis sp. Phomoenamide Amide tuberculosis 6.25 µg mL-1 (188) PSU-D15 H37Ra

M. Bisdethiobis(methylsulfanyl) Aspergillus terreus Peptide tuberculosis 25 µg mL-1 (189) apoaranotin BCC 4651 H37Ra

M. Mortierella alpine Calpinactam Peptide tuberculosis 12.5 µg mL-1 (190) FKI-4905 H37Rv

Ophiocordyceps M. Cordycommunin Peptide communis BCC tuberculosis 12.9 µg mL-1 (191) 16475 H37Ra

Nocardia M. Nocardithiocin Peptide pseudobrasiliensis tuberculosis 25 ng mL-1 (192) IFM 0757 H37Rv

M. Sansanmycin A Peptide Streptomyces sp. SS tuberculosis 16 µg mL-1 (193) H37Rv

M. Sansanmycin F Peptide Streptomyces sp. SS tuberculosis 16 µg mL-1 (193) H37Rv

M. Sansanmycin G Peptide Streptomyces sp. SS tuberculosis 16 µg mL-1 (193) H37Rv

M. Trichoderma sp. Trichoderin A Peptide tuberculosis 0.12 µg mL-1 (194) 05F148 H37Rv

M. Trichoderma sp. Trichoderin A1 Peptide tuberculosis 2.0 µg mL-1 (194) 05F148 H37Rv

M. Trichoderma sp. Trichoderin B Peptide tuberculosis 0.13 µg mL-1 (194) 05F148 H37Rv

(3S,4R)-4,8-dihydroxy-3- M. Phaeosphaeria sp. methoxy-3,4-dihydro- Polyketide tuberculosis 12.5 µg mL-1 (195) BCC 8292 naphthalen-1(2H)-one H37Ra

32 Introduction

Table 3 (continued) Microbial Active Compound Class MIC Ref Producer Against

(4S)-3,4,8-trihydroxy-6- M. Phaeosphaeria sp. methoxy-3,4-dihydro- Polyketide tuberculosis 25 µg mL-1 (195) BCC 8292 naphthalen-1(2H)-one H37Ra

(S)-4,6,8-trihydroxy-3,4- M. Phaeosphaeria sp. dihydronaphthalen-1(2H)- Polyketide tuberculosis 12.5 µg mL-1 (195) BCC 8292 one H37Ra

1-(1-hydroxy-3,6- M. dimethoxy-5,8-dioxo-5,8- Phaeosphaeria sp. Polyketide tuberculosis 0.39 µg mL-1 (195) dihydro-naphthalen-2- BCC 8292 H Ra yl)ethyl acetate 37

2,5,7-trihydroxy-3-(1-(1- hydroxy-3,6-dimethoxy- M. 5,8-dioxo-5,8- Phaeosphaeria sp. Polyketide tuberculosis 6.25 µg mL-1 (195) dihydronaphthalen-2- BCC 8292 H Ra yl)ethyl)naphthalene-1,4- 37 dione

6-ethyl-5-hydroxy-2,7- M. Phaeosphaeria sp. dimethoxynaphthalene-1,4- Polyketide tuberculosis 12.5 µg mL-1 (195) BCC 8292 dione H37Ra

M. Biscogniauxia Biscogniazaphilone A Polyketide tuberculosis 5.12 µg mL-1 (196) formosana H37Rv

M. Biscogniauxia Biscogniazaphilone B Polyketide tuberculosis 2.52 µg mL-1 (196) formosana H37Rv

M. Chaetomium Chaetoviridine E Polyketide tuberculosis 50 µg mL-1 (197) cochloides VTh01 H37Ra

M. Chaetomium Mollicellin K Polyketide tuberculosis 12.5 µg mL-1 (198) brasiliense H37Rv

M. Ramaria Ramariolide A Polyketide tuberculosis 64 µg mL-1 (199) cystidiophora W179 H37Rv

M. 3-epi-astrahygrol Terpene Astraeus pteridis tuberculosis 34 µg mL-1 (200) H37Rv

33 Introduction

Table 3 (continued) Microbial Active Compound Class MIC Ref Producer Against

M. 3-epi-astrapteridiol Terpene Astraeus pteridis tuberculosis 58 µg mL-1 (200) H37Rv

M. Astraodoric acid A Terpene Astraeus odoratus tuberculosis 50 µg mL-1 (201) H37Ra

M. Astraodoric acid B Terpene Astraeus odoratus tuberculosis 25 µg mL-1 (201) H37Ra

M. Hopane-6b,11a,22,27- Conoideocrella Terpene tuberculosis 24.8 µg mL-1 (202) tetraol tenuis BCC 18627 H37Ra

M. Kionochaeta Ramiferin Terpene tuberculosis 6.25 µg mL-1 (203) ramifera H37Ra Note: aMIC = minimum inhibitory concentration.

Additionally, to further increase chemical diversity, and based on the premise that each plant hosts a number of endophytic microorganisms, it has been beneficial exploring these microbes to discover novel compounds. An example is provided by a group of microbiologists in Thailand, who investigated fungal endophytes from their local medicinal plants for bioactivity (204). It was shown that from 360 morphologically distinct endophytic fungi, extracts from 92 isolates were found to inhibit the growth of

-1 M. tuberculosis H37Ra (MIC of 0.0625-200 µg mL ), 6 inhibited Plasmodium

-1 falciparum (IC50 of 1.2-9.1 µg mL ), 40 showed antiviral activity against Herpes

-1 simplex virus type I (IC50 of 0.28-50 µg mL ), 60 exhibited anti-proliferative activity

-1 against a human oral epidermoid carcinoma cell line (EC50 of 0.42-20 µg mL ), and 48

-1 extracts had anti-cancer activity against breast cancer cells (EC50 of 0.18-20 µg mL ).

34 Introduction

These examples highlight the mutual relationship between biological diversity and drug discovery.

Endophytes are a potential source of novel bioactive compounds. Nonetheless, precise screening, purification, and identification methods are required to target active compounds since each microorganism may contain a large pool of compounds with only few being bioactive to a chosen target. An example is the culturable endophytes from traditional Chinese medicinal plants (205). Bacterial and fungal endophytes from eight plants, traditionally used for anticancer therapy, were screened genetically for the presence of PKS and NRPS systems. Assays investigating antibacterial, antifungal, and cytotoxicity traits were also performed using crude extracts from these endophytes. The eight plants hosted 74 bacterial endophytes belonging to 14 genera, as well as 36 fungal endophytes from 10 genera. Moreover, 12% of bacterial endophytes and 58% of fungal endophytes possessed PKS machinery, while 13% of bacterial endophytes and 17% of fungal endophtyes had at least NRPS gene cluster. All of the endophytes containing either PKS and/or NRPS system exhibited anti-proliferative effects in at least one bioassay. From this example, it was shown that traditional medicinal plants harbour endophytes producing bioactive natural products. There was also a strong correlation between PKS/NRPS genes and bioactivity. Thus, combining genetic- and bioactivity- based de-replication steps, a streamlined method for bioactive natural product discovery was developed.

35 Introduction

1.3.4 Indonesian traditional medicine for the treatment of tuberculosis

Indonesia has one of the world’s largest floral diversities. This is largely due to its complex geological history, the existence of a large number of islands with endemic species, and the tropical climate that supports the growth of a diverse range of plants.

Indonesia contains two of the world’s 25 biodiversity hotspots, the Sundaland and

Wallacea regions, and has more than 40,000 different plant species, 16,500 of which are endemic (206). Of these plant species, approximately 10% are believed to possess some medicinal characteristics (207), many of which have not been investigated. Indonesian traditional herbal medicine, collectively referred to as jamu, has achieved a worldwide reputation for their use in treating various diseases. Approximately three-quarters of the country’s population consume various types of jamu on a regular basis for healthcare

(208). As with all traditional medicines, the development of jamu started by trial-and- error experiments to discover the beneficial properties of plants (209). The traditional healers, who possessed advanced knowledge of these plants, have occupied a privileged position in society (207). The knowledge has mainly passed verbally from generation to generation (210).

Ethnobotanical drug discovery efforts resulted the discovery of the polyphenols from two frequently used traditional Indonesian medicinal plants (208). Guazuma ulmifolia

Lam. (local name: daun jati belanda) was traditionally used to treat liver disease, while

Sauropus androgynus Merr. (local name: daun katuk) reduces fever. Researchers believed that the beneficial effects of these plants were associated with the antioxidative activity of polyphenols. Subsequent phytochemical investigations isolated kaempferol

36 Introduction

from S. androgynus and luteolin from G. ulmifolia. The antioxidative properties of these compounds were confirmed by in vitro tests using rat hepatoma cells (208).

As with other cultures around the world, a number of plants have been utilised by

Indonesian traditional herbalists to treat what commonly known as TB (Table 4). It is worth noting that as knowledge of the disease was limited, the plants used in traditional therapies for what we now know as TB were based on the symptoms the patients exhibited, such as coughing with blood-tinged sputum or shortness of breath. While a small proportion of Indonesian medicinal plants have been extensively studied and contain specific anti-tubercular compounds, most of these plants remain under-studied and may be host to many endophytes and their antibiotics compounds.

Table 4 Indonesian plants that were traditionally used to treat symptoms of tuberculosis Plant Local Name Parts Used Medicine Preparation Ground with mortar and pestle, Andrographis paniculata Sambiloto Leaves served with honey (211) Ground with mortar and pestle Brucea javanica Buah Makasar Fruit (212) Boiled water extract of Caesalpinia sappan Secang Stem chopped pieces (213) Boiled water extract of ground Centella asiatica Pegagan All aerial parts plant (212) Hibiscus tiliaceus Waru Leaves Boiled water extract (212) Lantana camara Tembelekan Leaves and flowers Boiled water extract (214) Morinda citrifolia Mengkudu All aerial parts Boiled water extract (215) Nasturtium indicum Sawi Tanah All aerial parts Boiled water extract (213) Pluchea indica Beluntas Leaves and roots Boiled water extract (211) Rhoeo spathacea Nanas Kerang Leaves Boiled water extract (216) Ricinus communis Jarak Leaves and roots Boiled water extract (217) Vitex trifolia Legundi Leaves Boiled water extract (217)

37 Introduction

The ultimate aim of bioprospecting for novel compounds is to isolate compounds which are safe and efficacious for human use. Efficient screening mechanisms are crucial for targeting potential bioactive compounds. Prior knowledge of biosynthesis of polyketides and small non-ribosomal peptides greatly assists in de-replicating the plethora of compounds produced by a single microorganism. Structure elucidation of the isolated chemicals and characterisation of their biosynthetic pathways provides a basis for these novel compounds to be investigated in clinical trials and for commercial purposes. The potential of antimycobacterial drug discovery from endophytes from traditional medicinal plants is immense.

1.4 Study Rationale and Aims

There is a persistent battle between pathogens and drugs and thus, a constant urgency to discover novel antibiotics against these microorganisms, particularly the rapidly developing drug resistant strains of M. tuberculosis. The critical first step in discovering novel bioactive compounds is pin-pointing the most suitable source material. There are three important criteria for bioprospecting: significant biodiversity, a history of long- term human habitation, and the presence of native healers with a knowledge of local medicinal plants (218).

Home to some of the largest tropical rainforests in the world, Indonesia offers an incredible range of biodiversity, most of which has never been investigated. Biological diversity often translates into molecular diversity, increasing the possibility of isolating new chemical entities. Utilising traditional knowledge by studying plants that have been used to treat symptoms of respiratory disease may assist in narrowing down the plants

38 Introduction

as targets for investigating the production of novel antimycobacterial compounds.

Furthermore, based on the premise that many plant bioactive compounds are actually produced by their microbial symbionts, exploring the endophytes from these medicinal plants will assist in isolating and producing their active components.

The ultimate aim of bioprospecting for novel compounds is to isolate compounds which are safe and efficacious for human use. Efficient screening mechanisms are crucial for targeting potential bioactive compounds. Prior knowledge of biosynthesis of polyketides and small non-ribosomal peptides greatly assists in de-replicating the plethora of compounds produced by a single microorganism. Advanced chemical detection technologies such as high performance liquid chromatography, nuclear magnetic resonance and high resolution mass spectrometry needs to be employed in order to purify, identify, and characterise these low abundance, active compounds.

The overall aim of this thesis was to bioprospect for novel anti-tuberculosis compounds from traditional Indonesian medicinal plant-associated endophytes. Endophytes were isolated from selected Indonesian medicinal plants and screened for PKS and NRPS biosynthetic genes as a means for prioritising strains for downstream analyses (Chapter

2). The fungal isolates were also subjected to antimicrobial screening against

Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, Mycobacterium phlei, Mycobacterium avium, Mycobacterium smegmatis, and Mycobacterium tuberculosis (Chapter 2). Based on the biological screening process, a Fusarium sp. strain and an Endothia sp. strain were selected for further chemical analysis. This led to the isolation of javanicin and anhydrofusarubin from Fusarium sp. (Chapter 3), and the isolation of acropyrone and compound 11UF1.S-5D6B from Endothia sp. (Chapter 4).

Chapter 2

BIOLOGICAL DIVERSITY AND

BIOACTIVITY PROFILE OF

CULTURABLE ENDOPHYTES

ISOLATED FROM TRADITIONAL

INDONESIAN MEDICINAL PLANTS

40 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Summary

This chapter explored the biodiversity and bioactivity potential of 168 bacterial and fungal endophytes isolated from twelve Indonesian traditional medicinal plants used to treat symptoms of tuberculosis. The 16S rRNA gene sequence analysis revealed phylogenetic diversity with at least 20 genera represented, spread across the phyla

Firmicutes, Actinobacteria, and Proteobacteria. All bacterial genera from this study have been previously isolated as endophytes. Similarly, 18S rRNA gene sequence analysis also uncovered phylogenetic diversity with at least 20 genera from the phylum

Ascomycota.

The biosynthetic potential of all morphologically distinct endophytes were evaluated by detecting the presence of highly conserved ketosynthase domain of the polyketide synthase (PKS) and the adenylation domain of the non-ribosomal peptide synthetase

(NRPS). PCR-based screening showed presence at high proportion of PKS and NRPS biosynthetic genes in both bacterial and fungal endophytes (83% and 94%, respectively). This is the first report on the isolation of endophytes in Nasturtium indicum, Vitex trifolia, and Rhoeo spathacea.

Furthermore, the fungal endophytes were tested for their anti-proliferative activity against Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus,

Mycobacterium phlei, M. smegmatis, M. avium, and M. tuberculosis. Seventy-five isolates demonstrated bioactivity on at least one test strain, 56 of which exhibited antiproliferative activity. Four isolates: 9RF2 (Fusarium sp. from R. spathacea), 11UF1,

11UF3, and 11UF4 (Endothia sp. from B. javanica), displayed total growth inhibition

41 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

against M. tuberculosis. This chapter highlighted the bioactive potential of endophytes from traditional Inodnesian medicines. This potential was further explored in chapters 3 and 4.

42 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

2.1 Introduction

Endophytes are microorganisms, mainly bacteria and fungi, that colonise healthy plant tissues without causing any damage to their plant hosts (37, 38). Research suggests that each individual plant harbours at least one endophyte (39), some of which are exclusive to their host plant (38). Endophytes establish a unique symbiotic relationship with their plant host by providing extra biological defence against foreign phytopathogens and enhancing the plant’s ecological fitness (42, 45, 46, 48, 50). Recently, research into endophytes has gained momentum due to their relatively unexplored potential as a source of novel bioactive compounds. It is widely suggested that the distinctive symbiosis endophytes hold with the plant hosts may result in a greater number and diversity of important biological molecules with reduced cell toxicity towards higher organisms (38).

Only a few plant species have been investigated for their endophytes (219, 220). This indicates that a myriad of potentially bioactive natural products are yet to be discovered from these largely understudied sources. Therefore, it is important to rationalise and select the best plant candidates to ensure effective novel bioactive metabolite discovery.

One such way is to investigate plants that have been traditionally used to treat diseases.

This ethnobotanical approach has been proven successful in increasing the likelihood of isolating novel bioactive compounds (221-223). Previous studies have also shown that endophytes also produce the same or similar bioactive molecules, as their host. This includes anticancer drugs camptothecin (51), podophyllotoxin (52), and most notably paclitaxel (taxol) (59). Furthermore, in some cases, the endophytes are the true producers of active compounds thought to be produced by the host plants (see Section

43 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

1.1.2). For example, a prolific, wide-spectrum antibiotic compounds munumbicins were produced by an endophytic strain of Streptomyces sp., discovered from the Australian

Aboriginal medicinal plant snakevine (Kennedia nigriscans), traditionally used to treat skin wounds and infections (224). In short, endophytes from traditional medicinal plants represent promising targets for novel drug discovery.

This study focused on endophytes from Indonesian medicinal plants. Indonesia possesses one of the largest floral biodiversity in the world due to its unique geographical settings of a tropical archipelago with an abundance of rainforests (206).

Approximately 4,000 of these plant species are thought to have some medicinal characteristics (207) and a large proportion of these have not been thoroughly studied. A major national effort coordinated by National Agency of Food and Drug Control under the Ministry for Health has been carried out to construct an Indonesian Pharmacopoeia

(225) to systematically record the country’s botanical diversity and traditional knowledge.

Twelve plants have been confirmed by the Indonesian Agency for the Assesment and

Application of Technology and the Indonesian branch of the International Council for

Science – United Nations (ICSU) to be traditionally used to treat TB (see Section 1.3.4).

However, due to the minimal knowledge of the disease itself, this traditional therapy was based on the symptoms exhibited by the patients, particularly coughs with blood- stained sputum. Nonetheless, despite being recognised as a traditional medicine for the treatment of TB, very few studies have been conducted on these plants to investigate their anti-tubercular constituents as well as their mechanism of action against mycobacteria.

44 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

One of the challenges of discovering novel compounds is the rediscovery of isolated microbes and compounds (226, 227). A strategy for strain de-replication upstream in the discovery process is necessary to increase the chance of obtaining novel chemical compounds. In this study, one of the strain prioritisation strategies was established by screening for the presence of polyketide/non-ribosomal peptide biosynthetic pathways, two of the most studied and largest classes of secondary metabolites (60, 228). The polyketides and non-ribosomal peptides are produced by large modular enzymatic machinery (67), with the genes encoding the ketosynthase domain of a PKS (229) and the adenylation domain of a NRPS (230) possessing highly conserved motifs, a characteristic that is useful for the screening process. Another strain prioritisation strategy was carried out through antimicrobial bioactivity screening against several pathogenic bacteria, including a number of mycobacterial strains. It is hypothesised that the gene-based molecular screening and the bioactivity screening would be effective in selecting the best candidates for targeted drug discovery.

Twelve Indonesian traditional medicinal plants were evaluated for their microbial diversity and the biosynthetic potential of their fungal and bacterial endophytes were determined. Based on the results of this screening, fungal isolates were selected for further study. Chemical extracts from the fungal endophytes were tested for their ability to inhibit the growth of Gram-negative Escherichia coli, Pseudomonas aeruginosa,

Gram-positive Staphylococcus aureus, and four mycobacterial strains: Mycobacterium phlei, M. smegmatis, M. avium, and M. tuberculosis. These bioassay results were combined with the genetic screening to determine the best candidates for downstream bioactive compound isolation and identification.

45 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

2.2 Materials and Methods

2.2.1 Plant collection

The plant collection and endophyte isolation were carried out at the facilities of the

Faculty of Biotechnology, Atma Jaya Catholic University of Indonesia, Jakarta, upon the establishment of a Collaborative Research Agreement with the University of New

South Wales (Matter 09-520). The endophyte materials were transferred to Australia using import permit IP09011087.

Twelve plants commonly used as traditional medicines in Indonesia to treat respiratory disorders were selected. These plant materials were collected from five different locations across the provinces of Jakarta, Banten, and West Java, Indonesia (Table 5).

Confirmation of the identities of these plants was carried out by Herbarium Bogoriense,

Research Centre for Biology, Indonesian Institute of Sciences in Bogor, Indonesia. The plants were collected between January-June 2010. Each plant was collected individually and processed at the Faculty of Biotechnology, Atma Jaya Catholic University of

Indonesia within 6 hours of collection.

46 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 5 Locations of Indonesian medicinal plants collected for isolation and culturing of endophytes Plant Collection Plant Local name* Collection Location ID Date Private garden at Kembangan, Jakarta, Andrographis 1 Sambiloto 12/01/2010 6° 11′ 46″ S / 106° 44′ 47″ E, elevation 5 paniculata m Streetside at Ciloto, Pacet, West Java, Centella 2 Pegagan 26/01/2010 6° 41′ 04″ S / 107° 01′ 01″ E, elevation asiatica 1387 m Private garden at Tajur, Bogor, Nasturtium 3 Sawi Tanah 29/01/2010 6° 35′ 45″ S / 106° 47′ 31″ E, elevation indicum 251 m Streetside at Tanah Abang, Jakarta, 4 Pluchea indica Beluntas 20/01/2010 6° 12′ 05″ S / 106° 49′ 01″ E, elevation 0 m Nursery at Pondok Cabe, Banten, 5 Vitex trifolia Legundi 17/02/2010 6° 20′ 14″ S / 106° 45′ 13″ E, elevation 60 m Streetside at Tanah Abang, Jakarta, Ricinus 6 Jarak 18/02/2010 6° 12′ 05″ S / 106° 49′ 01″ E, elevation 0 communis m Streetside at Tanah Abang, Jakarta, Hibiscus 7 Waru 01/03/2010 6° 12′ 05″ S / 106° 49′ 01″ E, elevation 0 tiliaceus m Nursery at Pondok Cabe, Banten, Caesalpinia 8 Secang 03/03/2010 6° 20′ 14″ S / 106° 45′ 13″ E, elevation sappan 60 m Nursery at Pondok Cabe, Banten, Rhoeo Nanas 9 04/03/2010 6° 20′ 14″ S / 106° 45′ 13″ E, elevation spathacea Kerang 60 m Private garden at Kembangan, Jakarta, Lantana 10 Tembelekan 25/05/2010 6° 11′ 46″ S / 106° 44′ 47″ E, elevation 5 camara m Nursery at Pondok Cabe, Banten, Brucea Buah 11 26/05/2010 6° 20′ 14″ S / 106° 45′ 13″ E, elevation javanica Makasar 60 m Private garden at Kembangan, Jakarta, Morinda 12 Mengkudu 03/06/2010 6° 11′ 46″ S / 106° 44′ 47″ E, elevation 5 citrifolia m

2.2.2 Endophyte isolation

Samples of roots, stems, leaves, flowers, and fruits were taken from apparently healthy plants. These plant materials were washed in running water for 10 min to remove soil contaminants and were surface sterilised by successive soaking in 70% ethanol for 2 47 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

min, sodium hypochlorite solution (5.25%) for 5 min, and 70% ethanol for 30 s before being air dried. Both sterilised and unsterilised leaves and stems were pressed on the surface of brain heart infusion agar (BHIA; Oxoid) for 15 s to confirm effectiveness of the surface sterilisation.

The surface-sterilised plant materials were then aseptically excised with the sizes between 2-5 mm2. For the isolation of fungi, these small fragments were placed on the surface of potato dextrose agar (PDA; BD) plates at 30°C for 7 days. After approximately 72 h, individual tips of the emerging fungi were removed and placed on fresh PDA plates. For bacterial isolation, the small fragments were placed on the surface of BHIA plates at 30°C for 7 days. After approximately 48 h, individual tips of the emerging bacterial colonies were removed and placed on fresh BHIA plates. The cultures were periodically checked for purity and successively subcultured until pure cultures were obtained. Long-term stocks were prepared in 50% glycerol and stored at -

80°C. Duplicates of these stock cultures are in repository at Atma Jaya Catholic

University of Indonesia, Jakarta.

2.2.3 Material transfer

The fungal and bacterial endophytes were transported to Australia in 0.6-mL microcentrifuge tubes containing 0.1 mL of culture media. Briefly, for the fungal isolates, a 2 mm × 2 mm fragment from a 3-day-old agar culture was aseptically transferred in to the microcentrifuge tube containing 0.1 mL of PDA and incubated for 3 days at 30°C. For the bacterial isolates, a swab of a day-old agar culture was stabbed in to RAVAN media (5 g L-1 glucose, 5 g L-1 peptone, 5 g L-1 yeast extract, 5 g L-1 sodium

48 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

acetate, 2 g L-1 pyruvic acid; pH 7.0) (231, 232) in the microcentrifuge tube and incubated overnight at 30°C.

Within 24 hours upon arrival in Australia, the fungal cultures were aseptically transferred to fresh PDA plates and incubated at 30°C for 7 days while the bacterial cultures were aseptically transferred to fresh heart infusion agar (HIA; Oxoid) plates and incubated at 30°C overnight. Long term storage of the strains were prepared in 50%

(v/v) glycerol and stored at -80°C.

2.2.4 Genomic DNA extraction from endophytes

Genomic DNA was extracted utilising the potassium ethyl xanthogenate (XS) buffer method (233). The buffer is composed of 1% potassium ethyl xanthogenate, 800 mM ammonium acetate, 100 mM Tris-HCl pH 7.4, 20 mM EDTA and 1% SDS.

Approximately 100 mg of fungal or bacterial cells were added to 500 µL of XS buffer.

Samples were incubated at 65°C for 2 h with rapid mixing every 30 min. The samples were placed on ice for 10 min then centrifuged at 12,000 × g RCF for 10 min at 4°C.

The supernatant was transferred to a fresh microcentrifuge tube and 500 µL of phenol/chloroform/isoamyl alcohol (25:24:1; Sigma-Aldrich) was added to the tube.

The aqueous layer was separated from the organic layer by centrifugation at 12,000 × g

RCF for 10 min at 4°C, and transferred to a fresh microcentrifuge tube. This phenol/chloroform/isoamyl alcohol purification step was repeated twice, followed by another purification step using 500 µL of chloroform/isoamyl alcohol (24:1, Ajax

FineChem). The DNA was precipitated from the solution by overnight incubation at

4°C after adding two volumes of ethanol and 1/10 volume of 3 M sodium acetate. The

49 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

DNA was washed twice with 190 µL of 70% ethanol. The purified DNA was stored in

TE buffer at -20°C. DNA yield and purity was assessed by electrophoresis on a 1% agarose gel and with the Nanodrop® spectroscopy system (Thermo Fisher Scientific).

Agarose gel electrophoresis was performed in TAE buffer (40 mM tris-acetate, 1 mM

EDTA, pH 7.8) and visualised by ethidium bromide staining (0.5 µg mL-1) using the

GelDoc XR UV transilluminator system equipped with Image Lab software (Bio-Rad).

2.2.5 Genetic analysis of bacterial endophytes

The rRNA primers 27F and 1494R (Table 6) were used to amplify the highly conserved

16S rRNA gene region, a component of small 30S ribosomal subunit in prokaryotes.

The PCR was performed with a MyCycler™ Thermal Cycler (Bio-Rad) in a 20-µL reaction, containing 1× reaction buffer (Bioline), 2.5 mM MgCl2 (Sigma-Aldrich), 0.2 mM dNTPs (Bioline), 10 pmol of each primer (IDT), 0.2 U of Taq DNA polymerase

(Bioline), 1–10 ng of DNA template and sterile Milli-Q water. The thermal cycling conditions were: 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, and a final extension step of 72°C for 7 min. The DNA of

Cylindrospermopsis raciborskii AWT205 was used as a positive control. PCR amplicons were separated by agarose gel electrophoresis in TAE buffer and visualised as described before. The 16S rRNA PCR amplicons were purified using DNA

AdvancedTM DNA Clean Up and Concentrator Miniprep System (Viogene) and sequenced using the PRISM Big-Dye™ cycle sequencing system v3.1 on an ABI

PRISM 373 DNA Sequencer (Life Technologies). Where two or more matches were returned with the same identity and coverage score, the top two organisms were tabulated or organisms (with the same match) which have been isolated as endophytes

50 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

or symbiotic organisms were recorded instead. Furthermore, multiple sequence alignment was performed to observe resemblance between strains returning similar

BLASTN results. Strains returning 100% match score but isolated from different parts of the same plant were considered separate. Likewise, phylogenetically matching strains displaying different morphology and physiology on the agar plate were both considered for further investigations.

2.2.6 Genetic analysis of fungal endophytes

Fungal specific rRNA primers nu-SSU-0817 and nu-SSU-1536 (Table 6) were used to amplify the highly conserved 18S rRNA gene region. The PCR reactions were performed in a 20-µL reaction as described before. The thermal cycling conditions were: 94°C for 2 min, followed by 35 cycles of 94°C for 30 s, 56°C for 10 s, and 72°C for 40 s, and a final extension step of 72°C for 7 min. The DNA of Aspergillus niger

ATCC 16404 was used as a positive control. PCR amplicons were separated by agarose gel electrophoresis in TAE buffer and visualised as described before. The 18S rRNA

PCR amplicons were purified using ethanol precipitation and sequenced using the

PRISM Big-Dye™ cycle sequencing system v3.1 on an ABI PRISM 373 DNA

Sequencer (Life Technologies).

51 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 6 PCR primers used in the DNA screening of bacterial and fungal endophyte isolates

Primer sequence PCR Target Primer product Reference (5′  3′) size (bp)

27Fl AGAGTTTGATCCTGGCTCAG Bacterial 16S 1486 (234) rRNA gene 1494Rc TACGGCTACCTTGTTACGAC

nu-ssu- TTAGCATGGAATRRATTAGGA 0817 Fungal 18S 719 (235) rRNA gene nu-ssu- ATTGCAATGCYCTATCCCCA 1536

Adenylation MTF2 GCNGGYGGYGCNTAYGTNCC domain of ~1000 (230) NRPSs MTR2 CCNCGDATYTTNACYTG

Ketosynthase DKF GTGCCGGTNCCRTGNGYYTC domain of ~650-700 (229) PKSs DKR GCGATGGAYCCNCARCARMG

Where two or more matches were returned with the same identity and coverage score, the top two organisms were tabulated or organisms (with the same match) which have been isolated as endophytes or symbiotic organisms were recorded instead.

Furthermore, multiple sequence alignment was performed to observe resemblance between strains returning similar BLASTN results. Strains returning 100% match score but isolated from different parts of the same plant were considered separate. Likewise, phylogenetically matching strains displaying different morphology and physiology on the agar plate were both considered for further investigations.

2.2.7 Phylogenetic tree construction of the fungal and bacterial endophytes

To determine the phylogenetic groupings of the endophytes, the 16S and 18S rRNA sequences were compared with those available in GenBank via BLASTN

52 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

(http://blast.ncbi.nlm.nih.gov/BLAST.cgi) searches. DNA sequences of representative strains were also retrieved from GenBank. The gene sequences of isolates and representative strains were aligned using MUSCLE v3.8.31 (236, 237). The ends of the sequence alignments were manually trimmed and truncated/ambiguous sequences were removed from the analysis using BioEdit (238). The optimal phylogenetic model used to analyse the data was identified using FindModel (available at http://www.hiv.lanl.gov/content/sequence/findmodel/findmodel.html). Specifically, the

Weighbor model was used for the rRNA gene data. Maximum likelihood tree was constructed using PhyML (available at http://www.atgc-montpellier.fr/phyml/) with aLRT SH-like method. The nucleotide sequences obtained in this study were deposited in GenBank and have the accession numbers KT150159 - KT150250 for bacterial 16S rRNA and KT150083 - KT150158 for fungal 18S rRNA.

2.2.8 Biosynthesis gene screening via PCR

The presence of PKS and NRPS coding genes within the genomes was determined using degenerate PCR. The primers DKF and DKR (Table 6) were used to amplify the ketosynthase domain coding regions of PKSs (229), while the primers MTF2 and

MTR2 (Table 6) were utilised to target the adenylation domain coding regions of

NRPSs (230). The PCR was performed with a total volume of 20 µL as described before, except with 25 pmol of each primer (IDT). Thermal cycling was performed with an initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 10 s, annealing at 52°C (for PKS) or 55°C (for NRPS) for 30 s and extension at

72°C for 1 min, followed by a final extension step at 72°C for 7 min. The DNA of

53 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Microcystis aeruginosa 7806 was used as a positive control. The PCR-amplified DNA was electrophoresed and visualised as described before.

2.2.9 Chemical extraction of fungal cultures

Fungal endophytes were cultured on PDA plates at 30°C for 7 days. Approximately 5 mm × 5 mm fragment of the agar culture was aseptically excised from the plate, transferred to a sterile Erlenmeyer flask containing 100 mL of malt extract broth (BD,

North Ryde, Australia), and incubated for 14 days at 30°C with shaking at 100 rpm. The culture media was then filtered through filter paper to separate the fungal mycelia from the supernatant culture broths. The culture broths were extracted three times with equal volumes of ethyl acetate (100 mL; Ajax FineChem), the organic layers separated and combined, the residual water removed using anhydrous MgSO4 (Sigma-Aldrich), and the extract dried via rotary evaporation. On the other hand, the fungal biomass was air- dried and then extracted by mild sonication after soaking for an hour with 1% acetic acid in methanol. The organic layer was separated from the fungal mycelia and the residual water was removed using anhydrous MgSO4 (Sigma-Aldrich), and the extract dried via rotary evaporation. The dry extracts were weighed and they were stored at -

20°C until required for the bioassay. Immediately prior to use, one miligram of each crude extract was dissolved in 50 µL of dimethyl sulfoxide (Sigma-Aldrich) to yield a final concentration of 20 mg mL-1.

54 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

2.2.10 Determination of antibacterial activity using the broth dilution

The antibacterial activities of the fungal endophyte extracts were determined using

Gram-negative bacteria Escherichia coli NCTC 10418 and Pseudomonas aeruginosa

NCTC 10490, and Gram-positive bacterium, Staphylococcus aureus NCTC 6571.

Briefly, bacterial test strains were grown in nutrient broth (Sigma) at 37°C until the cultures reached the mid-exponential phase of growth, as indicated by an OD600 of 0.6

(239). The cells were then collected by centrifugation at 5,000 × g RCF for 5 min and resuspended in half of their original volume. An aliquot of the crude extract was aseptically transferred to a vial and serially diluted in sterile culture media to a concentration of 20 and 200 μg mL-1. Prepared cell aliquots (50 μL) were seeded into sterile flatbottomed 96-well microtitre plates and diluted with an equal volume of the prepared extract to make the final concentrations of the extracts 10 and 100 μg mL-1.

Experiments were performed in triplicate with controls included in every plate. The controls included media-only wells and cells treated with 1% DMSO. Ciprofloxacin

(100 μg mL-1; Invitrogen) was used as a positive control while untreated cells served as a negative control in the assay. After 48 h incubation, the OD600 was measured using a

SpectraMax 340 plate reader (Molecular Devices).

The inhibition of cell proliferation, as a percentage of the untreated control, was calculated using the formula:

% inhibition = (1 – [(A600 test – A600 media)/(A600 control – A600 media)]) × 100 where %IC = proliferation of test cells as a percentage of the proliferation of untreated cells, A600 test = absorbance of test cells, A600 media = absorbance of media blank, and

A600 control = absorbance of untreated cells. The results were analysed and bioactivity

55 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

levels with standard error of the mean (SEM) were determined using Prism 6.0 for

Windows (GraphPad Software). Unpaired multiple t-test was performed on the data, and statistical significance determined without correction for multiple comparisons, with p < 0.05. Each triplicate of the same sample was analysed individually, without assuming a consistent SEM.

2.2.11 Determination of antimycobacterial activity using the agar dilution

Four test strains were used to determine the antimycobacterial activities of the fungal endophyte extracts using agar dilution method. Mycobacterium phlei ATCC 11758 and

Mycobacterium avium subsp. avium ATCC 25291 were obtained from the UNSW

BABS Microbiology Culture Collection. Mycobacterium smegmatis ATCC14468 and

Mycobacterium tuberculosis H37Ra ATCC 25177 were a gift from the Tuberculosis

Research Group at the Centenary Institute, Sydney. The test strains were grown on

Middlebrook 7H10 agar supplemented with oleic acid, albumin, dextrose and catalase

(OADC supplement, Difco). The crude extracts were added to the molten media (held at

50°C) at 1% v/v to yield a final concentration of 100 µg mL-1 and 2 mL of this was added to 24-well microplates. After the medium hardened, the inoculum was spotted on to the surface using a micro pipetter. The plates were incubated at 37°C for 7 days for

M. phlei and M. smegmatis, and 18 days for M. avium and M. tuberculosis. Experiments were performed in duplicate with controls included in every plate. The controls included media-only wells and cells treated with 1% DMSO. Ciprofloxacin (100 μg mL-1;

Invitrogen) was used as a positive control while untreated cells served as a negative control in the assay.

56 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

2.3 Results and Discussion

2.3.1 Plant surface sterilisation and endophyte isolation

The first step in endophyte isolation is to surface sterilise the plant materials to ensure all epiphytic (surface-colonising) microbes are eliminated and to allow endophytic microbes to emerge on to the media and grow independently from the plant materials.

The plant surface sterilisation step was verified by the absence of any microbial growth on the brain heart infusion agar containing the treated plant materials. No antibiotics were added onto the agar media during the endophyte isolation process to maintain natural growth conditions and minimise the antibiotic’s interference on the endophyte’s physiology.

The preliminary screening of the fungal and bacterial endophytes was based on macroscopic and microscopic morphologies. This process yielded 88 fungal isolates and

105 bacterial isolates from 12 plant species (Table 7). Overall, most morphologically unique endophytes were isolated from the stem of the plants (40% of all fungi and 31% of all bacteria), as is the case in A. paniculata, C. sappan, H. tiliaceus, L. camara, R. communis, and V. trifolia. Flowers and fruits are the main sources of distinct endophytes with the exception of L. camara, provided that these were present at the time of collection. The plants B. javanica and P. indica hosted the most morphologically unique endophytes (13 fungi and 14 bacteria). On average, each plant hosted 16.1 endophytes (7.3 fungi and 8.8 bacteria). Except for C. sappan, H. tiliaceus,

R. spathacea, and V. trifolia, there were more morphologically unique endophytic bacteria isolated from the plant host than the endophytic fungi.

57 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 7 Number of potentially distinct culturable fungal and bacterial endophytes from Indonesian traditional medicinal plants Section of Plant Plant Name Microbe Total Fruit Flower Leaf Stem Root Fungi -a - 1 1 0 2 Andrographis paniculata Bacteria - - 0 7 1 8 Total - - 1 8 1 10 Fungi 5 3 1 3 1 13 Brucea javanica Bacteria 2 4 3 2 3 14 Total 7 7 4 5 4 27 Fungi - - 1 4 1 6 Caesalpinia sappan Bacteria - - 1 2 2 5 Total - - 2 6 3 11 Fungi - - 2 3 1 6 Centella asiatica Bacteria - - 1 2 4 7 Total - - 3 5 5 13 Fungi - - 0 6 0 6 Hibiscus tiliaceus Bacteria - - 3 1 1 5 Total - - 3 7 1 11 Fungi 0 1 1 4 1 7 Lantana camara Bacteria 2 2 1 2 2 9 Total 2 3 2 6 3 16 Fungi 3 0 0 0 0 3 Morinda citrifolia Bacteria 3 1 0 1 3 8 Total 6 1 0 1 3 11 Fungi - - 4 3 2 9 Nasturtium indicum Bacteria - - 4 4 2 10 Total - - 8 7 4 19 Fungi - 5 3 2 3 13 Pluchea indica Bacteria - 3 4 5 2 14 Total - 8 7 7 5 27 Fungi - 3 4 n/ab 4 11 Rhoeo spathacea Bacteria - 5 1 n/a 4 10 Total - 8 5 n/a 8 21 Fungi - - 0 4 0 4 Ricinus communis Bacteria - - 3 5 2 10 Total - - 3 9 2 14 Fungi - - 2 5 1 8 Vitex trifolia Bacteria - - 1 2 2 5 Total - - 3 7 3 13 Fungi 8 12 19 35 14 88 TOTAL Bacteria 7 15 22 33 28 105 Total 15 27 41 68 42 193 Note: aDashes indicates the section of plant was not present at the time of collection, bn/a indicates the section of plant does not exist for this species.

In this study, only brain heart infusion agar and potato dextrose agar were used to isolate the microbes. While these media were chosen for their ability to grow fastidious bacteria and fungi, respectively, it is plausible that the diversity of culturable

58 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

endophytes may be limited. Furthermore, the surface sterilisation process was standardised across all plants and their sections to maintain consistency, however because the structures and compositions of plant materials may differ, the surface sterilisation process may work best on one plant but may not work sufficiently well on others.

2.3.2 16S and 18S rRNA gene amplification and sequence analysis

The 16S (Table 8) and 18S (Table 9) rRNA gene sequence data were used to identify the endophytes from each plant species. Unique isolates were labelled using the following nomenclature: the first character refers to the plant number (e.g. 1 =

Andrographis paniculata), the second character refers to the plant part where the endophyte was isolated (U = fruit, F = flower, L = leaf, S = stem, R = root), the third character identifies whether it is a fungal or bacterial isolate (F = fungal, B = bacterial), and the last character (digit) refers to the isolate number.

Strains returning 100% match score based on rRNA gene homology search but isolated from different parts of the same plant were considered separate entities due to the possibility of varying symbiotic associations with the host plant. Likewise, phylogenetically matching strains displaying different morphology and physiology on the agar plate were both considered for further investigations as they may possess different bioactivity profiles. For example, isolates 11UF1, 11UF3, and 11UF4 were all identified as Endothia sp., however the morphology on these plates were distinct. In addition, 11UF1 changed the colour of the PDA plate to a dark brown colour whereas

11UF4 did not, suggesting isolate 11UF1 secreted secondary metabolies which were not

59 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

expressed by 11UF4 under the described culture conditions. One Chinese study exploring fungal endophytes from Aquilaria sinensis discovered that two phylogenetically identical Fusarium solani isolated from the same plant species in different regions of China exhibited different antimicrobial and cytotoxic activities

(240). This implies that phylogenetic similarity does not warrant parallel metabolic profile.

60 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 8 BLASTn analysis of 16S rRNA gene sequences from isolated bacterial endophytes Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Andrographis Bacillus sp. EGY-SC*R3 KF217252 99 98 1SB1 Stem paniculata Bacillus cereus strain S1-5 KM273178 99 98

Andrographis Bacillus subtilis subsp. subtilis strain BTN7A KC438368 99 97 1SB3 Stem paniculata Bacillus tequilensis strain PUFSTFMId19 KC834391 98 98

Andrographis Microbacterium sp. 33 KJ726671 99 97 1SB4 Stem paniculata Microbacterium testaceum strain PCSB7 HM449703 99 97

Andrographis Macrococcus sp. CCGE2291 EU867328 100 97 1SB5 Stem paniculata Micrococcus luteus strain EHFS1_S04Ha EU071593 100 97

Andrographis Microbacterium testaceum strain L6-732 JQ659399 95 84 1SB6 Stem paniculata Microbacterium sp. M321 AB461732 94 84

Andrographis Methylobacterium sp. Asd M7-2 FM955875 98 92 1SB7 Stem paniculata Methylobacterium gregans strain RB678 AB252209 98 92

Andrographis Bacillus subtilis strain C3004 HQ154051 98 99 1RB1 Root paniculata Bacillus tequilensis strain SDS13 KM437882 98 99

Centella Enterobacter hormaechei strain VIT-SNSJ KJ437476 99 98 2LB1 Leaf asiatica Enterobacter xiangfangensis strain 10-17 NR_126208 99 98

Centella Bacillus thuringiensis strain CH-21 KF151161 99 97 2SB1 Stem asiatica Bacillus cereus strain -Y111 JX077093 99 97

Centella Bacillus licheniformis strain 3389O2 KF600530 96 99 2SB2 Stem asiatica Bacillus sp. LLVI-4 GU573844 96 99

Centella Pseudomonas sp. MG-2011-23-CX FR872478 99 99 2RB1 Root asiatica Pseudomonas fluorescens strain d3 HQ166099 99 99

Centella Burkholderia sp. KN-3 AB911047 99 99 2RB2 Root asiatica Burkholderia caribensis strain LUC264 AY586519 99 99

Centella Bacillus sp. THG-B11 KF793038 99 98 2RB3 Root asiatica Bacillus niacini strain GMA029 AB738789 99 98

Centella Bacillus sp. BCHMAC19 GU188891 99 98 2RB4 Root asiatica Bacillus pumilus strain FR-W6Ab FN395281 99 98

Nasturtium Staphylococcus arlettae strain Sn7 KM373314 100 98 3LB1 Leaf indicum Staphylococcus sp. LF79 JX114816 100 98

Nasturtium Paenibacillus sp. SBI-16 AB366300 96 98 3LB3 Leaf indicum Paenibacillus ourofinensis strain TS44 JQ735955 96 98

Nasturtium Xanthomonas sp. CR 7-08 KM252981 99 98 3LB4 Leaf indicum Xanthomonas gardneri strain Y3 JX298806 99 98

Nasturtium Bacillus pumilus strain GR29 KC771044 100 99 3SB2 Stem indicum Bacillus safensis strain ZN9 KJ542766 99 99

Nasturtium Bacillus megaterium isolate BD18-R20 HF584899 99 99 3SB3 Stem indicum Bacillus aryabhattai strain T10 KM019683 99 99

Nasturtium Bacillus amyloliquefaciens strain CD2901 KC492052 100 99 3RB1 Root indicum Bacillus subtilis strain P38 JQ669676 99 99

61 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 8 (continued) Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Nasturtium Bacillus safensis strain ZN9 KJ542766 98 99 3RB2 Root indicum Bacillus pumilus strain IHB B 16642 KM817268 98 99

Pluchea Bacillus sp. SCU-B154 KJ000811 99 98 4FB1 Flower indica Bacillus pumilus strain GR29 KC771044 100 98

Pluchea Bacillus safensis strain AB-206 KF843726 97 98 4LB1 Leaf indica Bacillus pumilus strain MMRL13 HM804301 97 98

Pluchea Bacillus subtilis strain SCDB1470 KM922588 99 99 4LB2 Leaf indica Bacillus sp. CIFE_HT35 KM016989 99 99

Pluchea Bacillus pumilus strain GR29 KC771044 100 99 4LB3 Leaf indica Bacillus safensis strain ZN9 KJ542766 99 99

Pluchea Microbacterium sp. 33 KJ726671 99 99 4LB4 Leaf indica Microbacterium testaceum strain PCSB7 HM449703 99 99

Pluchea Microbacterium sp. L7-509 JQ659442 98 97 4SB1 Stem indica Microbacterium testaceum strain PCSB7 HM449703 98 98

Pluchea Bacillus cereus strain VIT-RPJ KJ437475 99 97 4SB2 Stem indica Bacillus sp. CNJ732 PL04 DQ448749 99 97

Pluchea Enterobacter asburiae strain MSSRF QS66 KJ877656 94 97 4SB3 Stem indica Enterobacter ludwigii strain PRFR10 KF724149 94 97

Pluchea Staphylococcus nepalensis strain L1-1-1 KJ958205 98 99 4SB5 Stem indica Staphylococcus cohnii strain BCX-13 KM378572 98 99

Pluchea Rhizobium sp. CT 6-06 KM252989 99 99 4RB1 Root indica Agrobacterium tumefaciens strain D254 KJ499777 99 99

Pluchea Paenibacillus sp. EE-3 JF742969 99 99 4RB2 Root indica Paenibacillus alvei strain RMS01 JX437031 99 99 Bacillus cereus strain EM10 KJ612536 99 97 5LB1 Vitex trifolia Leaf Bacillus thuringiensis strain EAPL02 JX500174 99 97 Brevibacillus brevis strain ZFJ-2 EU931557 99 99 5SB1 Vitex trifolia Stem Bacillus sp. D58 KF788154 99 99 Bacillus sp. PVR20 KF648912 99 97 5SB2 Vitex trifolia Stem Bacillus sp. TS22 AB909442 99 97 Bacillus subtilis strain wheat bran-1 HQ640429 100 90 5RB2 Vitex trifolia Root Bacillus sp. M25(2010) strain M25 GQ340481 100 90

Ricinus Agrobacterium tumefaciens strain A55 KC196482 99 99 6LB1 Leaf communis Rhizobium sp. CT 6-06 KM252989 99 99

Ricinus Bacillus pumilus strain EHFS1_S14Ha EU071560 99 99 6LB2 Leaf communis Bacillus sp. strain WCH13 HQ143643 100 99

Ricinus Bacillus cereus strain EGY-SC*R1 KJ545607 99 99 6LB3 Leaf communis Bacillus salmalaya strain 139SI KM051837 99 99

Ricinus Bacillus cereus strain KD33 JQ580955 100 99 6SB1 Stem communis Bacillus salmalaya strain 139SI KM051837 100 99

62 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 8 (continued) Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Ricinus Rhizobium sp. KT56 KJ734018 98 97 6SB2 Stem communis Agrobacterium sp. C13 EF189105 98 97

Ricinus Stenotrophomonas sp. MHS019 DQ993326 98 99 6SB3 Stem communis Stenotrophomonas sp. bA22(2011) JF772548 98 99

Ricinus Xanthomonas campestris pv. campestris strain TKE5 JQ818433 100 96 6SB4 Stem communis Xanthomonas melonis strain NCPPB 3434 NR_113169 97 98

Ricinus Enterobacter cloacae subsp. dissolvens 189 (P21Ms) KF254602 99 98 6SB5 Stem communis Enterobacter cloacae strain Rs-35 EF551364 99 98

Ricinus Enterobacter cloacae strain ShB-6 KF975427 100 99 6RB1 Root communis Enterobacter cloacae strain RJ30 KC990813 100 99

Ricinus Bacillus cereus strain VIT-AVJ KJ437489 99 99 6RB2 Root communis Bacillus salmalaya strain 139SI KM051837 99 99

Hibiscus Bacillus sp. PGOa5 EU162013 99 98 7LB1 Leaf tiliaceus Bacillus cereus site2S DQ420176 99 98

Hibiscus Pseudomonas stutzeri strain Z11 KJ950366 99 99 7LB2 Leaf tiliaceus Pseudomonas sp. WXBSA KJ184974 99 99

Hibiscus Enterobacter cloacae strain LSRC11 JF772071 98 98 7SB1 Stem tiliaceus Enterobacter ludwigii strain R6-346-1 JQ659806 98 98

Hibiscus Enterobacter cloacae strain LSRC11 JF772071 99 98 7RB1 Root tiliaceus Enterobacter ludwigii strain R6-346-1 JQ659806 99 98

Caesalpinia Enterobacter cloacae subsp. dissolvens 189 (P21Ms) KF254602 100 99 8LB1 Leaf sappan Enterobacter cloacae strain Rs-35 EF551364 100 99

Caesalpinia Pantoea dispersa strain R7-378 JQ659875 99 99 8SB1 Stem sappan Pantoea agglomerans strain XJ2 GQ374472 99 99

Caesalpinia Enterobacter ludwigii strain VVS01-S1 KF769534 99 98 8SB2 Stem sappan Enterobacter sp. RL-1 KJ961633 99 97

Caesalpinia Bacillus subtilis strain XCCX-1 KC492497 99 94 8RB1 Root sappan Bacillus tequilensis strain PUFSTFMId19 KC834391 99 94

Caesalpinia Enterobacter ludwigii strain VVS01-S1 KF769534 99 97 8RB2 Root sappan Enterobacter sp. RL-1 KJ961633 99 97

Rhoeo Streptomyces phaeopurpureus strain NRRL B-2260 NR_043505 92 95 9FB1 Flower spathacea Streptomyces griseorubiginosus strain NBRC 13047 NR_112350 92 95

Rhoeo Bacillus sp. LT76 KF202893 91 95 9FB2 Flower spathacea Bacillus sp. 323(2010) HM011272 90 95

Rhoeo Klebsiella sp. ICB529 GU944653 100 98 9FB3 Flower spathacea Klebsiella sp. SFR-114 KC455433 100 98

Rhoeo Bacillus sp. 01105 EU520307 100 96 9FB4 Flower spathacea Bacillus pumilus strain Bp02 KJ438145 98 96

Rhoeo Microbacterium sp. FSBRN2 KJ185039 99 98 9FB5 Flower spathacea Microbacterium testaceum strain CE648 AF474330 99 98

63 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 8 (continued) Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Rhoeo Bacillus cereus strain C1H GQ214131 100 99 9LB1 Leaf spathacea Bacillus cereus strain VIT-RNAJ KJ716455 100 99

Rhoeo Herbaspirillum sp. NR 1-06 KM253103 97 98 9RB1 Root spathacea Herbaspirillum sp. RITF1206 JX277100 97 98

Rhoeo Bacillus cereus strain OKF01 KC969074 100 97 9RB2 Root spathacea Bacillus sp. UR2 JN230359 100 97

Rhoeo Rhizobium sp. JL28 JF740052 99 96 9RB3 Root spathacea Agrobacterium tumefaciens strain NJ-AT-6 KF673148 99 96

Rhoeo Bacillus sp. B5(2011b) JN874802 99 98 9RB4 Root spathacea Bacillus altitudinis strain KUDC1740 KC414719 100 98

Lantana Bacillus subtilis strain XCCX-1 KC492497 98 96 10UB1 Fruit camara Bacillus subtilis strain ATY9 HQ219928 98 96

Lantana Bacillus subtilis strain GPSSC KF322037 99 98 10UB2 Fruit camara Bacillus subtilis strain SCDB1470 KM922588 99 98

Lantana Pantoea sp. ICB509 GU944650 99 97 10FB2 Flower camara Pantoea dispersa strain R4-323-1 JQ659667 99 97

Lantana Escherichia sp. CPD32 DQ013851 99 98 10LB1 Leaf camara Escherichia sp. CZBRD4 KJ184949 99 98

Lantana Paenibacillus sp. C-5 KF479641 99 95 10SB1 Stem camara Paenibacillus sp. B49 KF479595 99 95

Lantana Xanthomonas melonis strain NCPPB 3434 NR_113169 96 99 10SB2 Stem camara X. axonopodis pv. desmodiirotundifolii KNU 28189 GU969139 96 99

Lantana Bacillus subtilis subsp. subtilis strain OS-105 NR_115001 96 97 10RB1 Root camara Bacillus sp. p-4 HQ259413 96 97

Lantana Bacillus thuringiensis isolate BD17-R18 HF584801 99 97 10RB2 Root camara Bacillus cereus strain LKT 1/1 AJ577278 99 97

Brucea Pseudomonas sp. L37 DQ300311 99 99 11UB2 Fruit javanica Pseudomonas sp. WPCB087 FJ006889 99 99

Brucea Pseudomonas psychrotolerans strain S6-247 JQ660202 99 98 11FB1 Flower javanica Pseudomonas sp. THG S6-1 KM073943 99 98

Brucea Bacillus pumilus strain LJ15 KF515665 100 97 11FB3 Flower javanica Bacillus altitudinis strain VIT-JPAN KJ716453 100 97

Brucea Sphingomonas sanguinis strain L4-317 JQ659363 95 96 11FB4 Flower javanica Sphingomonas sp. T19 HQ647266 95 96

Brucea Bacillus subtilis subsp. subtilis strain OS-105 NR_115001 95 98 11LB1 Leaf javanica Bacillus subtilis strain AMB_1 JX971518 95 98

Brucea Bacillus sp. DR 1-02 KM252992 99 98 11LB3 Leaf javanica Bacillus pumilus strain 6a FJ478434 99 98

Brucea Bacillus subtilis strain NRCD754 KJ746467 92 98 11SB1 Stem javanica Bacillus subtilis strain Tc1 GU391355 92 98

64 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 8 (continued) Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Brucea Agrobacterium tumefaciens strain A55 KC196482 96 98 11SB2 Stem javanica Rhizobium sp. Hc02 JN944187 96 98

Brucea Cupriavidus sp. SWF67209 JQ900246 98 95 11RB1 Root javanica Cupriavidus taiwanensis strain PAS15 AY752959 98 95

Brucea Bacillus sp. hb73 KF863866 99 95 11RB2 Root javanica Bacillus cereus strain LJ4 KF515654 99 95

Brucea Bacillus subtilis strain S2O JQ410786 100 96 11RB3 Root javanica Bacillus subtilis strain 1769 EU982543 100 96

Morinda Pantoea sp. 19(2014) KF922664 99 98 12UB1 Fruit citrifolia Pantoea stewartii strain R7-136 JQ659868 99 98

Morinda Bacillus subtilis strain OPS 6 JQ308573 99 98 12UB2 Fruit citrifolia Bacillus subtilis strain FBRo3 HQ443231 99 98

Morinda Bacillus cereus strain VIT-AVJ KJ437489 99 98 12UB3 Fruit citrifolia Bacillus sp. PVS08 KF648915 99 98

Morinda Pantoea sp. 19(2014) KF922664 98 97 12FB1 Flower citrifolia Pantoea stewartii subsp. indologenes strain CIP 104006 NR_104928 98 97

Morinda Pseudomonas sp. E4 KF791346 94 98 12SB1 Stem citrifolia Pseudomonas sp. F15 KF573430 94 98

Morinda Erwinia sp. Atl-10 EF028125 99 98 12RB1 Root citrifolia Pantoea cypripedii strain PSB-3 JX556216 99 97

Morinda Pseudomonas sp. t1(2014) KF898095 99 93 12RB2 Root citrifolia Pseudomonas putida strain A3 HQ697262 99 93

Morinda Bacillus cereus strain RGRI KF478235 99 98 12RB3 Root citrifolia Bacillus cereus strain W6 KC434991 99 98 Note: aClosest known relative in Genbank database based on 18S rRNA gene sequence; bAssociated GenBank database accession number; cPercentage of query covered by the alignment to the database sequence; dHighest percent identity of all query-subject alignments.

65 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Most of these bacterial isolates had between 97-100% sequence similarities to nucleotide sequences in the GenBank database. There were, however, 16 isolates which had less than 97% sequence similarities to previously characterised bacteria, indicating they might be novel organisms. Analysing the BLASTN results for these bacteria, it could be suggested that these organisms were new members of previously known genera. Nevertheless, there were two bacteria (isolates 1SB5 and 12RB1) which could not be assigned to a particular genus because the sequence alignments matched organisms belonging to different taxonomic classifications. It is suggested that isolate

12RB1 was a new member of Enterobacteriaceae as the top alignment results refer to genera of this family. Most of the BLASTN alignment results for isolate 1SB5 were homologous to uncultured bacteria, and the top results which were culturable bacteria belong to either the genus Macrococcus (Firmicutes) or Micrococcus (Actinobacteria).

Phylogenetic relationship analysis led to better understanding in taxonomic classification of this isolate (see section 2.3.3).

66 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 9 BLASTn analysis of 18S rRNA gene sequences from isolated fungal endophytes Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Andrographis Phyllosticta sp. L79 JN543168 99 99 1LF1 Leaf paniculata Guignardia mangiferae isolate ymy-01 EU781484 99 99

Andrographis Phyllosticta sp. L79 JN543168 99 99 1SF1 Stem paniculata Guignardia mangiferae isolate ymy-01 EU781484 99 99

Centella Colletotrichum gloeosporioides DQ916151 99 99 2LF1 Leaf asiatica Colletotrichum musae strain BBA 62471 AJ301904 99 99

Centella Colletotrichum sp. AHU9748 AB076801 100 99 2LF2 Leaf asiatica Colletotrichum nicotianae strain GZ-TJ HG798903 100 99

Centella Paraphaeosphaeria sp. E5-3C AB665311 98 99 2SF1 Stem asiatica Paraconiothyrium sp. WA0000017577 HM623325 98 99

Centella Paraphaeosphaeria sp. E5-3C AB665311 99 99 2SF2 Stem asiatica Paraconiothyrium sp. WA0000017577 HM623325 99 99

Centella Tetracladium maxilliforme strain A2F-4c-5 JX470348 99 99 2SF3 Stem asiatica Tetracladium furcatum strain CCM F-06983 EU883428 99 99

Centella Chaetomium globosum IFO 6310 AB048285 98 97 2RF1 Root asiatica Chaetomium sp. 15003 EU710830 98 97

Nasturtium Penicillium sp. CPCC 1400022 FJ375305 100 100 3LF1 Leaf indicum Penicillium sp. CD-1 KF954542 100 100

Nasturtium Paraphaeosphaeria sp. E5-3C AB665311 100 99 3LF2 Leaf indicum Paraconiothyrium sp. WA0000017577 HM623325 100 99

Nasturtium Acremonium antarcticum strain CBS 987.87 JX158487 99 98 3LF4 Leaf indicum Volutella colletotrichoides strain BBA 71246 AJ301962 99 98

Nasturtium Ophioceras leptosporum ATCC 24161 AF050474 100 99 3SF2 Stem indicum Magnaporthe oryzae clone FH12D21_FH2A9 JQ747492 100 95

Nasturtium Xylochrysis lucida strain CBS 135996 KF539912 99 98 3RF1 Root indicum Pesotum sp. UM87-8A HQ595738 99 97

Pluchea Bipolaris sp. JF2 FJ666899 100 99 4FF1 Flower indica Bipolaris sorokiniana strain NBRC 100205 JN941630 100 99

Pluchea Phomopsis mali strain IFO 31031 AB665315 100 99 4FF2 Flower indica Phomopsis sp. U4A2-A AB665312 100 99

Pluchea Curvularia lunata strain NBRC 100164 JN941609 100 99 4FF4 Flower indica Curvularia lunata strain (Walk.) Boed. 99-38 DQ337381 100 99

Pluchea Alternaria sp. 5 SD-2012 JX139936 100 99 4FF5 Flower indica Alternaria sp. CPCC 1400024 FJ375308 100 99

Pluchea Alternaria sp. 5 SD-2012 JX139936 100 99 4LF1 Leaf indica Alternaria sp. CPCC 1400024 FJ375308 100 99

Pluchea Colletotrichum gloeosporioides DQ916151 100 100 4LF2 Leaf indica Colletotrichum musae strain BBA 62471 AJ301904 100 99

Pluchea Ascomycete sp. Lrub20 DQ381536 99 99 4LF3 Leaf indica Dothideomycetes sp. CRI7 JQ867364 99 99

67 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 9 (continued) Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Pluchea Letendraea helminthicola AY016345 99 98 4SF1 Stem indica Dothideomycetes sp. BOER-OM-3M JERPCR575 HQ026493 99 98

Pluchea Phomopsis mali strain IFO 31031 AB665315 99 99 4SF2 Stem indica Phomopsis sp. U4A2-A AB665312 99 99

Pluchea Aspergillus sp. PF03 FJ941872 100 99 4RF1 Root indica Aspergillus niger strain W1102 KF758784 100 99

Pluchea Chaetomium elatum strain T53 FN666095 100 99 4RF3 Root indica Chaetomium sp. CPCC 480539 EU826480 100 99 Colletotrichum gloeosporioides DQ916151 99 97 5LF1 Vitex trifolia Leaf Colletotrichum musae strain BBA 62471 AJ301904 99 97 Colletotrichum musae strain BBA 62471 AJ301904 100 100 5LF2 Vitex trifolia Leaf Colletotrichum gloeosporioides DQ916151 100 100 Phomopsis mali strain IFO 31031 AB665315 100 100 5SF1 Vitex trifolia Stem Phomopsis sp. U4A2-A AB665312 100 100 Diaporthe phaseolorum isolate xk001 FJ392654 93 97 5SF2 Vitex trifolia Stem Diaporthe amygdali isolate MUCC0101 AB454228 93 97 Colletotrichum musae strain BBA 62471 AJ301904 100 99 5SF3 Vitex trifolia Stem Colletotrichum gloeosporioides DQ916151 100 99 Paecilomyces javanicus strain NBRC 8297 AB099944 100 99 5RF1 Vitex trifolia Root Paecilomyces fumosoroseus strain IFO 7072 AB086629 100 99

Ricinus Colletotrichum musae strain BBA 62471 AJ301904 99 99 6SF1 Stem communis Colletotrichum gloeosporioides DQ916151 99 99

Ricinus Phoma sp. strain F23 JX139939 100 99 6SF2 Stem communis Phoma sp. CPCC 480728 FJ515311 100 99

Ricinus Colletotrichum truncatum strain CBS 710.70 AJ301945 100 99 6SF3 Stem communis Colletotrichum circinans strain BBA 67846 AJ301955 100 99

Ricinus Phomopsis mali strain IFO 31031 AB665315 100 99 6SF4 Stem communis Phomopsis sp. U4A2-A AB665312 100 99

Hibiscus Colletotrichum gloeosporioides DQ916151 100 99 7SF1 Stem tiliaceus Colletotrichum musae strain BBA 62471 AJ301904 100 99

Hibiscus Phoma sp. strain F23 JX139939 100 99 7SF2 Stem tiliaceus Phoma sp. CPCC 480728 FJ515311 100 99

Hibiscus Colletotrichum gloeosporioides DQ916151 100 99 7SF3 Stem tiliaceus Colletotrichum musae strain BBA 62471 AJ301904 100 99

Hibiscus Diaporthe phaseolorum isolate xk001 FJ392654 99 99 7SF4 Stem tiliaceus Diaporthe amygdali isolate MUCC0101 AB454228 99 99

Hibiscus Aspergillus versicolor strain TS08 FJ941881 100 99 7SF6 Stem tiliaceus Aspergillus caesiellus strain H1 KJ476140 100 99

Caesalpinia Colletotrichum gloeosporioides DQ916151 100 99 8SF1 Stem sappan Colletotrichum musae strain BBA 62471 AJ301904 100 99

68 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 9 (continued) Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Caesalpinia Phomopsis mali strain IFO 31031 AB665315 100 99 8SF2 Stem sappan Phomopsis sp. U4A2-A AB665312 100 99

Caesalpinia Paraphaeosphaeria sp. E5-3C AB665311 100 99 8SF3 Stem sappan Paraconiothyrium sp. WA0000017577 HM623325 100 99

Caesalpinia Fusarium oxysporum strain 2T12JO1A KC493355 100 99 8RF1 Root sappan Fusarium sp. LNUF014 HM067111 100 99

Rhoeo Sporoschismopsis angustata strain CBS 136360 KF730741 99 99 9FF1 Flower spathacea Kylindria peruamazonensis strain CBS 838.91 GU180609 99 99

Rhoeo Fusarium solani strain EGY1 JQ837837 100 99 9FF2 Flower spathacea Fusarium sp. MAS2 FJ613598 100 99

Rhoeo Phyllosticta sp. L79 JN543168 100 99 9LF1 Leaf spathacea Guignardia mangiferae isolate ymy-01 EU781484 100 99

Rhoeo Phomopsis mali strain IFO 31031 AB665315 100 99 9LF2 Leaf spathacea Phomopsis sp. U4A2-A AB665312 100 99

Rhoeo Colletotrichum gloeosporioides DQ916151 100 99 9LF3 Leaf spathacea Colletotrichum musae strain BBA 62471 AJ301904 100 99

Rhoeo Colletotrichum musae strain BBA 62471 AJ301904 100 99 9LF4 Leaf spathacea Colletotrichum gloeosporioides DQ916151 100 99

Rhoeo Phoma macrostoma var. incolorata MUCC0106 AB454231 100 99 9RF1 Root spathacea Phoma herbarum isolate 8 BI 11-2-1 GU004245 100 99

Rhoeo Fusarium solani strain 48X3-P0-P7-2 KM222302 100 99 9RF2 Root spathacea Fusarium sp. s1817 HQ871896 100 99

Rhoeo Microdochium nivale strain UPSC 3273 AF548077 100 99 9RF3 Root spathacea Microdochium sp. EA10-87 JF418152 100 99

Rhoeo Sporoschismopsis angustata strain CBS 136360 KF730741 100 99 9RF4 Root spathacea Kylindria peruamazonensis strain CBS 838.91 GU180609 100 99

Lantana Aspergillus versicolor strain PSFNRO-2 HQ393875 100 99 10FF1 Flower camara Aspergillus sp. LVB1 DQ810193 100 99

Lantana Aspergillus terreus strain PSFCRG2-1 HQ393867 100 99 10LF1 Leaf camara Aspergillus sp. Ar-4jing-1 EF614252 100 99

Lantana Colletotrichum gloeosporioides DQ916151 100 99 10SF1 Stem camara Colletotrichum musae strain BBA 62471 AJ301904 100 99

Lantana Phoma sp. strain F23 JX139939 100 99 10SF2 Stem camara Phoma sp. CPCC 480728 FJ515311 100 99

Lantana Arthopyrenia salicis CBS 368.94 AY538333 99 99 10SF3 Stem camara Arthopyreniaceae sp. GMG_P1 FJ439584 99 99

Lantana Colletotrichum gloeosporioides DQ916151 100 99 10SF4 Stem camara Colletotrichum musae strain BBA 62471 AJ301904 100 99

Lantana Sporoschismopsis angustata strain CBS 136360 KF730741 100 99 10RF1 Root camara Kylindria peruamazonensis strain CBS 838.91 GU180609 100 99

69 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 9 (continued) Section Isolate Accession Coveragec Identityd Plant of Closest matcha Number numberb (%) (%) Plant

Brucea Endothia sp. IFB-E023 EF211126 99 99 11UF1 Fruit javanica Ophiodiaporthe cyatheae isolate YMJ 1364 JX570890 99 99

Brucea Sporoschismopsis angustata strain CBS 136360 KF730741 100 99 11UF2 Fruit javanica Kylindria peruamazonensis strain CBS 838.91 GU180609 100 99

Brucea Endothia sp. IFB-E023 EF211126 99 99 11UF3 Fruit javanica Ophiodiaporthe cyatheae isolate YMJ 1364 JX570890 99 99

Brucea Endothia sp. IFB-E023 EF211126 99 99 11UF4 Fruit javanica Ophiodiaporthe cyatheae isolate YMJ 1364 JX570890 99 99

Brucea Colletotrichum musae strain BBA 62471 AJ301904 100 99 11UF5 Fruit javanica Colletotrichum gloeosporioides DQ916151 100 99

Brucea Guignardia ardisiae isolate MUCC0045 AB454193 100 99 11FF1 Flower javanica Phyllosticta aspidistricola isolate MUCC0010 AB454176 100 99

Brucea Phomopsis mali strain IFO 31031 AB665315 100 98 11FF2 Flower javanica Phomopsis sp. U4A2-A AB665312 100 98

Brucea Phomopsis mali strain IFO 31031 AB665315 100 99 11FF3 Flower javanica Phomopsis sp. U4A2-A AB665312 100 99

Brucea Phomopsis mali strain IFO 31031 AB665315 99 99 11LF1 Leaf javanica Phomopsis sp. U4A2-A AB665312 99 99

Brucea Phomopsis mali strain IFO 31031 AB665315 99 99 11SF1 Stem javanica Phomopsis sp. U4A2-A AB665312 99 99

Brucea Colletotrichum gloeosporioides DQ916151 100 99 11SF2 Stem javanica Colletotrichum musae strain BBA 62471 AJ301904 100 99

Brucea Colletotrichum sp. CPCC 480565 EU827606 95 95 11SF3 Stem javanica Colletotrichum dematium strain BBA 62147 AJ301954 95 95

Brucea Fusarium solani strain EGY1 JQ837837 100 99 11RF1 Root javanica Fusarium sp. MAS2 FJ613598 100 99

Morinda Phomopsis mali strain IFO 31031 AB665315 99 98 12UF1 Fruit citrifolia Phomopsis sp. U4A2-A AB665312 99 98

Morinda Fusarium equiseti strain Salicorn 8 KJ413063 100 99 12UF2 Fruit citrifolia Fusarium sp. 2H5-P3-P1 KM222202 100 99

Morinda Colletotrichum gloeosporioides DQ916151 100 99 12UF3 Fruit citrifolia Colletotrichum musae strain BBA 62471 AJ301904 100 99 Note: aClosest known relative in Genbank database based on 18S rRNA gene sequence; bAssociated GenBank database accession number; cPercentage of query covered by the alignment to the database sequence; dHighest percent identity of all query-subject alignments.

70 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

When interpreting 18S rRNA gene homology for fungal isolates, it is important to acknowledge the presence of anamorphs (asexual reproductive stage) and teleomorphs

(sexual reproductive stage) of the same species, such as Glomerella and Colletotrichum

(241), Guignardia and Phyllosticta (242), Phomopsis and Diaporthe (243), and

Paraphaeosphaeria and Paraconiothyrium (244). The nu-SSU primers used in this study did not distinguish between the different morphotypes, so the BLASTN search might return results from any reproductive stage of the fungi. On the other hand,

BLASTN search of two morphologically distinct fungal cultures on the PDA plates might show same results as both cultures belong to the same species but isolated at different life cycle stages. This phenomenon is common in fungi and is also observed in our data. An endophyte Sphaeropsis sapinea from Pinus sp. was discovered to display more than five different morphologies in culture (245). This implies that morphotypes may overestimate biological diversity.

From the fungal isolates, only isolate 11SF3 had less than 97% similarity to the

GenBank entries, and the alignment results suggested that this candidate novel organism belongs to the genus Colletotrichum. There are, however, 6 other fungi which could not be assigned to a particular genus, namely isolates 3RF1, 4LF3, 9FF1, 9RF4, 10RF1, and

11UF2. Multiple sequence alignment indicated that isolates 9FF1, 9RF4, 10RF1, and

11UF2 were the same species of the genus Reticulascaceae, with only two base pair differentiating the sequences. The BLASTN alignment results could not predict the taxonomic classifications for isolate 3RF1 and 4LF3. Phylogenetic relationship analysis revealed that these isolates may belong to novel taxonomic groups (see section 2.3.3).

71 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

2.3.3 Phylogenetic relationship of the bacterial and fungal endophytes

Two phylogenetic trees were constructed, the first encompassing 16S rRNA gene sequences from the bacterial isolates (Figure 6) and the second 18S rRNA gene sequences from the fungal isolates (Figure 7), together with their respective reference strains from the GenBank database. Both the bacterial and fungal endophytes utilised the GTR (Generalised Time Reversible) phylogenetic substitution model (246) for the construction of the maximum likelihood tree. These trees would better illustrate the phylogenetic relationship between the endophytes, particularly among less common genera, and between host-specific isolates. In addition, the trees could also provide clearer information on the endophyte strains which could not be assigned to a particular genus based on the DNA sequence alignment with the GenBank database. Observation on the closest known relatives of these strains would assist in determining the taxonomic lineage of these potentially novel endophytes.

72 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Figure 6 Phylogenetic relationship of bacterial endophytes and reference bacteria based on 16S rRNA gene sequences. The maximum likelihood tree was generated from a multiple sequence alignment, using a GTR substitution matrix and the PhyML algorithm. Bootstrap values >0.500 are shown. Bootstrap values >0.500 are shown. Endophytes are shown in bold and colour-coded according to the host plant, and the accession numbers belonging to reference strains are included. The scale indicates number of inferred nucleotide changes.

Firmicutes, Actinobacteria, and Proteobacteria (alpha-, beta-, and gamma-) were isolated in this study. These bacterial isolates came from eight different orders:

73 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Actinomycetales, Bacillales, Burkholderiales, Enterobacteriales, Pseudomonadales,

Rhizobiales, Sphingomonadales, and Xanthomonadales, with Bacillales being the predominant class across all host plants. They represent at least 20 different genera:

Bacillus (44 isolates), Enterobacter (9 isolates), Pseudomonas (6 isolates),

Microbacterium (5 isolates), Rhizobium (5 isolates), Pantoea (4 isolates), Paenibacillus

(3 isolates), Xanthomonas (3 isolates), Staphylococcus (2 isolates), and one isolates each of Brevibacillus, Burkholderia, Cupriavidus, Escherichia, Herbaspirilium, Klebsiella,

Micrococcus, Methylobacterium, Sphingomonas, Stenotrophomonas, and Streptomyces.

Furthermore, based on the the phylogenetic relationship tree, it is suggested that 1SB5 belongs to the genus Micrococcus. Consequently, it is implied that Macrococcus sp.

CCGE2291 (GenBank accession number: EU867328), which a member of Firmicutes, may require species reassignment although further genetic and biochemical analysis are needed for clarification.

Bacillus endophytes are present in all plant hosts. On the other hand, there are a few endophytes which were host specific: Brevibacillus could only be detected in V. trifolia;

Burkholderia in C. asiatica; Cupriavidus and Sphingomonas in B. javanica; Escherichia in L. camara; Herbaspirillum, Klebsiella, and Streptomyces in R. spathacea;

Methylobacterium and Micrococcus in A. paniculata; and Stenotrophomonas in R. communis. The genera Enterobacter, Pseudomonas, Microbacterium, Rhizobium,

Pantoea, Paenibacillus, Xanthomonas, and Staphylococcus occur in more than one host plants. The plants P. indica and R. spathacea host the most diverse bacterial endophyte with isolates belonging to 6 genera, while bacteria from only 2 genera could be isolated from Vitex trifolia.

74 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

All bacterial genera detected in this study have been previously reported as endophytic

(247-253). Interestingly, Rhizobium, a typical root bacterium, was isolated from leaves and stems of R. communis, and stems of B. javanica. This is not an isolated case as a previous study had identified that root endophytes could migrate and colonised above- ground tissues (254). Rhizobium species possess unique adaptability traits which allow them to associate beneficially with a wide range of host plants and their tissues.

Except for L. camara, this is the first bacterial diversity investigation on these medicinal plants. Individual bacterial endophytes from these plants have been thoroughly examined and bioactive compounds have been isolated, yet the bacterial community study remains scarce. The results of this study further support the notion that some bacterial genera, such as Bacillus, Enterobacter, Pseudomonas, Microbacterium, and

Rhizobium are robust and able to colonise a range of plant hosts. On the other hand, less common endophytic bacterial genera isolated in this study, such as Cupriavidus and

Microbacterium, may provide greater potential for isolation of novel compounds with interesting chemistry. Cupriavidus species have been known to be metal-resistant root bacteria (255, 256), and prolific producers of biopolymers (257). Interestingly, this bacterium has been isolated from Mimosa pudica (258), a plant which has been investigated for its wound-healing properties (259). Bacteria of the genus

Microbacterium have also been identified as heavy metal-resistant (260, 261), and some species produce glycoglyerolipid biosurfactants (262). Little research has been carried out to explore their bioactivity potential, and therefore future studies should explore these lesser characterised bacteria.

75 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Figure 7 Phylogenetic relationship of fungal endophytes and reference fungi based on 18S rRNA gene sequences. The maximum likelihood tree was generated from a multiple sequence alignment, using a GTR substitution matrix and the PhyML algorithm. Bootstrap values >0.500 are shown. Endophytes are shown in bold and colour-coded according to the host plant, and the accession numbers belonging to reference strains are included. The scale indicates number of inferred nucleotide changes.

76 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

All fungal isolates in this study were from the Ascomycota, and came from at least ten orders: Botryosphaeriales, Diaporthales, Eurotiales, Glomerellales, Hypocreales,

Magnaporthales, Ophiostomatales, Pleosporales, Sordariales, and Xylariales, with most isolates belonging to Glomerellales. They represent at least 20 different genera:

Colletotrichum (19 isolates), Phomopsis/Diaporthe (13 isolates), Fusarium (5 isolates),

Aspergillus (4 isolates), Guignardia/Phyllosticta (4 isolates), Paraphaeosphaeria (4 isolates), Phoma (4 isolates), Endothia (3 isolates), Alternaria (2 isolates), Chaetomium

(2 isolates), and one isolate each of Acremonium, Arthopyrenia, Bipolaris, Curvularia,

Letendraea, Microdochium, Ophioceras, Paecilomyces, Penicillium, and Tetracladium.

Fungal taxonomists have not assigned Tetracladium sp. to a specific order or family; currently it is only classified as mitosporic (lacking sexual reproductive stage)

Ascomycota (263). Moreover, from the six previously uncategorised isolates, analysis of the phylogenetic relationship suggested that isolates 9FF1, 9RF4, 10RF1, and 11UF2 are members of Glomerellales order. On the other hand, the phylogenetic relationship of isolates 3RF1 and 4LF3 with their nearest homology matches suggested that these isolates may belong to new taxonomic families or orders. Isolate 4LF3, in fact, could belong to a novel class as the lowest common taxonomic classification of its closest homology matches is Ascomycota.

All fungal genera detected in this study have been previously isolated as endophytes

(37, 242, 264-273). Most of these, such as Aspergillus, Colletotrichum, Fusarium, and

Phomopsis, are common endophytes which have inhabited a variety of plant hosts. In this study, fungi from the genus Colletotrichum were discovered in 10 plants, while those from the genus Phomopsis appeared in 8 plants. In contrast, there were a number of fungal genera which was host-specific. Fungal endophytes belonging to the genus

77 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Endothia were only found in B. javanica. The genera Alternaria, Bipolaris, Curvularia, and Letendraea only colonised P. indica. Only the plant N. indicum hosted

Acremonium, Ophioceras, and Penicillium. Similarly, the genus Arthopyrenia was only detected in L. camara; Microdochium in R. spathacea; Paecilomyces in V. trifolia; and

Tetracladium in C. asiatica. The high occurrence of host specificity in these fungal endophytes might be a consequence of sporulation at the time of isolation. Endophytic fungi are commonly present as microscopic hyphae, and their presence would only be detected when they sporulate, an event that takes place seasonally for a very short period of time (274). Of all plants, P. indica hosted the most diverse fungal endophytes from 9 different genera, followed by R. spathacea with 7 genera. On the contrary, in this study A. paniculata was found to only contain fungal endophytes from one genus.

The fungal endophytes diversity discovered in this study are largely similar to those isolated from the same plants on previous investigations, indicating that the endophyte diversity may be retained within the same plant species.

The endophytic host specificity is probably due to genetic incompatibility, limiting the diversity of successful genotype-genotype combinations of the endophytes and the host plants (275). The endophyte-plant interactions are highly dynamic, and well-integrated symbiosis requires complementary architectural and physiological traits of both the host plant and the microorganisms to co-evolve and persist (276). However, these integrations do not commonly occur in nature as the symbiosis could easily be disrupted by a multitude of factors, including the energetic costs of hosting the endophytes, differences between host and endophyte reproduction mechanisms, and suppression of host immune system to accommodate the endophyte which could potentially increase the plant susceptibility to other microbial pathogens (277). The sustained adaptation

78 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

between the host plant and its endophytes eventually becomes permanently embedded in the genetic constitution of both organisms (278). This will ensure that the endophytes continue to subsist within the plant hosts and the host-endophyte mutualism persists.

Previous investigations indicate that tropical endophytes rarely demonstrate strict host specificity (279, 280), consistent with the results of this study. It was suggested that strong host affinity would be rare in communities containing a high diversity of potential host plants (281). Interestingly, in a recent investigation on communities of fungal endophytes in tropical forest grasses, most endophytes were found across plant hosts located in different types of soil and water availability, signifying no host or habitat specificity (282). Instead, the endophyte diversity was observed based on spatial structure consistent with dispersal limitation. This emphasises the highly dynamic nature of the symbiotic relationship between the plant host and its endophytes. The dominant factors determining the endophytic diversity may differ for individual plant hosts. Nevertheless, studies show that some endophytes are robust and it is suggested that these ubiquitous microbes are the producers of the active compounds.

This is the first report on the isolation of endophytes in N. indicum, V. trifolia, and R. spathacea. The endophytes from these plants displayed more diversity than those from the other plants, with N. indicum hosting 5 fungi from 5 genera and 7 bacteria from 4 genera, V. trifolia hosting 6 fungi from 3 genera and 4 bacteria from 2 genera, and R. spathacea hosting 10 fungi from 7 genera and 10 bacteria from 6 genera. In line with the general trend in this study, Bacillus was the dominant bacterial genus in all three plant hosts. Similarly, the fungal genus Colletotrichum was most common except in N. indicum where none was isolated. Interestingly several fungi and bacteria isolated from

79 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

these plants are host-specific. Fungi from the genera Acremonium, Ophioceras, and

Penicillium were isolated solely from N. indicum. Bacteria from the genus Brevibacillus were only found in V. trifolia, while Herbaspirillum, Klebsiella, and Streptomyces were isolated exclusively from R. spathacea.

Previous studies on strains from these host-specific genera have suggested their immense potential as producers of bioactive compounds. Streptomycetes, particularly

Streptomyces, are the most abundant sources of antibiotics such as actinorhodin and methylenomycin (283). Similarly, members of the genus Penicillium are well-known producers of beta-lactam antibiotics, including the penicillins and cephalosporins (284).

A number of active compounds have also been characterised from Acremonium species, including antibiotics pyrrocidines A and B, which are hybrid NRPS-PKS derived (285), acremosctrictin (286), and antitumour compounds NBRI17671 (287) and virescenosides

O, P, and Q (288). Furthermore, studies on the bacterial genus Brevibacillus, a close relative of Bacillus, have isolated a number of antibiotics, including NRPS-PKS hybrid products basiliskamides A and B (289) and NRPS-derived tauramamide (290). While studies on Ophioceras natural products are relatively scarce, an investigation on a marine strain of this genus showed that ophiocerol, isoamericanoic acid, and caffeic acid had antifungal properties, with the latter two compounds also exhibited nematicidal activities (291). Likewise, in spite of the limited investigations, a series of NRPS- derived siderophores the serobactins have been isolated from Herbaspirillium (292).

Natural product isolation from Klebsiella is very rare, although genome sequencing of a strain revealed its secondary metabolite biosynthetic gene clusters, including those of monolignol, naringenin, pelargnonidin, and paspaline (293). Thorough investigations on

80 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

the endophytes isolated from these plants might uncover a pool of biologically important novel compounds.

Furthermore, individual endophytes have been isolated and characterised from the other plants used in this study. An investigation on the fungal endophytic diversity from leaves of C. asiatica in Madagascar resulted in Colletotrichum as the dominant genus

(294), using a modified malt extract agar as the growth medium. An endophytic

Phomopsis sp., Penicillium commune, and Eurotium rubrum have been previously isolated from H. tiliaceus from various places in the Hainan province, China, and a number of benzaldehyde and glycerol derivatives, triterpenes, and other alkaloids were characterised from these fungi (295-297). A taxol-producing fungal endophyte

Lasiodiplodia theobromae was isolated from the leaves of M. citrifolia grown in India

(298). Twenty one distinct taxa of endophytic fungi were isolated from stems and leaves of B. javanica from Hong Kong and Australia (299), with seven of them successfully categorised to the genera Colletotrichum, Fusarium, Phomopsis, and Phoma.

The endophytic biodiversity of L. camara is the most comprehensively investigated to date. In the first study, bacterial endophytes from L. camara grown in Malaysia were isolated using nutrient agar as the growth medium (300). Identification of these isolates revealed various isolates from the genera Bacillus, Chryseobacterium, Cronobacter,

Edwardsiella, Enterobacter, Erwinia, Escherichia, Klebsiella, Pantoea, Pseudomonas, and Raoultella. Another study on the isolation of fungal endophytes from the same plant in Malnad region, India used potato dextrose agar and found Colletotrichum to be the dominant species (301). Interestingly, a similar study from L. camara in Bhopal region,

81 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

India using malt extract agar isolated fungi from the genera Alternaria, Aspergillus,

Fusarium, and Penicillium, but no Colletotrichum (302).

Nevertheless, a number of the endophyte studies focus on the bioactivity of the endophytes rather than their biodiversity. Two fungal endophytes from P. indica in

Thailand were isolated and tested for antitubercular properties against M. tuberculosis

H37Ra, with one of them qualitatively showing antiproliferative activity (204). Five endophytic bacteria and eleven endophytic fungi were isolated from the stems of M. citrifolia from Indonesia (303). All except one fungal strain exhibited antiproliferative activity against Bacillus subtilis, Escherichia coli, Salmonella thypimurium,

Staphylococcus aureus, and Candida albicans. Endophytic actinomycetes were isolated from the roots, and leaves of Indonesian A. paniculata and C. sappan using yeast malt extract agar as the growth medium, and qualitatively tested for alpha-glucosidase inhibitor activity in an attempt to discover novel treatment for diabetes (304). Out of seven isolates, only one from the root of C. sappan displayed minor (0.5%) inhibitory activity while the rest were inactive.

Generally, our bacterial and fungal diversities are in line with those from the previous studies. Nonetheless, there are several variations on the isolated genera, which can be attributed to a number of factors, one being the choice of growth media during the isolation process. The variety of isolated bacteria and fungi is dependent upon the nutrient availability in the media. The preferred growth media could select for certain types of bacteria or fungi. In a similar endophytic isolation study from Chinese traditional medicinal plants, brain heart infusion broth was used and Bacillus was also isolated as the main genus (205). On the other hand, a number of media, such as

82 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

arginine-glycerol-salt (AGS) medium (305), Water-Yeast-Extract (WYE) agar medium

(306), or glycerol-asparagine-agar (ISP 5) medium (307) are known to specifically select for Actinomycetes. In a case study on endophytic actinobacteria from medicinal plants of tropical rain forests in Xishuangbanna, China, the use of these selective media resulted in 87% of the isolates being from the genus Streptomyces (308). Using more types of growth media would likely enhance the diversity of culturable endophytes.

More endophytes could also be isolated by mimicking their natural growth environment in the laboratory. The use of ichip technology, where the microbes are incubated in situ in diffusion chambers, through which naturally occurring growth factors are provided

(309), allows previously unculturable microorganisms to be isolated and investigated.

Along with the experimental procedures, endophytic community can vary considerably in nature. In a single host species, the endophytic diversity could increase with distance

(310) or remain largely consistent across different populations (311). Similarly, as supported by this study, the dominant endopytic species in leaves, roots, and stems of a single plant could vary significantly (311-313). These differences are influenced by external factors as well as biological differences among plant organs and tissues. It has been reported that the type of soil on which the plant grows (314) as well as weather and seasonal factors (315, 316) have contributed in the fluctuation of the endophytes. In a study on endophytes from rice plants, neutral-pH soil favoured the growth of seed- borne Pseudomonas and Rhizobium species, while low-pH soil supported Enterobacter- like species, although a seed-borne endophyte Stenotrophomonas maltophilia was present in plants cultivated in both soils (314). Another investigation on endophytes from Heterosmilax japonica revealed that the plant harboured more endophytes in spring than in summer (315), suggesting temperature and humidity as influencing

83 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

factors to endophyte diversity. Similarly, water availability in the plant tissues is also known to affect the endophyte population, as observed in a comparative study of endophytes from water-sensitive and water-resistant sunflower (316). Nevertheless, it is envisaged that the endophytes producing the bioactive compounds for their plant hosts would be ubiquitous in their respective host plants.

Furthermore, as this study also supports, bacterial 16S rRNA or fungal 18S rRNA gene sequence analysis alone is not adequate to accurately assign an unknown organism to a particular taxonomic classification (317). The use of polyphasic taxonomy approach, including DNA-DNA hybridisation, phenotypic comparison, and chemotaxonomic analysis (318), is necessary to yield a conclusive result on the endophytic species and perhaps strains. Nevertheless, as the main purpose of these experiments is to select the best candidate strains for compound isolation, identifying the endophytes to the species level is not crucial. Identification to genus level is sufficient to provide indications on the active compounds that may be produced by these endophytes. For example, the genus Fusarium are prolific producers of naphthaquinones (319), which are polyketide- derived and known antimycobacterial compounds (320). Similarly, a number of naphthopyrones, other polyketide-derived antimycobacterials, have been known to be produced by fungi from the genus Aspergillus (321). This information would be complemented by the genetic screening for the presence of PKS or NRPS genes.

2.3.4 PKS and NRPS screening of the endophytes

One method of strain prioritisation in this study is by screening the endophytes for the presence of PKS and NRPS genes. Previous studies have suggested the existence of

84 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

PKS and NRPS systems within a strain is indicative of its bioactivity potential (205,

322-324). Endophytes with these biosynthetic genes displayed antiproliferative activity against at least one microbial pathogen. However, as the main purpose of this experiment is to select the isolates for further analyses, degenerate PKS and NRPS primers were used and no samples were sequenced and compared with the database.

The presence of these biosynthetic genes was assessed purely by gel electrophoresis and visualisation.

Overall, 77 of the 92 (84%) bacterial isolates and 72 of the 76 (94%) fungal isolates possessed either PKS or NRPS genes (Table 10). This suggests that the majority of the endophytes isolated in this study have high biosynthetic potential, which in turn supports the notion of the use of these plants as traditional medicines. There are several possible reasons for these trends. Firstly, the most common bacterial and fungal genera detected in this study were known to have PKS/NRPS biosynthetic pathways, and, in some cases, produced biologically active PKS/NRPS products (325). Fungal

Colletrotrichum, Aspergillus, Phomopsis, and Fusarium, four most common genera in our study, were identified to have an abundance of PKS/NRPS biosynthetic gene clusters (326, 327). Similarly, members of Bacillus, the most common bacterial genus in this study, produce a variety of nonribosomal peptide antibiotics such as bacitracin and the gramicidins and the bacitracins (328). The genus Pseudomonas, which was detected in four of the plants, is a prolific producers of PKS/NRPS compounds, including antimicrobials pyrrolnitrin and 2,4-diacetylphloroglucinol (329). Interestingly, 84% of the Bacillus isolates and all Pseudomonas isolates detected on the present study had either PKR and/or NRPS genes, indicating their substantial capacity for secondary metabolite production.

85 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 10 Qualitative PKS and NRPS screening results of the isolated endophytes, classified based on the host plant Bacterial Endophytes Fungal Endophytes Host Plant PKS NRPS PKS and PKS NRPS PKS and Total Total Species positive positive NRPS positive positive NRPS isolates isolates only only positive only only positive A. paniculata 7 0 3 0 2 0 0 2 C. asiatica 7 0 1 5 6 6 0 0 N. indicum 7 1 0 5 5 2 0 2 P. indica 11 0 2 8 11 7 0 3 V. trifolia 4 0 1 2 6 2 0 4 R. communis 10 0 3 7 4 0 0 4 H. tiliaceus 4 1 1 2 5 0 0 4 C. sappan 5 0 0 5 4 1 0 2 R. spathacea 10 0 3 0 10 3 0 7 L. camara 8 2 0 5 7 3 0 4 B. javanica 11 1 2 8 13 3 0 10 M. citrifolia 8 1 3 4 3 0 0 3 TOTAL 92 6 19 51 76 27 0 45 Note: The numbers on the table indicate the number of isolates belonging to the category.

Another alternative explanation for the abundance of PKS/NRPS biosynthetic genes in our isolates is that there might be high incidence of horizontal gene transfers (HGT) between the endophytes. Acquisition of foreign genetic material is a natural phenomenon in bacteria and fungi (330, 331), particularly between those sharing the same environmental niche (331), such as endophytes of the same plant host (55). This is a form of adaptation in which beneficial traits for the recipient, such as antibiotic resistance (332, 333) and synthesis of small molecules (334), are acquired. Under certain physiological conditions, some bacterial and fungal species are naturally competent, including Bacillus (335), the most common bacterial genus detected in this study, and Aspergillus (336), also identified in this study. Successful incorporation of foreign DNA material requires a physical clustering of the genes so that all necessary genes can be transferred in a single step, incorporated into the genome, and retained by the recipient. Consequently, HGT will select for gene clusters and for operons, which

86 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

can be expressed in the recipient cells by a host promoter at the site of insertion (337).

This is thought to be one of the reasons for the common occurrence of HGT between bacteria and the incorporation of bacterial genes into eukaryotic genome. The increased probability in horizontal transfer of genes organised in clusters suggests that PKS and

NRPS gene clusters (see Section 1.2), would be transferrable between micro-organisms.

Indeed, PKS and NRPS have been known to be horizontally transferred in bacteria and in fungi (338, 339). For example, yersiniabactin, an iron-scavenging agent and a hybrid

PKS/NRPS product, was initially isolated from a pathogenic bacterium Yersinia pestis.

However the gene cluster responsible for the production of this compound has been discovered in phylogenetically distant species, including the nematode symbiont

Photorhabdus luminescens (340), the plant pathogen Pseudomonas syringae (341), pathogenic strains of Escherichia coli (342), and even the Gram-positive marine bacterium Salinispora tropica (343). In Y. pestis and E. coli, the gene cluster resides on a high-pathogenicity island, a transmissible genetic element (344), and its propagation is facilitated by HGT of this entire component (345). Similarly, a fungal hybrid

PKS/NRPS gene cluster encoding for a signal molecule which allows penetration into the rice plant tissues was initially discovered in a rice pathogen Magnaporthe grisea

(339). Related clusters were detected through database searching in Chaetomium globosum, Stagonospora nodorum, and Aspergillus clavatus (339). Phylogenetic analysis revealed that these clusters were acquired through horizontal transfer from a donor closely related to M. grisea (339).

Moreover, the majority of both bacterial and fungal endophytes (55% and 59%, respectively) had both PKS and NRPS genes in a single isolate (Table 10). This indicates the high possibility of a more diverse secondary metabolite pool, including

87 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

hybrid PKS/NRPS products. Members of the genera detected in this study are known to produce such hybrid compounds, including immunosuppressant pseurotin A from

Aspergillus fumigatus (101), antiviral agent equisetin from Fusarium heterosporum

(346), and antitumour agent bleomycin from Streptomyces verticillus (98).

Screening of the bacterial endophytes revealed 71 of the strains possessed NRPS genes and 58 had PKS genes. All bacterial endophytes in R. communis, H. tiliaceus, C. sappan, B. javanica, and M. citrifolia possessed either PKS or NRPS. In fact, all bacterial strains from C. sappan possessed both biosynthetic clusters. However, the majority of bacterial isolates from A. paniculata and R. spathacea, did not have PKS or

NRPS genes, and no bacterial isolate from these two plants possessed both PKS and

NRPS; observations not found in bacterial endophytes from the other ten plants. This is compensated by the fact that the majority of fungal isolates from the two plants had both NRPS and PKS. Intriguingly, there are 6 bacterial endophytes which only had

PKS: two Pseudomonas strains, one strain each of Bacillus, Pantoea, Staphylococcus, and Sphingomonas, indicating that this phenomenon is not commonly encountered in bacteria. Previous bioinformatics analyses on complete genomes suggested that in bacteria, NRPS is the most commonly encountered biosynthetic machinery (347, 348), although hybrid PKS/NRPS systems are more prevalent than PKS products (348). No statistics are found on the distribution of PKS and NRPS within individual samples.

Fungal endophyte screening showed that 72 of the isolates had PKS genes and 45 possessed NRPS genes. These fungal screening results are in line with previous investigations where polyketide synthases are more prevalent than non-ribosomal peptides (349). All fungal endophytes from A. paniculata (2 Guignardia strains), R.

88 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

communis (2 Colletotrichum strains, 1 Phoma strain, and 1 Phomopsis strain), and M. citrifolia (1 Phomopsis strain, 1 Fusarium strain, and 1 Colletotrichum strain) possessed both PKS and NRPS genes. The absence of these biosynthetic machineries in fungi is also less common (5%) compared to bacteria (17%). This implies that the fungal isolates in this investigation possess higher biosynthetic potential, which could translate to the production of more abundant and diverse secondary metabolites.

It is important to note that the distribution of PKS and NRPS genes in these samples is not indicative of the general bacterial and fungal population. Previous surveys have analysed the distribution of PKS and NRPS in microbial and higher organisms by screening through genomic databases (325, 348). Nevertheless, it was acknowledged that there was sampling bias in favour of plant, animal, and human pathogens as these are the ones of public relevance (325, 348). Furthermore, the qualitative nature in the present study means the recorded numbers (Table 10) do not reflect the total number of

PKS/NRPS biosynthetic pathways present in the samples as it is likely that individual strains have more than one PKS/NRPS gene clusters.

The qualitative analysis of the presence of PKS/NRPS genes using PCR screening with degenerate primers in this study only provides minimum insight on the distribution or structural variation of these biosynthetic machineries. The PKS/NRPS diversity within these samples could be better studied through sequence analysis of the PCR-amplified

PKS and NRPS genes. Nevertheless, the information gathered from the qualitative screening is sufficient to depict the biosynthetic potential of the isolated endophytes.

89 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

2.3.5 Overall bioactivity profile of the fungal endophytes

The results of the preliminary genetic screening brought the focus of the investigation to the fungi, as the presence of PKS/NRPS biosynthetic genes was more prevalent in these isolates. Additionally, fungi are the largest class of isolated plant endophytes (9). A number of fungal endophytes have been identified as prolific producers of antimicrobial agents (272, 350). For example, a lipopeptide antifungal compound cryptocandin was isolated from Cryptosporiopsis quercine, an endophyte of Tripterigeum wilfordii, a medicinal plant native to Eurasia (351). This compound demonstrated outstanding antifungal activity against human fungal pathogens Candida albicans, Trichophyton mentagrophytes, and T. rubrum, with minimal inhibitory concentration (MIC) values of

0.03-0.07 µg mL-1 (351). Wide-spectrum antibiotic compounds munumbicins were produced by an endophytic strain of Streptomyces sp., discovered from the Australian

Aboriginal medicinal plant snakevine (Kennedia nigriscans) which was traditionally used to treat skin wounds and infections (224). The munumbicins displayed wide-range antiproliferative activity against Gram-positive bacteria such as B. subtilis, multidrug- resistant M. tuberculosis, and malarial parasite Plasmodium falciparum. One of them,

-1 munumbicin B, exhibited an IC50 value of 10 µg mL against an MDR-TB strain, which is 15 times lower than that of rifampicin, a standard TB drug (44). Another compound

-1 munumbicin D exhibited an IC50 value of 4.5 ng mL , which is approximately 50% below that of chloroquine, the gold-standard antimalarial drug (224). These examples indicate the immense potential of fungal endophytes for exploitation to find new and interesting compounds.

90 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Bioactivity assays were carried out on all fungal extracts against one Gram-positive bacterium and two Gram-negative bacteria, as well as four strains of Mycobacterium.

While the main aim of this project was to discover antimycobacterial compounds, testing the extracts against several other bacteria would reveal their bioactivity spectrum, and provide an early indication of the active compound’s mode of action. The

MIC cut-off value for pure compounds during preliminary screening in a tuberculosis drug screening program initiated by US National Institutes of Health was set at 6.25 µg mL-1 (352). Compounds exhibiting MIC above this value are generally not considered for further investigations. Based on the fact that each crude extract is comprised of a complex mixture of compounds, the crude extracts were tested at 100 µg mL-1 and

10 µg mL-1 to increase the probability of isolating active compounds with MIC value below the standardised cut-off value.

The Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa and Gram- positive bacterium, Staphylococcus aureus are commonly used to assess the antimicrobial activity of endophyte pure cultures or plant extracts (353, 354) and for general antibiotic susceptibility testing of known compounds (355). The antibacterial assays were performed using a broth dilution method, and the growth inhibition was quantified via spectrophometric analysis (356). This method is preferred over the agar disc diffusion method as a result of its ability to distinguish between bactericidal and bacteriostatic effects (357), and its capability of quantifying the antiproliferative activity.

Furthermore, these extracts were also tested against a number of mycobacterial strains which were commonly used in natural product research to test for antimycobacterial

91 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

compounds (184, 358). Mycobacterium phlei is an environmental, non-pathogenic mycobacterial strain (359). The strain M. avium subsp. avium, another non-tuberculous mycobacterium, was selected for its capability to cause lung infections (TB-like symptoms) in humans (360). Another strain M. smegmatis had been viewed as a good model for mycobacteria, largely due to its rapid growth, non-pathogenic nature, and shared homologues with other mycobacterial strains, despite not having large genetic and physiological similarities to MTB (361, 362). The M. tuberculosis H37Ra was specifically chosen as it is an attenuated, avirulent strain, which also had a drug susceptibility profile reasonably representative of the majority of drug susceptible clinical isolates. In addition, working with these strains required only the use of a class

2 biosafety cabinet in a PC2 laboratory. All antimycobacterial assays were carried out using the agar dilution method (363) and growth inhibition was qualitatively assessed.

Mycobacteria have very unique, lipid-rich, hydrophobic cell walls (364), and have tendency to clump in liquid culture (363). Mixing known concentration of extract in an agar medium with the mycobacteria ensures effective interactions between the chemicals and the cells.

Antiproliferative activity assays were carried out on all 76 fungal endophytes. First,

100-ml liquid cultures were grown for 14 days to allow secondary metabolite production. The biomass and the supernatant was then separated by filtration and individually extracted. Ethyl acetate was chosen as the solvent for culture broth extraction for its capability to capture compounds with wide polarity range and for its immiscibility with water from the culture media. On the other hand, the filtration and air drying were carried out on the biomass to remove media contamination, and the acetic acid was added onto the methanol to assist in cell lysis. Culture broth extraction yielded

92 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

dry weights between 7 and 46 mg, while biomass extraction yielded between 10 mg and

1609 mg (Appendix 1). Generally there were more extracts collected from the biomass than from the supernatant, indicating most of the metabolites are not secreted on to the media. The large discrepancy between the biomass extract yields could be attributed to the variation in the amount of biomass used in the extraction, the effectiveness of the sonication process in extracting the chemicals out of the cells, and the proportion of oily components in the extract.

The bioactivity assays revealed that the fungal endophyte extracts exhibited proliferative and antiproliferative effects (Table 19, Table 20, Table 21, Table 22 in

Appendix 1). Only one isolate Phomopsis sp. 6SF4 from R. communis did not affect the growth of the test strains. Some extracts promoted the growth of the test strains. This overarching observation supported the hypothesis that endophytes are valuable sources of bioactive secondary metabolites, particularly antibiotic candidates. Nonetheless, the focus of this screening was to select for best antibiotic candidates. Hence only extracts which inhibit the growth of the test strains were tabulated (Table 11), discussed, and considered for future investigation. From this point, unless stated otherwise, bioactivity refers to the ability of the fungal extract to inhibit the growth of the bacterial test strain.

93 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 11 Summary of the bacterial antiproliferative activity spectrum of the fungal endophytes from Indonesian traditional medicinal plants Biosynthesis Source Activity Isolate Proposed Fungal Genes ID Plant Plant Genus PKSa NRPSb ECc PAd SAe MPf MSg MAh MTbi Species Part 1LF1 A. paniculata Leaf Guignardia +j + m   l    1SF1 A. paniculata Stem Guignardia + +        2LF1 C. asiatica Leaf Colletotrichum + -k        2LF2 C. asiatica Leaf Colletotrichum + -        2SF1 C. asiatica Stem Paraphaeosphaeria + -        2SF2 C. asiatica Stem Paraphaeosphaeria + -        2SF3 C. asiatica Stem Tetracladium + -        2RF1 C. asiatica Root Chaetomium + -        3LF1 N. indicum Leaf Penicillium + -        3LF2 N. indicum Leaf Paraphaeosphaeria + +        3LF4 N. indicum Leaf Acremonium - -        3SF2 N. indicum Stem Ophioceras + +        3RF1 N. indicum Root -unclassified- + -        4FF1 P. indica Flower Bipolaris + -        4FF2 P. indica Flower Phomopsis + -        4FF4 P. indica Flower Curvularia + -        4FF5 P. indica Flower Alternaria + -        4LF1 P. indica Leaf Alternaria - -        4LF2 P. indica Leaf Colletotrichum + -        4LF3 P. indica Leaf -unclassified- + +        4SF1 P. indica Stem Letendraea + -        4SF2 P. indica Stem Phomopsis + -        4RF1 P. indica Root Aspergillus + +        4RF3 P. indica Root Chaetomium + +        5LF1 V. trifolia Leaf Colletotrichum + -        5LF2 V. trifolia Leaf Colletotrichum + -        5SF1 V. trifolia Stem Phomopsis + +        5SF2 V. trifolia Stem Phomopsis + +        5SF3 V. trifolia Stem Colletotrichum + +        5RF1 V. trifolia Root Paecilomyces + +        6SF1 R. communis Stem Colletotrichum + +        6SF2 R. communis Stem Phoma + +        6SF3 R. communis Stem Colletotrichum + +        6SF4 R. communis Stem Phomopsis + +        7SF1 H. tiliaceus Stem Colletotrichum + +        7SF2 H. tiliaceus Stem Phoma + +        7SF3 H. tiliaceus Stem Colletotrichum + +        7SF4 H. tiliaceus Stem Phomopsis + +        7SF6 H. tiliaceus Stem Aspergillus - -        8SF1 C. sappan Stem Colletotrichum + -        8SF2 C. sappan Stem Phomopsis + +       

94 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Table 11 (continued) Biosynthesis Source Activity Isolate Proposed Fungal Genes ID Plant Genus NRP Plant Species PKS EC PA SA MP MS MA MTb Part S 8SF3 C. sappan Stem Paraphaeosphaeria + +        8RF1 C. sappan Root Fusarium - -        9FF1 R. spathacea Flower -unclassified- + -        9FF2 R. spathacea Flower Fusarium + +        9LF1 R. spathacea Leaf Guignardia + -        9LF2 R. spathacea Leaf Phomopsis + +        9LF3 R. spathacea Leaf Colletotrichum + +        9LF4 R. spathacea Leaf Colletotrichum + +        9RF1 R. spathacea Root Phoma + +        9RF2 R. spathacea Root Fusarium + +        9RF3 R. spathacea Root Microdochium + +        9RF4 R. spathacea Root -unclassified- + -        10FF1 L. camara Flower Aspergillus + -        10LF1 L. camara Leaf Aspergillus + +        10SF1 L. camara Stem Colletotrichum + +        10SF2 L. camara Stem Phoma + -        10SF3 L. camara Stem Arthopyrenia + -        10SF4 L. camara Stem Colletotrichum + +        10RF1 L. camara Root -unclassified- + +        11UF1 B. javanica Fruit Endothia + +        11UF2 B. javanica Fruit -unclassified- + +        11UF3 B. javanica Fruit Endothia + +        11UF4 B. javanica Fruit Endothia + +        11UF5 B. javanica Fruit Colletotrichum + +        11FF1 B. javanica Flower Guignardia + +        11FF2 B. javanica Flower Phomopsis + -        11FF3 B. javanica Flower Phomopsis + +        11LF1 B. javanica Leaf Phomopsis + +        11SF1 B. javanica Stem Phomopsis + -        11SF2 B. javanica Stem Colletotrichum + +        11SF3 B. javanica Stem Colletotrichum + -        11RF1 B. javanica Root Fusarium + +        12UF1 M. citrifolia Fruit Phomopsis + +        12UF2 M. citrifolia Fruit Fusarium + +        12UF3 M. citrifolia Fruit Colletotrichum + +        Note: aPKS = polyketide synthase, bNRPS = non-ribosomal peptide synthetase, cEC = Escherichia coli, dPA = Pseudomonas aeruginosa, eSA = Staphylococcus aureus, fMP = Mycobacterium phlei, gMS = Mycobacterium smegmatis, hMA = Mycobacterium avium, iMTb = Mycobacterium tuberculosis; j “+” indicates presence of biosynthesis genes, k “-” indicates absence of biosynthesis genes;, l “” indicates presence of antiproliferative activity, m “” indicates absence of antiproliferative activity.

95 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

In summary, twenty isolates exhibited antiproliferative activity against E. coli, 15 against P. aeruginosa, 17 against S. aureus, 50 against M. phlei, 4 against M. avium, and most importantly, 4 against M. tuberculosis (Table 11). No isolates inhibited the growth of M. smegmatis. As mentioned earlier, M. smegmatis is a distant relative of most pathogenic mycobacteria, including M. avium and M. tuberculosis (361, 362).

Inactivity against this strain might indicate the specificity of the active constituents against other mycobacteria. Furthermore, a total of 14 isolates did not display antiproliferative activities against any tested bacteria. These isolates either promoted or had no effects on growth of the bacterial strains. Absence of antiproliferative activity on the bacterial test strains does not necessarily mean these endophytes do not produce bioactive compounds, especially considering twelve of these 14 isolates had the capacity to synthesise polyketide or non-ribosomal peptide metabolites. The bioactivity of these extracts may be exhibited against other test strains or cell lines which are beyond the scope of this study.

All plants in this study hosted endophytes which were active against a Gram-positive bacterium, Gram-negative bacterium, and at least one mycobacterial strain. The plant R. spathacea hosted fungal endophytes with the broadest antibacterial spectra. Out of 10 endophytes in total, 3 isolates were active against 4 bacterial test strains, 1 isolate was active against 3 bacterial test strains, and 3 isolates were active against 2 bacterial strains. These endophytes may act together, providing the plant host protection against a wide range of pathogenic bacteria. Interactions between endophytes within the same plant host could result in the activation of silent biosynthetic pathways and thus synthesis of potentially bioactive compounds (365, 366). To counter the possible harm from these metabolites, an endophyte generally builds its own self-resistance

96 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

mechanisms against toxic metabolites produced by other endophytes or by the host plants. For example, the anticancer compound camptothecin is co-produced by the plant

Camptotheca acuminata (367) as well as a number of its endophytes (51, 368).

However, the camptothecin-producing endophyte protects itself from its own and plant camptothecin by altering its DNA topoisomerase I, the cellular target of the compound

(368). Interestingly, this protective mechanism is also exhibited by another endophyte from the same plant which does not intrinsically produce camptothecin (368). These findings suggest that synergism between endophytes and its host plant is likely and involves self-protection against toxic metabolites.

Analysing the antiproliferative activity based on the cell wall structure of the test strains, 29 fungal isolates exhibited growth inhibitory effects on Gram-negative bacteria, 17 on a Gram-positive bacterium, and 52 on the mycobacteria (Figure 8). A total of five isolates, namely Paraphaeosphaeria sp. 3LF2 from N. indicum, Bipolaris sp. 4FF1 from P. indica, Colletotrichum sp. 9LF4, Phoma sp. 9RF1, and Microdochium sp. 9RF3 from R. spathacea displayed antiproliferative activity against Gram-positive,

Gram-negative, and mycobacterial test strains. While no antimycobacterial activity have been reported, members of these genera exhibit wide spectrum antiproliferative activity against a number of Gram-positive and Gram-negative bacteria (267, 369-373), further supporting the observations in this present study.

In general, more isolates were active against Gram-negative and mycobacteria than against Gram-positive. Interestingly, extensive whole genome comparisons revealed that M. tuberculosis is a closer relative to Gram-negative bacteria than Gram-positive

(374). The study showed that M. tuberculosis has closer evolutionary distance with the

97 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Gram-negative bacteria, and shares more orthologous genes for energy production and conversion with them (374). Furthermore, mycobacterial cell wall consists of a substantial amount of lipid components, particularly the mycolic acids, which form a pseudolipid bilayer resembling the outer bilayer in the Gram-negative cell wall (364).

Gram-positive Gram-negative

3 1 6 5 8 15

24 14

Mycobacteria

Figure 8 Venn diagram illustrating the distribution of fungal crude extracts exhibiting antiproliferative activity against Gram-positive, Gram-negative, and mycobacterial strains. The number represents the total number of isolates.

Observation of the bioactivity assay results suggest that these endophytes produce more bioactive compounds which act similarly to antibiotics against Gram-negative bacteria.

Some examples of antibiotics targeting Gram-negative bacteria are the cationic peptides, some of which are non-ribosomally synthesised such as colistin (375). The positively charged molecules disrupt the Gram-negative cell membrane by electrostatically binding to the negatively charged lipopolysaccharide (LPS), displacing magnesium and calcium ions which normally stabilise the LPS molecules, leading to a local disturbance of the outer membrane (376-378). This causes an increase in the permeability of the cell envelope, leakage of cell contents, and subsequently cell death

(376-378). Considering mycobacterial cell walls are also lipid-rich, these cationic 98 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

peptides might also be suitable candidates as antimycobacterial agents. Alternatively, their disruptive capability against the cell membrane means they can be utilised in collaboration with other known antimycobacterials. One recent study has explored this avenue by testing synthetic cationic peptides against several mycobacteria including M. tuberculosis, and observing their synergistic effects with rifampicin, a first-line TB treatment (379). The results showed that synthetic peptides with enhanced hydrophobicity through methionine addition increased the efficacy of the molecules against all test strains (379). Multiple exposures to sub-lethal doses of the peptides did not cause resistance development (379). These peptides also displayed synergism with rifampicin against M. smegmatis and M. bovis BCG, and additivity against M. tuberculosis (379).

Moreover, it could be seen that isolates from the same genus displayed varying bioactivity profiles under the circumstances used in these experiments. For example, out of the four Phoma isolates from four different plants, one was active against only Gram- negative bacteria, one was active only against M. phlei, one was active against E. coli and two mycobacteria, and one was active against Gram-positive and Gram-negative bacteria as well as M. phlei (Table 11). On the other hand, fungi belonging to different genera isolated from the same plant could exhibit similar bioactivity profiles. For example, Colletotrichum sp. 11UF5, Guignardia sp. 11FF1, Phomopsis sp. 11FF3, and

Fusarium sp. 11RF1 from Brucea javanica all exhibited antiproliferative activity against S. aureus and M. phlei (Table 11).

These trends could be attributed to multiple factors contributing to secondary metabolite production in each isolate. Growth stages, particularly in fungi which often have distinct

99 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

asexual and sexual phases, affect the production of secondary metabolites. Secondary metabolism is commonly associated with sporulation processes in fungi (380, 381). A number of environmental factors, such as temperature (382), pH (383), availability of an air- surface interface (384), and nutrient sources (382, 385) could also contribute to varied secondary metabolite production, although these were minimised by standardising the media and culturing conditions for all isolates. Nevertheless, it was observed during the culture period that similar strains might not produce similar amount of biomass, despite being grown in the same media with the same culture conditions.

This could be due to the uncontrolled nature of the culturing method, where the pH, aeration, and temperature level were not monitored and maintained.

Another factor that might explain the similarity and diversity of bioactivity profiles between endophytes is the complex endophyte-endophyte and host-endophyte interactions, which can be linked to the occurrence of horizontal gene transfer. Similar compounds have been produced by different strains from different taxonomic classifications. One notable example is the anti-cancer drug Taxol (paclitaxel) which has been isolated from several endophytic fungal genera, including Alternaria,

Aspergillus, Cladosporium, Fusarium, Monochaetia, Pestlotia, Pestalotiopsis,

Pithomyces, Penicillium and Xylaria, which were isolated from a number of yew

(Taxus) and non-Taxus plants (386-390). Furthermore, some fungi have been shown to possess genome plasticity. The complex genetic diversity of the human pathogen

Candida albicans, for example, was detected at the strain level, which could be a result of frequent occurrence of translocations and various chromosomal rearrangements, whole chromosome aneuploidy, and heterozygosity from the mating process (142). This ability to radically alter genomic configuration is a common mechanism used by

100 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

pathogenic fungi in response to stressful growth conditions. Considering some endophytes evolve from plant pathogens (275), and considering the fluctuating dynamics of the fungus-plant interactions (391), this genomic plasticity capability may be retained by the fungal endophytes. Consequently, the capacity to incorporate foreign genes certainly enriches the endophyte’s pool of secondary metabolites.

In addition, previous studies have linked PKS and NRPS genes with bioactivity (205,

322-324). The results of this study indicated that the likelihood of an isolate exhibiting bioactivity was increased with the presence of PKS and NRPS genes, although not all bioactive isolates had PKS and NRPS. Sixty out of 72 isolates with PKS or NRPS

(83%) showed antiproliferative activity against at least one test strain. However, two out of 4 isolates (50%) without PKS and NRPS genes also showed antiproliferative effects:

Aspergillus sp. 7SF6 against S. aureus and Fusarium sp. 8RF1 against S. aureus and M. phlei (Table 11). Previous studies have also shown that not all endophytes with antimicrobial activity had detectable PKS or NRPS genes (205, 308, 392, 393). The bioactivity of these isolates could be due to other classes of chemical compounds such as the terpenoids. Being another structurally diverse class of natural products (394), terpenoids are derived from two main precursors isopentenyl diphosphate (IPP) and dimethylallyl diphosphosphate (DMAPP) by the action of large enzyme complex terpene synthases, whose biosynthetic genes are also clustered (395, 396). A number of endophytic fungal terpenoids have been reported for their antibacterial activities.

Phomadecalin C, a sesquiterpene, was isolated from an endophytic Phoma sp. and displayed antibacterial activity against Bacillus subtilis (397). Diaporthein B, a diterpene from endophytic Diaporthe sp., was shown to be antagonistic against M. tuberculosis with an MIC of 3.1 µg mL-1 (398).

101 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Moreover, a number of host-specific endophytes, such as Arthopyrenia sp. 10SF3 from

L. camara, Paecilomyces sp. 5RF1 from V. trifolia, and Tetracladium sp. 2SF3 from C. asiatica, had PKS and NRPS, and exhibited antiproliferative activity against at least one bacterial test strain. In fact, some of the host-specific endophytes showed wide spectrum antibiotic profile. For example, the isolate Bipolaris sp. 4FF1 from P. indica exhibited antiproliferative activity against 3 test strains, while Microdochium sp. 9RF3 from R. spathacea, inhibited the growth of 4 test strains. Interestingly, a few others, namely

Curvularia sp. 2RF1 and Letendreaea sp. 4SF1 from from P. indica, Acremonium sp.

3LF4 and most notably Penicillium sp. 3LF1 from N. indicum, did not exhibit antiproliferative activity against any of the bacterial test strains. Aside from the fact that their bioactivity could be exhibited against other test strains, this potential loss of bioactivity capacity is likely due to the dynamic endophyte-endophyte or host- endophyte interactions explained before. The ability of other endophytes to produce the same active compounds could result in the endophyte losing its entire biosynthetic machinery to synthesise those chemicals to conserve energy. To illustrate this,

Acremonium sp. 3LF4 and Penicillium sp. 3LF1, which were isolated from leaves of N. indicum, were not active against any of the bacterial test strains. The earlier isolate had no detectable PKS or NRPS although the latter still retained its PKS. Another isolate from the same part of the same plant host, Paraphaosphaeria sp. 3LF2 had both PKS and NRPS and exhibited antiproliferative activity against E. coli, S. aureus, and M. phlei.

In this study, the antibacterial properties were quantitatively assayed against Gram- positive S. aureus and Gram-negative E. coli and P. aeruginosa, and qualitatively tested against four mycobacterial strains, and these are discussed in more details.

102 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

2.3.6 Fungal endophyte antibacterial activity against E. coli, P. aeruginosa,

and S. aureus

As mentioned before, the bioactivity assay using broth microdilution method on the fungal endophtyes revealed that 20 isolates inhibited the growth of E. coli, 15 isolates were active against P. aeruginosa, and 17 isolates were active against S. aureus.

Although there were less isolates inhibited the growth of Gram-positive bacterium, the antiproliferative activity of the crude extracts was generally more potent against S. aureus than against Gram-negative bacteria E. coli and P. aeruginosa. The percentage growth inhibition for S. aureus ranged from 10.8-35.7% (Figure 11), compared to 2.7-

20.4% for E. coli (Figure 9) and 2.6-23.8% for P. aeruginosa (Figure 10). These suggest that the active compounds in the crude extracts acted better on Gram-positive bacteria than on Gram-negative bacteria.

103 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Figure 9 Growth inhibition of E. coli by fungal endophytic crude extracts. The data represent the mean ± SEM, n = 3, p<0.05.

Figure 10 Growth inhibition of P. aeruginosa by fungal endophytic crude extracts. The data represent the mean ± SEM, n = 3, p<0.05.

104 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

Figure 11 Growth inhibition of S. aureus by fungal endophytic crude extracts. The data represent the mean ± SEM, n = 3, p<0.05.

The highest activity against E. coli (20.39%) was showed by biomass extract from

Aspergillus sp. 10LF1 from L. camara at 100 µg mL-1. The highest activity against

P. aeruginosa (23.8%) was displayed by supernatant extract from Phoma sp. 9RF1 from

R. spathacea at 10 µg mL-1. The highest activity against S. aureus (35.7%) was exhibited by supernatant extract from Phoma sp. 10SF2 from L. camara at 10 µg mL-1.

Nineteen of the 20 active isolates against E. coli showed strictly antiproliferative activity. Eight of the 15 active isolates against P. aeruginosa also showed strictly antiproliferative activity. Interestingly, only four of the 17 active isolates against S. aureus showed strictly antiproliferative activity. The other thirteen had extracts which promoted the growth of S. aureus. Furthermore, in most cases, the antiproliferative 105 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

activity was exhibited only by the culture broth extract or the biomass extract. Only a few isolates displayed antiproliferative activity on both culture broth and biomass extracts, namely Phoma sp. 7SF2 and Phomopsis sp. 7SF4 against E. coli,

Paraphaeosphaeria sp. 2SF2 and Reticulascaceae sp. 9RF4 against P. aeruginosa, and

Aspergillus sp. 7SF6 against S. aureus. It was also observed that some extracts were more potent at 100 µg mL-1 and some were more potent at 10 µg mL-1. In some cases, such as in Paraphaeosphaeria sp. 2SF1 against P. aeruginosa and Endothia sp. 11UF4 against S. aureus, exposure to 10 µg mL-1 of the culture broth extract inhibited bacterial growth, although exposure to 100 µg mL-1 of the same extract promoted bacterial growth.

A number of reasons are proposed to rationalise the varying outcomes following different treatments of the extracts from the same isolate, but the underlying cause of these results is due to the fact that each crude extract contains a mixture of compounds.

Different active compounds may be the reason for growth promotion with one extract and growth inhibition by the other. As indicated earlier, ethyl acetate and methanol, as organic phase during the chemical extraction, may capture different compounds with different polarity. Previous studies investigating extracts collected from the same isolate using different solvents also resulted in different bioactivity profile (399-401).

Furthermore, there might be some bioactive secondary metabolites, often intermediates, which are stored intracellularly and not secreted in to the media. Sub-cellular compartmentalisation is a common theme in fungal secondary metabolism (402-404).

Enzymes, substrates, intermediates, and end products of secondary metabolism are often stored in different compartments (e.g. vacuoles, vesicles, peroxisomes, cytoplasm, endoplasmic reticulum), and this is irrespective of the complexity of the metabolic

106 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

pathways. This would explain why some antiproliferative activity might only be exhibited by biomass extracts and not the culture broth extracts.

On the other hand, contradicting outcomes between different concentrations of the same extract could be the result of sub-inhibitory concentrations of the active compounds in the crude extracts. A similar study in our group exploring antimicrobial and anticancer potentials of endophyte crude extracts from Chinese traditional medicine also revealed extracts which induced cell proliferation of the test strain after exposure at one concentration and inhibited cellular growth at another concentration (205). The use of crude extracts containing a complex mixture of compounds meant both synergistic and antagonistic components were collectively present, and the dynamics of the interactions may be concentration-dependent. Effective antiproliferative activity would only be exhibited if the target cells were exposed to optimum dose of the active compounds.

Otherwise, the use of subinhibitory concentrations of these supposedly antibiotic compounds could make them act as cell signalling molecules. Exposure of the bacterial target cells to these low-dose cell signalling molecules could instead promote its growth, a phenomenon called the hormesis (405). In group A streptococci such as

Streptococcus pyrogenes, sub-minimal inhibitory concentrations (sub-MICs) of protein synthesis inhibitors such as clindamycin alters the production of bacterial virulence factors (406). Furthermore, sub-MICs of aminoglycoside antibiotics could induce biofilm formation in P. aeruginosa (407). Intriguingly, horizontal gene transfer, discussed before, is known to be increased by sub-MIC concentrations of tetracycline

(408). These postulated reasons indicate that the best bioactivity profiles were exhibited by crude extracts containing optimum concentrations of active compounds.

107 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

In summary, bioactivity assays against Gram-positive bacterium and Gram-negative bacteria revealed the wide range antibiotic profile of the fungal isolates from medicinal plants, with most of the isolates being tested were active against more than one test strain. While more isolates were active against Gram-negative bacteria, the potency of the extracts was more visible against S. aureus. The diversity of antiproliferative activity was also displayed against mycobacterial test strains.

2.3.7 Fungal endophyte antimycobacterial activity profile

The antimycobacterial properties of the fungal endophytes were qualitatively evaluated using the agar dilution method. Similar to the general antibacterial assay using broth dilution, two concentrations of the same extract were investigated. Growth inhibition was assessed through visual observation. In this assay, low antiproliferative activity was indicated by <50% reduced cellular growth, while moderate antiproliferative activity was indicated by >50% reduced cellular growth, compared to the negative control

(untreated cells). High antiproliferative activity was indicated by total growth inhibition, which could indicate bacteriostatic and bacteriocidal activity. A DMSO control (1%) was included to exclude all apparent growth inhibition by the action of the solvent. In this series of experiments, the DMSO did not appear to affect the growth of the mycobacterial test strains. This is in line with previous studies which reported that any concentration below 2.5% DMSO is non-toxic to mycobacteria (409, 410).

In brief, apart from M. phlei inhibition, all the antiproliferative activity observed in the bioactivity essays was derived from the culture broth extracts (Table 22 in Appendix

1). Nearly two-thirds (50/76) of the isolates inhibited growth of M. phlei, while no

108 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

isolate displayed visible antiproliferative activity against M. smegmatis (Table 22 in

Appendix 1). All growth inhibition was caused by exposure to 100 µg mL-1 of crude extracts, except for the supernatant from isolate Endothia sp. 11UF1 which showed mild activity against M. phlei at 10 µg mL-1 (Table 22 in Appendix 1). Only six isolates were active against more than one mycobacterial strain. Isolates Phoma sp. 7SF2 and

Reticulasceae sp. 9FF1 were active against M. phlei and M. avium, and all four isolates which inhibited the growth of M. tuberculosis (Fusarium sp. 9RF2, Endothia sp.

11UF1, Endothia sp. 11UF3, and Endothia sp. 11UF4) were also active against M. phlei

(Table 22 in Appendix 1).

Table 12 Number of endophyte isolates with culture broth extracts showing antiproliferative activity against mycobacteria at 100 µg mL-1 Mycobacterial test strain Activity M. phlei M. avium M. tuberculosis Supernatant Biomass Supernatant Biomass Supernatant Biomass No anti-proliferative 27 69 72 76 72 76 Low anti-proliferative 36 5 0 0 0 0 Moderate anti- 13 2 4 0 0 0 proliferative High anti-proliferative 0 0 0 0 4 0

Comparing the strength of the antiproliferative activity of these crude extracts, the majority (36 culture broth extracts and 5 biomass extracts) displayed mild antiproliferative activity against environmental, non-pathogenic M. phlei (Table 12).

Interestingly, all four extracts which inhibited the growth of M. avium caused >50% growth inhibition. Most importantly, all extracts that were active against M. tuberculosis totally inhibited its growth (Figure 12), and in the case of Endothia sp. 11UF1, the effect was bactericidal. The cells that remained visible on some of the active wells were

109 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

the original culture placed on the agar surface, suggesting the bacteriostatic effects of the crude extracts. These results still warrant further investigations for compound isolation and identification as the crude extracts contained a complex mixture of chemicals, and that antiproliferative activity would only exhibited upon exposure of optimum concentration of the active components.

The variations in the antimyobacterial profile against the four test strains could be due to the different cellular chacteristics of each mycobacterial strain. The genus

Mycobacterium consists of obligate pathogens including M. tuberculosis, opportunistic pathogens including M. avium, and non-pathogenic saprophytes including M. smegmatis and M. phlei. The unique, lipid-rich mycobacterial cell wall structure (157) combined with a broad selection of efflux pumps (158) has made them resistant to most antimicrobials. In addition to these multiple layers of intrinsic defence mechanisms, it is thought that pathogenic M. avium and M. tuberculosis have undergone major evolutionary changes as they infect higher organisms, particularly humans. It is suggested that slow growth and production of virulence factors may be the adaptive responses of these pathogenic mycobacteria to closer-to-human environments (411).

This could explain the apparent resistance of M. tuberculosis and M. avium against most crude extracts in this study.

110 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

9RF2

Media blank Supernatant 100 µg mL-1 Negative control

Positive control Supernatant 10 µg mL-1 DMSO control

(A)

11UF1 11UF3 11UF4

Media blank Supernatant 100 µg mL-1 Negative control

Positive control Supernatant 10 µg mL-1 DMSO control

(B)

Figure 12 Two 24-well plate photos displaying significant results of the agar dilution assay against M. tuberculosis H37Ra: (A) Total growth inhibition by isolate 9RF2, (B) Total growth inhibition by 11UF1, 11UF3, and 11UF4. Wells highlighted in red were media blank, wells highlighted in yellow contained 100 μg mL-1 of ciprofloxacin as the positive control, wells highlighted in green contained untreated cells as the negative control, and wells highlighted in blue contained 1% DMSO vehicle control.

Furthermore, higher levels of drug resistance are more common in non-tuberculous mycobacteria (412). Most microbe-derived antibiotics are produced in competition with other microbes in their environmental settings. Thus, resistance to these compounds is a mere survival response by the mycobacteria sharing the niche with the antibiotic- producing microorganisms. This could explain the natural resistance of M. smegmatis against the endophytic crude extracts. This non-pathogenic strain was originally isolated

111 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

from human natural flora (413), where the mycobacterium was regularly exposed to other microorganisms which might excrete antibiotic secondary metabolites. On the other hand, the apparent susceptibility of M. phlei against most fungal crude extracts in this study could be the result of multiple sub-culturing under axenic conditions, which may cause some loss of antibiotic resistance as the strain was no longer exposed to the selective pressure of its typical environment.

The antiproliferative activity exhibited by the eight extracts against M. avium and M. tuberculosis suggested the presence of compounds which were able to penetrate the various mycobacterial defence mechanisms. The specificity of these crude extracts against a particular mycobacterial species suggested that the mode of actions of these compounds might be specially tailored against a particular mycobacterium. This is undoubtedly of interest as the active compounds candidates would specifically target the mycobacterial pathogens without causing detrimental effects against other human natural microbial flora.

The results in this chapter showed that screening for PKS and NRPS genes were beneficial to increase the probability of selecting isolates with bioactivity. Nevertheless, combining the genetic screening with bioactivity assays ensured a thorough evaluation of the antimicrobial potential of the culturable endophytes. These two methods were complementary in the strain prioritisation for bioactive compound isolation.

112 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

2.3.8 Prioritising the fungal strains for active compound isolation

The main aim of this project was to isolate antitubercular compounds from the endophytes. The genetic screening revealed that that 72 of the 76 fungal isolates (94%) had either PKS or NRPS genes, higher than the bacterial isolates, of which only 84% had the biosynthetic genes. Thus, the fungal samples were tested for antibacterial and antimycobacterial activities to create an antibacterial bioactivity profile. From this process, four isolates demonstrated significant antiproliferative activity against M. tuberculosis. All these isolates had PKS and NRPS biosynthetic genes, and all were active against environmental M. phlei and one non-mycobacterial test strain, indicating a relatively narrow antibiotic spectrum. A narrow-spectrum antibiotic is beneficial for this purpose as it will not kill as many non-target microorganisms in the body as broad spectrum antibiotics, meaning it has less ability to cause superinfection. Also, the narrow spectrum antibiotic will cause less resistance as it will contend with only specific bacteria. The three active isolates from the fruits of B. javanica belong to the genus Endothia, which is not widely studied. Thus far only a number of secondary metabolites have been characterised from members of this genus, most notably the cytotoxic cytohalasins (271). Both isolates Endothia sp. 11UF1 and Fusarium sp. 9RF2 exhibited bactericidal properties against M. tuberculosis H37Ra. Based on these reasons, these two isolates were deemed best candidates for antitubercular compound isolation.

2.4 Conclusion

This chapter described the microbial diversity and assess the biosynthetic potential of culturable endophytes from 12 traditional Indonesian medicinal plants used to treat

113 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

symptoms of tuberculosis. It also established the bioactivity profile of the fungal isolates. The main aim of these investigations was to screen the microbial isolates and select the best candidate for targeted discovery of novel antimycobacterial compounds.

It was hypothesised that traditional medicinal plants harbour endophytes with high biosynthetic potential.

This study is the first comprehensive endophytic diversity investigation on Indonesian medicinal plants traditionally used to treat symptoms of tuberculosis. It is also the first reported study on bacterial endophyte diversity from these plants except L. camara, and the first endophyte diversity study on N. indicum, V. trifolia, and R. spathacea. A total of 105 bacterial endophytes and 88 fungal endophytes were initially isolated. Following loss during material transfer and strain de-replication using PCR screening, the 92 bacterial isolates were identified and phylogenetically categorised into 8 orders and at least 20 genera, while the 76 fungal isolates were categorised into 10 orders and at least

20 genera. Although the genera detected in this study have been previously isolated as endophytes, lesser is known regarding their roles in the host plants as individual endophytes or as a microbial community. It is important to note that the culturable endophyte community gives only a narrow insight into the total diversity. Further investigations employing different isolation media, growth conditions, and the use of metagenomics analysis of the total plant genomes would lead to better understanding of the complex endophyte-host symbiotic relationship on the studied plants.

Moreover, the biosynthetic gene screening revealed that 62% of bacteria and 94% of fungi possessed PKS genes, and 76% of bacterial isolates and 59% of fungal isolates tested positive for NRPS genes. Besides the fact that the bacterial and fungal genera

114 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

identified in this study are known producers of PKS or NRPS products, it is also possible that horizontal gene transfer may have taken place between endophytes in a particular plant host. The fact that most isolates possess both PKS and NRPS suggests that the isolated endophytes in this study possess significant potential in the production of more diverse secondary metabolites, confirming our initial hypothesis. This also would increase the possibility of novel active compound discovery.

Members of the endophytic genera detected in this study have been previously known to possess beneficial traits, including antiproliferative activities against various pathogens.

Some are also known for producing antimycobacterial compounds. Nevertheless, the high abundance of PKS and NRPS genes in this sample set means a second screening method, bioactivity assay, is required to prioritise the strains for active compound isolation.

The bioactivity assay was carried out on the fungal endophytes as these isolates showed better genetic screening results. Assays were performed on these fungal endophytes to create an antimicrobial bioactivity profile, while at the same time investigating its correlation with the presence of the aforementioned biosynthetic genes. Using Gram- positive, Gram-negative, and mycobacterial test strains would provide good bioactivity spectrum overview of the endophytic crude extracts.

Due to the quantitative nature of the broth dilution method, it was discovered that the crude extracts exhibited both proliferative and antiproliferative activity against E. coli,

P. aeruginosa, and S. aureus. Nonetheless, as the aim of this project was to discover new antibiotics, only the latter was taken into consideration. Furthermore, the

115 Biological Diversity and Bioactivity Profile of Culturable Endophytes from Indonesian Traditional Medicinal Plants

qualitative antimycobacterial assays revealed that except for M. phlei, antiproliferative activities were only exhibited by very few isolates. The results showed that more extracts were active against Gram-negative and mycobacterial test strains, although generally the growth inhibition was more potent against Gram-positive S. aureus. Of the

62 isolates which exhibited antiproliferative activity, 29 isolates had specific activity against one test strain, and 33 of them exhibited a broader antibiotic spectrum. The antiproliferative activity of the crude extracts might be the result of multiple compounds, and the dynamics of interactions between these compounds may be concentration-dependent.

The results of this study suggested that the presence of PKS and NRPS genes is indicative of the endophyte’s bioactivity, with 83% of the isolates with the genes displayed antiproliferative activity against at least one of the bacterial test strain.

Nevertheless, bioactivity was also displayed by isolates not having PKS and NRPS genes, indicating that other classes of compounds were responsible for the bioactivity of the endophytes.

Combining the results of genetic-based and bioactivity screening, two isolates,

Fusarium sp. 9RF2 and Endothia sp. 11UF1, were chosen for antitubercular compound isolation. Chapter 3 describes the purification of two polyketides from a Fusarium species, and Chapter 4 discusses the purification of two polyketides from an Endothia species.

116

Chapter 3

ISOLATION AND

CHARACTERISATION OF

ANTIMYCOBACTERIAL

COMPOUNDS FROM FUSARIUM sp.

117 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Summary

The endophyte Fusarium sp. 9RF2 was isolated from Rhoeo spathacea, an Indonesian medicinal plant used to treat symptoms of tuberculosis. Previous genetic and bioactivity screening revealed that this isolate had polyketide and non-ribosomal peptide biosynthetic genes and exhibited strong antiproliferative activity against M. tuberculosis

H37Ra. Chemicals were extracted from large scale cultures, and NMR-guided fractionation of the crude extracts led to the isolation of javanicin (11) and anhydrofusarubin (12). The two naphthoquinones exhibited moderate antibacterial activity. Javanicin was active against M. tuberculosis (MIC of 25 µg mL-1), M. phlei

(MIC of 25 µg mL-1), and S. aureus (MIC of 25 µg mL-1), while anhydrofusarubin was active against M. tuberculosis (MIC of 50 µg mL-1) and S. aureus (MIC of 50 µg mL-1).

This is the first report on antimycobacterial compounds from the medicinal plant Rhoeo spathacea.

118 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

3.1 Introduction

Fungi are potent sources of active compounds against Mycobacterium tuberculosis.

These antitubercular secondary metabolites are structurally diverse and exhibit antiproliferative activity with MIC values comparable to that of commercial drug therapies for tuberculosis. Some of the recently isolated novel antitubercular compounds include the terpene, ramiferin (1), from Kionochaeta ramifera which exhibited an MIC

-1 against M. tuberculosis H37Ra of 6.25 µg mL (203), an epidioxysterol 2 from Stereum

-1 hirsutum with MIC against M. tuberculosis H37Rv of 16 µg mL (414), a dimeric alkaloid hirsutellone F (3) from Trichoderma sp. BCC7579 which inhibited M.

-1 tuberculosis H37Rv with MIC of 3.12 µg mL (415), and phomoenamide (4) from

-1 Phomopsis sp. PSU-D15 with MIC of 6.25 µg mL against M. tuberculosis H37Ra (188)

(Figure 13).

Many isolated fungal antitubercular compounds are also polyketides or small peptides

(184, 416), which constitute the largest and most diverse classes of fungal metabolites

(Section 1.2). The remarkable diversity of polyketide and non-ribosomal peptide structures arise from coordinated, multistep enzymatic reactions in the biosynthetic pathways. Variations in the monomer units used, the number of extension reactions, the number and sequence of the tailoring enzymes, and post-synthesis modifications contribute to the production of compounds belonging to these chemical classes. Fungal polyketides are mostly biosynthesised by type I iterative polyketide synthases (PKSs), by which short-chain carboxylates, typically acetyl-CoA and malonyl-CoA, are condensed to assemble β-ketide chains of variable lengths which are ultimately tailored to provide the final products (100). Examples of antitubercular polyketides include a

119 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

naphthaquinone 5, isolated from Phaeosphaeria sp. BCC8292 that was active against

-1 M. tuberculosis H37Ra with an MIC value of 0.39 µg mL (195) and an azaphilone, bioscogniazaphilone A (6), isolated from Biscogniauxia formosana BCRC33718 that displayed antiproliferative activity against M. tuberculosis H37Rv with MIC of 5.12 µg mL-1 (196) (Figure 13).

On the other hand, fungal non-ribosomal peptide synthetases (NRPSs) utilise proteinogenic and non-proteinogenic amino acids as monomer units (417). Fungal antitubercular peptides are also structurally diverse and potent against M. tuberculosis.

For example, the hexapeptide calpinactam (7) from Mortierella alpina FKI-4905

-1 inhibited the growth of M. tuberculosis H37Rv with MIC value of 12.5 µg mL (190).

An aminolipopeptide trichoderin A (8) isolated from Trichoderma sp. strain 05FI48 exhibited powerful antiproliferative activity against M. tuberculosis H37Rv with MIC of

0.12 µg mL-1, comparable to isoniazid under aerobic condition but far more potent under hypoxia (194) (Figure 13).

120 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Figure 13 Examples of fungal anti-tuberculosis compounds: ramiferin (1), (3β,5α,8α,22E)-5, 8-epidioxy-cholesta-6,9(11),22-trien-3-ol (2), hirsutellone F (3) , phomoenamide (4), 6- [1-(acetyloxy)ethyl]-5-hydroxy-2,7-dimethoxy-1,4-naphthalenedione (5), bioscogniazaphilone A (6), calpinactam (7), trichoderin A (8), 9α-hydroxyhalorosellinia A (9), and nigrosporin B (10).

121 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

The genus Fusarium includes producers of a variety of mycotoxins, including trichothecenes, zearalenone, enniatins, beauvericin, moniliformin, fumonisins, fusaproliferin, fusarins, and fusaric acids (418). The biosynthesis of these toxins has been deciphered: the trichothecenes and fusaproliferin are produced by terpene synthases (419, 420), zearalenone, moniliformin, the fumosinins, and the fusaric acids by PKSs (420-423), the enniatins and beauvericin by NRPSs (420), and the fusarins by a hybrid PKS/NRPS pathway (424). A number of pharmaceutically important compounds have also been isolated from Fusarium species. These include antifungal agents fusarielin A (425), fusapyrone and deoxyfusapyrone (426), the anti-HIV integracides (427), and the anticancer agent taxol (428). Nonetheless, the most common classes of secondary metabolites produced by the genus are the bioactive, polyketide- derived quinones, such as the fusarubins, the bostrycoidins, and the karuquinones (429-

431). Some of these compounds have been investigated and exhibited antitubercular properties, including 9α-hydroxyhalorosellinia A (9) and nigrosporin B (10) (432)

(Figure 13).

This chapter focuses on a Fusarium isolate that possesses both PKS and NRPS genes

(section 2.3.4) and whose crude extract exhibited strong anti-proliferative activity against M. tuberculosis H37Ra (section 2.3.7). Discussed here are the results of a chemistry-based investigation of Fusarium sp. 9RF2. The isolation, chemical structure elucidation, and biological activity of the compounds are presented.

122 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

3.2 Materials and Methods

3.2.1 Large scale culture of Fusarium sp.

The isolate Fusarium sp. 9RF2 was cultured at a large scale for compound purification.

A small (2 mm × 2 mm) piece of the agar culture was aseptically excised from the plate, transferred to 100 mL of malt extract broth (Difco) and grown for 7 days at 30°C with shaking at 100 rpm. This starter culture was then transferred in to 2 L of malt extract broth (Difco) for a further 28 days at 30°C with shaking at 100 rpm.

3.2.2 Chemical extraction of Fusarium sp.

The 28-day-old culture was filtered through cheesecloth to remove fungal mycelia. The supernatant filtrate was exhaustively extracted with three volumes of ethyl acetate (Ajax

Finechem). The organic phase was separated from the aqueous broth using a separating funnel, combined, dried over anhydrous MgSO4 (Sigma-Aldrich), transferred by filtration to a pre-weighed scintillation vial, and evaporated to dryness under reduced pressure using a rotary evaporator. The crude extract was weighed and stored at -20°C until further use.

3.2.3 Fractionation of crude extracts

The crude extract was fractionated on a Sephadex LH-20 (500 mm × 24 mm, Pharmacia

Biotech) column, prepared by immersing the resin into analytical grade methanol (Ajax

Finechem). The column was packed and then equilibrated with a 4:1

123 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

methanol:dichloromethane. The sample was loaded to the top of the column and eluted with 4:1 methanol:dichloromethane at the rate of 2.67 mL min-1. Separate bands were collected and dried under reduced pressure. The resulting fractions were examined by normal phase thin layer chromatography on silica gel 60 F254 plates (Merck) visualised under UV light at 254 and 280 nm, then by 1H NMR using deuterated methanol

(CD3OD, Cambridge Isotope Laboratories). The best fractions were selected based on the presence of fluorescent bands at 254 nm, which was indicative of aromatic rings and conjugated double bonds (433). These fractions were further purified using High

Performance Liquid Chromatography (HPLC).

3.2.4 HPLC purification

3.2.4.1 Compound 9RF2.S-6I

High Performance Liquid Chromatography (HPLC) was performed using a Dionex

UltiMate 3000 series HPLC with UV detections at 254 and 280 nm. Separation was achieved with a Luna 5 µm C18(2) 100 A (10.00 × 250 mm, 5 micron) reversed phase column (Phenomenex), employing a gradient of A (0.01% trifluoroacetic acid, Sigma-

Aldrich) and B (100% acetonitrile, Ajax Finechem) as follows: 0% B as initial condition, followed by a linear increase of solvent B to 100% in 25 min then held for 10 min; followed by a linear decrease of solvent B to 0% in 5 min then held for 10 min prior to the next run. The flow rate was kept at 4 mL min-1. Purified compounds were analysed by MR and MS, and their antibacterial and antimycobacterial activities were determined via broth dilution assay.

124 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

3.2.4.2 Compound 9RF2.S-6G

High Performance Liquid Chromatography (HPLC) was carried out using a Hewlett

Packard 1100 series HPLC with UV detections at 254 and 280 nm. Separation was achieved with a Discovery® BIO Wide Pore C18 (10.00 × 250 mm, 5 micron) reversed phase column (Supelco Analytical), employing a gradient of A (0.01% trifluoroacetic acid, Sigma-Aldrich) and B (100% acetonitrile, Ajax Finechem) as follows: 0% B as initial condition, followed by a linear increase of solvent B to 100% in 60 min then held for 10 min; followed by a linear decrease of solvent B to 0% in 5 min then held for 10 min prior to the next run. The flow rate was kept at 2.5 mL min-1. Purified fractions were analysed by NMR and MS, and their antibacterial and antimycobacterial activities were determined via broth dilution assay.

3.2.5 NMR and mass spectometry analysis of the pure compounds

NMR experiments were performed at the Nuclear Magnetic Resonance facility at the

Mark Wainwright Analytical Centre, UNSW. Proton-nuclear magnetic resonance (1H-

NMR), carbon nuclear magnetic resonance (13C-NMR), and two dimensional NMR correlation spectra (1H−1H COSY, and 1H−13C HSQC and HMBC) were recorded on a

Bruker Tesla 600 MHz instrument (operating at 600 MHz for 1H and 150 MHz for 13C) in CDCl3 (Cambridge Isotope Laboratories). Spectra were referenced to CDCl3 (7.26 and 77.0 ppm). The mass spectrometry data were obtained using a Thermo Scientific

LTQ FT ULTRA instrument operating in negative and positive electrospray ionisation modes. This work was carried out at the Bioanalytical Mass Spectrometry Facility

(BMSF) at the Mark Wainwright Analytical Centre, UNSW. Mass spectrometry data

125 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

was analysed using Qual Browser Thermo Xcalibur 2.2 SP1.48 (Thermo Fisher

Scientific). The 1H and 13C chemical shift calculation on the proposed chemical structures were performed using ChemBioDraw Ultra v.14.0.0.117 (CambridgeSoft

Corporation).

3.2.6 Determination of bioactivity and minimal inhibitory concentration of

the pure compounds

A modified resazurin microtiter plate assay (REMA) method (434) was employed to determine the minimal inhibitory concentration (MIC) of the compounds against

Escherichia coli, Staphylococcus aureus, Mycobacterium phlei, M. smegmatis, and M. tuberculosis. A Middlebrook 7H9 medium with 0.2% glycerol supplemented with oleic acid, albumin, dextrose, and catalase (Becton-Dickinson) was utilised for the antimycobacterial assays, while nutrient broth was used for all other antibacterial assays. The bacterial strains in this study are the ones previously used for the crude extracts (see Sections 2.2.10 and 2.2.11).

Serial dilutions from 1 mg mL-1 of each compound in water were prepared in triplicate.

Each well contained 10 µL of the test material in serially descending concentrations. To each well, 80 µL of the corresponding media broth and 10 µL of bacterial suspension

(5×106 cfu mL-1) were added to achieve a final concentration of 5×105 cfu mL-1 on each well. Each plate had a set of controls: a column with ciprofloxacin as positive control, a column with all solutions with the exception of the test compound, and a column with all solutions with the exception of the bacterial solution, adding 10 µL of media instead.

The plates were then incubated at 37°C: overnight for E. coli and S. aureus plates, 2

126 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

days for M. phlei plates, 3 days for M. avium plates, and 5 days for M. tuberculosis plates. At the end of the stated incubation period, 10 µL of resazurin solution (0.01% w/v) was added to each well and the plate was incubated overnight at 37°C, then assessed for colour alteration. A change from blue to pink indicates reduction of resazurin and therefore bacterial growth. The MIC was defined as the lowest concentration that prevented this colour change.

3.3 Results and Discussion

3.3.1 Isolation of compound 9RF2.S-6I

Following the antimicrobial activity screening of the endophytic crude extracts, a 2-L culture of Fusarium sp. 9RF2 was prepared for compound isolation. The fractionation and compound purification were carried out using an NMR-guided approach (Figure

14). Chemical extraction of the supernatant of this liquid culture yielded 0.353 g of crude extract, which was then subjected to size-exclusion liquid chromatography using

LH-20 resin. Eleven fractions were collected based on colour. The fractions were analysed using 1H NMR, and the red-coloured fraction 9RF2.S-6 (28.5 mg), eluting between 54-67 min, was selected for compound purification due to the abundance of chemical shifts corresponding to protons in aromatic rings. Semi-preparative HPLC separation of this fraction yielded ten major peaks which were analysed using 1H NMR to assess their purity and determine the best candidate for 2D-NMR analyses. The red- coloured compound, 9RF2.S-6I (2.0 mg), eluting at 19.8 min, was chosen for its purity and high signal-to-noise ratio.

127 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Isolate 9RF2 from the root of Rhoeo spathacea

EtOAc MeOH/DCM extraction extraction

9RF2.S 9RF2.B (supernatant) (biomass)

Activity against Inactive against M. tuberculosis M. tuberculosis

LH-20 column fractionation (11 fractions)

9RF2.S-6

HPLC C18 column fractionation (10 fractions)

9RF2.S-6I

Figure 14 Isolation and purification of compound 9RF2.S-6I.

3.3.2 Structure elucidation of compound 9RF2.S-6I

Positive ion high resolution Fourier Transform mass spectrometry (HRFTMS) detected a sodiated molecular ion [M+Na]+ peak at m/z 313.06729 (313.06826 calc, Δ 3.1 ppm).

The calculated best-fit empirical formula of this compound is C15H14O6, requiring 9 rings and double bond equivalents (RDBE). The HMBC NMR spectrum confirmed the presence of 15 carbons.

The carbon atoms at 177.7 ppm and 184.4 ppm were suggestive of a 1,4-benzoquinone structure, and based on the predicted number of carbons, the compound was likely to be a naphthoquinone derivative. Methyl protons at δ 3.96 attached to a carbon at 56.7 ppm indicated an O-methyl group and showed a three-bond correlation to a carbon at 160.6

128 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

ppm. The proton at δ 6.23, which is HSQC H-C correlated to carbon at 109.7 ppm, shows HMBCs to the carbons at 160.6 ppm, 177.7 ppm, and 184.4 ppm, indicating they were part of the same closed ring structure. This information constructed the first ring structure (Figure 15A).

Figure 15 Partial structures of 9RF2.S-6I determined from HSQC and HMBC. Numbers in blue are the carbon chemical shifts, numbers in pink are proton chemical shifts, and arrows indicate HMBC.

129 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

The remaining three oxygen atoms were assigned to two hydroxyl groups (correlated to the protons at δ 12.88 and 13.28) and one ketone (203.8 ppm). The HMBCs of the two hydroxyl groups suggested that they are para to each other in the same ring structure, and that one hydroxyl group was attached to the carbon at 160.3 ppm, while the other was attached to the carbon at 161.4 ppm. The quaternary carbons at 134.1 ppm, 142.5 ppm, and 160.3 ppm, and 161.4 ppm suggested that they form the backbone of the second ring structure (Figure 15B).

Two methyl groups were also present. Three protons at δ 2.26, attached to carbon at

12.8 ppm, showed HMBCs to carbons at 134.1 ppm, 142.5 ppm, and 160.3 ppm, indicating this methyl group was directly attached to the ring. The other methyl protons at δ 2.32, attached to a carbon at 29.7 ppm, showed HMBCs to the carbons at 41.2 ppm and 203.8 ppm. The carbon at 41.2 ppm was attached to two protons at δ 3.93, and

HMBC of this proton showed the connection to the ring backbone through the carbon at

134.1 ppm (Figure 15B).

The two partial structures were combined with carbons at 108.4 ppm and 107.9 ppm positioned at the ring junctions completed the assignment and confirmed the compound to be javanicin (IUPAC systematic name: 5,8-dihydroxy-2-methoxy-6-methyl-7-(2- oxopropyl)naphthalene-1,4-dione, CID: 10149, Figure 16). In principle, the experimental carbon chemical shifts of this compound agree with the calculated data generated using ChemBioDraw software (Table 23 in Appendix 2). It has to be noted, however, that the software predictions are solvent independent and thus minor discrepancies may be observed.

130 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Figure 16 Structure of javanicin.

Table 13 NMR data for javanicin (11) acquired in CDCl3 at 30°C 13C 1H Position 2J and 3J (δ) (δ, mult) CH CH 1 177.7 - - 2 160.6 - - 3 109.7 6.23 (s) C-1, C-2, C-4, C-4a 4 184.4 - - 4a 108.4 - - 5 160.3 - - 6 142.5 - - 7 134.1 - - 8 161.4 - - 8a 109.7 - - 9 41.2 3.93 (s) C-6, C-7, C-8, C-10 10 203.8 - - 11 29.7 2.32 (s) C-9, C-10 12 12.8 2.26 (s) C-5, C-6, C-7 8-OH – 12.88 (s) C-7, C-8, C-8a 5-OH – 13.28 (s) C-4a, C-5, C-6

2-OCH3 56.7 3.96 (s) C-2

131 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Javanicin was first isolated from the free-living species Fusarium javanicum (435). It has also been isolated from both free-living (436-438) and endophytic (430) Fusarium species, in addition to an endophytic Chloridium sp. (439). Javanicin is biosynthesised under growth cessation at a pH lower than 4.0 (440) via a typical polyketide synthase pathway, using acetyl-CoA and malonyl-CoA extender units to provide the carbon backbone (441). The C-2 O-methyl group is presumably S-adenosylmethionine derived, as described by Gatenbeck and Bentley (441).

3.3.3 Isolation of compound 9RF2.S-6G

To increase the yield of the crude extract and increase the likelihood of isolate low- abundance compounds, a second fermentation of Fusarium sp. 9RF2 was performed with a 10-L liquid media. Similar to the isolation of javanicin, this compound isolation was carried out using NMR-guided approach (Figure 17). Chemical extraction of the supernatant of this liquid culture yielded 0.932 g of crude extract, which was then subjected to size-exclusion liquid chromatography using LH-20. Eight fractions were collected based on colour bands. A red-coloured fraction, 9RF2.S-6 (32.0 mg), eluting between 82-90 min, was selected for purification due to the presence of numerous chemical shifts corresponding to aromatic protons in its 1H NMR spectrum. HPLC purification of this fraction yielded seven major fractions, of which 9RF2.S-6G (3.0 mg), eluting at 44.6 min, was chosen for structural characterisation due to its high purity and abundance.

132 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Isolate 9RF2 from the root of Rhoeo spathacea

EtOAc MeOH/DCM extraction extraction

9RF2.S 9RF2.B (supernatant) (biomass)

Activity against Inactive against M. tuberculosis M. tuberculosis

LH-20 column fractionation (8 fractions)

9RF2.S-6

HPLC C18 column fractionation (7 fractions)

9RF2.S-6G Figure 17 Isolation and purification of compound 9RF2.S-6G.

3.3.4 Structure elucidation of compound 9RF2.S-6G

Positive ion high resolution Fourier Transform mass spectrometry (HRFTMS) gave an

[M+H]+ peak at m/z 289.07043 (289.07066 calc, Δ 0.80 ppm). The calculated best-fit empirical formula of this compound is C15H12O6, requiring 10 rings and double bond equivalents (RDBE). The HMBC NMR spectrum revealed the presence of 14 carbons.

The carbon atoms at 178.2 ppm and 183.0 ppm were indicative of a 1,4-benzoquinone structure, and based on the predicted number of carbons, the compound was likely to be a naphthoquinone derivative, similar to javanicin. The three protons at δ 3.93 were attached to a carbon at 63.6 ppm, indicative of an O-methyl group and showed a three- bond correlation to a carbon at 160.6 ppm. The proton at δ 6.22, attached to a carbon at

110.0 ppm, had HMBCs to the quaternary carbons at 109.7 ppm, 178.2 ppm, and 183.0 133 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

ppm, indicating the carbons were part of the same ring. This information constructed the first partial structure (Figure 18A).

Figure 18 Partial structures of 9RF2.S-6G determined from HSQC and HMBC. Numbers in blue are the carbon chemical shifts, numbers in pink are proton chemical shifts, and arrows indicate HMBC.

134 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

The chemical shift of two CH2 protons at δ 5.23, which was correlated to a carbon at

63.6 ppm, indicated the presence of strong electronegative atom nearby, quite possibly an oxygen atom. HMBC of these protons showed three-bond correlations with quaternary carbons at 161.6 ppm and 132.9 ppm, and a two-bond correlation with a quaternary carbon at 122.9 ppm. Furthermore, HMBC of three protons at δ 2.02, which were attached to a carbon at 20.1 ppm, showed a two-bond correlation of the methyl group to the ring structure via a quaternary carbon at 161.6 ppm, and a three-bond correlation to the carbon at 94.9 ppm which was attached to a proton at δ 6.01. HMBC of this proton at δ 6.01 also showed correlations with a carbon at 132.9 ppm. A proton at δ 12.69, which suggested it was part of a hydroxyl group, has three-bond correlation to the carbon at 132.9 ppm. Combining these pieces of information resulted in the second partial structure (Figure 18B).

With the compound still requiring two carbon, one oxygen, and one hydrogen atoms, it is suggested that the two partial structures are connected by a benzene ring with two attached hydroxyl bonds. The remaining quaternary carbon at 110.9 ppm was assigned to the ring junction between the carbons at 107.9 ppm and 178.2 ppm. It was possible that the two carbons where the hydroxyl bonds were attached to may have the same chemical shifts. The compound was thus identified as anhydrofusarubin (IUPAC systematic name: 5,10-dihydroxy-7-methoxy-3-methyl-1H-benzo[g]isochromene-6,9- dione, Figure 19). The experimental carbon chemical shifts of this compound also agree with the calculated data generated using ChemBioDraw software (Table 23 in

Appendix 2).

135 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Anhydrofusarubin was first identified through chemical synthesis by heating fusarubin in glacial acetic acid (442). The first natural isolation of this compound was from an entomogenous Fusarium solani (443). It was then isolated from a number of epiphytic and endophytic Fusarium species (444, 445), and from the closely related

Neocosmospora vasinfecta (446) and Nectria haematococca (447). The crystal structure of this compound has also been described through X-ray diffraction analysis (448).

Similar to javanicin, anhydrofusarubin is biosynthesised during growth cessation at a pH lower than 4.0 (440). Biosynthesis of its parent compound fusarubin and other fusarubin derivatives have been extensively described, both via feeding studies (449) and through genetic analysis of their gene cluster (450), however no enzymatic reaction has been attributed to the conversion of the parent molecule to anhydrofusarubin, possibly due to the previous investigations being carried out under alkaline pH. It is known that the fusarubins are derived from an aldol-type cyclisation of a linear heptaketide (449, 450).

Figure 19 Structure of anhydrofusarubin.

136 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Table 14 NMR data for anhydrofusarubin (12) acquired in CDCl3 at 30°C 13C 1H Position 2J and 3J (δ) (δ, mult) CH CH 1 178.2 - - 2 160.2 - - 3 110.0 6.22 (s) C-1, C-2, C-4, C-4a 4 183.0 - - 4a 107.9 - - 5 157.8 - - 5a 122.9 - - 6 63.6 5.23 (s) C-5a, C-7, C-8a 7 161.6 - - 8 94.9 6.01 (d) C-5a, C-9, C-10 8a 132.9 - - 9 157.8 - - 9a 110.9 - - 10 20.1 2.02 (d) C-7, C-8 5-OH - 12.88 (s) - 9-OH - 12.88 (s) C-8a

2-OCH3 56.6 3.93 (s) C-2

In this study, javanicin and anhydrofusarubin were isolated through NMR-guided fractionation. This method was chosen as it was the best method for detecting polyketides in fungal samples. The best fractions were chosen based on the strong 1H-

NMR signals in the spectroscopy, particularly at the regions indicative of the presence of aromatic rings or amide bonds, which are indicative of fungal polyketides and peptides. The isolation of two polyketides is in line with the fact that this class of compounds is more commonly found in fungi than non-ribosomal peptides (349).

137 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

3.3.5 Antibacterial activity of the isolated compounds

The two compounds were subjected to bioassay against a number of bacterial test strains to determine their bioactivity and their corresponding minimum inhibitory concentration (MIC). Bacterial test strains for the bioassay were selected based on the activity exhibited by the crude extract from which the compounds were derived. The supernatant-derived crude extract of Fusarium sp. isolate 9RF2 showed antiproliferative activity against M. phlei and M. tuberculosis (see Table 11). To test the antibacterial spectrum of the active compounds, Staphylococcus aureus representing Gram-positive bacteria, E. coli representing Gram-negative bacteria, and Mycobacterium smegmatis representing non-pathogenic environmental mycobacteria were also chosen as test strains.

The resazurin colorimetric assay revealed that none of the pure compounds showed antiproliferative activity against E. coli and M. smegmatis at this concentration range.

Only javanicin was active against M. phlei and only anhydrofusarubin was active against S. aureus (Table 15). The two isolated Fusarium sp. compounds exhibited antiproliferative activity against M. tuberculosis with varying degrees of MIC (Table

15).

138 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

Table 15 Minimal inhibitory concentration (MIC) of the isolated compounds against five bacterial test strains M. Compound E. coli S. aureus M. phlei M. smegmatis tuberculosis 9RF2.S-6I n.a.a 25 µg mL-1 50 µg mL-1 n.a. 25 µg mL-1 9RF2.S-6G n.a. 50 µg mL-1 n.a. n.a. 50 µg mL-1 Note: an.a. = not active.

The results of the javanicin bioassay against M. phlei and M. tuberculosis are consistent with the published literature. Javanicin has been previously reported to be active against

M. phlei with an MIC of 50 µg mL-1. However, the study did not elaborate on the assay method or the test strain (435). The compound has been previously shown to be active

-1 against M. tuberculosis H37Ra with an MIC of 25 µg mL (430), using a modified green fluorescent protein microplate assay (180). These values are consistent with the data presented in this thesis. Another study on naphthoquinones from Fusaria, utilising broth microdilution assay against a human pathogenic strain Staphylococcus aureus

Rosenbach (Smith), showed javanicin inhibited bacterial growth with an MIC of 0.5 µg mL-1 (319). A similar study reported the MIC value of javanicin against Staphylococcus aureus as 20 µg mL-1 (451).

Anhydrofusarubin has also been tested for its antimicrobial activity. The same study on naphthoquinones from Fusaria revealed that the compound was active against human pathogenic strains Staphylococcus aureus Rosenbach (Smith) and Staphylococcus pyrogenes Rosenbach, with MIC values of 2 µg mL-1 and 8 µg mL-1, respectively (319).

Another study on anhydrofusarubin from soil-based Fusarium solani described its activity against M. smegmatis IMRU 24 with an MIC of 3 µg mL-1, against S. aureus

ATCC 6538P with an MIC of 50 µg mL-1, and against E. coli B PP 01 with an MIC of

75 µg mL-1 (452) using an agar microdilution assay in peptone-meat extract-glucose

139 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

medium (453). In a more recent study, anhydrofusarubin from a sea fan-derived

Fusarium strain was assayed using the green-fluorescent-protein (GFP) method (180)

-1 and shown to be active against M. tuberculosis H37Ra with an MIC of 25 µg mL (432).

Variations were found for the bioassay results against E. coli, S. aureus, and M. smegmatis between the present data and previous reports. This may due to differences in the growth inhibition detecting methods, different sensitivities of individual test strains, or the choice of growth media for the test strains. The significant differences between our MIC values against S. aureus and those from the studies by Baker et al. (319), and between our results against M. smegmatis and those from the studies by Ammar et al.

(452) are likely due to the solvent of choice. The previous studies utilised ethanol or dimethyl sulfoxide, which are known to have inhibitory effect towards bacteria (454).

More recent studies on these two naphthoquinones utilise deionised water as it has no reported inhibitory effects, and the compounds are water-soluble. The colorimetric assay employing oxidation-reduction indicator resazurin used in this study is advantageous for MIC value determination over other methods as it requires small sample amount, relatively inexpensive, and offer rapid, sensitive, reliable, and reproducible results.

Javanicin, anhydrofusarubin, and other naphthoquinones serve as biological defences for the host cell. Chemically, naphthoquinones act as pro-oxidants and electrophiles

(455). As pro-oxidants, the quinones transfer electrons from a biological reducing agent, such as NAPDH, to oxygen generating reactive oxygen species which oxidise functional groups on regulatory proteins (455). As electrophiles, quinones form irreversible covalent bonds with nucleophiles in an arylation reaction (455). Javanicin and

140 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

anhydrofusarubin, 1,4-naphthoquinone derivatives, acts primarily as an electrophile rather than a pro-oxidant due to its low redox potential (456).

In biological systems, naphthoquinones exert their auto-oxidative properties on target cells and act on key regulatory proteins by affecting cell signalling pathways that protect against oxidative stress and cellular damage. Naphthoquinones inhibit the aerobic decarboxylation of α-ketoglutarate and the anaerobic decarboxylation of pyruvate by reacting directly with thiamine pyrophosphate (457). The uncontrollable oxidation of NADH and NADPH by the naphthoquinones excludes these reducing equivalents from the oxidative phosphorylation system (458), decreasing ATP synthesis. The reactive oxygen species generated from the process can bind to and ultimately damage the DNA or RNA (459). Naphthoquinones have also been shown to inhibit glutathione reductase, disrupting the cellular response to oxidative stress (460).

The fungal host is protected from naphthoquinones by elevating its level of superoxidase dismutase and catalase, the two enzymes responsible for reducing the reactive oxygen species level during oxidative stress (461).

While javanicin and anhydrofusarubin have been previously isolated from a wide range of hosts, these results represent the first isolation of antimycobacterial compounds from

Rhoeo spathacea, a plant which has been traditionally used to treat symptoms of tuberculosis. These two compounds may contribute to the medicinal properties exhibited by the host plant and this provides strong scientific support for the medicinal use of this plant in traditional Indonesian culture. Furthermore, these findings also confirm our hypothesis that traditional medicinal plants are valuable sources of endophytes that produce bioactive compounds. It has also validated our combined

141 Isolation and Characterisation of Antimycobacterial Compounds from Fusarium sp.

bioactivity and genetics-based approach for the prioritisation of candidate endophytes for downstream chemical discovery.

3.4 Conclusion

This chapter presents the isolation, identification, and bioactivity profile of two endophytic compounds from Rhoeo spathacea. Javanicin and anhydrofusarubin represent two naphthoquinones which have been previously known to exhibit antimycobacterial activities, including against M. tuberculosis. This study showed that javanicin displayed antiproliferative activity against M. tuberculosis and S. aureus with an MIC of 25 µg mL-1, and against M. phlei with an MIC of 50 µg mL-1. Similarly, anhydrofusarubin exhibited bactericidal activity against M. tuberculosis and S. aureus with an MIC of 50 µg mL-1. The results of this chapter are largely consistent with the results of previous studies. While their biosynthetic gene clusters have not been identified, there have been a number of postulated theories on their biosynthesis based on feeding studies and biosynthesis of related compounds. This study is the first report on the isolation of antimycobacterial compounds from Rhoeo spathacea, a plant which has been traditionally used in Indonesia to treat symptoms of tuberculosis. The findings in this study strongly support the traditional use of the plant, and suggest that the compounds may play an important role in the medicinal properties exhibited by the host plant. This investigation also supports the notion that genetic screening for the presence of NRPS and PKS encoding genes assists in detecting endophytes capable of synthesising bioactive compounds.

142

Chapter 4

ISOLATION AND

CHARACTERISATION OF

ANTIMYCOBACTERIAL

COMPOUNDS FROM ENDOTHIA sp.

143 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

Summary

An endophyte Endothia sp. 11UF1 was isolated from Brucea javanica, an Indonesian medicinal plant used to treat lung illnesses, including symptoms of tuberculosis. This isolate had PKS and NRPS biosynthetic genes and exhibited bactericidal activity against

M. tuberculosis H37Ra. Bioassay-guided and NMR-guided fractionation of the crude extracts led to the isolation of acropyrone (13) and compound 11UF1.S-5D6B (15). The two compounds exhibited moderate but specific activity against M. tuberculosis, with the MIC of 50 µg mL-1 for acropyrone and 100 µg mL-1 for compound 11UF1.S-5D6B.

This is the first report of antitubercular compounds from Endothia sp.

144 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

4.1 Introduction

Isolation of two polyketides from an endophyte of a traditional medicinal plant described on the previous chapter highlights the importance of fungal endophytes as sources of bioactive metabolites. This investigation of natural products continued with an Endothia sp. isolate from Brucea javanica. The plant has been extensively studied, and an abundance of natural products have been isolated, including some pregnane glycosides (462), indole-type alkaloids (463), and sesquiterpenes (464). It has also been established that its main constituents are the tetracyclic triterpenes quassinoids (465), which have displayed a wide range of biological activity, including anticancer (466), antitumour (467), antibabesial (468), antiviral (469, 470), antimalarial (471), and antitubercular (472).

In contrast, only a handful of secondary metabolites have been isolated and characterised from the Endothia sp. A number of cytochalasins, namely cytochalasin H, cytochalasin J, epoxycytochalasin H, cytochalasin Z10, and cytochalasin Z11, have been isolated from Endothia gyrosa, an endophyte of Vatica mangachapo (271). These compounds were cytotoxic to the human leukaemia K562 cell line with IC50 values of between 1.5-28.3 μM (0.68-13.2 μg mL-1), lower than 30 μM (3.9 μg mL-1) of the commercial 5-fluorouracil (271). Cytochalasins are biosynthesised by a hybrid

PKS/NRPS pathway (473), although no investigation has been carried out on cytochalasin biosynthesis in Endothia species. Several other metabolites have been isolated, such as endothiapepsin (474), oxalic acid (475), and pigments (+)-rugulosin and skyrin (476), although the fungal producers which were thought to be Endothia

145 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

species have been re-classified to a new genus Cryphonectria (477) and no bioactivity study has been carried out on these compounds.

This chapter focuses on an isolate of Endothia that had both PKS and NRPS genes and whose crude extract had bactericidal effects against M. tuberculosis H37Ra. The compounds were purified using a combination of bioassay-guided and NMR-guided fractionation. The isolation, chemical structure elucidation, and biological activity of the compounds are presented.

4.2 Materials and Methods

4.2.1 Large scale culture of Endothia sp.

The isolate Endothia sp. 11UF1 was cultured at a large scale for compound purification.

A small (2 mm × 2 mm) piece of the agar culture was aseptically excised from the plate, transferred to 100 mL of malt extract broth (Difco) and grown for 7 days at 30°C with shaking at 100 rpm. This starter culture was then transferred in to 10 L of malt extract broth (Difco) for a further 28 days at 30°C with shaking at 100 rpm.

4.2.2 Chemical extraction of Endothia sp.

The 28-day-old cultures were filtered through cheesecloth to remove fungal mycelia, and approximately 40 g of sterilised Amberlite XAD-7HP resin (Sigma-Aldrich) was added to the filtrate to adsorb the fungal metabolites. The resin was collected 24 h later by filtration and the crude extract was eluted with ethyl acetate. The organic solvent was dried over anhydrous MgSO4 (Sigma-Aldrich), transferred by filtration to a pre-weighed

146 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

scintillation vial, and evaporated to dryness under reduced pressure using a rotary evaporator. The crude extract was weighed and stored at -20°C until further use.

4.2.3 Antitubercular bioassay on Endothia sp. fractions

A modified resazurin microtiter plate assay (REMA) method (434) in Middlebrook 7H9 medium with 0.2% glycerol supplemented with oleic acid, albumin, dextrose, and catalase (Becton-Dickinson) was employed to screen the collected crude extract and fractions for antiproliferative activity against M. tuberculosis H37Ra, as per the protocol described in Section 3.2.6.

4.2.4 Fractionation of crude extract

The crude extract was fractionated on Sephadex LH-20 (Pharmacia Biotech) using the protocol described before (see Section 3.2.3). The resulting fractions were examined by normal phase thin layer chromatography on silica gel 60 F254 plates (Merck) visualised under UV light at 254 and 280 nm, then by 1H NMR using deuterated methanol

(CD3OD, Cambridge Isotope Laboratories). These fractions were also subjected to the antitubercular bioassay as per the protocol described in Section 4.2.3. This step was carried out twice. Fraction 11UF1.S-5D, the active component from these LH-20 separations, was chosen for High Performance Liquid Chromatography (HPLC) purification (Figure 20). This process yielded two active fractions 11UF1.S-5D5 and

11UF1.S-5D6. Both fractions were subjected to another HPLC purification which yielded pure compounds 11UF1.S-5D5D and 11UF1.S-5D6B (Figure 20).

147 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

4.2.5 HPLC separation and purification

4.2.5.1 Fractions 11UF1.S-5D5 and 11UF1.S-5DB

HPLC was performed using a Hewlett Packard 1100 series HPLC with UV detections at

254 and 280 nm. Separation was achieved with a Discovery® BIO Wide Pore C18

(10.00 × 250 mm, 5 micron) reversed phase column (Supelco Analytical), employing a gradient of A (0.01% trifluoroacetic acid, Sigma-Aldrich) and B (100% acetonitrile,

Ajax Finechem) as follows: 5% B as initial condition, followed by a linear increase of solvent B to 100% in 50 min then held for 10 min; followed by a linear decrease of solvent B to 5% in 10 min, and held for 10 min prior to the next run. The flow rate was kept at 2.5 mL min-1. Major peaks were collected, and the resulting fractions were

1 examined by H NMR using deuterated methanol (CD3OD, Cambridge Isotope

Laboratories), and subjected to the antitubercular assay as per the protocol described in

Section 4.2.3.

4.2.5.2 Compound 11UF1.S-5D5D

HPLC was carried out using a Hewlett Packard 1100 series HPLC with UV detections at 254 and 280 nm. Separation was achieved with a Zorbax SB-C18 (4.6 × 250 mm, 5 micron) reversed phase analytical column (Agilent Technologies), employing a gradient of A (0.01% trifluoroacetic acid, Sigma-Aldrich) and B (100% acetonitrile, Ajax

Finechem) as follows: 0% B as initial condition, followed by a linear increase of solvent

B to 100% in 30 min then held for 5 min; followed by a linear decrease of solvent B to

0% in 5 min, then held for 5 min prior to the next run. The flow rate was kept at 1.1 mL min-1. The purified compound was analysed by NMR and MS as per the protocol

148 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

described in Section 3.2.5, and its antibacterial and antimycobacterial activities were determined via broth dilution assay (see Section 3.2.6).

4.2.5.3 Compound 11UF1.S-5D6B

HPLC was performed using a Hewlett Packard 1100 series HPLC with UV detections at

254 and 280 nm. Separation was achieved with a Zorbax SB-C18 (4.6 × 250 mm, 5 micron) reversed phase analytical column (Agilent Technologies), employing a gradient of A (0.01% trifluoroacetic acid, Sigma-Aldrich) and B (100% acetonitrile, Ajax

Finechem) as follows: 5% B as initial condition, followed by a linear increase of solvent

B to 100% in 20 min then held for 5 min; followed by a linear decrease of solvent B to

5% in 10 min then held for 10 min prior to the next run. The flow rate was kept at 1.1 mL min-1. The purified compound was analysed by NMR and MS as per the protocol described in Section 3.2.5, and its antibacterial and antimycobacterial activities were determined via broth dilution assay (see Section 3.2.6).

4.3 Results and Discussion

4.3.1 Fractionation of Endothia sp. crude extract

An Endothia sp. strain exhibiting antiproliferative activity against M. tuberculosis was cultured at a large scale for compound purification. The fractionation and compound isolation were carried out using a combination of bioassay-guided and NMR-guided approaches (Figure 20). The chemical extraction of the supernatant of this liquid culture yielded 3.013 g of crude extract, which was then subjected to size-exclusion liquid chromatography using LH-20 resin. Eleven distinct bands were separately

149 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

collected and they were tested for their bioactivity against M. tuberculosis. It was revealed that activity was only exhibited by fraction 11UF1.S-5, which eluted between

60-70 min.

Considering the large amount of the active fraction (457.7 mg), it was once again subjected to size-exclusion liquid chromatography using LH-20, through which 4 distinct bands were separately collected. The antitubercular bioassay on these four fractions showed that the activity was concentrated on fraction 11UF1.S-5D, eluting between 18-33 min. This fraction (183 mg) was then fractionated using HPLC, utilising a semi-preparative reverse-phase column. Nine major peaks were collected from this process and all were tested against M. tuberculosis. Two fractions, 11UF1.S-5D5

(eluting at 19.7 min) and 11UF1.S-5D6 (eluting at 22.6 min) exhibited antiproliferative activity against the mycobacterium. The 1H-NMR analysis showed that both fractions still contained more than one major compound.

Fraction 11UF1.S-5D5 (12.3 mg) was separated via HPLC using an analytical reverse- phase column. Six major peaks were collected and assessed for purity by 1H NMR analysis. Compound 11UF1.S-5D5D (1.3 mg, eluting at 14.3 min) was deemed pure and thus selected for 2D NMR analyses. Similarly, fraction 11UF1.S-5D6 (7.9 mg) was separated on HPLC using an analytical reverse-phase column. The five dominant peaks were collected and through 1H NMR analysis, compound 11UF1.S-5D6B (1.5 mg, eluting at 12.6 min) was selected for 2D NMR analyses.

150 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

Isolate 11UF1 from the root of Brucea javanica

EtOAc MeOH/DCM extraction extraction

11UF1.S 11UF1.B (supernatant) (biomass)

Active against Inactive against M. tuberculosis M. tuberculosis

LH-20 column fractionation (11 fractions)

11UF1.S-5

Active against M. tuberculosis

LH-20 column fractionation (4 fractions)

11UF1.S-5D

Active against M. tuberculosis

HPLC C18 column fractionation (9 fractions)

11UF1.S-5D5 11UF1.S-5D6

Active against Active against M. tuberculosis M. tuberculosis

HPLC C18 column HPLC C18 column fractionation fractionation (6 fractions) (5 fractions)

11UF1.S-5D5D 11UF1.S-5D6D

Figure 20 Isolation and purification of compounds from Endothia sp.

151 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

4.3.2 Structure elucidation of compound 11UF1S-5D5D

The positive ion high resolution Fourier Transform mass spectrum (HRFTMS) displayed a sodiated molecular ion [M+Na]+ peak at m/z 247.05727 (247.05769 calc, Δ

1.70 ppm). The calculated best-fit empirical formula of this compound was C11H12O5, requiring 6 rings or double-bond equivalents (RDBE). The HMBC NMR spectrum revealed the presence of 11 carbons.

The 1H NMR indicated the presence of 3 methyl groups (δ 1.99, 2.43, and 3.97). The protons at δ 2.43 were attached to a carbon at 13.6 ppm, and showed HMBCs to quaternary carbons at 144.6 ppm, 157.2 ppm, and 169.0 ppm. Furthermore, the proton at

δ 6.80, attached to carbon at 118.7 ppm, also showed HMBCs to the same quaternary carbons, in addition to a correlation to the methyl group at 13.6 ppm. The methyl doublet at δ 2.43 showed a long range coupling (1.1 Hz) to a doublet at δ 6.80. No other protons showed HMBC to carbon at 169.0 ppm, suggesting that this carbon corresponded to a terminal carboxylic acid. The absence of the proton of this carboxylic acid was due to the hydroxyl proton being exchanged with residual water.

The arrangement of the methyl group and the two quaternary carbons at 144.6 ppm and

157.2 ppm was determined by the correlations from the proton at δ 6.55. This proton, attached to a carbon at 97.0 ppm, had HMBCs with carbons at 144.6 ppm, 157.2 ppm,

106.2 ppm, and 165 ppm. The first two carbons were correlated with the previous partial structure, indicating that this protonated carbon was situated near the junction between the two parts of the compound. As this proton did not have HMBC correlation to carbon at 118.7 ppm, it was determined that the methyl was attached at the carbon

152 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

two bonds away from the carbon at 169.0 ppm, forming the partial structure A (Figure

21A).

Figure 21 Partial structures of 11UF1.S-5D5D determined from HSQC and HMBC. Numbers in blue are the carbon chemical shifts, numbers in pink are proton chemical shifts, and arrows indicate HMBC.

The protons at δ 3.97 were attached to a carbon at 56.3 ppm, indicative of an O-methyl group and showed three-bond correlation to a carbon at 165.1 ppm. The protons at δ

1.99 were attached to a carbon at 8.8 ppm, and the protons showed HMBCs to the

153 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

quaternary carbons at 164.9 ppm, 106.2 ppm, and the protonated carbon at 97.0 ppm.

The chemical shifts and correlations suggested that the carbons at 97.0 ppm, 106.2 ppm,

164.9 ppm, and 165.1 ppm belonged to a closed-ring structure. Taking the number of predicted atoms into consideration, the carbon at 164.9 ppm was suggestive of a lactone and the previous partial structure was attached to the ring at the carbon between the carbon at 97.0 ppm and the oxygen from the lactone component (Figure 21B).

The two partial structures A and B were combined, and the chemical shift of the connecting carbon was assigned at 157.2 ppm. The compound was then identified as the polyketide derived acropyrone (IUPAC systematic name (E)-3-(4-methoxy-3-methyl-2- oxo-2H-pyran-6-yl)but-2-enoic acid, Figure 22). The experimental carbon chemical shifts of this compound are in line with the calculated data generated using

ChemBioDraw software (Table 23 in Appendix 2).

Figure 22 Structure of acropyrone.

154 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

Table 16 NMR data for acropyrone (13) acquired in CDCl3 at 30°C 13 1 C H 2 3 4 Position JCH, JCH, JCH (δ) (δ, mult, Jab) 2 164.9 - - 3 106.2 - - 4 165.1 - - 5 97.0 6.55 (s) C-3, C-4, C-6, C-7 6 157.2 - - 7 144.6 - - 8 118.7 6.80 (d, 1.1 Hz) C-6, C-7, C-9, C-12 9 169.0 - - 10 8.8 1.99 (s) C-2, C-3 11 56.3 3.97 (s) C-4 12 13.6 2.43 (d, 1.1 Hz) C-6, C-7, C-8, C-9

Moreover, another compound convolvulopyrone (14), which was first isolated from a pathogenic fungus Phomopsis convolvulus (478), had a very similar structure to acropyrone (Figure 23). Both Endothia and Phomopsis belong to the family

Diaporthales, however, NMR data comparison verified that this compound was indeed acropyrone. Long range correlation between H-5 and H-7 in convolvulopyrone was not observed in acropyrone. Also, HMBC observed for H-5 (δ 6.55) to C-6 and C-7 but not

C-8 (Table 16) confirmed the attachment of the methyl group at C-7, not C-8 as in convolvulopyrone.

Figure 23 Structure comparison between acropyrone (13) and convolvulopyrone (14). 155 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

This is the first isolation of acropyrone from an Endothia species. The compound has only been reported from mangrove-derived endophytic fungus Acremonium strictum

(479), a member of the Glomerrelales order. The ability of two distantly related fungi to produce acropyrone could be a consequence of a horizontal gene transfer of the biosynthetic gene cluster or a result of independent evolution. Horizontal gene transfer has been previously reported in fungi, where a fungal hybrid PKS/NRPS gene cluster was transferred between Magnaporthe and several other distantly related fungal genera

(339). On the other hand, genome comparison between several fungal genera which produced the anticancer agent paclitaxel revealed minimal similarities between their terpene synthases, suggesting the ability of these fungi to biosynthesise the secondary metabolite was independently developed (56). Genome sequencing of this isolate would provide a valuable insight to the biosynthesis of this polyketide, and might lead to the discovery of other potentially active secondary metabolites.

This is also the first of acropyrone NMR data acquired using deuterated chloroform

(CDCl3) as the solvent. Previously NMR data was collected using DMSO-d6 as the solvent (479).

4.3.3 Structure elucidation of compound 11UF1S-5D6B

The 1H NMR indicated the presence of a proton signal at δ 11.54, which corresponded to a hydroxyl group. This proton had HMBCs to quaternary carbons at 108.0 ppm and

160.3 ppm, and a protonated carbon at 110.5 ppm, suggesting the hydroxyl group was attached to a ring system. Moreover, the proton at δ 6.54, attached to the carbon at 110.5 ppm, showed COSY correlation to another proton at δ 7.45, which was attached to a

156 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

carbon at 138.6 ppm. The proton at δ 6.54 showed HMBCs to carbons at 108.0 ppm, and 160.3 ppm, while the proton at δ 7.45 showed three-bond correlation to carbons at

153.8 ppm and 160.3 ppm, and two-bond correlation to a quaternary carbon at 111.0 ppm. Assuming this is a six-membered ring, these pieces of information created the first partial structure (Figure 25A).

A B

Figure 24 Partial structures of 11UF1.S-5D6B determined from HSQC and HMBC. Arrows indicate HMBC, numbers in blue are the carbon chemical shifts, and numbers in pink are proton chemical shifts.

Moreover, the three protons at δ 1.29, attached to a carbon at 20.7 ppm, were indicative of a methyl group. This proton showed HMBCs to carbons at 29.6 ppm, 36.3 ppm, and

86.4 ppm. The proton at δ 4.35, attached to the carbon at 86.4 ppm, had HMBCs to carbons at 20.7 ppm, 29.6 ppm, 38.2 ppm, 62.7 ppm, 176.0 ppm. This protonated carbon at 86.4 ppm suggested the presence of an electronegative atom, likely an oxygen, adjacent to it. The protons at δ 2.24 and δ 3.04 were both attached to a carbon at 36.3 ppm, and both protons showed HMBCs to carbons at 20.7 ppm, 29.6 ppm, 86.4 ppm, 157 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

and 176.0 ppm. The correlations between carbons at 20.7 ppm, 29.6 ppm, 36.3 ppm,

86.4 ppm, and 176.0 ppm, suggested that this partial structure was a methyl attached to a five-membered lactone (Figure 25B).

A proton at δ 3.95, attached to a carbon at 62.7 ppm, had HMBCs to carbons at 38.2 ppm, 83.6 ppm, and 86.4 ppm. Furthermore, there were also two protons at δ 2.93 and and δ 3.09, both attached to a carbon at 38.2 ppm. These protons had HMBCs to carbons at 62.7 ppm, 83.6 ppm, 86.4 ppm, 108.0 ppm, and 195.5 ppm, suggesting this fragment connected the two previous partial structures. The chemical shift of the quaternary carbon at 195.5 ppm suggested it was a carbonyl and located adjacent to the carbon at 108.0 ppm from partial structure A. The quaternary carbons at 83.6 ppm and

153.8 ppm from partial structure A could be connected by an oxygen atom. This information was indicative of a second ring structure which was connected to the lactone, excluding the carbon at 62.7 ppm (Figure 25C).

158 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

Figure 25 Proposed partial structures of 11UF1.S-5D6B determined from HSQC and HMBC. Arrows indicate HMBC, numbers in blue are the carbon chemical shifts, and numbers in pink are proton chemical shifts.

Based on the HSQC and HMBC, the remaining atoms attached to the carbons at 111.0 ppm and 67.2 ppm could not been assigned. Considering the chemical shifts of these two carbons, it is proposed that the atoms were halogens, either bromine or chlorine

(Figure 26). The lack of reliable mass spectrometry data has hindered a conclusive decision on the compound structure. Cluster of the molecular ion did not clearly indicate dihalogenation of the compound. This might be due to the chemical stability of the compound, or the interference from impurities in the sample, as indicated from the

NMR spectra. Halogenating enzymes and other natural halogenating mechanisms have also been characterised from fungal sources, and the most common types of natural halogenation are chlorination and bromination (480). While halogenated polyketides are more commonly encountered in marine fungi (481), there have been several reports on the halogenation of polyketides from non-marine derived fungi, including from plant endophytes (482-484).

159 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

Figure 26 Proposed structure of 11UF1.S-5D6B, where X = Cl or Br.

Table 17 NMR data for 11UF1.S-5D6B (15) acquired in CDCl3 at 30°C 13 1 C H 2 3 4 Position COSY JCH, JCH, JCH (δ) (δ, mult, Jab, Jbc) 1 160.3 - - - 2 110.5 6.54, d, 8.93 Hz C-3 C-1, C-4, C-10 3 138.6 7.45, d, 9.23 Hz C-2 C-1, C-4, C-5 4 111.0 - - - 5 153.8 - - - 7 83.6 - - - 8 38.2 2.93, d, 17.4 Hz - C-7, C-9, C-10, C-11, C-17 3.09, d, 17.4 Hz 9 195.5 - - - 10 108.0 - - - 11 86.4 4.35, d, 4.1 Hz - C-8, C-12, C-14, C-16, C-17 12 29.7 1.28, m - - 13 36.3 2.24, dd, 18.7 Hz, 4.8 Hz - C-11, C-12, C-14, C-16 3.04, dd, 17.8 Hz, 2.4 Hz 14 176.0 - - - 16 20.7 1.29, d, 8.45 Hz - C-11, C-13 17 62.7 3.95, d, 3.11 Hz - C-7, C-8, C-11 1-OH - 11.54, s - C-1, C-2, C-10

160 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

A literature search revealed similar compounds paecilin A (16) and its monomer paecilin B (17) which were isolated from a mangrove endophytic fungus Paecilomyces sp. (485). Our NMR data did not support the presence of a dimer or methoxy functional groups, hence the compound is different from the reported paecilins.

Figure 27 Structures of paecilin A (16) and paecilin B (17).

4.3.4 Antibacterial activity of the isolated compounds

The compounds isolated in this study were subjected to bioassays against a number bacterial test strains to determine their minimum inhibitory concentration (MIC). The compounds were tested against E. coli, and M. phlei and M. tuberculosis based on the activity of the crude extracts (see Table 11). To test their antiproliferative activity spectrum, the compounds were also tested against the Gram-positive Staphylococcus aureus and another mycobacterium M. smegmatis. This is the first time Endothia compounds have been tested for antimycobacterial activity.

161 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

Both compounds showed specific activity against M. tuberculosis, with no other bacterial test strains affected upon exposure of the compounds. Acropyrone had an MIC of 50 µg mL-1 while compound 11UF1.S-5D6B had an MIC of 100 µg mL-1. The first report on acropyrone also tested its activity against S. aureus but was found to be inactive (479). This is the first report of antitubercular compounds from Endothia sp.

These bioactivity results are promising as the compounds specifically targeted M. tuberculosis. A number of other α-pyrone derivative compounds have been shown to be bioactive. The pyrones (-) pestalotin and its derivative (S)-4-butoxy-6-((S)-1- hydroxypentyl)-5,6-dihydro-2H-pyran-2-one, isolated from Phomopsis amygdali, was shown to exhibit cytotoxicity against three cancer cell lines with IC50 values between

11.8–132.2 µg mL-1 (486). Similarly, nigerapyrones B and E, isolated from endophytic

Aspergillus niger, also displayed cytotoxic activities against tumour cell lines (487).

Nigerapyrone B showed cytotoxicity against the HepG2 cell line with an IC50 of 19.8 μg mL-1, while nigerapyrone E displayed cytotoxicities against SW1990, MDA-MB-231,

-1 -1 -1 and A549 cell lines with IC50 values of 79.1 μg mL , 99.9 μg mL , and 89.4 μg mL , respectively (487). Two α-pyrone derivatives pseudopyrines A and B exhibited

-1 antitubercular activities against M. tuberculosis H37Rv with MIC of >20 μg mL and 25

μg mL-1 respectively when grown in rich 7H9 media, and MIC of 3.125 μg mL-1 and

1.56 μg mL-1 respectively when grown in low nutrient GAST media (488).

These observations indicate the potential of α-pyrones as antitubercular agents.

Derivatives of these compounds could be synthesised to increase its efficacy on the pathogenic bacterium. For example, a natural product carbazole clausine K had an MIC of 100 µg mL-1 (489) and another carbazole micromeline had an MIC of 31.5 µg mL-1

162 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

(490). A number of carbazole derivatives have been synthesised and one derivative, carbazoquinocin C, exhibited antitubercular activity with an MIC of 11 µg mL-1 (491).

Furthermore, derivatives of the pseudopyrines have also been synthesised, and one compound 3-hexanoyl-4-hydroxy-6-pentyl-2-pyrone, exhibited antitubercular activity

-1 against M. tuberculosis H37Rv with an MIC of 5 μg mL when grown in rich 7H9 media, and 0.78 μg mL-1 when grown in low nutrient GAST media (488).

The two compounds from Endothia sp. were isolated using a combination of bioassay- guided and NMR-guided fractionation. Repeated testing of each fraction for activity against M. tuberculosis focused the isolation of antitubercular compounds. Furthermore, the amount of material extracted and fractionated was sufficient to carry out the bioassays. Combination of these two approaches directed the isolation towards potentially novel antitubercular polyketides.

4.4 Conclusion

This chapter described the isolation, identification, and bioactivity profile of two endophytic compounds from Brucea javanica. Both compounds displayed specific activity against M. tuberculosis. Acropyrone had an MIC of 50 µg mL-1, and the benzopyranone-derivative compound 11UF1.S-5D6B had an MIC of 100 µg mL-1.

Isolation of acropyrone from a distantly-related fungal genus generates interest in investigating its PKS biosynthetic pathway. This study adds to the library of compounds isolated from Endothia sp. and adds to the library of antitubercular compounds from the plant Brucea javanica, which has been traditionally used in Indonesia to treat lung disease. Again, PKS and NRPS genetic screening has assisted in the detection of

163 Isolation and Characterisation of Antimycobacterial Compounds from Endothia sp.

endophytes capable of synthesising bioactive metabolites and a combination of bioassay-guided and NMR-guided fractionation has directed the discovery of antitubercular polyketides.

164

Chapter 5

GENERAL DISCUSSION

165 General Discussion

5.1 Research Motivation and Objectives

Tuberculosis (TB) is a potentially deadly infectious disease caused by mycobacteria, mainly Mycobacterium tuberculosis. The rapid emergence of multidrug-resistant TB

(MDR-TB), extensively drug-resistant TB (XDR-TB), and totally drug-resistant TB

(TDR-TB) cases has driven the discovery of new drug leads from natural sources, particularly rarely encountered microorganisms. Traditional medicinal plants have long been investigated as sources of bioactive molecules, many of which are polyketides or non-ribosomal peptides. It is established that natural products from these structural classes are biosynthesised by microorganisms, therefore it is hypothesised that many of these bioactive molecules originally isolated from plants are in fact microbial products.

Thus a genetic-based screening program of culturable endophytes was initiated to identify strains capable of producing bioactive polyketides and peptides.

The rich biodiversity and traditional history of Indonesia make it an attractive target for the discovery of novel therapeutic compounds from medicinal plants and their endophytic fungi. Reports on endophyte communities of traditional Indonesian medicinal plants are sparse, and thus represent an under investigated source of microbial natural products. Therefore, the general aim of this thesis was to bioprospect for novel antitubercular compounds from endophytes isolated from traditional Indonesian medicinal plants used to treat symptoms of tuberculosis. Specifically, this thesis aimed to isolate and identify endophytes from selected medicinal plants (Chapter 2), to assess their biosynthetic potential through screening for genes involved in the biosynthesis of polyketides and non-ribosomal peptides (Chapter 2), to determine the bioactivity profile of their organic crude extract particularly against M. tuberculosis (Chapter 2), and to

166 General Discussion

isolate and elucidate the structure of antitubercular compounds (Chapters 3 and 4). It was hypothesised that these particular medicinal plants host endophytes capable of producing antitubercular compounds.

5.2 Key Findings

5.2.1 Biological diversity of the bacterial and fungal endophytes

Twelve medicinal plants were collected from five different locations around the provinces of Jakarta, Banten, and West Java, Indonesia. The microbial communities isolated from these plants included a range of phylogenetically distinct bacteria and fungi, including members of at least 20 bacterial and 20 fungal genera. All classified bacterial and fungal genera in this study have been previously isolated as endophytes.

Nevertheless, the phylogenetically diverse microorganisms isolated in this study are indicative of a wide spectrum of metabolic profiles as co-habitation within the plant host increases the likelihood of microbial interactions (492). This is the first comprehensive report of endophyte diversity from Indonesian medicinal plants traditionally used to treat symptoms of tuberculosis. It is also the first reported study on bacterial endophyte diversity from these plants, except for Lantana camara, and the first endophyte diversity study of the plant species Nasturtium indicum, Vitex trifolia, and

Rhoeo spathacea.

5.2.2 Biosynthetic potential of the bacterial and fungal endophytes

167 General Discussion

The diversity of these isolated microbial endophytes required the need for strain prioritisation to increase the chance of isolating novel bioactive compounds. The first strategy was to assess the endophytes for their biosynthetic potential. This was carried out via screening by PCR amplification of genes encoding for non-ribosomal peptide synthetase (NRPS) and polyketide synthase (PKS), which are responsible for the biological production of non-ribosomal peptides and polyketides, respectively. It was found that 84% of the bacterial isolates and 94% of the fungal isolates possessed either

PKS or NRPS genes, suggesting these endophytes had high biosynthetic potential, thus supporting the use of these plants as traditional medicine. Moreover, 55% of bacterial and 59% of fungal endophyte isolates each had both PKS and NRPS genes, indicating a high possibility of more diverse secondary metabolites which also include hybrid compounds.

5.2.3 Bioactivity profile of the fungal endophytes

The abundance of PKS and NRPS genes in these endophytes leads to a second strategy of specific bioassay that was required to prioritise the strains for active compound isolation. Fungal endophytes, which had greater biosynthetic potential in this study, were tested against Gram-negative, Gram-positive, and mycobacterial species, including

M. tuberculosis. Briefly, 62 out of 76 fungal isolates inhibited the growth of at least one bacterial test strain. Of these, 20 fungal isolates exhibited antiproliferative activity against E. coli, 15 against P. aeruginosa, 17 against S. aureus, 50 against M. phlei, 4 against M. avium, and 4 against M. tuberculosis. A total of 29 isolates had specific activity against one test strain, while 33 others displayed a broader antibacterial

168 General Discussion

spectrum. These results highlighted the potential of these culturable endophytes in producing antibacterial compounds.

Furthermore, these results suggested that the presence of PKS and NRPS biosynthetic genes increased the likelihood of an isolate exhibiting bioactivity, in line with a number of previous studies (205, 322-324). Eighty three percent of the fungal endophyte with

PKS or NRPS genes inhibited the growth of at least one test strain. Yet, two out of 4 isolates which did not have PKS or NRPS genes also displayed antiproliferative activity, suggesting the activity might come from other classes of secondary metabolites. Previous investigations have also shown that bioactivity was displayed by isolates lacking PKS or NRPS genes (205, 308, 392, 393). Similarly, the 12 isolates with PKS or NRPS genes which did not exhibit antiproliferative activity against any of the bacterial test strain might still display bioactivity against other test strains or cell lines not described in this study.

5.2.4 Antitubercular compounds from Fusarium sp.

Chemistry-based investigation of Fusarium sp. 9RF2 resulted in the isolation, structure elucidation, and bioactivity profile of the polyketide naphthoquinones javanicin and anhydrofusarubin (Chapter 3). This showed that javanicin displayed antiproliferative activity against M. tuberculosis and S. aureus with an MIC of 25 µg mL-1, and against

M. phlei with an MIC of 50 µg mL-1. Similarly, anhydrofusarubin exhibited bactericidal activity against M. tuberculosis and S. aureus with an MIC of 50 µg mL-1. The results of this chapter are largely consistent with the results of previous studies (430, 432, 435).

This study is the first report of the isolation of antimycobacterial compounds from

169 General Discussion

Rhoeo spathacea, supporting the plant’s traditional use to treat symptoms of tuberculosis.

5.2.5 Antitubercular compounds from Endothia sp.

The investigation into Endothia sp. 11UF1 resulted in the isolation, structure elucidation, and bioactivity profile of polyketide acropyrone and novel benzopyranone- derivative compound 11UF1.S-5D6B (Chapter 4). This is only the second report of isolation of acropyrone, and the fungal producers of this compound belong to different taxonomic orders (479). This generates interest on its biosynthetic pathway regarding the possible evolutionary lineage between the gene clusters. Both compounds displayed specific activity against M. tuberculosis, with acropyrone exhibiting an MIC of 50 µg mL-1, and the novel second compound displaying an MIC of 100 µg mL-1. This is the first report of antimycobacterial activity from Endothia sp. secondary metabolites.

These two compounds add to the library of Endothia compounds, and the library of antitubercular compounds from Brucea javanica.

5.3 Future Directions

5.3.1 Determining the active compounds’ mode of action

Following active compound isolation, the next progressive step is to identify its mode of action on M. tuberculosis. This can be achieved through affinity chromatography (493,

494), or through cell-based affinity tagging (495). Alternatively, in order to thoroughly investigate the complexity of drug-target interactions, more powerful techniques, such as whole genome expression profiling using microarray technology (496) or genome

170 General Discussion

sequencing of the resistant microbe (165), could be utilised. Identifying specific biomolecular targets whereby the drug exerts its pharmacological effects will establish a structure-activity profile. This will assist in identifying or revisiting previously characterised molecules with similar structure for their activity against M. tuberculosis or in tailoring the drug candidate to increase its efficacy against the pathogenic microbe

(497).

5.3.2 Whole genome sequencing of the bioactive isolates

The polyketide compounds isolated in this investigation have generated interest in exploring the biosynthetic machineries behind their production. While some intermediate compounds of the isolated polyketides in our study have been previously identified through feeding studies (441, 449), a deeper understanding of the biosynthetic pathways at the genetic level will be useful for downstream genetic modification to generate compound derivatives which have better activity against M. tuberculosis.

Whole genome sequencing of the fungal strains can be carried out to identify the PKS gene clusters (498, 499). Online databases such as AntiSMASH are available to predict the structure of the polyketides based on the biosynthetic gene cluster (500, 501), and this could then be matched with the isolated compounds. This information could then be utilised to generate novel derivatives by genetic engineering through cloning and site- directed mutagenesis of the PKS acyltransferase domain which are responsible for substrate specificity (502, 503).

Furthermore, whole genome sequencing of the active isolates would also potentially identify other biosynthetic gene clusters which are not naturally expressed. Activating

171 General Discussion

cryptic secondary metabolite gene clusters, possibly via heterologous expression of the genes controlled by characterised promoters (504) or through promoter exchange of the biosynthetic genes (505), may result in access to novel compounds.

5.3.3 Exploring uncultured microorganisms from the medicinal plants

This investigation supports the notion that traditional medicinal plants host endophytes which are capable of producing bioactive compounds. It has successfully explored the culturable endophytes, however, it is generally agreed that that most microorganisms are unculturable under laboratory conditions (506). These unculturable microorganisms might host a plethora of potentially novel biosynthetic pathways which are otherwise not detectable. Construction of a metagenomic environmental DNA library from the plants using high-throughput sequencing technology may be able to identify these novel biosynthetic pathways (507-509).

Alternatively, cultivation in diffusion chambers in natural environment (510) or prolonged incubation in vitro (511) could result in isolation of previously uncultured microorganisms. These techniques have been proven successful in the isolation of a

Lentzea kentuckyensis capable of producing lassomycin, a ribosomally synthesised cyclic peptide which targets a M. tuberculosis ATP-dependent protease (512).

Moreover, the discovery of teixobactin, a novel antibiotic which potently inhibits bacterial cell wall synthesis, from a previously uncultured β-proteobacteria (513), credited the use of ichip technology (309) which was based on these principles. In short, an investigation of these uncultured microorganisms is sure to discover further biosynthetic potential in medicinal plants and their endophytes.

172 General Discussion

5.4 Concluding Remarks

The aim of this thesis was to bioprospect for antitubercular endophytic natural products from Indonesian traditional medicinal plants. In this thesis, we have successfully bridged traditional medicinal knowledge and modern medicine (Figure 1). The thesis started with exploration on the ethnobotanical knowledge from Indonesian traditional cultures in search for plants used to treat what was understood to be symptoms of tuberculosis. We then focused our investigation on the endophytes from these medicinal plants based on the hypothesis that the microorganisms residing within the plant cells might be the primary producers of the active compounds. In order to narrow down our search for bioactive compounds, we specifically targeted non-ribosomal peptides and the polyketides, which are the two largest classes of microbial secondary metabolites in use as antibiotics. This approach resulted in the isolation and characterisation of four antitubercular polyketides.

This investigation confirmed our hypothesis that empirically trialled traditional medicinal plants are valuable sources of endophytes that produce bioactive compounds.

It has also validated our combined bioactivity and genetics-based approach for the prioritisation of candidate endophytes for downstream chemical discovery. We have shown that there is a positive correlation between the presence of polyketide synthase

(PKS) and/or non-ribosomal peptide synthetase (NRPS) encoding genes in endophytes and the bioactivity of their respective organic extracts. Isolation of the antimycobacterial PKS products from plant endophytes not only confirmed our theory but also serves to establish a renewable supply of this compound and provides strong

173 General Discussion

scientific support for the medicinal use of this plant by traditional peoples. This study highlights the importance of ethnobotanical knowledge as a primer for bioactive natural product discovery from endophytes. As the world is increasingly in need of new pharmaceuticals, the bioprospecting from nature approach described in this thesis is at future direction that has the potential to be adapted in any context of medicinal plants from around the world.

174

APPENDICES

175 Appendices

Appendix 1: Antimicrobial assay results of the fungal endophyte extracts from Indonesian traditional medicinal plants (for Chapter 2)

Table 18 Dry yield of the chemical extracts from the fungal endophytes Isolate Host Extract dry yield (mg) Proposed Fungal Genus ID Plant Species Plant Part Supernatant Biomass 1LF1 A. paniculata Leaf Guignardia 19 951 1SF1 A. paniculata Stem Guignardia 21 356 2LF1 C. asiatica Leaf Colletotrichum 12 40 2LF2 C. asiatica Leaf Colletotrichum 14 46 2SF1 C. asiatica Stem Paraphaeosphaeria 16 51 2SF2 C. asiatica Stem Paraphaeosphaeria 15 36 2SF3 C. asiatica Stem Tetracladium 19 139 2RF1 C. asiatica Root Chaetomium 17 152 3LF1 N. indicum Leaf Penicillium 31 1180 3LF2 N. indicum Leaf Paraphaeosphaeria 23 265 3LF4 N. indicum Leaf Acremonium 11 1238 3SF2 N. indicum Stem Ophioceras 13 1264 3RF1 N. indicum Root -unclassified- 13 11 4FF1 P. indica Flower Bipolaris 33 1023 4FF2 P. indica Flower Phomopsis 12 635 4FF4 P. indica Flower Curvularia 27 884 4FF5 P. indica Flower Alternaria 28 1609 4LF1 P. indica Leaf Alternaria 12 583 4LF2 P. indica Leaf Colletotrichum 10 489 4LF3 P. indica Leaf -unclassified- 10 407 4SF1 P. indica Stem Letendraea 14 224 4SF2 P. indica Stem Phomopsis 8 256 4RF1 P. indica Root Aspergillus 27 1313 4RF3 P. indica Root Chaetomium 12 16 5LF1 V. trifolia Leaf Colletotrichum 12 267 5LF2 V. trifolia Leaf Colletotrichum 8 42 5SF1 V. trifolia Stem Phomopsis 27 61 5SF2 V. trifolia Stem Phomopsis 19 28 5SF3 V. trifolia Stem Colletotrichum 35 731 5RF1 V. trifolia Root Paecilomyces 13 10 6SF1 R. communis Stem Colletotrichum 17 472 6SF2 R. communis Stem Phoma 16 968 6SF3 R. communis Stem Colletotrichum 12 26 6SF4 R. communis Stem Phomopsis 19 40 7SF1 H. tiliaceus Stem Colletotrichum 19 636 7SF2 H. tiliaceus Stem Phoma 8 74

176 Appendices

Table 18 (continued) Isolate Host Extract dry yield (mg) Proposed Fungal Genus ID Plant Species Plant Part Supernatant Biomass 7SF3 H. tiliaceus Stem Colletotrichum 25 1284 7SF4 H. tiliaceus Stem Phomopsis 15 23 7SF6 H. tiliaceus Stem Aspergillus 29 134 8SF1 C. sappan Stem Colletotrichum 46 671 8SF2 C. sappan Stem Phomopsis 16 45 8SF3 C. sappan Stem Paraphaeosphaeria 13 699 8RF1 C. sappan Root Fusarium 18 16 9FF1 R. spathacea Flower -unclassified- 13 11 9FF2 R. spathacea Flower Fusarium 30 347 9LF1 R. spathacea Leaf Guignardia 10 21 9LF2 R. spathacea Leaf Phomopsis 15 56 9LF3 R. spathacea Leaf Colletotrichum 9 63 9LF4 R. spathacea Leaf Colletotrichum 12 85 9RF1 R. spathacea Root Phoma 12 32 9RF2 R. spathacea Root Fusarium 12 27 9RF3 R. spathacea Root Microdochium 20 91 9RF4 R. spathacea Root -unclassified- 14 34 10FF1 L. camara Flower Aspergillus 18 73 10LF1 L. camara Leaf Aspergillus 9 960 10SF1 L. camara Stem Colletotrichum 19 1264 10SF2 L. camara Stem Phoma 11 59 10SF3 L. camara Stem Arthopyrenia 12 24 10SF4 L. camara Stem Colletotrichum 11 101 10RF1 L. camara Root -unclassified- 9 39 11UF1 B. javanica Fruit Endothia 38 58 11UF2 B. javanica Fruit -unclassified- 10 64 11UF3 B. javanica Fruit Endothia 14 69 11UF4 B. javanica Fruit Endothia 28 38 11UF5 B. javanica Fruit Colletotrichum 8 126 11FF1 B. javanica Flower Guignardia 11 36 11FF2 B. javanica Flower Phomopsis 27 652 11FF3 B. javanica Flower Phomopsis 14 41 11LF1 B. javanica Leaf Phomopsis 18 57 11SF1 B. javanica Stem Phomopsis 15 100 11SF2 B. javanica Stem Colletotrichum 7 80 11SF3 B. javanica Stem Colletotrichum 11 32 11RF1 B. javanica Root Fusarium 23 124 12UF1 M. citrifolia Fruit Phomopsis 16 57 12UF2 M. citrifolia Fruit Fusarium 24 346 12UF3 M. citrifolia Fruit Colletotrichum 10 132

177 Appendices

Table 19 Bioactivity assay results of the fungal crude extracts against E. coli Percentage growth inhibition N P Plant Proposed fungal R Supernatant Biomass ID Host plant K part genus P 100 µg mL-1 10 µg mL-1 100 µg mL-1 10 µg mL-1 Sa Sb Mean SEM Mean SEM Mean SEM Mean SEM 1LF1 A. paniculata Leaf Guignardia +c + -9.90 -0.11 -11.53 -0.28 -4.51 -0.15 -2.56 -0.12 1SF1 A. paniculata Stem Guignardia + + -12.18 -0.25 -11.85 -0.26 2.56 0.07 -10.68 -0.28 2LF1 C. asiatica Leaf Colletotrichum + -d 1.18 0.04 3.68 0.07 -0.79 -0.06 7.10 0.13 2LF2 C. asiatica Leaf Colletotrichum + - 6.83 0.16 8.80 0.26 3.68 0.02 8.41 0.05 2SF1 C. asiatica Stem Paraphaeosphaeria + - -15.90 -0.41 -2.76 -0.13 5.78 0.41 11.43 0.33 2SF2 C. asiatica Stem Paraphaeosphaeria + - 4.47 0.26 5.26 0.35 3.68 0.08 5.65 0.16 2SF3 C. asiatica Stem Tetracladium + - 3.81 0.14 9.86 0.29 -1.97 -0.09 2.23 0.03 2RF1 C. asiatica Root Chaetomium + - -10.30 -0.39 -15.70 -0.41 3.35 0.09 0.13 0.00 3LF1 N. indicum Leaf Penicillium + - -6.01 -0.07 -7.95 -0.19 6.02 0.20 -1.50 -0.02 3LF2 N. indicum Leaf Paraphaeosphaeria + + -5.68 -0.10 -1.30 -0.03 7.82 0.18 2.71 0.13 3LF4 N. indicum Leaf Volutella - - 2.19 0.12 -2.70 -0.17 0.51 0.01 -1.67 -0.06 3SF2 N. indicum Stem Ophioceras + + -3.86 -0.14 -3.22 -0.13 4.63 0.10 1.29 0.04 3RF1 N. indicum Root -unclassified- + - 8.37 0.18 -1.54 -0.07 -2.83 -0.14 -2.57 -0.05 4FF1 P. indica Flower Bipolaris + - 5.68 0.09 3.25 0.04 9.47 0.36 4.21 0.19 4FF2 P. indica Flower Phomopsis + - 3.08 0.05 3.08 0.04 -2.41 -0.06 2.86 0.09 4FF4 P. indica Flower Curvularia + - -7.49 -0.45 -0.47 -0.01 9.20 0.49 7.33 0.45 4FF5 P. indica Flower Alternaria + - -4.87 -0.13 2.60 0.04 -19.24 -0.29 -19.08 -0.17 4LF1 P. indica Leaf Alternaria - - -5.81 -0.17 -3.48 -0.09 7.26 0.19 3.19 0.03 4LF2 P. indica Leaf Colletotrichum + - -13.73 -0.63 -0.78 -0.02 -0.16 0.00 -3.43 -0.15 4LF3 P. indica Leaf -unclassified- + + -2.03 -0.11 3.74 0.05 0.16 0.00 3.90 0.11 4SF1 P. indica Stem Letendraea + - -3.90 -0.13 5.15 0.06 -5.77 2.03 -0.19 0.08 4SF2 P. indica Stem Phomopsis + - -0.47 -0.02 0.94 0.01 -4.06 -0.15 -8.89 -0.20 4RF1 P. indica Root Aspergillus + + 2.11 0.04 -4.38 -0.07 -15.42 -0.18 -15.73 -0.13 4RF3 P. indica Root Chaetomium + + -0.41 -0.01 2.88 0.10 11.95 1.20 14.70 0.48 5LF1 V. trifolia Leaf Colletotrichum + - -0.96 -0.04 15.25 0.54 11.81 0.82 13.19 0.50 5LF2 V. trifolia Leaf Colletotrichum + - 12.50 0.45 8.24 0.27 6.04 0.48 13.05 0.40 5SF1 V. trifolia Stem Phomopsis + + 9.20 0.34 11.13 0.33 9.07 0.57 10.71 0.29 5SF2 V. trifolia Stem Phomopsis + + 12.36 0.55 14.70 0.47 -2.88 -0.08 1.37 0.04 5SF3 V. trifolia Stem Colletotrichum + + -9.29 -0.15 -16.85 -0.19 -10.69 -0.22 -11.91 -0.13 5RF1 V. trifolia Root Paecilomyces + + -1.88 -0.05 15.16 1.34 8.28 0.54 7.19 0.12 6SF1 R. communis Stem Colletotrichum + + -8.82 -0.07 -13.23 -0.28 -5.50 -0.17 -5.19 -0.10 6SF2 R. communis Stem Phoma + + -6.14 -0.03 -8.98 -0.07 1.22 0.03 -1.83 -0.03 6SF3 R. communis Stem Colletotrichum + + 3.59 0.11 9.38 0.16 -5.47 -0.47 9.06 0.44 6SF4 R. communis Stem Phomopsis + + 3.91 0.17 7.97 0.15 -11.41 -0.25 -5.16 -0.07 7SF1 H. tiliaceus Stem Colletotrichum + + -2.05 -0.01 -6.14 -0.16 2.44 0.05 1.37 0.01 7SF2 H. tiliaceus Stem Phoma + + 6.47 0.03 2.89 0.03 15.01 0.38 10.88 0.36 7SF3 H. tiliaceus Stem Colletotrichum + + 0.63 0.01 -2.52 -0.05 6.87 0.07 3.82 0.07 7SF4 H. tiliaceus Stem Phomopsis + + 9.92 0.44 10.06 0.10 11.16 0.39 8.95 0.21 7SF6 H. tiliaceus Stem Aspergillus - - 1.57 0.03 1.26 0.03 -0.61 -0.01 1.98 0.05

178 Appendices

Table 19 (continued) Percentage growth inhibition N P Plant Proposed fungal R Supernatant Biomass ID Host plant K part genus P 100 µg mL-1 10 µg mL-1 100 µg mL-1 10 µg mL-1 S S Mean SEM Mean SEM Mean SEM Mean SEM 8SF1 C. sappan Stem Colletotrichum + - 5.98 0.07 1.10 0.01 2.90 0.05 -5.95 -0.25 8SF2 C. sappan Stem Phomopsis + + 9.92 0.42 15.29 0.61 3.03 0.16 8.82 0.26 8SF3 C. sappan Stem Paraphaeosphaeria + + 10.61 0.25 11.57 0.33 0.96 0.02 2.62 0.09 8RF1 C. sappan Root Fusarium - - 8.03 0.27 5.89 0.02 8.03 0.37 9.50 0.32 9FF1 R. spathacea Flower -unclassified- + - -3.88 -0.08 7.50 0.29 8.57 0.29 12.32 0.31 9FF2 R. spathacea Flower Fusarium + + 3.62 0.07 1.26 0.02 24.73 6.49 -1.68 -0.03 9LF1 R. spathacea Leaf Guignardia + - -9.77 -0.42 8.57 0.32 7.10 0.33 8.43 0.27 9LF2 R. spathacea Leaf Phomopsis + + 5.35 0.09 6.96 0.18 1.07 0.04 5.09 0.19 9LF3 R. spathacea Leaf Colletotrichum + + 10.76 0.19 13.69 0.27 17.11 0.95 18.70 1.23 9LF4 R. spathacea Leaf Colletotrichum + + 15.53 0.73 19.93 0.63 19.44 0.79 22.13 0.66 9RF1 R. spathacea Root Phoma + + 11.25 0.63 16.01 0.08 16.26 0.49 21.52 0.17 9RF2 R. spathacea Root Fusarium + + -7.98 -0.26 -3.48 -0.03 -5.66 -0.11 -4.21 -0.02 9RF3 R. spathacea Root Microdochium + + 19.80 0.87 17.97 0.46 2.69 0.17 18.34 0.57 9RF4 R. spathacea Root -unclassified- + - 11.37 0.50 22.86 0.50 -2.93 -0.05 11.12 0.16 10FF1 L. camara Flower Aspergillus + - 3.84 0.02 1.08 0.05 14.54 0.03 14.27 0.41 10LF1 L. camara Leaf Aspergillus + + 2.83 0.07 8.21 0.24 20.39 0.17 12.92 0.19 10SF1 L. camara Stem Colletotrichum + + 4.72 0.10 -3.62 -0.06 0.47 0.01 17.67 3.24 10SF2 L. camara Stem Phoma + - 5.25 0.03 3.10 0.07 14.13 0.26 17.23 0.82 10SF3 L. camara Stem Arthopyrenia + - 10.50 0.09 13.46 0.42 6.46 0.07 14.13 0.09 10SF4 L. camara Stem Colletotrichum + + 12.11 0.08 17.09 0.42 -4.24 -0.01 13.32 0.39 10RF1 L. camara Root -unclassified- + + -2.90 -0.09 -0.73 -0.03 5.95 0.17 0.73 0.02 11UF1 B. javanica Fruit Endothia + + 16.55 0.25 0.58 0.02 5.08 0.11 2.03 0.07 11UF2 B. javanica Fruit -unclassified- + + -0.58 -0.01 3.05 0.16 6.97 0.31 6.24 0.17 11UF3 B. javanica Fruit Endothia + + 6.24 0.27 3.77 0.08 0.00 0.00 -3.34 -0.14 11UF4 B. javanica Fruit Endothia + + 0.24 0.00 7.52 0.19 7.64 0.21 12.22 0.31 11UF5 B. javanica Fruit Colletotrichum + + 9.99 0.42 11.28 0.28 10.46 0.50 14.57 0.16 11FF1 B. javanica Flower Guignardia + + 7.99 0.10 16.22 0.22 -1.65 -0.09 12.10 0.58 11FF2 B. javanica Flower Phomopsis + - -17.89 -1.15 -12.33 -0.09 5.68 0.14 4.73 0.12 11FF3 B. javanica Flower Phomopsis + + 0.71 0.01 13.75 0.17 -3.88 -0.14 16.45 0.12 11LF1 B. javanica Leaf Phomopsis + + 13.16 0.61 18.45 0.23 -4.82 -0.09 11.28 0.08 11SF1 B. javanica Stem Phomopsis + - -15.33 -0.33 -3.15 -0.04 4.73 0.29 1.72 0.04 11SF2 B. javanica Stem Colletotrichum + + -5.30 -0.21 -4.73 -0.06 6.02 0.19 6.30 0.18 11SF3 B. javanica Stem Colletotrichum + - -3.30 -0.15 -1.86 -0.04 4.30 0.17 4.87 0.11 11RF1 B. javanica Root Fusarium + + -12.03 -0.26 -3.31 -0.04 4.89 0.12 2.68 0.16 12UF1 M. citrifolia Fruit Phomopsis + + -5.73 -0.16 10.60 0.09 -1.29 -0.05 8.17 0.10 12UF2 M. citrifolia Fruit Fusarium + + -9.62 -0.16 -9.77 -0.17 8.36 0.21 11.51 0.36 12UF3 M. citrifolia Fruit Colletotrichum + + -3.30 -0.09 7.88 0.19 -0.29 -0.01 -2.01 -0.04 Note: aPKS = polyketide synthase, bNRPS = non-ribosomal peptide synthetase, c “+” indicates the presence of the biosynthetic genes, d “-” indicates the absence of the biosynthetic genes; result in bold denotes statistical significance after Student’s t-test with p<0.05.

179 Appendices

Table 20 Bioactivity assay results of the fungal crude extracts against P. aeruginosa Percentage growth inhibition N P Plant Proposed fungal R Supernatant Biomass ID Host plant K part genus P 100 µg mL-1 10 µg mL-1 100 µg mL-1 10 µg mL-1 Sa Sb Mean SEM Mean SEM Mean SEM Mean SEM 1LF1 A. paniculata Leaf Guignardia +c + -36.17 -2.40 -25.00 -1.02 12.25 0.34 -20.83 -0.40 1SF1 A. paniculata Stem Guignardia + + -51.86 -3.10 -36.44 -1.77 -33.09 -0.88 -39.95 -1.80 2LF1 C. asiatica Leaf Colletotrichum + -d -2.62 -0.03 13.41 0.83 -16.49 -0.84 9.24 0.57 2LF2 C. asiatica Leaf Colletotrichum + - -7.86 -0.44 4.93 0.24 2.62 0.15 5.70 0.28 2SF1 C. asiatica Stem Paraphaeosphaeria + - -14.79 -0.82 3.70 0.15 4.47 0.23 6.93 0.26 2SF2 C. asiatica Stem Paraphaeosphaeria + - -0.77 -0.04 9.55 0.25 3.39 0.16 14.18 0.64 2SF3 C. asiatica Stem Tetracladium + - -1.23 -0.03 5.86 0.11 9.40 0.59 3.70 0.26 2RF1 C. asiatica Root Chaetomium + - -14.69 -0.70 -3.01 -0.14 -78.34 -3.77 -6.97 -0.21 3LF1 N. indicum Leaf Penicillium + - -57.18 -9.48 -40.96 -1.69 4.17 0.02 -21.32 -0.11 3LF2 N. indicum Leaf Paraphaeosphaeria + + -60.64 -4.62 -35.37 -3.24 -43.38 -2.62 -29.66 -0.39 3LF4 N. indicum Leaf Volutella - - -22.79 -0.66 -2.45 -0.07 -82.11 -2.95 -14.69 -0.61 3SF2 N. indicum Stem Ophioceras + + -18.46 -0.28 4.52 0.25 -68.93 -2.34 -4.90 -0.06 3RF1 N. indicum Root -unclassified- + - 5.08 0.18 -1.51 -0.03 1.69 0.14 4.14 0.05 4FF1 P. indica Flower Bipolaris + - -29.26 -4.35 -17.29 -0.50 -38.48 -1.52 -30.64 0.00 4FF2 P. indica Flower Phomopsis + - -44.41 -1.86 -28.46 -2.63 -58.82 -3.83 -37.99 -1.86 4FF4 P. indica Flower Curvularia + - -56.16 -2.43 -19.20 -2.09 -41.12 -2.47 -38.04 -1.24 4FF5 P. indica Flower Alternaria + - -184.3 -4.38 -36.17 -1.69 -95.86 -12.68 -31.07 -2.60 4LF1 P. indica Leaf Alternaria - - -17.51 -0.70 6.81 0.20 -82.49 -6.91 -0.78 -0.05 4LF2 P. indica Leaf Colletotrichum + - -35.87 -0.74 -30.98 -0.66 -84.24 -5.68 -39.49 -1.36 4LF3 P. indica Leaf -unclassified- + + -45.47 -0.80 -30.07 -1.00 -60.14 -2.35 -32.79 -2.63 4SF1 P. indica Stem Letendraea + - -31.70 -0.20 -17.39 -1.18 -57.79 -3.95 -45.83 -3.78 4SF2 P. indica Stem Phomopsis + - -47.83 -1.27 -22.46 -1.58 -73.91 -9.88 -32.07 -2.59 - 4RF1 P. indica Root Aspergillus + + -28.19 -1.06 -25.53 -0.11 -16.62 -33.43 -3.12 108.58 4RF3 P. indica Root Chaetomium + + -22.49 -4.94 -6.02 -0.87 -30.12 -0.25 -17.67 -0.63 5LF1 V. trifolia Leaf Colletotrichum + - -41.77 -4.68 -31.33 -1.28 -71.08 -4.19 -28.71 -0.69 5LF2 V. trifolia Leaf Colletotrichum + - -7.83 -0.38 -31.53 -2.15 -29.12 -1.06 -17.27 -0.44 5SF1 V. trifolia Stem Phomopsis + + -29.32 -0.72 -19.08 -0.26 -20.88 -1.59 -28.51 -1.00 5SF2 V. trifolia Stem Phomopsis + + -21.69 -0.73 -31.33 -1.04 -35.74 -2.81 -29.32 -1.04 5SF3 V. trifolia Stem Colletotrichum + + -34.65 -1.59 -15.59 -1.03 -111.5 -13.56 -67.75 -3.74 5RF1 V. trifolia Root Paecilomyces + + 2.83 0.08 -0.61 -0.01 4.86 0.14 5.47 0.16 6SF1 R. communis Stem Colletotrichum + + -3.71 -0.07 -2.72 -0.13 -105.9 -0.26 -61.83 -1.72 6SF2 R. communis Stem Phoma + + -11.39 -0.63 -2.48 -0.06 -99.70 -7.19 -72.19 -0.20 6SF3 R. communis Stem Colletotrichum + + 2.43 0.08 -2.83 -0.09 -6.07 -0.39 -4.86 -0.26 6SF4 R. communis Stem Phomopsis + + -10.53 -0.37 1.21 0.04 1.01 0.03 -10.12 -0.51 7SF1 H. tiliaceus Stem Colletotrichum + + -4.95 -0.13 -10.89 -0.28 -142.6 -9.07 -72.78 -3.80 7SF2 H. tiliaceus Stem Phoma + + -4.27 -0.19 -13.91 -0.25 -5.94 -0.16 1.67 0.02 7SF3 H. tiliaceus Stem Colletotrichum + + -8.91 -0.45 -15.84 -1.81 -95.56 -2.23 -88.17 -5.33 7SF4 H. tiliaceus Stem Phomopsis + + -7.98 -0.47 0.93 0.03 9.28 0.30 2.41 0.07 7SF6 H. tiliaceus Stem Aspergillus - - -18.81 -0.34 -21.53 -2.46 -163.3 -6.69 -136.7 -1.50

180 Appendices

Table 20 (continued) Percentage growth inhibition N P Plant Proposed fungal R Supernatant Biomass ID Host plant K part genus P 100 µg mL-1 10 µg mL-1 100 µg mL-1 10 µg mL-1 S S Mean SEM Mean SEM Mean SEM Mean SEM 8SF1 C. sappan Stem Colletotrichum + - 0.50 0.08 -28.47 -0.67 -159.4 -15.07 -117.2 -3.44 8SF2 C. sappan Stem Phomopsis + + 3.71 0.04 21.52 0.24 8.35 0.30 9.65 0.22 8SF3 C. sappan Stem Paraphaeosphaeria + + -14.10 -0.91 8.91 0.36 -5.38 -0.34 9.28 0.40 8RF1 C. sappan Root Fusarium - - -33.84 -1.80 -12.88 -0.91 -25.55 -1.25 -9.17 -0.21 9FF1 R. spathacea Flower -unclassified- + - -17.03 -0.55 -17.90 -1.06 -20.31 -1.14 -3.06 -0.11 9FF2 R. spathacea Flower Fusarium + + -7.18 -0.36 -11.14 -0.11 -195.0 -21.62 -123.4 -10.80 9LF1 R. spathacea Leaf Guignardia + - -27.29 -0.54 -4.37 -0.04 -15.94 -1.00 -1.97 -0.02 9LF2 R. spathacea Leaf Phomopsis + + -21.40 -0.42 -24.24 -0.59 -17.03 -1.32 4.80 0.34 9LF3 R. spathacea Leaf Colletotrichum + + 7.59 0.13 11.64 0.27 8.77 0.44 20.57 0.60 9LF4 R. spathacea Leaf Colletotrichum + + 7.42 0.06 -0.84 -0.03 9.44 0.45 4.72 0.28 9RF1 R. spathacea Root Phoma + + -1.35 -0.09 23.78 0.52 7.76 0.33 19.56 0.09 9RF2 R. spathacea Root Fusarium + + -19.65 -0.39 4.47 0.14 -2.53 -0.17 14.98 0.59 9RF3 R. spathacea Root Microdochium + + 11.97 0.29 12.98 0.72 5.56 0.17 15.68 0.22 9RF4 R. spathacea Root -unclassified- + - 10.79 0.35 22.43 2.07 10.46 0.74 12.48 0.41 10FF1 L. camara Flower Aspergillus + - -5.81 -0.20 7.12 0.37 7.30 0.08 8.24 0.08 10LF1 L. camara Leaf Aspergillus + + -11.99 -0.34 4.12 0.21 -36.14 -0.63 9.36 0.07 10SF1 L. camara Stem Colletotrichum + + -21.53 -2.29 -30.69 -3.43 -19.47 -1.27 6.15 0.32 10SF2 L. camara Stem Phoma + - 5.81 0.09 2.25 0.16 -2.62 -0.15 -4.31 -0.23 10SF3 L. camara Stem Arthopyrenia + - 4.87 0.09 7.12 0.28 -7.12 -0.57 -0.56 -0.03 10SF4 L. camara Stem Colletotrichum + + 9.18 0.10 16.29 0.76 1.31 0.08 5.43 0.13 10RF1 L. camara Root -unclassified- + + 4.86 0.13 -3.11 -0.09 3.89 0.18 8.37 0.37 11UF1 B. javanica Fruit Endothia + + -6.42 -0.10 -8.37 -0.36 4.28 0.15 5.45 0.39 11UF2 B. javanica Fruit -unclassified- + + 2.92 0.09 4.09 0.10 6.42 0.24 8.17 0.46 11UF3 B. javanica Fruit Endothia + + -5.64 -0.16 1.75 0.11 10.70 0.74 7.59 0.42 11UF4 B. javanica Fruit Endothia + + -23.58 -0.66 -1.59 -0.03 -23.81 -0.39 -9.30 -0.48 11UF5 B. javanica Fruit Colletotrichum + + -19.05 -0.45 -22.00 -0.62 -22.68 -0.94 -2.04 -0.06 11FF1 B. javanica Flower Guignardia + + -16.10 -0.44 -8.84 -0.38 -19.95 -0.24 3.17 0.09 11FF2 B. javanica Flower Phomopsis + - -11.76 -0.22 -24.02 -0.36 -20.70 -1.17 -7.58 -0.37 11FF3 B. javanica Flower Phomopsis + + -8.16 -0.20 -20.18 -0.54 -20.63 -0.37 -8.16 -0.04 11LF1 B. javanica Leaf Phomopsis + + -12.02 -0.29 -9.75 -0.28 1.81 0.05 0.45 0.01 11SF1 B. javanica Stem Phomopsis + - -4.52 -0.22 -9.25 -0.04 -4.73 -0.14 -4.09 -0.25 11SF2 B. javanica Stem Colletotrichum + + -9.89 -0.32 -0.86 -0.04 3.23 0.02 0.43 0.04 11SF3 B. javanica Stem Colletotrichum + - -7.31 -0.29 -15.48 -1.28 -1.72 -0.06 -6.88 -0.28 11RF1 B. javanica Root Fusarium + + -36.52 -0.10 -15.44 -0.16 -37.09 -4.58 -21.52 -1.04 12UF1 M. citrifolia Fruit Phomopsis + + -6.45 -0.38 -3.44 -0.17 -1.29 -0.04 2.58 0.11 12UF2 M. citrifolia Fruit Fusarium + + -40.69 -1.00 -15.44 -0.19 -56.97 -2.78 -4.51 -0.26 12UF3 M. citrifolia Fruit Colletotrichum + + -1.08 -0.03 3.66 0.22 1.51 0.03 -1.29 -0.02 Note: aPKS = polyketide synthase, bNRPS = non-ribosomal peptide synthetase, c “+” indicates the presence of the biosynthetic genes, d “-” indicates the absence of the biosynthetic genes; result in bold denotes statistical significance after Student’s t-test with p<0.05.

181 Appendices

Table 21 Bioactivity assay results of the fungal crude extracts against S. aureus Percentage growth inhibition N P Plant Proposed fungal R Supernatant Biomass ID Host plant K part genus P 100 µg mL-1 10 µg mL-1 100 µg mL-1 10 µg mL-1 Sa Sb Mean SEM Mean SEM Mean SEM Mean SEM 1LF1 A. paniculata Leaf Guignardia +c + -1.44 -0.04 2.88 0.31 2.48 0.08 -2.03 -0.08 1SF1 A. paniculata Stem Guignardia + +d -8.44 -0.63 -1.85 -0.13 4.29 0.27 9.48 0.26 2LF1 C. asiatica Leaf Colletotrichum + - -22.31 -1.58 -10.75 -0.10 -45.64 -4.15 1.62 0.02 2LF2 C. asiatica Leaf Colletotrichum + - -35.09 -2.52 -14.20 -0.52 -4.26 -0.49 16.23 1.90 2SF1 C. asiatica Stem Paraphaeosphaeria + - -26.77 -1.85 23.33 1.90 -6.69 -1.01 0.41 0.04 2SF2 C. asiatica Stem Paraphaeosphaeria + - -36.92 -3.07 3.04 0.22 -12.58 -1.07 0.61 0.04 2SF3 C. asiatica Stem Tetracladium + - -20.49 -1.73 -2.23 -0.07 -18.86 -0.98 -16.84 -1.08 2RF1 C. asiatica Root Chaetomium + - -38.78 -2.57 12.06 0.72 -6.12 -0.24 20.96 1.55 3LF1 N. indicum Leaf Penicillium + - 5.35 0.13 7.00 0.10 7.22 0.27 13.09 0.52 3LF2 N. indicum Leaf Paraphaeosphaeria + + 5.35 0.25 1.85 0.13 9.71 0.27 17.61 0.58 3LF4 N. indicum Leaf Volutella - - -35.44 -0.96 15.96 0.58 -20.78 -2.49 29.31 2.04 3SF2 N. indicum Stem Ophioceras + + -27.09 -0.59 13.17 1.71 5.38 0.25 15.58 0.61 3RF1 N. indicum Root -unclassified- + - -1.30 -0.13 34.88 2.44 -27.27 -0.62 16.14 1.02 4FF1 P. indica Flower Bipolaris + - 4.73 0.24 12.14 0.45 7.45 0.33 16.93 0.63 4FF2 P. indica Flower Phomopsis + - 14.20 1.24 13.17 0.97 -5.19 -0.18 5.64 0.16 4FF4 P. indica Flower Curvularia + - -13.47 -1.39 22.22 1.56 15.49 1.66 -0.67 -0.03 4FF5 P. indica Flower Alternaria + - -48.77 -3.19 1.23 0.06 10.76 0.13 15.47 1.37 4LF1 P. indica Leaf Alternaria - - -67.77 -1.64 -1.02 -0.05 -0.26 0.00 10.23 0.56 4LF2 P. indica Leaf Colletotrichum + - -37.37 -1.73 17.68 0.31 -5.22 -0.13 3.87 0.30 4LF3 P. indica Leaf -unclassified- + + -27.95 -0.25 6.06 0.34 24.41 2.08 17.17 1.07 4SF1 P. indica Stem Letendraea + - -15.82 -1.56 24.75 1.22 7.07 0.32 13.97 0.85 4SF2 P. indica Stem Phomopsis + - -14.14 -1.02 9.09 0.56 -18.18 -0.41 -3.54 -0.16 4RF1 P. indica Root Aspergillus + + -7.61 -0.35 14.40 0.54 2.47 0.11 10.31 1.01 4RF3 P. indica Root Chaetomium + + -15.52 -1.17 1.72 0.01 -13.58 -1.58 14.01 0.43 5LF1 V. trifolia Leaf Colletotrichum + - -59.70 -3.85 10.13 0.55 -0.22 -0.01 10.13 0.30 5LF2 V. trifolia Leaf Colletotrichum + - -15.52 -0.16 11.64 0.21 -27.80 -3.42 -4.53 -0.11 5SF1 V. trifolia Stem Phomopsis + + -26.29 -2.77 9.05 0.28 -8.41 -1.04 -27.37 -1.43 5SF2 V. trifolia Stem Phomopsis + + -37.28 -1.23 25.86 1.09 -47.20 -1.95 -43.10 -2.38 5SF3 V. trifolia Stem Colletotrichum + + 0.21 0.00 5.96 0.19 -1.57 -0.08 16.37 1.26 5RF1 V. trifolia Root Paecilomyces + + -30.36 -1.98 10.86 0.71 -107.8 -9.98 -9.47 -0.22 6SF1 R. communis Stem Colletotrichum + + -12.55 -0.63 9.15 0.32 -2.69 -0.26 11.66 0.60 6SF2 R. communis Stem Phoma + + -13.40 -0.47 0.64 0.03 9.19 0.31 13.68 0.06 6SF3 R. communis Stem Colletotrichum + + -45.13 -3.02 11.70 0.57 -59.61 -7.30 -8.36 -0.64 6SF4 R. communis Stem Phomopsis + + -32.31 -1.86 5.85 0.44 -53.76 -4.51 -18.66 -2.16 7SF1 H. tiliaceus Stem Colletotrichum + + -8.51 -0.31 7.45 0.28 4.71 0.40 17.26 0.42 7SF2 H. tiliaceus Stem Phoma + + -151.1 -2.96 -100.4 -1.85 -108.1 -2.34 -46.69 -2.21 7SF3 H. tiliaceus Stem Colletotrichum + + 4.26 0.11 11.70 0.34 -7.17 -0.30 13.00 0.93 7SF4 H. tiliaceus Stem Phomopsis + + -81.62 -3.32 -23.90 -0.94 -7.72 -0.12 -55.51 -2.18 7SF6 H. tiliaceus Stem Aspergillus - - -41.49 -1.36 11.91 0.65 -17.71 -0.90 11.88 1.38

182 Appendices

Table 21 (continued) Percentage growth inhibition N P Plant Proposed fungal R Supernatant Biomass ID Host plant K part genus P 100 µg mL-1 10 µg mL-1 100 µg mL-1 10 µg mL-1 S S Mean SEM Mean SEM Mean SEM Mean SEM 8SF1 C. sappan Stem Colletotrichum + - 10.43 0.31 14.26 1.01 -4.48 -0.18 10.99 0.82 8SF2 C. sappan Stem Phomopsis + + -117.3 -0.86 -11.40 -0.08 -66.54 -3.76 -100.4 -3.56 8SF3 C. sappan Stem Paraphaeosphaeria + + -93.75 -2.43 -18.01 -0.87 -126.4 -4.14 -88.24 -4.89 8RF1 C. sappan Root Fusarium - - -55.01 -4.63 -12.61 -0.31 22.35 0.65 -2.01 -0.10 9FF1 R. spathacea Flower -unclassified- + - -47.28 -3.66 -3.72 -0.18 -54.15 -2.37 -13.75 -0.16 9FF2 R. spathacea Flower Fusarium + + 17.02 0.91 17.87 1.06 -10.76 -0.56 1.12 0.03 9LF1 R. spathacea Leaf Guignardia + - -40.11 -3.89 -6.88 -0.48 -28.08 -3.16 -8.02 -0.06 9LF2 R. spathacea Leaf Phomopsis + + -59.03 -3.51 -0.29 0.00 -45.85 -8.09 10.89 0.89 9LF3 R. spathacea Leaf Colletotrichum + + -20.30 -0.18 -6.02 -0.29 14.54 0.52 10.28 0.71 9LF4 R. spathacea Leaf Colletotrichum + + -16.29 -0.41 9.77 0.76 21.43 0.56 17.54 1.74 9RF1 R. spathacea Root Phoma + + -17.79 -0.18 16.79 0.29 3.76 0.19 2.51 0.12 9RF2 R. spathacea Root Fusarium + + -64.19 -5.36 -12.53 -1.33 -43.73 -0.87 -24.04 -0.47 9RF3 R. spathacea Root Microdochium + + -18.05 0.00 20.30 0.45 -22.56 -0.13 -5.01 -0.62 9RF4 R. spathacea Root -unclassified- + - -26.32 -0.07 16.04 1.03 -82.33 -1.77 -46.37 -4.87 10FF1 L. camara Flower Aspergillus + - -104.1 -2.64 19.49 1.68 -63.29 -2.88 0.51 0.02 10LF1 L. camara Leaf Aspergillus + + -30.38 -0.79 10.13 0.59 15.95 0.95 20.00 1.98 10SF1 L. camara Stem Colletotrichum + + -13.83 -0.78 10.21 0.38 -1.42 -0.09 -1.89 -0.12 10SF2 L. camara Stem Phoma + - -50.13 -3.07 35.70 0.75 12.66 0.57 -7.09 -0.33 10SF3 L. camara Stem Arthopyrenia + - -24.56 -0.77 9.11 0.08 -26.46 -0.41 -8.23 -0.46 10SF4 L. camara Stem Colletotrichum + + -28.73 -0.12 8.10 0.18 -44.68 -0.96 -46.20 -0.86 10RF1 L. camara Root -unclassified- + + -90.54 -11.12 3.58 0.14 15.09 1.32 7.16 0.31 11UF1 B. javanica Fruit Endothia + + -70.33 -5.78 13.55 0.62 -2.30 -0.28 -7.42 -0.42 11UF2 B. javanica Fruit -unclassified- + + -37.34 -3.06 23.27 0.96 -2.30 -0.16 -4.86 -0.29 11UF3 B. javanica Fruit Endothia + + -76.98 -2.62 11.51 1.46 -31.20 -0.62 -22.25 -0.94 11UF4 B. javanica Fruit Endothia + + -23.53 -1.80 1.96 0.08 -36.27 -2.43 13.97 0.47 11UF5 B. javanica Fruit Colletotrichum + + -95.10 -8.80 -0.74 -0.06 29.66 1.79 -0.98 -0.03 11FF1 B. javanica Flower Guignardia + + -37.75 -1.21 22.79 1.20 -9.80 -0.37 -3.43 -0.04 11FF2 B. javanica Flower Phomopsis + - -6.55 -0.60 -8.80 -0.21 -11.08 -0.74 3.07 0.19 11FF3 B. javanica Flower Phomopsis + + -39.46 -4.52 26.72 2.33 -48.04 -3.35 -4.66 -0.36 11LF1 B. javanica Leaf Phomopsis + + -7.84 -0.18 15.20 1.16 -51.47 -2.62 -17.40 -1.08 11SF1 B. javanica Stem Phomopsis + - -64.18 -5.36 -2.39 -0.07 -12.54 -0.13 1.79 0.21 11SF2 B. javanica Stem Colletotrichum + + -83.88 -5.66 3.88 0.06 -28.66 -1.21 -32.54 -3.95 11SF3 B. javanica Stem Colletotrichum + - -88.66 -3.05 14.93 0.66 -30.45 -1.41 -17.01 -2.55 11RF1 B. javanica Root Fusarium + + 16.93 0.36 12.42 0.30 6.13 0.35 34.67 11.92 12UF1 M. citrifolia Fruit Phomopsis + + -94.03 -0.74 13.13 0.91 -61.49 -2.05 -44.48 -4.92 12UF2 M. citrifolia Fruit Fusarium + + -19.41 -0.47 -0.90 -0.02 -1.89 -0.04 16.27 1.09 12UF3 M. citrifolia Fruit Colletotrichum + + -100.6 -2.74 5.67 0.40 -73.13 -3.07 -63.28 -4.09 Note: aPKS = polyketide synthase, bNRPS = non-ribosomal peptide synthetase, c “+” indicates the presence of the biosynthetic genes, d “-” indicates the absence of the biosynthetic genes; result in bold denotes statistical significance after Student’s t-test with p<0.05.

183 Appendices

Table 22 Bioactivity assay results of the fungal crude extracts against Mycobacteria M. phlei M. avium M. tuberculosis N Super- Super- Super- P Biomass Biomass Biomass Plant Proposed fungal R natant natant natant ID Host plant K part genus P a 100 10 100 10 100 10 100 10 100 10 100 10 S b S µg µg µg µg µg µg µg µg µg µg µg µg mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1

1LF1 A. paniculata Leaf Guignardia yc y ++f ------1SF1 A. paniculata Stem Guignardia y y -h ------

2LF1 C. asiatica Leaf Colletotrichum y nd +e - ++ ------2LF2 C. asiatica Leaf Colletotrichum y n ------2SF1 C. asiatica Stem Paraphaeosphaeria y n - - - - ++ ------2SF2 C. asiatica Stem Paraphaeosphaeria y n ------2SF3 C. asiatica Stem Tetracladium y n + ------2RF1 C. asiatica Root Chaetomium y n ------

3LF1 N. indicum Leaf Penicillium y n ------3LF2 N. indicum Leaf Paraphaeosphaeria y y + ------3LF4 N. indicum Leaf Volutella n n ------3SF2 N. indicum Stem Ophioceras y y ------3RF1 N. indicum Root -unclassified- y n ------

4FF1 P. indica Flower Bipolaris y n + ------4FF2 P. indica Flower Phomopsis y n + ------4FF4 P. indica Flower Curvularia y n ------4FF5 P. indica Flower Alternaria y n ++ - + ------4LF1 P. indica Leaf Alternaria n n ------4LF2 P. indica Leaf Colletotrichum y n ------4LF3 P. indica Leaf -unclassified- y y + ------4SF1 P. indica Stem Letendraea y n ------4SF2 P. indica Stem Phomopsis y n ------4RF1 P. indica Root Aspergillus y y + - + ------4RF3 P. indica Root Chaetomium y y + ------

5LF1 V. trifolia Leaf Colletotrichum y n ------5LF2 V. trifolia Leaf Colletotrichum y n + ------5SF1 V. trifolia Stem Phomopsis y y ------5SF2 V. trifolia Stem Phomopsis y y ------5SF3 V. trifolia Stem Colletotrichum y y + ------5RF1 V. trifolia Root Paecilomyces y y + ------

6SF1 R. communis Stem Colletotrichum y y + ------6SF2 R. communis Stem Phoma y y + ------6SF3 R. communis Stem Colletotrichum y y + ------6SF4 R. communis Stem Phomopsis y y ------

7SF1 H. tiliaceus Stem Colletotrichum y y - - - - ++ ------7SF2 H. tiliaceus Stem Phoma y y - - + - ++ ------7SF3 H. tiliaceus Stem Colletotrichum y y + ------7SF4 H. tiliaceus Stem Phomopsis y y ++ ------7SF6 H. tiliaceus Stem Aspergillus n n ------

184 Appendices

Table 22 (continued) M. phlei M. avium M. tuberculosis N Super- Super- Super- P Biomass Biomass Biomass Plant Proposed fungal R natant natant natant ID Host plant K part genus P S 100 10 100 10 100 10 100 10 100 10 100 10 S µg µg µg µg µg µg µg µg µg µg µg µg mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1 mL-1

8SF1 C. sappan Stem Colletotrichum y n + ------8SF2 C. sappan Stem Phomopsis y y + ------8SF3 C. sappan Stem Paraphaeosphaeria y y ------8RF1 C. sappan Root Fusarium n n + ------

9FF1 R. spathacea Flower -unclassified- y n ++ - - - ++ ------9FF2 R. spathacea Flower Fusarium y y ++ ------9LF1 R. spathacea Leaf Guignardia y n + ------9LF2 R. spathacea Leaf Phomopsis y y + ------9LF3 R. spathacea Leaf Colletotrichum y y ------9LF4 R. spathacea Leaf Colletotrichum y y + ------9RF1 R. spathacea Root Phoma y y + ------9RF2 R. spathacea Root Fusarium y y ++ - ++ - - - - - +++g - - - 9RF3 R. spathacea Root Microdochium y y + - + ------9RF4 R. spathacea Root -unclassified- y n + ------

10FF1 L. camara Flower Aspergillus y n ++ ------10LF1 L. camara Leaf Aspergillus y y + ------10SF1 L. camara Stem Colletotrichum y y + ------10SF2 L. camara Stem Phoma y n ------10SF3 L. camara Stem Arthopyrenia y n ------10SF4 L. camara Stem Colletotrichum y y + ------10RF1 L. camara Root -unclassified- y y + ------

11UF1 B. javanica Fruit Endothia y y ++ + ------+++ - - - 11UF2 B. javanica Fruit -unclassified- y y + ------11UF3 B. javanica Fruit Endothia y y ++ ------+++ - - - 11UF4 B. javanica Fruit Endothia y y ++ ------+++ - - - 11UF5 B. javanica Fruit Colletotrichum y y ++ ------11FF1 B. javanica Flower Guignardia y y + ------11FF2 B. javanica Flower Phomopsis y n + ------11FF3 B. javanica Flower Phomopsis y y + ------11LF1 B. javanica Leaf Phomopsis y y + ------11SF1 B. javanica Stem Phomopsis y n + ------11SF2 B. javanica Stem Colletotrichum y y + ------11SF3 B. javanica Stem Colletotrichum y n + ------11RF1 B. javanica Root Fusarium y y ++ - + ------

12UF1 M. citrifolia Fruit Phomopsis y y ------12UF2 M. citrifolia Fruit Fusarium y y ++ ------12UF3 M. citrifolia Fruit Colletotrichum y y ------Note: aPKS = polyketide synthase, bNRPS = non-ribosomal peptide synthetase, c “y” indicates the presence of the biosynthetic genes, d “n” indicates the absence of the biosynthetic genes, e “+” indicates growth inhibition below 50%, f “++” incidates growth inhibition above 50% but not total inhibition, g “+++” indicates total growth inhibition, h “-” indicates no growth inhibition.

185 Appendices

Appendix 2: NMR data comparison of the proposed chemical structures isolated in this study (for Chapters 3 and 4)

Table 23 13C NMR chemical shift comparison of javanicin (11), anhydrofusarubin (12), and acropyrone (13) between data collected from this study, previously published data, and calculated data using chemical shift prediction software javanicin (11) anhydrofusarubin (12) acropyrone (13) Published Published Position This Calculated This Calculated This Calculated data data study dataa study data study data (514)b (479)c 1 177.7 179.4 178.2 177.9 179.4 - - - 2 160.6 160.3 160.2 160.1 160.3 164.9 162.6 167.9 3 109.7 109.5 110.0 110.1 109.5 106.2 102.8 103.6 4 184.4 184.8 183.0 183.0 184.8 165.1 165.5 165.9 4a 108.4 109.6 107.9 108.1 107.9 - - - 5 160.3 154.7 157.8 158.0 156.4 97.0 98.1 94.2 5a - - 122.9 122.9 122.6 - - - 6 142.5 132.3 63.6 63.1 63.0 157.2 156.7 160.8 7 134.1 137.9 161.6 161.7 161.2 144.6 141.8 146.8 8 161.4 154.6 94.9 94.9 94.6 118.7 120.2 116.0 8a 109.7 106.9 132.9 133.2 132.9 - - - 9 41.2 42.9 157.8 158.1 157.5 169.0 166.8 171.6 9a - - 110.9 111.1 110.8 - - - 10 203.8 204.9 20.1 20.2 20.2 8.8 8.5 7.6 11 29.7 30.5 - - - 56.3 56.4 56.2 12 12.8 11.3 - - - 13.6 13.2 2.2

2-OCH3 56.7 58.0 56.6 56.8 58.0 - - - Note: aThere is no published 13C NMR data on javanicin with complete assignment. bThe c published data was collected in CDCl3. The published data was collected in DMSO-d6.

186 References

REFERENCES

1. Strobel G, Daisy B, Castillo U, Harper J. 2004. Natural products from endophytic microorganisms. Journal of Natural Products 67:257-268. 2. Demain AL. 2000. Microbial natural products: a past with a future, p 3-16. In Wrigley SK, Hayes MA, Thomas R, Chrystal EJT, Nicholson N (ed), Biodiversity: New Leads for Pharmaceutical and Agrochemical Industries. The Royal Society of Chemistry, Cambridge. 3. Mandal S, Moudgil M, Mandal SK. 2009. Rational drug design. European Journal of Pharmacology 625:90-100. 4. Gallop MA, Barrett RW, Dower WJ, Fodor SPA, Gordon EM. 1994. Application of combinatorial technologies to drug discovery. 1. Background and peptide combinatorial libraries. Journal of Medicinal Chemistry 37:1233-1251. 5. Strohl WR. 2000. The role of natural products in a modern drug discovery program. Drug Discovery Today 5:39-41. 6. Müller BA. 2009. Imatinib and its successors - How modern chemistry has changed drug development. Current Pharmaceutical Design 15:120-133. 7. Barry III CE, Blanchard JS. 2010. The chemical biology of new drugs in the development for tuberculosis. Current Opinion in Chemical Biology 14:456- 466. 8. Baker D, Mocek U, Garr C. 2000. Natural products vs. combinatorials: A case study, p 66-72. In Wrigley SK, Hayes MA, Thomas R, Chrystal EJT, Nicholson N (ed), Biodiversity: New Leads for Pharmaceutical and Agrochemical Industries. The Royal Society of Chemistry, Cambridge. 9. Strobel GA, Daisy B. 2003. Bioprospecting for microbial endophytes and their natural products. Microbiology and Molecular Biology Reviews 67:491-502. 10. Newman DJ, Cragg GM. 2012. Natural products as sources of new drugs over the 30 years from 1981 to 2010. Journal of Natural Products 75:311-335. 11. Kingston DGI. 2011. Modern natural products drug discovery and its relevance to biodiversity conservation. Journal of Natural Products 74:496-511. 12. Dančík V, Seiler KP, Young DW, Schreiber SL, Clemons PA. 2010. Distinct biological network properties between the targets of natural products and disease genes. Journal of the American Chemical Society 132:9259-9261. 13. Danziger LH, Neuhauser M. 2011. Beta-lactam antibiotics, p 203-242. In Piscitelli SC, Rodvold KA, Pai MP (ed), Drug Interactions in Infectious Diseases. Humana Press, New York. 14. Bisht D, Owais M, Venkatesan K. 2006. Potential of plant-derived products in the treatment of mycobacterial infections, p 293-312. In Ahmad I, Aqil F, Owais M (ed), Modern Phytomedicine: Turning Medicinal Plants Into Drugs. Wiley- VCH, Weinheim. 15. Verpoorte R. 2000. Pharmacognosy in the new millenium: Leadfinding and biotechnology. Journal of Pharmacy and Pharmacology 52:253-262. 16. Davis EW. 1995. Ethnobotany: An old practice, a new discipline, p 40-51. In Schultes RE, von Reis S (ed), Ethnobotany: Evolution of a Discpline. Chapman & Hall, London. 17. Gurib-Fakim A. 2006. Medicinal plants: Traditions of yesterday and drugs of tomorrow. Molecular Aspects of Medicine 27:1-93.

187 References

18. Alcorn JB. 1995. The scope and aims of ethnobotany in a developing world, p 23-39. In Schultes RE, von Reis S (ed), Ethnobotany: Evolution of a Discipline. Chapman & Hall, London. 19. Hoffmann A. 1995. Medicinal chemistry's debt to ethnobotany. In Schultes RE, von Reis S (ed), Ethnobotany: Evolution of a Discipline. Chapman & Hall, London. 20. Schultes RE. 1939. Plantae Mexicanae II: The identification of teonanacatl, a narcotic Basidiomycete of the Aztecs. Botanical Museum Leaflets, Harvard University 7:37-56. 21. Johnson JB. 1939. Elements of Mazatec witchcraft. Etnologiska Studier (Gothenburg) 9:128-150. 22. Wasson VP, Wasson RG. 1957. Mushrooms, Russia, and History, vol II. Pantheon Books, New York. 23. Heim R, Wasson RG. 1958. Les Champignons Hallucinogènes du Mexique. Editions du Musée National d'Histoire Naturelle, Paris. 24. Hofmann A, Heim R, Brack A, Kobel H. 1958. Psilocybin, ein psychotroper Wirkstoff aus dem mexikanischen Rauschpilz Psilocybe mexicana Heim. Experientia 14:107-109. 25. Hofmann A, Heim R, Brack A, Kobel H, Frey A, Ott H, Petrzilka T, Troxler F. 1959. Psilocybin und Psilocin, zwei psychotrope Wirkstoffe aus mexikanischen Rauschpilzen. Helvetica Chimica Acta 42:1557-1572. 26. Ashforth EJ, Fu C, Liu X, Dai H, Song F, Guo H, Zhang L. 2010. Bioprospecting for antituberculosis leads from microbial metabolites. Natural Product Reports 27:1709-1719. 27. Fleming A. 1929. On the antibacterial action of the cultures of a penicillium, with special reference to their use in the isolation of B. influenzae. The British Journal of Experimental Pathology 10:226-236. 28. Salim AA, W. CY, Kinghorn AD. 2008. Drug discovery from plants, p 1-24. In Ramawat KG, Mérillon JM (ed), Bioactive Molecules and Medicinal Plants. Springer, Berlin. 29. Martin GE. 2005. Small-volume and high-sensitivity NMR probes. Annual Reports on NMR Spectroscopy 56:1-96. 30. Styles P, Soffe NF, Scott CA, Crag DA, Row F, White DJ, White PCJ. 1984. A high-resolution NMR probe in which the coil and preamplifier are cooled with liquid helium. Journal of Magnetic Resonance (1969) 60:397-404. 31. Black R, Early T, Roemer P, Mueller O, Mogro-Campero A, Turner L, Johnson G. 1993. A high-temperature superconducting receiver for nuclear magnetic resonance microscopy. Science 259:793-795. 32. Walters WP, Namchuk M. 2003. Designing screens: How to make your hits a hit. Nature Reviews Drug Discovery 2:259-266. 33. McCoy M. 2004. Lining up to make a cancer drug. Chemical and Engineering News 82:12-14. 34. Zhou X, Zhu H, Liu L, Lin J, Tang K. 2010. A review: Recent advances and future prospects of taxol-producing endophytic fungi. Applied Microbiology and Biotechnology 86:1707-1717. 35. McAlpine JB, Pazoles C, Stafford A. 1999. Phytera's strategy for the discovery of novel anti-infective agents from plant cell cultures. In Bohlin L, Bruhn JG (ed), Bioassay Method in Natural Product Research and Drug Development. Kluwer Academic Publishers, Dordrecht.

188 References

36. Schulz B, Boyle C. 2006. What are endophytes?, p 1-13. In Schulz B, Boyle C, Sieber T (ed), Microbial Root Endophytes. Springer-Verlag, Berlin. 37. Stone JK, Bacon CW, White JF. 2000. An overview of endophytic microbes: Endophytism defined, p 3-30. In Bacon CW, White JF (ed), Microbial Endophytes. Dekker, New York. 38. Strobel GA. 2003. Endophytes as sources of bioactive products. Microbes and Infection 5:535-544. 39. Ryan RP, Germaine K, Franks A, Ryan DJ, Dowling DN. 2008. Bacterial endophytes: Recent developments and applications. FEMS Microbiology Letters 278:1-9. 40. Schardl CL, Clay K. 1997. Evolution of mutualistic endophytes from plant pathogens, p 221-238. In Carroll GC, Tudzynski P (ed), The Mycota V: Plant Relationships Part B. Springer-Verlag, Berlin. 41. Carroll GC. 1988. Fungal endophytes in stems and leaves: from latent pathogen to mutualistic symbiont. Ecology 69:2-9. 42. Berg G, Hallmann J. 2006. Control of plant pathogenic fungi with bacterial endophytes, p 53-69. In Schulz B, Boyle C, Sieber T (ed), Microbial Root Endophytes. Springer-Verlag, Berlin. 43. Azevedo JL, Maccheroni Jr. W, Pereira JO, de Araújo WL. 2000. Endophytic microorganisms: a review on insect control and recent advances on tropical plants. Electronic Journal of Biotechnology 3:40-65. 44. Hallmann J, Quadt-Hallman A, Rodríguez-Kábana R, Kloepper JW. 1998. Interactions between Meloidogyne incognita and endophytic bacteria in cotton and cucumber. Soil Biology and Biochemistry 30:925-937. 45. Kloepper JW, Ryu CM. 2006. Bacterial endophytes as elicitors of induced systemic resistance, p 33-52. In Schulz B, Boyle C, Sieber T (ed), Microbial Root Endophytes. Springer-Verlag, Berlin. 46. Tudzynski B. 1997. Fungal phytohormones in pathogenic and mutualistic associations, p 167-184. In Carroll GC, Tudzynski P (ed), The Mycota V: Plant Relationships Part A. Springer-Verlag, Berlin. 47. O'Sullivan DJ, O'Gara F. 1992. Traits of fluorescent Pseudomonas spp. involved in suppresion of plant root pathogens. Microbiological Reviews 56:662-676. 48. Richardson AE, Barea JM, McNeill AM, Prigent-Combaret C. 2009. Acquisition of phosphorus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil 321:305-339. 49. Glick BR, Penrose DM, Li JP. 1998. A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria. Journal of Theoretical Biology 190:63-68. 50. Siciliano SD, Fortin N, Mihoc A, Wisse G, Labelle S, Beaumier D, Ouellette D, Roy R, Whyte LG, Banks MK, Schwab P, Lee K, Greer CW. 2001. Selection of specific endophytic bacterial genotypes by plants in response to soil contamination. Applied and Environmental Microbiology 67:2469-2475. 51. Puri SC, Verma V, Amna T, Qazi GN, Spiteller M. 2005. An endophytic fungus from Nothapodytes foetida that produces camptothecin. Journal of Natural Products 68:1717-1719. 52. Puri SC, Nazir A, Chawla R, Arora R, Riyaz-ul-Hasan S, Amna T, Ahmed B, Verma V, Singh S, Sagar R, Sharma A, Kumar R, Sharma RK, Qazi GN. 2006. The endophytic fungus Trametes hirsuta as a novel alternative source of

189 References

podophyllotoxin and related aryl tetralin lignans. Journal of Biotechnology 122:494-510. 53. Kusari S, Verma VC, Lamshoeft M, Spiteller M. 2012. An endophytic fungus from Azadirachta indica A. Juss. that produces azadirachtin. World Journal of Microbiology and Biotechnology 28:1287-1294. 54. Bömke C, Tudzynski B. 2009. Diversity, regulation, and evolution of the gibberellin biosynthetic pathway in fungi compared to plants and bacteria. Phytochemistry 70:1876-1893. 55. Taghavi S, Barac T, Greenberg B, Borremans B, Vangronsveld J, van der Lelie D. 2005. Horizontal gene transfer to endogenous endophytic bacteria from poplar improves phytoremediation of toluene. Applied and Environmental Microbiology 71:8500-8505. 56. Heinig U, Scholz S, Jennewein S. 2013. Getting to the bottom of Taxol biosynthesis by fungi. Fungal Diversity 60:161-170. 57. Wani MC, Taylor HL, Wall ME, Coggon P, McPhail AT. 1971. The isolation and structure of taxol, a novel antileukemic and antitumor agent from Taxus brevifolia. Journal of the American Chemical Society 93:2325-2327. 58. Gunther E. 1945. Ethnobotany of western Washington. University of Washington Press, Washington. 59. Stierle A, Strobel G, Stierle D, Grothaus P, Bignami G. 1995. The search for a taxol-producing microorganism among the endophytic fungi of the Pacific yew, Taxus brevifolia. Journal of Natural Products 58:1315-1324. 60. Hoffmeister D, Keller NP. 2007. Natural products of filamentous fungi: enzymes, genes, and their regulation. Natural Product Reports 24:393-416. 61. Walker K, Croteau R. 2001. Taxol biosynthetic genes. Phytochemistry 58:1-7. 62. Paradkar AS, Jensen SE, Mosher RH. 1997. Comparative genetics and molecular biology of β-lactam biosynthesis, p 241-277. In Strohl WR (ed), Biotechnology of Antibiotics, 2nd ed. Marcel Dekker Inc., New York. 63. Kleinkauf H, von Döhren H. 1996. A nonribosomal system of peptide biosynthesis. European Journal of Biochemistry 236:335-351. 64. Lambalot RH, Gehring AM, Flugel RS, Zuber P, LaCelle M, Marahiel MA, Reid R, Khosla C, Walsh CT. 1996. A new enzyme superfamily - The phosphopantetheinyl transferases. Chemistry and Biology 3:923-936. 65. Marahiel MA, Stachelhaus T, Mootz HD. 1997. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chemical Reviews 97:26512673. 66. Belshaw PJ, Walsh CT, Stachelhaus T. 1999. Aminoacyl-CoAs as probes of condensation domain selectivity in nonribosomal peptide synthesis. Science 284:486-489. 67. Fischbach MA, Walsh CT. 2006. Assembly-line enzymology for polyketide and nonribosomal peptide antiobiotics: Logic, machinery, and mechanisms. Chemical Reviews 106:3468-3496. 68. Keating TA, Walsh CT. 1999. Initiation, elongation, and termination strategies in polyketide and polypeptide antibiotic biosynthesis. Current Opinion in Chemical Biology 3:598-606. 69. Gaitatzis N, Kunze B, Müller R. 2001. In vitro reconstitution of the myxochelin biosynthetic machinery of Stigmatella aurantiaca Sg a15: Biochemical characterization of a reductive release mechanism from nonribosomal peptide synthetases. Proceedings of the National Academy of Sciences of the United States of America 98:11136-11141.

190 References

70. Walsh CT. 1989. Enzymes in the D-alanine branch of bacterial cell wall peptidoglycan assembly. Journal of Biological Chemistry 264:2393-2396. 71. Hoffmann K, Schneider-Scherzer E, Kleinkauf H, Zocher R. 1994. Purification and characterization of eucaryotic alanine racemase acting as key enzyme in cyclosporin biosynthesis. Journal of Biological Chemistry 269:12710-12714. 72. Gehring AM, Mori I, Perry RD, Walsh CT. 1998. The nonribosomal peptide synthetase HMWP2 forms a thiazoline ring during biogenesis of yersiniabactin, an iron-chelating virulence factor of Yersinia pestis. Biochemistry 37:11637- 11650. 73. Schneider TL, Shen B, Walsh CT. 2003. Oxidase domains in epothilone and bleomycin biosynthesis: Thiazoline to thiazole oxidation during chain elongation. Biochemistry 42:9722-9730. 74. Hacker C, Glinski M, Hornbogen T, Doller A, Zocher R. 2000. Mutational analysis of the N-methyltransferase domain of the multifunctional enzyme enniatin synthetase. Journal of Biological Chemistry 275:30826-30832. 75. Miao V, Coëffet-LeGal MF, Brian P, Brost R, Penn J, Whiting A, Martin S, Ford R, Parr I, Bouchard M, Silva CJ, Wrigley SK, Baltz RH. 2005. Daptomycin biosynthesis in Streptomyces roseosporus: cloning and analysis of the gene cluster and revision of peptide stereochemistry. Microbiology 151:1507-1523. 76. Cheng YQ. 2006. Deciphering the biosynthetic codes for the potent anti-SARS- CoV cyclodepsipeptide valinomycin in Streptomyces tsusimaensis ATCC15141. ChemBioChem 7:471-477. 77. Felnagle EA, Rondon MR, Berti AD, Crosby HA, Thomas MG. 2007. Identification of the biosynthetic gene cluster and an additional gene for resistance to the antituberculosis drug capreomycin. Applied and Environmental Microbiology 73:4162-4170. 78. Mootz HD, Schwarzer D, Marahiel MA. 2002. Ways of assembling complex natural products on modular nonribosomal peptide synthetases. ChemBioChem 3:490-504. 79. Raja A, LaBonte J, Lebbos J, Kirkpatrick P. 2003. Daptomycin. Nature Reviews Drug Discovery 2:943-944. 80. Gil JA, Martín JF. 1997. Polyene antibiotics, p 551-575. In Strohl WR (ed), Biotechnology of Antibiotics, 2nd ed. Marcel Dekker Inc., New York. 81. Cane DE. 2010. Programming of erythromycin biosynthesis by a modular polyketide synthase. Journal of Biological Chemistry 285:27517-27523. 82. Chan YA, Podevels AM, Kevany BM, Thomas MG. 2009. Biosynthesis of polyketide synthase extender units. Natural Product Reports 26:90-114. 83. Gross H, Loper JE. 2009. Genomics of secondary metabolite production by Pseudomonas spp. Natural Product Reports 26:1408-1446. 84. Bisang C, Long PF, Cortés J, Westcott J, Crosby J, Matharu AL, Cox RJ, Simpson TJ, Staunton J, Leadlay PF. 1999. A chain initiation factor common to both modular and aromatic polyketide synthases. Nature 401:502-505. 85. Wilkinson CJ, Frost EJ, Staunton J, Leadlay PF. 2001. Chain initiation on the soraphen-producing modular polyketide synthase from Sorangium cellulosum. Chemistry and Biology 8:1197-1208. 86. Rawlings BJ. 2001. Type I polyketide biosynthesis in bacteria (Part A - erythromycin biosynthesis). Natural Product Reports 18:190-227.

191 References

87. Hertweck C, Luzhetskyy A, Rebets Y, Bechthold A. 2007. Type II polyketide synthases: gaining a deeper insight into enzymatic teamwork. Natural Product Reports 24:162-190. 88. Shen B. 2000. Biosynthesis of aromatic polyketides. Topics in Current Chemistry 209:1-51. 89. Grimm A, Madduri K, Ali A, Hutchinson CR. 1994. Characterization of the Streptomyces peucetius ATCC 29050 genes encoding doxorubicin polyketide synthase. Gene 151:1-10. 90. Watanabe K, Praseuth AP, Wang CCC. 2007. A comprehensive and engaging overview of the type III family of polyketide synthases. Current Opinion in Chemical Biology 11:279-286. 91. Austin MB, Noel JP. 2003. The chalcone synthase superfamily of type III polyketide synthases. Natural Product Reports 20:79-110. 92. Gita Bangera M, Thomashow LS. 1999. Identification and characterization of a gene cluster for synthesis of the polyketide antibiotic 2,4- diacetylphloroglucinol from Pseudomonas fluorescens Q2-87. Journal of Bacteriology 181:3155-3163. 93. Du L, Sánchez C, Shen B. 2001. Hybrid peptide-polyketide natural products: Biosynthesis and prospects toward engineering novel molecules. Metabolic Engineering 3:78-95. 94. Pfeifer BA, Wang CCC, Walsh CT, Khosla C. 2003. Biosynthesis of yersiniabactin, a complex polyketide-nonribosomal peptide, using Escherichia coli as a heterologous host. Applied and Environmental Microbiology 69:6698- 6702. 95. Fisch KM. 2013. Biosynthesis of natural products by microbial iterative hybrid PKS-NRPS. RSC Advances 3:18228-18247. 96. Wu K, Chung L, Revill WP, Katz L, Reeves CD. 2000. The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Gene 251:81-90. 97. Gatto Jr. GJ, Boyne MT, Kelleher NL, Walsh CT. 2006. Biosynthesis of pipecolic acid by RapL, a lysine cyclodeaminase encoded in the rapamycin gene cluster. Journal of the American Chemical Society 128:3838-3847. 98. Du L, Sánchez C, Chen M, Edwards DJ, Shen B. 2000. The biosynthetic gene cluster for the antitumor drug bleomycin from Streptomyces verticillus ATCC15003 supporting functional interactions between nonribosomal peptide synthetases and a polyketide synthase. Chemistry and Biology 7:623-642. 99. Boettger D, Hertweck C. 2013. Molecular diversity sculpted by fungal PKS- NRPS hybrids. ChemBioChem 14:28-42. 100. Cox RJ. 2007. Polyketides, proteins and genes in fungi: programmed nano- machines begin to reveal their secrets. Organic and Biomolecular Chemistry 5:2010-2026. 101. Maiya S, Grundmann A, Li X, Li S-M, Turner G. 2007. Identification of a hybrid PKS/NRPS required for pseurotin A biosynthesis in the human pathogen Aspergillus fumigatus. ChemBioChem 8:1736-1743. 102. Ishikawa M, Ninomiya T, Akabane H, Kushida N, Tsujiuchi G, Ohyama M, Gomi S, Shito K, Murata T. 2009. Pseurotin A and its analogues as inhibitors of immunoglobuline E production. Bioorganic and Medicinal Chemistry Letters 19:1457-1460.

192 References

103. Bender CL, Stone HE, Sims JJ, Cooksey DA. 1987. Reduced pathogen fitness of Pseudomonas syringae pv. tomato Tn5 mutants defective in coronatine production. Physiological and Molecular Plant Pathology 30:273-283. 104. Rangaswamy V, Jiralerspong S, Parry R, Bender CL. 1998. Biosynthesis of the Pseudomonas polyketide coronafacic acid requires monofunctional and multifunctional polyketide synthase proteins. Proceedings of the National Academy of Sciences of the United States of America 95:15469-15474. 105. Liyanage H, Penfold C, Turner J, Bender CL. 1995. Sequence, expression and transcriptional analysis of the coronafacate ligase-encoding gene required for coronatine biosynthesis by Pseudomonas syringae. Gene 153:17-23. 106. Koul A, Arnoult E, Lounis N, Guillemont J, Andries K. 2011. The challenge of new drug discovery for tuberculosis. Nature 469:483-490. 107. Ottenhoff THM, Kaufmann SHE. 2012. Vaccine against tuberculosis: Where are we and where do we need to go? PLoS Pathogens 8:e1002607. 108. Frieden TR, Sterling TR, Munsiff SS, Watt CJ, Dye C. 2003. Tuberculosis. Lancet 362:887-899. 109. World Health Organization. 2011. Global Tuberculosis Control. World Health Organization, Press W, Geneva. 110. Grosset J. 1996. Current problems with tuberculosis treatment. Research in Microbiology 147:10-16. 111. Pestka S. 1977. Inhibitors of protein synthesis, p 467-553. In Weissbach H, Pestka S (ed), Molecular Mechanisms of Protein Biosynthesis. Academic Press, New York. 112. Shaw KJ, Rather PN, Hare RS, Miller GH. 1993. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiological Reviews 57:138-163. 113. Alangaden GJ, Kreiswirth BN, Aouad A, Khetarpal M, Igno FR, Moghazeh SL, Manavathu EK, Lerner SA. 1998. Mechanism of resistance to amikacin and kanamycin in Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 42:1295-1297. 114. Finken M, Kirschner P, Meier A, Wrede A, Böttger EC. 1993. Molecular basis of streptomycin resistance in Mycobacterium tuberculosis: Alterations of the ribosomal protein S12 gene and point mutations within a functional 16S ribosomal RNA pseudoknot. Molecular Microbiology 9:1239-1246. 115. Halouska S, Chacon O, Fenton RJ, Zinniel DK, Barletta RG, Powers R. 2007. Use of NMR metabolomics to analyze the targets of D-cycloserine in mycobacteria: role of D-alanine racemase. Journal of Proteome Research 6:4608-4614. 116. Cáceres NE, Harris NB, Wellehan JF, Feng ZY, Kapur V, Barletta RG. 1997. Overexpression of the D-alanine racemase gene confers resistance to D- cycloserine in Mycobacterium smegmatis. Journal of Bacteriology 179:5046- 5055. 117. Wolucka BA, McNeil MR, de Hoffmann E, Chojnacki T, Brennan PJ. 1994. Recognition of the lipid intermediate for arabinogalactan/arabinomannan biosynthesis and its relation to the mode of action of ethambutol on mycobacteria. Journal of Biological Chemistry 269:23328-23335. 118. Lee RE, Mikušová K, Brennan PJ, Besra GS. 1995. Synthesis of the mycobacterial arabinose donor β-D-arabinofuranosyl-1-monophosphoryldecaprenol, development of a basic arabinosyl-transferase assay, and identification of ethambutol as

193 References

an arabinosyl transferase inhibitor. Journal of the American Chemical Society 117:11829-11832. 119. Ramaswamy SV, Amin AG, Göksel S, Stager CE, Dou SJ, El Sahly H, Moghazeh SL, Kreiswirth BN, Musser JM. 2000. Molecular genetic analysis of nucleotide polymorphisms associated with ethambutol resistance in human isolates of Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 44:326-336. 120. Banerjee A, Dubnau E, Quemard A, Balasubramanian V, Um KS, Wilson T, Collins D, de Lisle G, Jacobs Jr. WR. 1994. inhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis. Science 263:227- 230. 121. Baulard AR, Betts JC, Engohang-Ndong J, Quan S, McAdam RA, Brennan PJ, Locht C, Besra GS. 2000. Activation of the pro-drug ethionamide is regulated in mycobacteria. Journal of Biological Chemistry 275:28326-28331. 122. Engohang-Ndong J, Baillat D, Aumercier M, Bellefontaine F, Besra GS, Locht C, Baulard AR. 2004. EthR, a repressor of the TetR/CamR family implicated in ethionamide resistance in mycobacteria, octamerizes cooperatively on its operator. Molecular Microbiology 51:175-188. 123. Drlica K, Zhao X. 1997. DNA gyrase, topoisomerase IV, and the 4-quinolones. Microbiology and Molecular Biology Reviews 61:377-392. 124. Alangaden GJ, Manavathu EK, Vakulenko SB, Zvonok NM, Lerner SA. 1995. Characterization of fluoroquinolone-resistant mutant strains of Mycobacterium tuberculosis selected in the laboratory and isolated from patients. Antimicrobial Agents and Chemotherapy 39:1700-1703. 125. Aubry A, Veziris N, Cambau E, Truffot-Pernot C, Jarlier V, Fisher LM. 2006. Novel gyrase mutations in quinolone-resistant and -hypersusceptible clinical isolates of Mycobacterium tuberculosis: functional analysis of mutant enzymes. Antimicrobial Agents and Chemotherapy 50:104-112. 126. Takayama K, Schnoes HK, Armstrong EL, Boyle RW. 1975. Site of inhibitory action of isoniazid in the synthesis of mycolic acids in Mycobacterium tuberculosis. Journal of Lipid Research 16:308-317. 127. Rozwarski DA, Grant GA, Barton DHR, Jacobs Jr. WR, Sacchettini JC. 1998. Modification of the NADH of the isoniazid target (InhA) from Mycobacterium tuberculosis. Science 279. 128. Zhang Y, Heym B, Allen B, Young D, Cole ST. 1992. The catalase-peroxidase gene and isoniazid resistance of Mycobacterium tuberculosis. Nature 358:591- 593. 129. Rouse DA, Li Z, Bai GH, Morris SL. 1995. Characterization of the katG and inhA genes of isoniazid-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 39:2472-2477. 130. Bergval IL, Schuitema ARJ, Klatser PR, Anthony RM. 2009. Resistant mutant of Mycobacterium tuberculosis selected in vitro do not reflect the in vivo mechanism of isoniazid resistance. Journal of Antimicrobial Chemotherapy 64:515-523. 131. Phetsuksiri B, Jackson M, H. S, McNeil M, Besra GS, Baulard AR, Slayden RA, deBarber AE, Barry III CE, Baird MS, Crick DC, Brennan PJ. 2003. Unique mechanism of action of the thiourea drug isoxyl on Mycobacterium tuberculosis. Journal of Biological Chemistry 278:53123-53130. 132. DeBarber AE, Mdluli K, Bosman M, Bekker LG, Barry III CE. 2000. Ethionamide activation and sensitivity in multidrug-resistant Mycobacterium

194 References

tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 97:9677-9682. 133. Taubman SB, Jones NR, Young FE, Corcoran JW. 1966. Sensitivity and resistance to erythromycin in Bacillus subtilis 168: The ribosomal binding of erythromycin and chloramphenicol. Biochimica et Biophysica Acta 123:438- 440. 134. Meier A, Kirschner P, Springer B, Steingrube VA, Brown BA, Wallace Jr. RJ, Böttger EC. 1994. Identification of mutations in 23S rRNA gene of clarithromycin-resistant Mycobacterium intracellulare. Antimicrobial Agents and Chemotherapy 38:381-384. 135. Nakajima Y. 1999. Mechanisms of bacterial resistance to macrolide antibiotics. Journal of Infection and Chemotherapy 5:61-74. 136. Andini N, Nash KA. 2006. Intrinsic macrolide resistance of the Mycobacterium tuberculosis complex is inducible. Antimicrobial Agents and Chemotherapy 50:2560-2562. 137. Shinabarger DL, Marotti KR, Murray RW, Lin AH, Melchior EP, Swaney SM, Dunyak DS, Demyan WF, Buysee JM. 1997. Mechanism of action of oxazolidinones: Effects of linezolid and eperezolid on translation reactions. Antimicrobial Agents and Chemotherapy 41:2132-2136. 138. Richter E, Rüsch-Gerdes S, Hillemann D. 2007. First linezolid-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 51:1534-1536. 139. Rengarajan J, Sassetti CM, Naroditskaya V, Sloutsky A, Bloom BR, J. RE. 2004. The folate pathway is a target for resistance to the drug para- aminosalicylic acid (PAS) in mycobacteria. Molecular Microbiology 53:275- 282. 140. Mathys V, Wintjens R, Lefevre P, Bertout J, Singhal A, Kiass M, Kurepina N, Wang XM, Mathema B, Baulard A, Kreiswirth BN, Bifani P. 2009. Molecular genetics of para-aminosalicylic acid resistance in clinical isolates and spontaneous mutants of Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 53:2100-2109. 141. Heifets L, Lindholm-Levy P. 1992. Pyrazinamide sterilizing activity in vitro against semi-dormant Mycobacterium tuberculosis bacterial populations. American Review of Respiratory Diseases 145:1223-1225. 142. Zhang Y, Scorpio A, Nikaido H, Sun Z. 1999. Role of acid pH and deficient efflux of pyrazinoic acid in unique susceptibility of Mycobacterium tuberculosis to pyrazinamide. Journal of Bacteriology 181:2044-2049. 143. Zhang Y, Mitchison D. 2003. The curious characteristics of pyrazinamide: A review. The International Journal of Tuberculosis and Lung Disease 7:6-21. 144. Scorpio A, Lindholm-Levy P, Heifets L, Gilman R, Siddiqi S, Cynamon MH, Zhang Y. 1997. Characterization of pncA mutations in pyrazinamide- resistant Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 41:540-543. 145. Kunin CM. 1996. Antimicrobial activity of rifabutin. Clinical Infectious Diseases 22:S3-S14. 146. Engelberg-Kulka H, Sat B, Reches M, Amitai S, Hazan R. 2004. Bacterial programmed cell death systems as targets for antibiotics. Trends in Microbiology 12:66-71.

195 References

147. Telenti A, Imboden P, Marchesi F, Lowrie D, Cole ST, Colston MJ, Matter L, Schopfer K, Bodmer T. 1993. Detection of rifampicin-resistance mutations in Mycobacterium tuberculosis. Lancet 341:647-650. 148. Cholo MC, Boshoff HI, Steel HC, Cockeran R, Matlola NM, Downing KJ, Mizrahi V, Anderson R. 2006. Effects of clofazimine on potassium uptake by a Trk-deletion mutant of Mycobacterium tuberculosis. Journal of Antimicrobial Chemotherapy 57:79-84. 149. Boshoff HI, Myers TG, Copp BR, McNeil MR, Wilson MA, Barry III CE. 2004. The transcriptional responses of Mycobacterium tuberculosis to inhibitors of metabolism: novel insights into drug mechanisms of action. Journal of Biological Chemistry 279:40174-10184. 150. Xu HB, Jiang RH, Xiao HP. 2011. Clofazimine in the treatment of multidrug- resistant tuberculosis. Clinical Microbiology and Infection doi:10.1111/j.1469- 0691.2011.03716.x. 151. Alahari A, Alibaud L, Trivelli X, Gupta R, Lamichhane G, Reynolds RC, Bishai WR, Guerardel Y, Kremer L. 2009. Mycolic acid methyltransferase, MmaA4, is necessary for thiacetazone susceptibility in Mycobacterium tuberculosis. Molecular Microbiology 71:1263-1277. 152. Thomas MG, Chan YA, Ozanick SG. 2003. Deciphering tuberactinomycin biosynthesis: Isolation, sequencing, and annotation of the viomycin biosynthetic gene cluster. Antimicrobial Agents and Chemotherapy 47:2823-2830. 153. Liou YF, Tanaka N. 1976. Dual actions of viomycin on the ribosomal functions. Biochemical and Biophysical Research Communications 71:477-483. 154. Wank H, Rogers J, Davies J, Schroeder R. 1994. Peptide antibiotics of the tuberactinomycin family as inhibitors of group I intron RNA splicing. Journal of Molecular Biology 236:1001-1010. 155. Yamada T, Mizugichi Y, Nierhaus KH, Wittmann HG. 1978. Resistance to viomycin conferred by RNA of either ribosomal subunit. Nature 275:460-461. 156. Taniguchi H, Chang B, Abe C, Nikaido Y, Mizuguchi Y, Yoshida SI. 1997. Molecular analysis of kanamycin and viomycin resistance in Mycobacterium smegmatis by use of the conjugation system. Journal of Bacteriology 179:4795- 4801. 157. Jarlier V, Nikaido H. 1994. Mycobacterial cell wall: Structure and role in natural resistance to antibiotics. FEMS Microbiology Letters 123:11-18. 158. Louw GE, Warren RM, van Pittius NCG, McEvoy CRE, van Helden PD, Victor TC. 2009. A balancing act: Efflux/influx in mycobacterial drug resistance. Antimicrobial Agents and Chemotherapy 53:3181-3189. 159. Domenech P, Barry III CE, Cole ST. 2001. Mycobacterium tuberculosis in the post-genomic age. Current Opinion in Microbiology 4:28-34. 160. Rattan A, Kalia A, Ahmad N. 1998. Multidrug-resistant Mycobacterium tuberculosis: Molecular prespectives. Emerging Infectious Diseases 4:195-209. 161. Cohen J. 2013. Approval of novel TB drug celebrated - with restraint. Science 339:130. 162. Diacon AH, Pym A, Grobusch M, Patientia R, Rustomjee R, Page-Shipp L, Pistorius C, Krause R, Bogoshi M, Churchyard G, Venter A, Allen J, Palomino JC, De Marez T, van Heeswijk RPG, Lounis N, Meyvisch P, Verbeeck J, Parys W, de Beule K, Andries K, McNeeley DF. 2009. The diarylquinoline TMC207 for multidrug-resistant tuberculosis. The New England Journal of Medicine 360:2397-2405.

196 References

163. Diacon AH, Donald PR, Pym A, Grobusch M, Patientia RF, Mahanyele R, Bantubani N, Narasimooloo R, de Marez T, van Heeswijk RPG, Lounis N, Meyvisch P, Andries K, McNeeley DF. 2012. Randomized pilot trial of eight weeks of bedaquiline (TMC207) treatment for multidrug-resistant tuberculosis: Long-term outcome, tolerability, and effect on emergence of drug resistance. Antimicrobial Agents and Chemotherapy 56:3271-3276. 164. Osborne R. 2013. First novel anti-tuberculosis drug in 40 years. Nature Biotechnology 31:89-91. 165. Andries K, Verhasselt P, Guillemont J, Göhlmann HWH, Neefs JM, Winkler H, Van Gestel J, Timmerman P, Zhu M, Lee E, Williams P, de Chaffoy D, Huitric E, Hoffner S, Cambau E, Truffot-Pernot C, Lounis N, Jarlier V. 2005. A diarylquinoline drug active on the ATP synthase of Mycobacterium tuberculosis. Science 307:223-227. 166. Koul A, Vranckx L, Dendouga N, Balemans W, van den Wyngaert I, Vergauwen K, Göhlmann HWH, Willebrords R, Poncelet A, Guillemont J, Bald D, Andries K. 2008. Diarylquinolines are bactericidal for dormant mycobacteria as a result of disturbed ATP homeostatis. Journal of Biological Chemistry 283:25273-25280. 167. Huitric E, Verhasselt P, Koul A, Andries K, Hoffner S, Andersson DI. 2010. Rates and mechanisms of resistance development in Mycobacterium tuberculosis to a novel diarylquinoline ATP synthase inhibitor. Antimicrobial Agents and Chemotherapy 54:1022-1028. 168. Stover CK, Warrener P, VanDevanter DR, Sherman DR, Arain TM, Langhorne MH, Anderson SW, Towell JA, Yuan Y, McMurray DN, Kreiswirth BN, Barry III CE, Baker WR. 2000. A small-molecule nitroimidazopyran drug candidate for the treatment of tuberculosis. Nature 405:962-966. 169. Singh R, Manjunatha U, Boshoff HI, Ha YH, Niyomrattanakit P, Ledwidge R, Dowd CS, Lee IY, Kim P, Zhang L, Kang S, Keller TH, Jiricek J, Barry III CE. 2008. PA-824 kills nonreplicating Mycobacterium tuberculosis by intracellular NO release. Science 322:1392-1395. 170. Maroz A, Shinde SS, Franzblau SG, Ma ZK, Denny WA, Palmer BD, Anderson RF. 2010. Release of nitrite from the antitubercular nitroimidazole drug PA-824 and analogues upon one-electron reduction in protic, non-aqueous solvent. Organic and Biomolecular Chemistry 8:413-418. 171. Manjunatha U, Boshoff HI, Barry III CE. 2009. The mechanism of action of PA-824: Novel insights from transcriptional profiling. Communicative and Integrative Biology 2:215-218. 172. Manjunatha U, Boshoff HI, Dowd CS, Zhang L, Albert TJ, Norton JE, Daniels L, Dick T, Pang SS, Barry III CE. 2006. Identification of a nitroimidazo-oxazine-specific protein involved in PA-824 resistance in Mycobacterium tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 103:431-436. 173. Jones D. 2013. Tuberculosis success. Nature Reviews Drug Discovery 12:175- 176. 174. Matsumoto M, Hashizume H, Tomishige T, Kawasaki M, Tsubouchi H, Sasaki H, Shimokawa Y, Komatsu M. 2006. OPC-67683, a nitro-dihydro- imidazooxazole derivative with promising action against tuberculosis in vitro and in mice. PLoS Medicine 3:e466.

197 References

175. Gler MT, Skripconoka V, Sanchez-Garavito E, Xiao HP, Cabrera-Rivero JL, Vargas-Vasquez DE, Gao MQ, Awad M, Park SK, Shim TS, Suh GY, Danilovits M, Ogata H, Kurve A, Chang J, Suzuki K, Tupasi T, Koh WJ, Seaworth B, Geiter LJ, Wells CD. 2012. Delamanid for multidrug-resistant pulmonary tuberculosis. The New England Journal of Medicine 366:2151-2160. 176. Sacksteder KA, Protopopova M, Barry III CE, Andries K, Nacy CA. 2012. Discovery and development of SQ109: A new antitubercular drug with a novel mechanism of action. Future Medicine 7:823-837. 177. Tahlan K, Wilson R, Kastrinsky DB, Arora K, Nair V, Fischer E, Barnes W, Walker JR, Alland D, Barry III CE, Boshoff HI. 2012. SQ 109 MmpL3, a membrane transporter of trehalose monomycolate involved in mycolic acid donation to the cell wall core of Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 56:1797-1809. 178. Barbachyn MR, Hutchinson DK, Brickner SJ, Cynamon MH, Kilburn JO, Klemens SP, Glickman SE, Grega KC, Hendges SK, Toops DS, Ford CW, Zurenko GE. 1996. Identification of a novel oxazolidinone (U-100480) with potent antimycobacterial activity. Journal of Medicinal Chemistry 39:680-685. 179. Patel U, Yan YP, Hobbs Jr. FW, Kaczmarczyk J, Slee AM, Pompliano DL, Kurilla MG, Bobkova EV. 2001. Oxazolidinones mechanism of action: Inhibition of the first peptide bond formation. Journal of Biological Chemistry 276:37199-37205. 180. Changsen C, Franzblau SG, Palittapongarnpim P. 2003. Improved green fluorescent protein reporter gene-based microplate screening for antituberculosis compounds by utilizing an acetamidase promoter. Antimicrobial Agents and Chemotherapy 47:3682-3687. 181. Schaeffer ML, Carson JD, Kallender H, Lonsdale JT. 2004. Development of a scintillation proximity assay for the Mycobacterium tuberculosis KasA and KasB enzymes involved in mycolic acid biosynthesis. Tuberculosis 84:353-360. 182. Scherman MS, Winans KA, Stern RJ, Jones V, Bertozzi CR, McNeil MR. 2003. Drug targeting Mycobacterium tuberculosis cell wall synthesis: Development of a microtiter plate-based screen for UDP-galactopyranose mutase and identification of an inhibitor from a uridine-based library. Antimicrobial Agents and Chemotherapy 47:378-382. 183. Lenaerts AJM, Gruppo V, Brooks JV, Orme IM. 2003. Rapid in vivo screening of experimental drugs for tuberculosis using gamma interferon gene- disrupted mice. Antimicrobial Agents and Chemotherapy 47:783-785. 184. Copp BR, Pearce AN. 2007. Natural product growth inhibitors of Mycobacterium tuberculosis. Natural Product Reports 24:278-297. 185. Salomon CE, Schmidt LE. 2012. Natural products as leads for tuberculosis drug development. Current Topics in Medicinal Chemistry 12:735-765. 186. Singh SB, Pelaez F. 2008. Biodiversity, chemical diversity, and drug discovery. Progress in Drug Research 65:143-174. 187. Farnsworth NR, Akerele O, Bingel AS, Soejarto DD, Guo Z. 1985. Medicinal plants in therapy. Bulletin of the World Health Organization 63:965- 981. 188. Rukachaisirikul V, Sommart U, Phongpaichit S, Sakayaroj J, Kirtikara K. 2008. Metabolites from the endophytic fungus Phomopsis sp. PSU-D15. Phytochemistry 69:783-787. 189. Haritakun R, Rachtawee P, Komwijit S, Nithithanasilp S, Isaka M. 2012. Highly conjugated ergostane-type steroids and aranotin-type diketopiperazines

198 References

from the fungus Aspergillus terreus BCC 4651. Helvetica Chimica Acta 95:308- 313. 190. Koyama N, Kojima S, Nonaka K, Masuma R, Matsumoto M, Ōmura S, Tomoda H. 2010. Calpinactam, a new anti-mycobacterial agent, produced by Mortierella alpina FKI-4905. The Journal of Antibiotics 63:183-186. 191. Haritakun R, Sappan M, Suvannakad R, Tasanathai K, Isaka M. 2010. An antimycobacterial cyclodepsipeptide from the entomopathogenic fungus Ophiocordyceps communis BCC 16475. Journal of Natural Products 73:75-78. 192. Mukai A, Fukai T, Hoshino Y, Yazawa K, Harada K, Mikami Y. 2009. Nocardithiocin, a novel thiopeptide antibiotic, produced by pathogenic Nocardia pseudobrasiliensis IFM 0757. The Journal of Antibiotics 62:613-619. 193. Xie Y, Xu H, Sun C, Yu Y, Chen R. 2010. Two novel nucleosidyl-peptide antibiotics: Sansanmycin F and G produced by Streptomyces sp SS. The Journal of Antibiotics 63:143-146. 194. Pruksakorn P, Arai M, Kotoku N, Vilchèze C, Baughn AD, Moodley P, Jacobs Jr. WR, Kobayasi M. 2010. Trichoderins, novel aminolipopeptides from a marine sponge-derived Trichoderma sp., are active against dormant mycobacteria. Bioorganic and Medicinal Chemistry Letters 20:3658-3663. 195. Pittayakhajonwut P, Sohsomboon P, Dramae A, Suvannakad R, Lapanun S, Tantichareon M. 2008. Antimycobacterial substances from Phaeosphaeria sp BCC8292. Planta Medica 74:281-286. 196. Cheng MJ, Wu MD, Yanai H, Su YS, Chen IS, Yuan GF, Hsieh SY, Chen JJ. 2012. Secondary metabolites from the endophytic fungus Biscogniauxia formosana and their antimycobacterial activity. Phytochemistry Letters 5:467- 472. 197. Phonkerd N, Kanokmedhakul S, Kanokmedhakul K, Soytong K, Prabpai S, Kongsaeree P. 2008. Bis-spiro-azaphilones and azaphilones from the fungi Chaetomium cochliodes VTh01 and C. cochliodes CTh05. Tetrahedron 64:9636- 9645. 198. Khumkomkhet P, Kanokmedhakul S, Kanokmedhakul K, Hahnvajanawong C, Soytong K. 2009. Antimalarial and cytotoxic depsidones from the fungus Chaetomium brasiliense. Journal of Natural Products 72:1487- 1491. 199. Centko RM, Ramón-García S, Taylor T, Patrick BO, Thompson CJ, Miao VP, Andersen RJ. 2012. Ramariolides A-D, antimycobacterial butenolides isolated from the mushroom Ramaria cystidiophora. Journal of Natural Products 75:2178-2182. 200. Stanikunaite R, Radwan MM, Trappe JM, Fronczek F, Ross SA. 2008. Lanostane-type triterpenes from the mushroom Astraeus pteridis with antituberculosis activity. Journal of Natural Products 71:2077-2079. 201. Arpha K, Phosri C, Suwannasai N, Monkolthanaruk W, Sodngam S. 2012. Astraodoric acids A-D: New lanostante triterpenes from edible mushroom Astraeus odoratus and their anti-Mycobacterium tuberculosis H37Ra and cytotoxic activity. Journal of Agricultural and Food Chemistry 60:9834-9841. 202. Isaka M, Palasarn S, Supothina S, Komwijit S, Luangsa-ard JJ. 2011. Bioactive compounds from the scale insect pathogenic fungus Conoideocrella tenuis BCC 18627. Journal of Natural Products 74:782-789. 203. Bunyapaiboonsri T, Veeranondha S, Boonruangprapa T, Somrithipol S. 2008. Ramiferin, a bisphenol-sesquiterpene from the fungus Kionochaeta ramifera BCC 7585. Phytochemistry Letters 1:204-206.

199 References

204. Wiyakrutta S, Sriubolmas N, Panphut W, Thongon N, Danwisetkanjana K, Ruangrungsi N, Meevootisom V. 2004. Endophytic fungi with anti-microbial, anti-cancer and anti-malarial activities isolated from Thai medicinal plants. World Journal of Microbiology and Biotechnology 20:265-272. 205. Miller KI, Qing C, Sze DMY, Roufogalis BD, Neilan BA. 2012. Culturable endophytes of medicinal plants and the genetic basis for their bioactivity. Microbial Ecology 64:431-449. 206. Myers N, Mittermeier RA, da Fonseca GAB, Kent J. 2000. Biodiversity hotspots for conservation priorities. Nature 403:853-858. 207. Schumacher T. 1999. Plants used in medicine, p 68-69. In Whitten T, Whitten J (ed), Indonesian Heritage: Plants, vol 4. Archipelago Press, Singapore. 208. Steffan B, Wätjen W, Michels G, Niering P, Wray V, Ebel R, Edrada RA, Kahl R, Proksch P. 2005. Polyphenols from plants used in traditional Indonesian medicine (Jamu): uptake and antioxidative effects in rat H4IIE hepatoma cells. Journal of Pharmacy and Pharmacology 57:233-240. 209. Stevensen C. 1999. Jamu: An Indonesian herbal tradition with a long past, a little known present and an uncertain future. Complementary Therapies in Nursing and Midwifery 5:1-3. 210. Limyati DA, Juniar BLL. 1998. Jamu gendong, a kind of traditional medicine in Indonesia: The microbial contamination of its raw materials and endproduct. Journal of Ethnopharmacology 63:201-208. 211. Dalimartha S. 1999. Atlas Tumbuhan Obat Indonesia, vol 1. Trubus Agriwidya, Jakarta. 212. Dalimartha S. 2000. Atlas Tumbuhan Obat Indonesia, vol 2. Trubus Agriwidya, Jakarta. 213. Dalimartha S. 2009. Atlas Tumbuhan Obat Indonesia, vol 6. Pustaka Bunda, Jakarta. 214. de Padua LS, Bunyapraphatsara N, Lemmens RHMJ (ed). 1999. Plant Resources of South-East Asia: Medicinal and Poisonous Plants 1. Prosea, Bogor. 215. Dalimartha S. 2006. Atlas Tumbuhan Obat Indonesia, vol 4. Puspa Swara, Jakarta. 216. Dalimartha S. 2003. Atlas Tumbuhan Obat Indonesia, vol 3. Puspa Swara, Jakarta. 217. Dalimartha S. 2008. Atlas Tumbuhan Obat Indonesia, vol 5. Pustaka Bunda, Jakarta. 218. Gordon B. 2007. Jeweler of the jungle. Americas (English edition) 59:38-45. 219. Petrini O. 1991. Fungal endophytes of tree leaves, p 179-197. In Andrews JH, Hirano SS (ed), Microbial Ecology of Leaves doi:10.1007/978-1-4612-3168- 4_9. Springer New York. 220. Hawksworth DL. 2012. Global species numbers of fungi: Are tropical studies and molecular approaches contributing to a more robust estimate? Biodiversity and Conservation 21:2425-2433. 221. Cox PA, Balick MJ. 1994. The ethnobotanical approach to drug discovery. Scientific American 270:60-65. 222. Fabricant DS, Farnsworth NR. 2001. The value of plants used in traditional medicine for drug discovery. Environmental Health Perspectives 109:69-75. 223. Gyllenhaal C, Kadushin MR, Southavong B, Sydara K, Bouamanivong S, Xaiveu M, Xuan LT, Hiep NT, Hung NV, Loc PK, Dac LX, Bich TQ, Cuong NM, Ly HM, Zhang HJ, Franzblau SG, Xie H, Riley MC, Elkington BG, Nguyen HT, Waller DP, Ma CY, Tamez P, Tan GT, Pezzuto JM, Soejarto

200 References

DD. 2012. Ethnobotanical approach versus random approach in the search for new bioactive compounds: Support of a hypothesis. Pharmaceutical Biology 50:30-41. 224. Castillo UF, Strobel GA, Ford EJ, Hess WM, Porter H, Jensen JB, Albert H, Robison R, Condron MAM, Teplow DB, Stevens D, Yaver D. 2002. Munumbicins, wide-spectrum antibiotics produced by Streptomyces NRRL 30562, endophytic on Kennedia nigriscans. Microbiology 148:2675-2685. 225. Ministry for Health of the Republic of Indonesia. 1995. Farmakope Indonesia (Indonesian Pharmacopoeia), 4th ed. Ministry for Health of the Republic of Indonesia, Jakarta. 226. Silver LL. 2011. Challenges of antibacterial discovery. Clinical Microbiology Reviews 24:71-109. 227. Livermore DM. 2011. Discovery research: The scientific challenge of finding new antibiotics. Journal of Antimicrobial Chemotherapy 66:1941-1944. 228. Evans BS, Robinson SJ, Kelleher NL. 2011. Surveys of non-ribosomal peptide and polyketide assembly lines in fungi and prospects for their analysis in vitro and in vivo. Fungal Genetics and Biology 48:49-61. 229. Moffitt MC, Neilan BA. 2001. On the presence of peptide synthetase and polyketide synthase genes in the cyanobacterial genus Nodularia. FEMS Microbiology Letters 196:207-214. 230. Neilan BA, Dittmann E, Rouhiainen L, Bass RA, Schaub V, Sivonen K, Börner T. 1999. Nonribosomal peptide synthesis and toxigenicity of cyanobacteria. Journal of Bacteriology 181:4089-4097. 231. Watve M, Shejval V, Sonawane C, Rahalkar M, Matapurkar A, Shouche Y, Patole M, Phadnis N, Champhenkar A, Damle K. 2000. The 'K' selected oligophilic bacteria: A key to uncultured diversity? Current Science 78:1535- 1542. 232. Ferrari BC, Binnerup SJ, Gillings M. 2005. Microcolony cultivation on a soil substrate membrane system selects for previously uncultured soil bacteria. Applied and Environmental Microbiology 71:8714-8720. 233. Tillett D, Neilan BA. 2000. Xanthogenate nucleic acid isolation from cultured and environmental cyanobacteria. Journal of Phycology 36:251-258. 234. Neilan BA, Jacobs D, Therese DD, Blackall LL, Hawkins PR, Cox PT, Goodman AE. 1997. rRNA sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus Microcystis. International Journal of Systematic Bacteriology 47:693-697. 235. Borneman J, Hartin RJ. 2000. PCR primers that amplify fungal rRNA genes from environmental samples. Applied and Environmental Microbiology 66:4356-4360. 236. Edgar RC. 2004. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792-1797. 237. Edgar RC. 2004. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5:113-113. 238. Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41:95-98. 239. Pfeifer BA, Admiraal SJ, Gramajo H, Cane DE, Khosla C. 2001. Biosynthesis of complex polyketides in a metabolically engineered strain of Escherichia coli. Science 291:1790-1792.

201 References

240. Cui JL, Guo SX, Xiao PG. 2011. Antitumor and antimicrobial activities of endophytic fungi from medicinal parts of Aquilaria sinensis. Journal of Zhejiang University Science B 12:385-392. 241. Sutton B. 1992. The genus Glomerella and its anamorph Colletotrichum, p 1- 26. In Bailey J, Jeger M (ed), Colletotrichum: Biology, Pathology and Control. 242. Rodrigues KF, Sieber TN, GrüNig CR, Holdenrieder O. 2004. Characterization of Guignardia mangiferae isolated from tropical plants based on morphology, ISSR-PCR amplifications and ITS1–5.8S-ITS2 sequences. Mycological Research 108:45-52. 243. Udayanga D, Liu X, Crous P, McKenzie EC, Chukeatirote E, Hyde K. 2012. A multi-locus phylogenetic evaluation of Diaporthe (Phomopsis). Fungal Diversity 56:157-171. 244. Ariyawansa HA, Tanaka K, Thambugala KM, Phookamsak R, Tian Q, Camporesi E, Hongsanan S, Monkai J, Wanasinghe DN, Mapook A, Chukeatirote E, Kang J-C, Xu J-C, McKenzie EHC, Jones EBG, Hyde KD. 2014. A molecular phylogenetic reappraisal of the Didymosphaeriaceae (= Montagnulaceae). Fungal Diversity 68:69-104. 245. Burgess T, Wingfield MJ, Wingfield BW. 2001. Simple sequence repeat markers distinguish among morphotypes of Sphaeropsis sapinea. Applied and Environmental Microbiology 67:354-362. 246. Tavaré S. 1986. Some probabilistic and statistical problems in the analysis of DNA sequences. Lectures on Mathematics in the Life Sciences 17:57-86. 247. Hallmann J, Quadt-Hallmann A, Mahaffee WF, Kloepper JW. 1997. Bacterial endophytes in agricultural crops. Canadian Journal of Microbiology 43:895-914. 248. Elbeltagy A, Nishioka K, Sato T, Suzuki H, Ye B, Hamada T, Isawa T, Mitsui H, Minamisawa K. 2001. Endophytic colonization and in planta nitrogen fixation by a Herbaspirillum sp. isolated from wild rice species. Applied and Environmental Microbiology 67:5285-5293. 249. Araújo WL, Marcon J, Maccheroni W, van Elsas JD, van Vuurde JWL, Azevedo JL. 2002. Diversity of endophytic bacterial populations and their interaction with Xylella fastidiosa in citrus plants. Applied and Environmental Microbiology 68:4906-4914. 250. Fang Y, Lu Z, Lv F, Bie X, Liu S, Ding Z, Xu W. 2006. A newly isolated organic solvent tolerant Staphylococcus saprophyticus M36 produced organic solvent-stable lipase. Current Microbiology 53:510-515. 251. Mano H, Tanaka F, Nakamura C, Kaga H, Morisaki H. 2007. Culturable endophytic bacterial flora of the maturing leaves and roots of rice plants (Oryza sativa) cultivated in a paddy field. Microbes and Environments 22:175-185. 252. Morohoshi T, Wang W-Z, Someya N, Ikeda T. 2011. Genome sequence of Microbacterium testaceum StLB037, an N-acylhomoserine lactone-degrading bacterium isolated from potato leaves. Journal of Bacteriology 193:2072-2073. 253. Ho YN, Chiang HM, Chao CP, Su CC, Hsu HF, Guo CT, Hsieh JL, Huang CC. 2014. In planta biocontrol of soilborne Fusarium wilt of banana through a plant endophytic bacterium, Burkholderia cenocepacia 869T2. Plant and Soil doi:10.1007/s11104-014-2297-0:1-12. 254. Chi F, Shen S-H, Cheng H-P, Jing Y-X, Yanni YG, Dazzo FB. 2005. Ascending migration of endophytic rhizobia, from roots to leaves, inside rice plants and assessment of benefits to rice growth physiology. Applied and Environmental Microbiology 71:7271-7278.

202 References

255. von Rozycki T, Nies D. 2009. Cupriavidus metallidurans: Evolution of a metal- resistant bacterium. Antonie van Leeuwenhoek 96:115-139. 256. Mergeay M, Monchy S, Janssen P, Houdt R, Leys N. 2009. Megaplasmids in Cupriavidus genus and metal resistance, p 209-238. In Schwartz E (ed), Microbial Megaplasmids, vol 11. Springer Berlin Heidelberg. 257. Cavalheiro JMBT, de Almeida MCMD, Grandfils C, da Fonseca MMR. 2009. Poly(3-hydroxybutyrate) production by Cupriavidus necator using waste glycerol. Process Biochemistry 44:509-515. 258. Chen W-M, Wu C-H, James EK, Chang J-S. 2008. Metal biosorption capability of Cupriavidus taiwanensis and its effects on heavy metal removal by nodulated Mimosa pudica. Journal of Hazardous Materials 151:364-371. 259. Kokane DD, More RY, Kale MB, Nehete MN, Mehendale PC, Gadgoli CH. 2009. Evaluation of wound healing activity of root of Mimosa pudica. Journal of Ethnopharmacology 124:311-315. 260. Sheng X-F, Xia J-J, Jiang C-Y, He L-Y, Qian M. 2008. Characterization of heavy metal-resistant endophytic bacteria from rape (Brassica napus) roots and their potential in promoting the growth and lead accumulation of rape. Environmental Pollution 156:1164-1170. 261. Achour-Rokbani A, Cordi A, Poupin P, Bauda P, Billard P. 2010. Characterization of the ars gene cluster from extremely arsenic-resistant Microbacterium sp. strain A33. Applied and Environmental Microbiology 76:948-955. 262. Wicke C, Hüners M, Wray V, Nimtz M, Bilitewski U, Lang S. 2000. Production and structure elucidation of glycoglycerolipids from a marine sponge-associated Microbacterium species. Journal of Natural Products 63:621- 626. 263. Letourneau A, Seena S, Marvanová L, Bärlocher F. 2010. Potential use of barcoding to identify aquatic hyphomycetes. Fungal Diversity 40:51-64. 264. Tan RX, Zou WX. 2001. Endophytes: A rich source of functional metabolites. Natural Product Reports 18:448-459. 265. Huang Y, Wang J, Li G, Zheng Z, Su W. 2001. Antitumor and antifungal activities in endophytic fungi isolated from pharmaceutical plants Taxus mairei, Cephalataxus fortunei and Torreya grandis. FEMS Immunology and Medical Microbiology 31:163-167. 266. Ge HM, Song YC, Chen JR, Hu S, Wu JY, Tan RX. 2006. Paranolin: A new xanthene-based metabolite from Paraphaeosphaeria nolinae. Helvetica Chimica Acta 89:502-506. 267. Zhang W, Krohn K, Draeger S, Schulz B. 2008. Bioactive isocoumarins isolated from the endophytic fungus Microdochium bolleyi. Journal of Natural Products 71:1078-1081. 268. Kharwar RN, Verma VC, Strobel G, Ezra D. 2008. The endophytic fungal complex of Catharanthus roseus (L.) G. Don. Current Science 95:228-233. 269. Wang H-k, Hyde KD, Soytong K, Lin F-c. 2008. Fungal diversity on fallen leaves of Ficus in northern Thailand. Journal of Zhejiang University Science B 9:835-841. 270. Sati SC, Arya P, Belwal M. 2009. Tetracladium nainitalense sp. nov., a root endophyte from Kumaun Himalaya, India. Mycologia 101:692-695. 271. Xu S, Ge HM, Song YC, Shen Y, Ding H, Tan RX. 2009. Cytotoxic cytochalasin metabolites of endophytic Endothia gyrosa. Chemistry and Biodiversity 6:739-745.

203 References

272. Aly AH, Debbab A, Kjer J, Proksch P. 2010. Fungal endophytes from higher plants: a prolific source of phytochemicals and other bioactive natural products. Fungal Diversity 41:1-16. 273. Rivera-Orduña F, Suarez-Sanchez R, Flores-Bustamante Z, Gracida- Rodriguez J, Flores-Cotera L. 2011. Diversity of endophytic fungi of Taxus globosa (Mexican yew). Fungal Diversity 47:65-74. 274. Stone JK, Polishook JD, White Jr JF. 2004. Endophytic fungi, p 241-270. In Mueller GM, Bills GF, Foster MS (ed), Biodiversity of Fungi: Inventory and Monitoring Methods. Elsevier Academic Press, Burlington. 275. Saikkonen K, Wäli P, Helander M, Faeth SH. 2004. Evolution of endophyte- plant symbioses. Trends in Plant Science 9:275-280. 276. Thompson JN. 1996. Evolutionary ecology and the conservation of biodiversity. Trends in Ecology and Evolution 11:300-303. 277. Christensen MJ, Bennett RJ, Schmid J. 2002. Growth of Epichloë/Neotyphodium and p-endophytes in leaves of Lolium and Festuca grasses. Mycological Research 106:93-106. 278. Clay K, Schardl C. 2002. Evolutionary origins and ecological consequences of endophyte symbiosis with grasses. The American Naturalist 160:S99-S127. 279. Cannon PF, Simmons CM. 2002. Diversity and host preference of leaf endophytic fungi in the Iwokrama Forest Reserve, Guyana. Mycologia 94:210- 220. 280. Murali TS, Suryanarayanan TS, Venkatesan G. 2007. Fungal endophyte communities in two tropical forests of southern India: Diversity and host affiliation. Mycological Progress 6:191-199. 281. May RM. 1991. A fondness for fungi. Nature 352:475-476. 282. Higgins KL, Arnold AE, Coley PD, Kursar TA. 2014. Communities of fungal endophytes in tropical forest grasses: highly diverse host- and habitat generalists characterized by strong spatial structure. Fungal Ecology 8:1-11. 283. Liu G, Chater KF, Chandra G, Niu G, Tan H. 2013. Molecular regulation of antibiotic biosynthesis in Streptomyces. Microbiology and Molecular Biology Reviews 77:112-143. 284. Weber SS, Bovenberg RAL, Driessen AJM. 2012. Biosynthetic concepts for the production of β-lactam antibiotics in Penicillium chrysogenum. Biotechnology Journal 7:225-236. 285. Wicklow DT, Poling SM. 2008. Antimicrobial activity of pyrrocidines from Acremonium zeae against endophytes and pathogens of maize. Phytopathology 99:109-115. 286. Julianti E, Oh H, Jang KH, Lee JK, Lee SK, Oh DC, Oh KB, Shin JH. 2011. Acremostrictin, a highly oxygenated metabolite from the marine fungus Acremonium strictum. Journal of Natural Products 74:2592-2594. 287. Kawada M, Usami I, Someno T, Watanabe T, Abe H, Inoue H, Ohba S-i, Masuda T, Tabata Y, Yamaguchi S-i, Ikeda D. 2010. NBRI17671, a new antitumor compound, produced by Acremonium sp. CR17671. The Journal of Antibiotics 63:237-243. 288. Afiyatullov SS, Kalinovsky AI, Kuznetsova TA, Isakov VV, Pivkin MV, Dmitrenok PS, Elyakov GB. 2002. New diterpene glycosides of the fungus Acremonium striatisporum isolated from a sea cucumber. Journal of Natural Products 65:641-644. 289. Theodore CM, Stamps BW, King JB, Price LSL, Powell DR, Stevenson BS, Cichewicz RH. 2014. Genomic and metabolomic insights into the natural

204 References

product biosynthetic diversity of a feral-hog-associated Brevibacillus laterosporus strain. PLoS ONE 9:e90124. 290. Desjardine K, Pereira A, Wright H, Matainaho T, Kelly M, Andersen RJ. 2007. Tauramamide, a lipopeptide antibiotic produced in culture by Brevibacillus laterosporus isolated from a marine habitat: Structure elucidation and synthesis. Journal of Natural Products 70:1850-1853. 291. Dong JY, Wang L, Song HC, Wang LM, Shen KZ, Sun R, Li GH, Li L, Zhang KQ. 2010. Ophiocerol, a novel macrocylic neolignan from the aquatic fungus Ophioceras dolichostomum YMF1.00988. Natural Product Research 24:1004-1012. 292. Rosconi F, Davyt D, Martínez V, Martínez M, Abin-Carriquiry JA, Zane H, Butler A, de Souza EM, Fabiano E. 2013. Identification and structural characterization of serobactins, a suite of lipopeptide siderophores produced by the grass endophyte Herbaspirillum seropedicae. Environmental Microbiology 15:916-927. 293. Liao T-L, Lin A-C, Chen E, Huang T-W, Liu Y-M, Chang Y-H, Lai J-F, Lauderdale T-L, Wang J-T, Chang S-C, Tsai S-F, Chen Y-T. 2012. Complete genome sequence of Klebsiella oxytoca E718, a New Delhi metallo-β- lactamase-1-producing nosocomial strain. Journal of Bacteriology 194:5454. 294. Rakotoniriana EF, Munaut F, Decock C, Randriamampionona D, Andriambololoniaina M, Rakotomalala T, Rakotonirina EJ, Rabemanantsoa C, Cheuk K, Ratsimamanga SU, Mahillon J, El-Jaziri M, Quetin-Leclercq J, Corbisier AM. 2008. Endophytic fungi from leaves of Centella asiatica: Occurrence and potential interactions within leaves. Antonie van Leeuwenhoek 93:27-36. 295. Li DL, Li XM, Li TG, Dang HY, Proksch P, Wang BG. 2008. Benzaldehyde derivatives from Eurotium rubrum, an endophytic fungus derived from the mangrove plant Hibiscus tiliaceus. Chemical and Pharmaceutical Bulletin 56:1282-1285. 296. Li L, Sattler I, Deng Z, Groth I, Walther G, Klaus-Dieter M, Peschel G, Grabley S, Lin W. 2008. A-seco-oleane-type triterpenes from Phomopsis sp. (strain HKI0458) isolated from the mangrove plant Hibiscus tiliaceus. Phytochemistry 69:511-517. 297. Yan H-J, Gao S-S, Li C-S, Li X-M, Wang B-G. 2010. Chemical constituents of a marine-derived endophytic fungus Penicillium commune G2M. Molecules 15:3270-3275. 298. Pandi M, Kumaran RS, Choi Y-K, Kim HJ, Muthumary J. 2013. Isolation and detection of taxol, an anticancer drug produced from Lasiodiplodia theobromae, an endophytic fungus of the medicinal plant Morinda citrifolia. African Journal of Biotechnology 10:1428-1435. 299. Choi Y, Hodgkiss I, Hyde K. 2005. Enzyme production by endophytes of Brucea javanica. Journal of Agricultural Technology 1:55-66. 300. Janardhan BS, Vijayan K. 2012. Types of endophytic bacteria associated with traditional medicinal plant Lantana camara Linn. Pharmacognosy Journal 4:20- 23. 301. Shankar Naik B, Shashikala J, Krishnamurthy YL. 2008. Diversity of fungal endophytes in shrubby medicinal plants of Malnad region, Western Ghats, Southern India. Fungal Ecology 1:89-93.

205 References

302. Zaidi KU, Mani A, Ali AS, Ali SA. 2013. Evaluation of tyrosinase producing endophytic fungi from Calotropis gigantea, Azadirachta indica, Ocimum tenuiflorum and Lantana camara. Annual Review and Research in Biology 3. 303. Kumala S, Siswanto EB. 2010. Isolation and screening of endophytic microbes from Morinda citrifolia and their ability to produce anti-microbial substances. Microbiology Indonesia 1:145-148. 304. Pujiyanto S, Lestari Y, Suwanto A, Budiarti S, Darusman LK. 2012. Alpha- glucosidase inhibitor activity and characterization of endophytic actinomycetes isolated from some Indonesian diabetic medicinal plants. International Journal of Pharmacy and Pharmaceutical Sciences 4:327-333. 305. El-Nakeeb MA, Lechevalier HA. 1963. Selective isolation of aerobic actinomycetes. Applied Microbiology 11:75-77. 306. Crawford DL, Lynch JM, Whipps JM, Ousley MA. 1993. Isolation and characterization of actinomycete antagonists of a fungal root pathogen. Applied and Environmental Microbiology 59:3899-3905. 307. Shirling EB, Gottlieb D. 1966. Methods for characterization of Streptomyces species. International Journal of Systematic Bacteriology 16:313-340. 308. Qin S, Li J, Chen H-H, Zhao G-Z, Zhu W-Y, Jiang C-L, Xu L-H, Li W-J. 2009. Isolation, diversity, and antimicrobial activity of rare actinobacteria from medicinal plants of tropical rain forests in Xishuangbanna, China. Applied and Environmental Microbiology 75:6176-6186. 309. Nichols D, Cahoon N, Trakhtenberg EM, Pham L, Mehta A, Belanger A, Kanigan T, Lewis K, Epstein SS. 2010. Use of ichip for high-throughput in situ cultivation of “uncultivable” microbial species. Applied and Environmental Microbiology 76:2445-2450. 310. Arnold AE, Herre EA. 2003. Canopy cover and leaf age affect colonization by tropical fungal endophytes: Ecological pattern and process in Theobroma cacao (Malvaceae). Mycologia 95:388-398. 311. Herrera J, Khidir HH, Eudy DM, Porras-Alfaro A, Natvig DO, Sinsabaugh RL. 2010. Shifting fungal endophyte communities colonize Bouteloua gracilis: Effect of host tissue and geographical distribution. Mycologia 102:1012-1026. 312. Gazis R, Chaverri P. 2010. Diversity of fungal endophytes in leaves and stems of wild rubber trees (Hevea brasiliensis) in Peru. Fungal Ecology 3:240-254. 313. Sturz AV, Christie BR, Matheson BG, Nowak J. 1997. Biodiversity of endophytic bacteria which colonize red clover nodules, roots, stems and foliage and their influence on host growth. Biology and Fertility of Soils 25:13-19. 314. Hardoim PR, Hardoim CCP, van Overbeek LS, van Elsas JD. 2012. Dynamics of seed-borne rice endophytes on early plant growth stages. PLoS ONE 7:e30438. 315. Gao X-X, Zhou H, Xu D-Y, Yu C-H, Chen Y-Q, Qu L-H. 2005. High diversity of endophytic fungi from the pharmaceutical plant, Heterosmilax japonica Kunth revealed by cultivation-independent approach. FEMS Microbiology Letters 249:255-266. 316. Forchetti G, Masciarelli O, Izaguirre M, Alemano S, Alvarez D, Abdala G. 2010. Endophytic bacteria improve seedling growth of sunflower under water stress, produce salicylic acid, and inhibit growth of pathogenic fungi. Current Microbiology 61:485-493. 317. Fox GE, Wisotzkey JD, Jurtshuk P. 1992. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity. International Journal of Systematic Bacteriology 42:166-170.

206 References

318. Vandamme P, Pot B, Gillis M, de Vos P, Kersters K, Swings J. 1996. Polyphasic taxonomy, a consensus approach to bacterial systematics. Microbiological Reviews 60:407-438. 319. Baker RA, Tatum JH, Nemec S, Jr. 1990. Antimicrobial activity of naphthoquinones from Fusaria. Mycopathologia 111:9-15. 320. Tran T, Saheba E, Arcerio AV, Chavez V, Li Q-y, Martinez LE, Primm TP. 2004. Quinones as antimycobacterial agents. Bioorganic and Medicinal Chemistry 12:4809-4813. 321. Zhang Y, Ling S, Fang Y, Zhu T, Gu Q, Zhu W-M. 2008. Isolation, structure elucidation, and antimycobacterial properties of dimeric naphtho-γ-pyrones from the marine-derived fungus Aspergillus carbonarius. Chemistry and Biodiversity 5:93-100. 322. Graça AP, Viana F, Bondoso J, Correia MI, Gomes LAGR, Humanes M, Reis A, Xavier J, Gaspar H, Lage O. 2015. The antimicrobial activity of heterotrophic bacteria isolated from the marine sponge Erylus deficiens (Astrophorida, Geodiidae). Frontiers in Microbiology 6. 323. Ingrey SD, Neilan BA. 2008. The genetic basis for bioactivity in the traditional medicine plants of Australia. Planta Medica 74:SL11. 324. Passari AK, Mishra VK, Saikia R, Gupta VK, Singh BP. 2015. Isolation, abundance and phylogenetic affiliation of endophytic actinomycetes associated with medicinal plants and screening for their in vitro antimicrobial biosynthetic potential. Frontiers in Microbiology 6:273. 325. Amoutzias GD, Van De Peer Y, Mossialos D. 2008. Evolution and taxonomic distribution of nonribosomal peptide and polyketide synthases. Future Microbiology 3:361-370. 326. Gan P, Ikeda K, Irieda H, Narusaka M, O'Connell RJ, Narusaka Y, Takano Y, Kubo Y, Shirasu K. 2013. Comparative genomic and transcriptomic analyses reveal the hemibiotrophic stage shift of Colletotrichum fungi. New Phytologist 197:1236-1249. 327. Amnuaykanjanasin A, Phonghanpot S, Sengpanich N, Cheevadhanarak S, Tanticharoen M. 2009. Insect-specific polyketide synthases (PKSs), potential PKS-nonribosomal peptide synthetase hybrids, and novel PKS clades in tropical fungi. Applied and Environmental Microbiology 75:3721-3732. 328. Katz E, Demain AL. 1977. The peptide antibiotics of Bacillus: Chemistry, biogenesis, and possible functions. Bacteriological Reviews 41:449-474. 329. Gross H, Loper JE. 2009. Genomics of secondary metabolite production by Pseudomonas spp. Natural Product Reports 26:1408-1446. 330. Ochman H, Lawrence JG, Groisman EA. 2000. Lateral gene transfer and the nature of bacterial innovation. Nature 405:299-304. 331. Keeling PJ, Palmer JD. 2008. Horizontal gene transfer in eukaryotic evolution. Nature Reviews Genetics 9:605-618. 332. Berg DE. 1989. Transposon Tn5, p 185-210. In Berg DE, Howe MM (ed), Mobile DNA. American Society for Microbiology, Washington D.C. 333. Kleckner N. 1989. Transposon Tn10, p 227-268. In Berg DE, Howe MM (ed), Mobile DNA. American Society for Microbiology, Washington D.C. 334. Slot JC, Hibbett DS. 2007. Horizontal transfer of a nitrate assimilation gene cluster and ecological transitions in fungi: A phylogenetic study. PLoS ONE 2:e1097. 335. Dubnau D. 1999. DNA uptake in bacteria. Annual Review of Microbiology 53:217-244.

207 References

336. Hoffmann T, Golz C, Schieder O. 1994. Foreign DNA sequences are received by a wild-type strain of Aspergillus niger after co-culture with transgenic higher plants. Current Genetics 27:70-76. 337. Lawrence JG, Roth JR. 1996. Selfish operons: Horizontal transfer may drive the evolution of gene clusters. Genetics 143:1843-1860. 338. Fischbach MA, Walsh CT, Clardy J. 2008. The evolution of gene collectives: How natural selection drives chemical innovation. Proceedings of the National Academy of Sciences of the United States of America 105:4601-4608. 339. Khaldi N, Collemare J, Lebrun M-H, Wolfe K. 2008. Evidence for horizontal transfer of a secondary metabolite gene cluster between fungi. Genome Biology 9:1-10. 340. Duchaud E, Rusniok C, Frangeul L, Buchrieser C, Givaudan A, Taourit S, Bocs S, Boursaux-Eude C, Chandler M, Charles J-F, Dassa E, Derose R, Derzelle S, Freyssinet G, Gaudriault S, Medigue C, Lanois A, Powell K, Siguier P, Vincent R, Wingate V, Zouine M, Glaser P, Boemare N, Danchin A, Kunst F. 2003. The genome sequence of the entomopathogenic bacterium Photorhabdus luminescens. Nature Biotechnology 21:1307-1313. 341. Buell CR, Joardar V, Lindeberg M, Selengut J, Paulsen IT, Gwinn ML, Dodson RJ, Deboy RT, Durkin AS, Kolonay JF, Madupu R, Daugherty S, Brinkac L, Beanan MJ, Haft DH, Nelson WC, Davidsen T, Zafar N, Zhou L, Liu J, Yuan Q, Khouri H, Fedorova N, Tran B, Russell D, Berry K, Utterback T, Van Aken SE, Feldblyum TV, D'Ascenzo M, Deng W-L, Ramos AR, Alfano JR, Cartinhour S, Chatterjee AK, Delaney TP, Lazarowitz SG, Martin GB, Schneider DJ, Tang X, Bender CL, White O, Fraser CM, Collmer A. 2003. The complete genome sequence of the Arabidopsis and tomato pathogen Pseudomonas syringae pv. tomato DC3000. Proceedings of the National Academy of Sciences of the United States of America 100:10181-10186. 342. Koczura R, Kaznowski A. 2003. The Yersinia high-pathogenicity island and iron-uptake systems in clinical isolates of Escherichia coli. Journal of Medical Microbiology 52:637-642. 343. Udwary DW, Zeigler L, Asolkar RN, Singan V, Lapidus A, Fenical W, Jensen PR, Moore BS. 2007. Genome sequencing reveals complex secondary metabolome in the marine actinomycete Salinispora tropica. Proceedings of the National Academy of Sciences of the United States of America 104:10376- 10381. 344. Hacker J, Blum-Oehler G, Mühldorfer I, Tschäpe H. 1997. Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution. Molecular Microbiology 23:1089-1097. 345. Carniel E. 1999. The Yersinia high-pathogenicity island. International Microbiology 2:161-167. 346. Sims JW, Fillmore JP, Warner DD, Schmidt EW. 2005. Equisetin biosynthesis in Fusarium heterosporum. Chemical Communications doi:10.1039/b413523g:186-188. 347. Donadio S, Monciardini P, Sosio M. 2007. Polyketide synthases and nonribosomal peptide synthetases: the emerging view from bacterial genomics. Natural Product Reports 24:1073-1109. 348. Wang H, Fewer DP, Holm L, Rouhiainen L, Sivonen K. 2014. Atlas of nonribosomal peptide and polyketide biosynthetic pathways reveals common

208 References

occurrence of nonmodular enzymes. Proceedings of the National Academy of Sciences of the United States of America 111:9259-9264. 349. Keller NP, Turner G, Bennett JW. 2005. Fungal secondary metabolism - From biochemistry to genomics. Nature Reviews Microbiology 3:937-947. 350. Schulz B, Boyle C, Draeger S, Römmert A-K, Krohn K. 2002. Endophytic fungi: A source of novel biologically active secondary metabolites. Mycological Research 106:996-1004. 351. Strobel GA, Miller RV, Martinez-Miller C, Condron MM, Teplow DB, Hess WM. 1999. Cryptocandin, a potent antimycotic from the endophytic fungus Cryptosporiopsis cf. quercina. Microbiology 145:1919-1926. 352. Tuberculosis Drug Screening Program. 2001. Search for new drugs for treatment of tuberculosis. Antimicrobial Agents and Chemotherapy 45:1943- 1946. 353. Li J, Zhao GZ, Chen HH, Wang HB, Qin S, Zhu WY, Xu LH, Jiang CL, Li WJ. 2008. Antitumour and antimicrobial activities of endophytic streptomycetes from pharmaceutical plants in rainforest. Letters in Applied Microbiology 47:574-580. 354. Corrado M, Rodrigues KF. 2004. Antimicrobial evaluation of fungal extracts produced by endophytic strains of Phomopsis sp. Journal of Basic Microbiology 44:157-160. 355. Ceri H, Olson ME, Stremick C, Read RR, Morck D, Buret A. 1999. The Calgary Biofilm Device: New technology for rapid determination of antibiotic susceptibilities of bacterial biofilms. Journal of Clinical Microbiology 37:1771- 1776. 356. Wikler MA, Cockerill III FR, Bush K, Dudley MN, Eliopoulos GM, Hardy DJ, Hecht DW, Hindler JF, Patel JB, Powell M, Turnidge JD, Weinstein MP, Zimmer BL, Ferraro MJ, Swenson JM. 2009. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically, 5th ed, vol 20(2). Clinical and Laboratory Standards Institute, Wayne, Pennsylvania, USA. 357. Eloff JN. 1998. A sensitive and quick microplate method to determine the minimal inhibitory concentration of plant extracts for bacteria. Planta Medica 64:711-713. 358. Rogoza LN, Salakhutdinov NF, Tolstikov GA. 2009. Natural and synthetic compounds with an antimycobacterial activity. Mini-Reviews in Organic Chemistry 6:135-151. 359. Primm TP, Lucero CA, Falkinham JO. 2004. Health impacts of environmental mycobacteria. Clinical Microbiology Reviews 17:98-106. 360. Inderlied CB, Kemper CA, Bermudez LE. 1993. The Mycobacterium avium complex. Clinical Microbiology Reviews 6:266-310. 361. Reyrat J-M, Kahn D. 2001. Mycobacterium smegmatis: An absurd model for tuberculosis? Trends in Microbiology 9:472-473. 362. Tyagi JS, Sharma D. 2002. Mycobacterium smegmatis and tuberculosis. Trends in Microbiology 10:68-69. 363. Pauli GF, Case RJ, Inui T, Wang Y, Cho S, Fischer NH, Franzblau SG. 2005. New perspectives on natural products in TB drug research. Life Sciences 78:485-494. 364. Connell ND, Nikaido H. 1994. Membrane permeability and transport in Mycobacterium tuberculosis, p 333-350. In Bloom BR (ed), Tuberculosis:

209 References

Pathogenesis, Protection, and Control. American Society for Microbiology, Washington DC, USA. 365. Hughes DT, Sperandio V. 2008. Inter-kingdom signalling: Communication between bacteria and their hosts. Nature Reviews Microbiology 6:111-120. 366. Keller L, Surette MG. 2006. Communication in bacteria: An ecological and evolutionary perspective. Nature Reviews Microbiology 4:249-258. 367. Wall ME, Wani MC, Cook CE, Palmer KH, McPhail AT, Sim GA. 1966. Plant antitumor agents. I. The isolation and structure of camptothecin, a novel alkaloidal leukemia and tumor Inhibitor from Camptotheca acuminata. Journal of the American Chemical Society 88:3888-3890. 368. Kusari S, Košuth J, Čellárová E, Spiteller M. 2011. Survival-strategies of endophytic Fusarium solani against indigenous camptothecin biosynthesis. Fungal Ecology 4:219-223. 369. Miao L, Qian PY. 2005. Antagonistic antimicrobial activity of marine fungi and bacteria isolated from marine biofilm and seawaters of Hong Kong. Aquatic Microbial Ecology 38:231-238. 370. Shao MW, Lu YH, Miao S, Zhang Y, Chen TT, Zhang YL. 2015. Diversity, bacterial symbionts and antibacterial potential of gut-associated fungi isolated from the Pantala flavescens larvae in China. PLoS ONE 10:e0134542. 371. Sette LD, Passarini MRZ, Delarmelina C, Salati F, Duarte MCT. 2006. Molecular characterization and antimicrobial activity of endophytic fungi from coffee plants. World Journal of Microbiology and Biotechnology 22:1185-1195. 372. Lu H, Zou WX, Meng JC, Hu J, Tan RX. 2000. New bioactive metabolites produced by Colletotrichum sp., an endophytic fungus in Artemisia annua. Plant Science 151:67-73. 373. Zhang W, Krohn K, Egold H, Draeger S, Schulz B. 2008. Diversity of antimicrobial pyrenophorol derivatives from an endophytic fungus, Phoma sp. European Journal of Organic Chemistry 2008:4320-4328. 374. Fu LM, Fu-Liu CS. 2002. Is Mycobacterium tuberculosis a closer relative to Gram-positive or Gram-negative bacterial pathogens? Tuberculosis 82:85-90. 375. Falagas ME, Kasiakou SK, Saravolatz LD. 2005. Colistin: The revival of polymyxins for the management of multidrug-resistant Gram-negative bacterial infections. Clinical Infectious Diseases 40:1333-1341. 376. Davis SD, Iannetta A, Wedgwood RJ. 1971. Activity of colistin against Pseudomonas aeruginosa: Inhibition by calcium. The Journal of Infectious Diseases 124:610-612. 377. Newton B. 1956. The properties and mode of action of the polymyxins. Bacteriological Reviews 20:14. 378. Schindler M, Osborn MJ. 1979. Interaction of divalent cations and polymyxin B with lipopolysaccharide. Biochemistry 18:4425-4430. 379. Khara JS, Wang Y, Ke X-Y, Liu S, Newton SM, Langford PR, Yang YY, Ee PLR. 2014. Anti-mycobacterial activities of synthetic cationic α-helical peptides and their synergism with rifampicin. Biomaterials 35:2032-2038. 380. Bu'Lock JD. 1961. Intermediary metabolism and antibiotic synthesis, p 293- 342. In Wayne WU (ed), Advances in Applied Microbiology, vol Volume 3. Academic Press. 381. Sekiguchi J, Gaucher GM. 1977. Conidiogenesis and secondary metabolism in Penicillium urticae. Applied and Environmental Microbiology 33:147-158.

210 References

382. Feng GH, Leonard TJ. 1998. Culture conditions control expression of the genes for aflatoxin and sterigmatocystin biosynthesis in Aspergillus parasiticus and A. nidulans. Applied and Environmental Microbiology 64:2275-2277. 383. Buchanan RL, Ayres JC. 1975. Effect of initial pH on aflatoxin production. Applied Microbiology 30:1050-1051. 384. Guzmán-de-Peña D, Ruiz-Herrera J. 1997. Relationship between aflatoxin biosynthesis and sporulation in Aspergillus parasiticus. Fungal Genetics and Biology 21:198-205. 385. Abdollahi A, Buchanan RL. 1981. Regulation of aflatoxin biosynthesis: Characterization of glucose as an apparent inducer of aflatoxin production. Journal of Food Science 46:143-146. 386. Flores-Bustamante ZR, Rivera-Orduna FN, Martinez-Cardenas A, Flores- Cotera LB. 2010. Microbial paclitaxel: Advances and perspectives. The Journal of Antibiotics 63:460-467. 387. Hoffman AM. 30 March 2010 2010. Method for obtaining taxanes. US patent 7,687,086 B1. 388. Soca-Chafre G, Rivera-Orduña FN, Hidalgo-Lara ME, Hernandez- Rodriguez C, Marsch R, Flores-Cotera LB. 2011. Molecular phylogeny and paclitaxel screening of fungal endophytes from Taxus globosa. Fungal Biology 115:143-156. 389. Strobel G, Yang X, Sears J, Kramer R, Sidhu RS, Hess WM. 1996. Taxol from Pestalotiopsis microspora, an endophytic fungus of Taxus wallachiana. Microbiology 142:435-440. 390. Zhang P, Zhou P-P, Yu L-J. 2009. An endophytic Taxol-producing fungus from Taxus media, Cladosporium cladosporioides MD2. Current Microbiology 59:227-232. 391. Kogel K-H, Franken P, Hückelhoven R. 2006. Endophyte or parasite – what decides? Current Opinion in Plant Biology 9:358-363. 392. Zhao K, Penttinen P, Guan T, Xiao J, Chen Q, Xu J, Lindström K, Zhang L, Zhang X, Strobel G. 2011. The diversity and anti-microbial activity of endophytic actinomycetes isolated from medicinal plants in Panxi Plateau, China. Current Microbiology 62:182-190. 393. Schneemann I, Nagel K, Kajahn I, Labes A, Wiese J, Imhoff JF. 2010. Comprehensive investigation of marine actinobacteria associated with the sponge Halichondria panicea. Applied and Environmental Microbiology 76:3702-3714. 394. Christianson DW. 2007. Roots of biosynthetic diversity. Science 316:60-61. 395. Brock NL, Dickschat JS. 2013. Biosynthesis of terpenoids, p 2693-2732. In Ramawat KG, Mérillon J-M (ed), Natural Products doi:10.1007/978-3-642- 22144-6_121. Springer Berlin Heidelberg. 396. Tholl D. 2006. Terpene synthases and the regulation, diversity, and biological roles of terpene metabolism. Current Opinion in Plant Biology 9:297-304. 397. Che Y, Gloer JB, Wicklow DT. 2002. Phomadecalins A−D and phomapentenone A: New bioactive metabolites from Phoma sp. NRRL 25697, a fungal colonist of Hypoxylon stromata. Journal of Natural Products 65:399- 402. 398. Dettrakul S, Kittakoop P, Isaka M, Nopichai S, Suyarnsestakorn C, Tanticharoen M, Thebtaranonth Y. 2003. Antimycobacterial pimarane diterpenes from the fungus Diaporthe sp. Bioorganic and Medicinal Chemistry Letters 13:1253-1255.

211 References

399. Gordien AY, Gray AI, Ingleby K, Franzblau SG, Seidel V. 2010. Activity of Scottish plant, lichen and fungal endophyte extracts against Mycobacterium aurum and Mycobacterium tuberculosis. Phytotherapy Research 24:692-698. 400. Tong W, Darah I, Latiffah Z. 2011. Antimicrobial activities of endophytic fungal isolates from medicinal herb Orthosiphon stamineus Benth. Journal of Medicinal Plants Research 5:831-836. 401. Liu CH, Zou WX, Lu H, Tan RX. 2001. Antifungal activity of Artemisia annua endophyte cultures against phytopathogenic fungi. Journal of Biotechnology 88:277-282. 402. Roze LV, Chanda A, Linz JE. 2011. Compartmentalization and molecular traffic in secondary metabolism: A new understanding of established cellular processes. Fungal Genetics and Biology 48:35-48. 403. Chanda A, Roze LV, Kang S, Artymovich KA, Hicks GR, Raikhel NV, Calvo AM, Linz JE. 2009. A key role for vesicles in fungal secondary metabolism. Proceedings of the National Academy of Sciences of the United States of America 106:19533-19538. 404. Bartoszewska M, Opaliński Ł, Veenhuis M, van der Klei I. 2011. The significance of peroxisomes in secondary metabolite biosynthesis in filamentous fungi. Biotechnology Letters 33:1921-1931. 405. Davies J, Spiegelman GB, Yim G. 2006. The world of subinhibitory antibiotic concentrations. Current Opinion in Microbiology 9:445-453. 406. Tanaka M, Hasegawa T, Okamoto A, Torii K, Ohta M. 2005. Effect of antibiotics on group A Streptococcus exoprotein production analyzed by two- dimensional gel electrophoresis. Antimicrobial Agents and Chemotherapy 49:88-96. 407. Hoffman LR, D'Argenio DA, MacCoss MJ, Zhang Z, Jones RA, Miller SI. 2005. Aminoglycoside antibiotics induce bacterial biofilm formation. Nature 436:1171-1175. 408. Celli J, Trieu-Cuot P. 1998. Circularization of Tn916 is required for expression of the transposon-encoded transfer functions: Characterization of long tetracycline-inducible transcripts reading through the attachment site. Molecular Microbiology 28:103-117. 409. Molina-Salinas GM, Ramos-Guerra MC, Vargas-Villarreal J, Mata- Cárdenas BD, Becerril-Montes P, Said-Fernández S. 2006. Bactericidal activity of organic extracts from Flourensia cernua DC against strains of Mycobacterium tuberculosis. Archives of Medical Research 37:45-49. 410. Jagannath C, Reddy VM, Gangadharam PRJ. 1995. Enhancement of drug susceptibility of multi-drug resistant strains of Mycobacterium tuberculosis by ethambutol and dimethyl sulphoxide. Journal of Antimicrobial Chemotherapy 35:381-390. 411. van Ingen J, Boeree MJ, van Soolingen D, Iseman MD, Heifets LB, Daley CL. 2012. Are phylogenetic position, virulence, drug susceptibility and in vivo response to treatment in mycobacteria interrelated? Infection, Genetics and Evolution 12:832-837. 412. van Ingen J, van der Laan T, Dekhuijzen R, Boeree M, van Soolingen D. 2010. In vitro drug susceptibility of 2275 clinical non-tuberculous Mycobacterium isolates of 49 species in The Netherlands. International Journal of Antimicrobial Agents 35:169-173. 413. Gordon RE, Smith MM. 1953. Rapidly growing, acid fast bacteria I: Species' descriptions of Mycobacterium phlei Lehmann and Neumann and

212 References

Mycobacterium smegmatis (Trevisan) Lehmann and Neumann. Journal of Bacteriology 66:41-48. 414. Cateni F, Doljak B, Zacchigna M, Anderluh M, Piltaver A, Scialino G, Banfi E. 2007. New biologically active epidioxysterols from Stereum hirsutum. Bioorganic and Medicinal Chemistry Letters 17:6330-6334. 415. Isaka M, Prathumpai W, Wongsa P, Tantichareon M. 2006. Hirsutellone F, a dimer of antitubercular alkaloids from the seed fungus Trichoderma species BCC 7579. Organic Letters 8:2815-2817. 416. García A, Bocanegra-García V, Palma-Nicolás JP, Rivera G. 2012. Recent advances in antitubercular natural products. European Journal of Medicinal Chemistry 49:1-23. 417. Bushley KE, Turgeon BG. 2010. Phylogenomics reveals subfamilies of fungal nonribosomal peptide synthetases and their evolutionary relationships. BMC Evolutionary Biology 10:26. 418. Stępień Ł. 2013. The use of Fusarium secondary metabolite biosynthetic genes in chemotypic and phylogenetic studies. Critical Reviews in Microbiology 40:176-185. 419. Desjardins AE, Hohn TM, McCormick SP. 1993. Trichothecene biosynthesis in Fusarium species: chemistry, genetics, and significance. Microbiological Reviews 57:595-604. 420. Jestoi M. 2008. Emerging Fusarium mycotoxins fusaproliferin, beauvericin, enniatins, and moniliformin: A review. Critical Reviews in Food Science and Nutrition 48:21-49. 421. Gaffoor I, Trail F. 2006. Characterization of two polyketide synthase genes involved in zearalenone biosynthesis in Gibberella zeae. Applied and Environmental Microbiology 72:1793-1799. 422. Brown DW, Butchko RAE, Busman M, Proctor RH. 2012. Identification of gene clusters associated with fusaric acid, fusarin, and perithecial pigment production in Fusarium verticillioides. Fungal Genetics and Biology 49:521- 532. 423. Proctor RH, Desjardins AE, Plattner RD, Hohn TM. 1999. A polyketide synthase gene required for biosynthesis of fumonisin mycotoxins in Gibberella fujikuroi mating population A. Fungal Genetics and Biology 27:100-112. 424. Niehaus E-M, Kleigrewe K, Wiemann P, Studt L, Sieber Christian MK, Connolly Lanelle R, Freitag M, Güldener U, Tudzynski B, Humpf H-U. 2013. Genetic manipulation of the Fusarium fujikuroi fusarin gene cluster yields insight into the complex regulation and fusarin biosynthetic pathway. Chemistry and Biology 20:1055-1066. 425. Kobayashi H, Sunaga R, Furihata K, Morisaki N, Iwasaki S. 1995. Isolation and structures of an antifungal antibiotic, fusarielin A, and related compounds produced by a Fusarium sp. The Journal of Antibiotics 48:42-52. 426. Altomare C, Perrone G, Zonno MC, Evidente A, Pengue R, Fanti F, Polonelli L. 2000. Biological characterization of fusapyrone and deoxyfusapyrone, two bioactive secondary metabolites of Fusarium semitectum. Journal of Natural Products 63:1131-1135. 427. Singh SB, Zink DL, Dombrowski AW, Polishook JD, Ondeyka JG, Hirshfield J, Felock P, Hazuda DJ. 2003. Integracides: Tetracyclic triterpenoid inhibitors of HIV-1 integrase produced by Fusarium sp. Bioorganic and Medicinal Chemistry 11:1577-1582.

213 References

428. Garyali S, Reddy MS. 2013. Taxol production by an endophytic fungus, Fusarium redolens, isolated from Himalayan yew. Journal of Microbiology and Biotechnology 23:1372-1380. 429. Takemoto K, Kamisuki S, Chia PT, Kuriyama I, Mizushina Y, Sugawara F. 2014. Bioactive dihydronaphthoquinone derivatives from Fusarium solani. Journal of Natural Products 77:1992-1996. 430. Kornsakulkarn J, Dolsophon K, Boonyuen N, Boonruangprapa T, Rachtawee P, Prabpai S, Kongsaeree P, Thongpanchang C. 2011. Dihydronaphthalenones from endophytic fungus Fusarium sp. BCC14842. Tetrahedron 67:7540-7547. 431. Medentsev AG, Akimenko VK. 1998. Naphthoquinone metabolites of the fungi. Phytochemistry 47:935-959. 432. Trisuwan K, Khamthong N, Rukachaisirikul V, Phongpaichit S, Preedanon S, Sakayaroj J. 2010. Anthraquinone, cyclopentanone, and naphthoquinone derivatives from the sea fan-derived fungi Fusarium spp. PSU-F14 and PSU- F135. Journal of Natural Products 73:1507-1511. 433. Jork H, Funk W, Fischer W, Wimmer H. 1990. Thin-Layer Chromatoraphy: Reagents and Detection Method, vol 1a. Physical and Chemical Detection Methods. VCH Verlagsgesellschaft mbH, Winheim, Germany. 434. Palomino J-C, Martin A, Camacho M, Guerra H, Swings J, Portaels F. 2002. Resazurin microtiter assay plate: Simple and inexpensive method for detection of drug resistance in Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy 46:2720-2722. 435. Arnstein H, Cook A, Lacey M. 1946. An antibacterial pigment from Fusarium javanicum. Nature 157:333-334. 436. Parisot D, Maugin M, Gerlinger C. 1981. Genetic and epigenetic factors involved in the excretion of naphthoquinone pigments into the culture medium by Nectria haematococca. Journal of General Microbiology 126:443-457. 437. McCulloch AW, McInnes AG, Smith DG, Kurobane I, Vining LC. 1982. Alkaline oxidation of diastereoisomeric 4a,10a-dihydrofusarubins to norjavanicin, fusarubin, and a new antibiotic isofusarubin: nonenzymic formation of products in Fusarium solani cultures. Canadian Journal of Chemistry 60:2943-2949. 438. Kurobane I, Zaita N, Fukuda A. 1986. New metabolites of Fusarium martii related to dihydrofusarubin. The Journal of Antibiotics 39:205-214. 439. Kharwar RN, Verma VC, Kumar A, Gond SK, Harper JK, Hess WM, Lobkovosky E, Ma C, Ren Y, Strobel GA. 2009. Javanicin, an antibacterial naphthaquinone from an endophytic fungus of neem, Chloridium sp. Current Microbiology 58:233-238. 440. Medentsev AG, Arinbasarova AY, Akimenko VK. 2005. Biosynthesis of naphthoquinone pigments by fungi of the genus Fusarium. Applied Biochemistry and Microbiology 41:503-507. 441. Gatenbeck S, Bentley R. 1965. Naphthaquinone biosynthesis in moulds: The mechanism for formation of javanicin. Biochemical Journal 94:478-481. 442. Ruelius HW, Gauhe A. 1950. Über fusarubin, einen naphthochinonfarbstoff aus Fusarien. Justus Liebigs Annalen der Chemie 569:38-59. 443. Claydon N, Grove JF, Pople M. 1977. Insecticidal secondary metabolic products from the entomogenous fungus Fusarium solani. Journal of Invertebrate Pathology 30:216-223.

214 References

444. Medentsev AG, Baskunov BP, Akimenko VK. 1988. Biosynthesis of naphthoquinone pigments in the fungus Fusarium decemcellulare cells and their effects on oxidative metabolism of the producer. Biokhimiya 53:413-423. 445. Hashmi MH, Thrane U. 1990. Mycotoxins and other secondary metabolites in species of Fusarium isolated from seeds of capsicum, coriander and fenugreek. Pakistan Journal of Botany 22:106-116. 446. Roos A. 1977. Zur physiologie und pathologie von Neocosmospora vasinfecta E. F. Smith. Journal of Phytopathology 88:238-271. 447. Parisot D, Devys M, Férézou J-P, Barbier M. 1983. Pigments from Nectria haematococca: Anhydrofusarubin lactone and nectriafurone. Phytochemistry 22:1301-1303. 448. Shao CL, Wang CY, Deng DS, She ZG, Gu YC, Lin YC. 2008. Crystal structure of a marine natural compound, anhydrofusarubin. Chinese Journal of Structural Chemistry 27:824-828. 449. Kurobane I, Vining LC, McInnes AG, Walter JA. 1980. Use of 13C in biosynthetic studies: The labeling pattern in dihydrofusarubin enriched from [13C]- and [13C, 2H]acetate in cultures of Fusarium solani. Canadian Journal of Chemistry 58:1380-1385. 450. Studt L, Wiemann P, Kleigrewe K, Humpf H-U, Tudzynski B. 2012. Biosynthesis of fusarubins accounts for pigmentation of Fusarium fujikuroi perithecia. Applied and Environmental Microbiology 78:4468-4480. 451. Bérdy J, Aszalos A, Boatian M, McNitt KL. 1980. Handbook of Antibiotic Compounds III. Quionone and Similar Antibiotics. CRC Press, Boca Raton, FL. 452. Ammar MS, Gerber NN, McDaniel LE. 1979. New antibiotic pigments related to fusarubin from Fusarium solani (Mart.) Sacc. I. Fermentation, isolation, and antimicrobial activities. The Journal of Antibiotics 32:679-684. 453. Lechevalier H, Borowski E, Lampen J, Schaffner C. 1961. Water-soluble N- acetyl derivatives of heptaene macrolide antifungal antibiotics: Microbiological studies. Antibiotics and Chemotherapy 11:640-647. 454. Zgoda JR, Porter JR. 2001. A convenient microdilution method for screening natural products against bacteria and fungi. Pharmaceutical Biology 39:221-225. 455. Kumagai Y, Shinkai Y, Miura T, Cho AK. 2012. The chemical biology of naphthoquinones and its environmental implications. Annual Review of Pharmacology and Toxicology 52:221-247. 456. Wardman P. 1990. Bioreductive activation of quinones: Redox properties and thiol reactivity. Free Radical Research 8:219-229. 457. Kern H, Naef-Roth S, Item H. 1970. Parasitogene naphthazarin-derivate als hemmstoffe der decarboxylierung von α-ketocarbonsäuren. Journal of Phytopathology 67:1-14. 458. Howland JL. 1963. Uncoupling and inhibition of oxidative phosphorylation by 2-hydroxy-3-alkyl-1,4-naphthoquinones. Biochimica et Biophysica Acta 77:659-662. 459. Werner RG, Appel K-R, Merk WMA. 1979. Gunacin, a new quinone antibiotic from Ustilago sp. The Journal of Antibiotics 32:1104-1111. 460. Bironaitė DA, Čėnas NK, Kulys JJ, Medentsev AG, Akimenko VK. 1991. The inhibition of glutathione reductase by quinones. Zeitschrift für Naturforschung C 46:966. 461. Medentsev AG, Arinbasarova AY, Akimenko VK. 2001. Adaptation of the phytopathogenic fungus Fusarium decemcellulare to oxidative stress. Microbiology 70:26-30.

215 References

462. Chen YY, Pan QD, Li DP, Liu JL, Wen YX, Huang YL, Lu FL. 2011. New pregnane glycosides from Brucea javanica and their antifeedant activity. Chemistry and Biodiversity 8:460-466. 463. Chen H, Bai J, Fang ZF, Yu SS, Ma SG, Xu S, Li Y, Qu J, Ren JH, Li L, Si YK, Chen XG. 2011. Indole alkaloids and quassinoids from the stems of Brucea mollis. Journal of Natural Products 74:2438-2445. 464. Chen QJ, Ouyang MA, Tan QW, Zhang ZK, Wu ZJ, Lin QY. 2009. Constituents from the seeds of Brucea javanica with inhibitory activity of Tobacco Mosaic Virus. Journal of Asian Natural Products Research 11:539-547. 465. Dong SH, Liu J, Ge YZ, Dong L, Xu CH, Ding J, Yue JM. 2013. Chemical constituents from Brucea javanica. Phytochemistry 85:175-184. 466. Murakami C, Fukamiya N, Tamura S, Okano M, Bastow KF, Tokuda H, Mukainaka T, Nishino H, Lee KH. 2004. Multidrug-resistant cancer cell susceptibility to cytotoxic quassinoids, and cancer chemopreventive effects of quassinoids and canthin alkaloids. Bioorganic and Medicinal Chemistry 12:4963-4968. 467. Liu JH, Zhao N, Zhang GJ, Yu SS, Wu LJ, Qu J, Ma SG, Chen XG, Zhang TQ, Bai J, Chen H, Fang ZF, Zhao F, Tang WB. 2012. Bioactive quassinoids from the seeds of Brucea javanica. Journal of Natural Products 75:683-688. 468. Subeki, Matsuura H, Takahashi K, Nabeta K, Yamasaki M, Maede Y, Katakura K. 2007. Screening of Indonesian medicinal plant extracts for antibabesial activity and isolation of new quassinoids from Brucea javanica. Journal of Natural Products 70:1654-1657. 469. Morré DJ, Zeichhardt H, Maxeiner H-G, Grünert H-P, Sawitzky D, Grieco P. 1997. Effect on the quassinoids glaucarubolone and simalikalactone D on growth of cells permanently infected with feline and human immunodeficiency viruses and on viral infections. Life Sciences 62:213-219. 470. Okano M, Fukamiya N, Tagahara K, Cosentino M, Lee TTY, Morris- Natschke S, Lee KH. 1996. Anti-HIV activity of quassinoids. Bioorganic and Medicinal Chemistry Letters 6:701-706. 471. Houël E, Stien D, Bourdy G, Deharo E. 2013. Quassinoids: Anticancer and antimalarial activities, p 3775-3802. In Ramawat KG, Mérillon J-M (ed), Natural Products doi:10.1007/978-3-642-22144-6_161. Springer Berlin Heidelberg. 472. Rahman S, Fukamiya N, Okano M, Tagahara K, Lee KH. 1997. Anti- tuberculosis activity of quassinoids. Chemical and Pharmaceutical Bulletin 45:1527-1529. 473. Schümann J, Hertweck C. 2007. Molecular basis of cytochalasan biosynthesis in fungi: Gene cluster analysis and evidence for the involvement of a PKS- NRPS hybrid synthase by RNA silencing. Journal of the American Chemical Society 129:9564-9565. 474. Choi GH, Pawlyk DM, Rae B, Shapira R, Nuss DL. 1993. Molecular analysis and overexpression of the gene encoding endothiapepsin, an aspartic protease from Cryphonectria parasitica. Gene 125:135-141. 475. Vannini A, Smart CD, Fulbright DW. 1993. The comparison of oxalic acid production in vivo and in vitro by virulent and hypovirulent Cryphonectria (Endothia) parasitica. Physiological and Molecular Plant Pathology 43:443-451. 476. Shibata S, Murakami T, Tanaka O, Chihara G, Sumimoto M. 1955. Metabolic products of fungi. IV. Isolation of the coloring matters of Endothia

216 References

spp. and the respective identities of endothianin and redicalisin with skyrin and rugulosin. Pharmaceutical Bulletin 3:274-277. 477. Myburg H, Gryzenhout M, Wingfield BD, Stipes RJ, Wingfield MJ. 2004. Phylogenetic relationships of Cryphonectria and Endothia species, based on DNA sequence data and morphology. Mycologia 96:990-1001. 478. Tsantrizos YS, Ogilvie KK, Watson AK. 1992. Phytotoxic metabolites of Phomopsis convolvulus, a host-specific pathogen of field bindweed. Canadian Journal of Chemistry 70:2276-2284. 479. Hammerschmidt L, Debbab A, Ngoc TD, Wray V, Hemphil CP, Lin W, Broetz-Oesterhelt H, Kassack MU, Proksch P, Aly AH. 2014. Polyketides from the mangrove-derived endophytic fungus Acremonium strictum. Tetrahedron Letters 55:3463-3468. 480. Neumann CS, Fujimori DG, Walsh CT. 2008. Halogenation strategies in natural product biosynthesis. Chemistry and Biology 15:99-109. 481. Akey DL, Gehret JJ, Khare D, Smith JL. 2012. Insights from the sea: Structural biology of marine polyketide synthases. Natural Product Reports 29:1038-1049. 482. Sato Y, Oda T, Urano S. 1976. Griseofulvin biosynthesis: New evidence of two acetate-dispositions in the ring A from 13C nuclear magnetic resonance studies. Tetrahedron Letters 17:3971-3974. 483. de Jong E, Field JA, Spinnler H-E, Wijnberg JBPA, de Bont JAM. 1994. Significant biogenesis of chlorinated aromatics by fungi in natural environments. Applied and Environmental Microbiology 60:264-270. 484. Xu X, Liu L, Zhang F, Wang W, Li J, Guo L, Che Y, Liu G. 2014. Identification of the first diphenyl ether gene cluster for pestheic acid biosynthesis in plant endophyte Pestalotiopsis fici. ChemBioChem 15:284-292. 485. Guo Z, She Z, Shao C, Wen L, Liu F, Zheng Z, Lin Y. 2007. 1H and 13C NMR signal assignments of Paecilin A and B, two new chromone derivatives from mangrove endophytic fungus Paecilomyces sp. (tree 1–7). Magnetic Resonance in Chemistry 45:777-780. 486. Akay Ş, Ekiz G, Kocabaş F, Hameş-Kocabaş EE, Korkmaz KS, Bedir E. 2014. A new 5,6-dihydro-2-pyrone derivative from Phomopsis amygdali, an endophytic fungus isolated from hazelnut (Corylus avellana). Phytochemistry Letters 7:93-96. 487. Liu D, Li XM, Meng L, Li CS, Gao SS, Shang Z, Proksch P, Huang CG, Wang BG. 2011. Nigerapyrones A–H, α-pyrone derivatives from the marine mangrove-derived endophytic fungus Aspergillus niger MA-132. Journal of Natural Products 74:1787-1791. 488. Giddens AC, Nielsen L, Boshoff HI, Tasdemir D, Perozzo R, Kaiser M, Wang F, Sacchettini JC, Copp BR. 2008. Natural product inhibitors of fatty acid biosynthesis: Synthesis of the marine microbial metabolites pseudopyronines A and B and evaluation of their anti-infective activities. Tetrahedron 64:1242-1249. 489. Sunthitikawinsakul A, Kongkathip N, Kongkathip B, Phonnakhu S, Daly JW, Spande TF, Nimit Y, Rochanaruangrai S. 2003. Coumarins and carbazoles from Clausena excavata exhibited antimycobacterial and antifungal activities. Planta Medica 69:155-157. 490. Ma C, Case RJ, Wang Y, Zhang HJ, Tan GT, Van Hung N, Cuong NM, Franzblau SG, Soejarto DD, Fong HHS, Pauli GF. 2005. Anti-tuberculosis

217 References

constituents from the stem bark of Micromelum hirsutum. Planta Medica 71:261-267. 491. Choi TA, Czerwonka R, Fröhner W, Krahl MP, Reddy KR, Franzblau SG, Knölker H-J. 2006. Synthesis and activity of carbazole derivatives against Mycobacterium tuberculosis. ChemMedChem 1:812-815. 492. Danhorn T, Fuqua C. 2007. Biofilm formation by plant-associated bacteria. Annual Review of Microbiology 61:401-422. 493. Lomenick B, Olsen RW, Huang J. 2011. Identification of direct protein targets of small molecules. ACS Chemical Biology 6:34-46. 494. Sato S-I, Murata A, Shirakawa T, Uesugi M. 2010. Biochemical target isolation for novices: Affinity-based strategies. Chemistry and Biology 17:616- 623. 495. Liu Y, Patricelli MP, Cravatt BF. 1999. Activity-based protein profiling: The serine hydrolases. Proceedings of the National Academy of Sciences of the United States of America 96:14694-14699. 496. Hughes TR, Marton MJ, Jones AR, Roberts CJ, Stoughton R, Armour CD, Bennett HA, Coffey E, Dai H, He YD, Kidd MJ, King AM, Meyer MR, Slade D, Lum PY, Stepaniants SB, Shoemaker DD, Gachotte D, Chakraburtty K, Simon J, Bard M, Friend SH. 2000. Functional discovery via a compendium of expression profiles. Cell 102:109-126. 497. Kling A, Lukat P, Almeida DV, Bauer A, Fontaine E, Sordello S, Zaburannyi N, Herrmann J, Wenzel SC, König C, Ammerman NC, Barrio MB, Borchers K, Bordon-Pallier F, Brönstrup M, Courtemanche G, Gerlitz M, Geslin M, Hammann P, Heinz DW, Hoffmann H, Klieber S, Kohlmann M, Kurz M, Lair C, Matter H, Nuermberger E, Tyagi S, Fraisse L, Grosset JH, Lagrange S, Müller R. 2015. Targeting DnaN for tuberculosis therapy using novel griselimycins. Science 348:1106-1112. 498. Cuomo CA, Güldener U, Xu J-R, Trail F, Turgeon BG, Di Pietro A, Walton JD, Ma L-J, Baker SE, Rep M, Adam G, Antoniw J, Baldwin T, Calvo S, Chang Y-L, DeCaprio D, Gale LR, Gnerre S, Goswami RS, Hammond- Kosack K, Harris LJ, Hilburn K, Kennell JC, Kroken S, Magnuson JK, Mannhaupt G, Mauceli E, Mewes H-W, Mitterbauer R, Muehlbauer G, Münsterkötter M, Nelson D, O'Donnell K, Ouellet T, Qi W, Quesneville H, Roncero MIG, Seong K-Y, Tetko IV, Urban M, Waalwijk C, Ward TJ, Yao J, Birren BW, Kistler HC. 2007. The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science 317:1400-1402. 499. Wiemann P, Sieber CMK, von Bargen KW, Studt L, Niehaus E-M, Espino JJ, Huß K, Michielse CB, Albermann S, Wagner D, Bergner SV, Connolly LR, Fischer A, Reuter G, Kleigrewe K, Bald T, Wingfield BD, Ophir R, Freeman S, Hippler M, Smith KM, Brown DW, Proctor RH, Münsterkötter M, Freitag M, Humpf H-U, Güldener U, Tudzynski B. 2013. Deciphering the cryptic genome: Genome-wide analyses of the rice pathogen Fusarium fujikuroi reveal complex regulation of secondary metabolism and novel metabolites. PLoS Pathogens 9:e1003475. 500. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, Weber T, Takano E, Breitling R. 2011. antiSMASH: Rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research 39:W339-W346.

218 References

501. Blin K, Medema MH, Kazempour D, Fischbach MA, Breitling R, Takano E, Weber T. 2013. antiSMASH 2.0—A versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Research 41:W204-W212. 502. Ruan X, Pereda A, Stassi DL, Zeidner D, Summers RG, Jackson M, Shivakumar A, Kakavas S, Staver MJ, Donadio S, Katz L. 1997. Acyltransferase domain substitutions in erythromycin polyketide synthase yield novel erythromycin derivatives. Journal of Bacteriology 179:6416-6425. 503. Reeves CD, Murli S, Ashley GW, Piagentini M, Hutchinson CR, McDaniel R. 2001. Alteration of the substrate specificity of a modular polyketide synthase acyltransferase domain through site-specific mutations. Biochemistry 40:15464- 15470. 504. Corre C, Song L, O'Rourke S, Chater KF, Challis GL. 2008. 2-Alkyl-4- hydroxymethylfuran-3-carboxylic acids, antibiotic production inducers discovered by Streptomyces coelicolor genome mining. Proceedings of the National Academy of Sciences of the United States of America 105:17510- 17515. 505. Chiang Y-M, Szewczyk E, Davidson AD, Keller N, Oakley BR, Wang CCC. 2009. A gene cluster containing two fungal polyketide synthases encodes the biosynthetic pathway for a polyketide, asperfuranone, in Aspergillus nidulans. Journal of the American Chemical Society 131:2965-2970. 506. Stewart EJ. 2012. Growing unculturable bacteria. Journal of Bacteriology 194:4151-4160. 507. Banik JJ, Brady SF. 2010. Recent application of metagenomic approaches toward the discovery of antimicrobials and other bioactive small molecules. Current Opinion in Microbiology 13:603-609. 508. Wilson Micheal C, Piel J. 2013. Metagenomic approaches for exploiting uncultivated bacteria as a resource for novel biosynthetic enzymology. Chemistry and Biology 20:636-647. 509. Feng Z, Kallifidas D, Brady SF. 2011. Functional analysis of environmental DNA-derived type II polyketide synthases reveals structurally diverse secondary metabolites. Proceedings of the National Academy of Sciences of the United States of America 108:12629-12634. 510. Kaeberlein T, Lewis K, Epstein SS. 2002. Isolating "uncultivable" microorganisms in pure culture in a simulated natural environment. Science 296:1127-1129. 511. Buerger S, Spoering A, Gavrish E, Leslin C, Ling L, Epstein SS. 2012. Microbial scout hypothesis and microbial discovery. Applied and Environmental Microbiology 78:3229-3233. 512. Gavrish E, Sit Clarissa S, Cao S, Kandror O, Spoering A, Peoples A, Ling L, Fetterman A, Hughes D, Bissell A, Torrey H, Akopian T, Mueller A, Epstein S, Goldberg A, Clardy J, Lewis K. 2014. Lassomycin, a ribosomally synthesized cyclic peptide, kills Mycobacterium tuberculosis by rargeting the ATP-dependent protease ClpC1P1P2. Chemistry and Biology 21:509-518. 513. Ling LL, Schneider T, Peoples AJ, Spoering AL, Engels I, Conlon BP, Mueller A, Schaberle TF, Hughes DE, Epstein S, Jones M, Lazarides L, Steadman VA, Cohen DR, Felix CR, Fetterman KA, Millett WP, Nitti AG, Zullo AM, Chen C, Lewis K. 2015. A new antibiotic kills pathogens without detectable resistance. Nature 517:455-459. 514. Pillay A, Rousseau AL, Fernandes MA, de Koning CB. 2012. The synthesis of the pyranonaphthoquinones dehydroherbarin and anhydrofusarubin using

219 References

Wacker oxidation methodology as a key step and other unexpected oxidation reactions with ceric ammonium nitrate and salcomine. Organic and Biomolecular Chemistry 10:7809-7819.

220