Exploration of Chemical Interactions Between Streptomyces and Eukaryotes

Exploration of chemical interactions between Streptomyces and eukaryotes

Louis K. Ho

A thesis submitted in conformity with the requirements For the degree of Doctor of Philosophy

Department of Biochemistry University of Toronto

Exploration of chemical interactions between Streptomyces and eukaryotes

Louis K. Ho

Doctor of Philosophy

Department of Biochemistry University of Toronto

2020

Abstract

In the environment, bacteria live in complex communities with other organisms. In this work, I characterize two new chemically-mediated ways in which bacteria and eukaryotes interact. First,

I show that ingestion of Streptomyces bacteria can directly be lethal to fruit flies and that this toxicity is the result of bacterial production of insecticides. I also show that this toxicity is facilitated by airborne odors that reducesin insect progeny. Second, I show that the yeast

Saccaromyces cerevisiae can trigger Streptomyces to enter a new mode of growth called

‘exploration’. I characterize ‘exploratory’ growth and identify how it is triggered by airborne chemicals and the chemical modification of the growth environment. Overall, this thesis describes two new ways in which bacteria and eukaryotes interact and highlights how chemicals play an important role in these interactions.

ii ii

Acknowledgements

I would like to thank all past and present members of the laboratory for their support and putting up with me throughout the years. You are not only my trusted colleagues but also my friends that I hope to cherish and keep in touch with for many years to come*.

I would like to thank my supervisor, Dr. Justin Nodwell for putting insurmountable faith in me from the very beginning and for shaping my view of the world.

I would like to thank my committee members Dr. Craig Smibert and Dr. Leah Cowen for providing monumental guidance and grilling me at committee meetings.

I would like to thank my family for their foundational support. It is through my cultural roots where I have found motivation and have profound respect towards.

Finally, I would like to thank nature itself…for without it, we would have nothing to study.

*Sheila Marie Pimentel-Elardo, Martin Daniel-Ivad, Stephanie Tan, Jan ‘The Man’ Vincent Falguera, Vanessa Yoon-Calvelo, Glenna Kramer, Jing Li, Stefanie Mak, Scott McAuley, Krysten Joy Myer, Ali Nikdel, Daniel Socko, Tomas Gverzdys. Cyrus Savalanpour, Maxime Lefebvre.

iiiiii

Table of contents

Acknowledgments……………………………………………………………………………….iii Table of contents…………………………………………………….……………………..……iv List of figures and tables………………………………..……...………………….…………….v Publications……………………………………………………..…...……………….…………vii

Chapter 1 Chemical perturbation of eukaryotes by bacteria……………….………………...1 1.1 Abstract………………………………………………………………………………..1 1.2 Introduction…………………………………………………………...…………….…1 1.2.1 Targeting DNA synthesis: Doxorubicin…………………..……………..….6 1.2.2 Targeting fungal sterols: Amphotericin B………………..……………...….8 1.2.3 Targeting growth and development: mTOR……………………………….10 1.2.4 Targeting neurotransmission: Avermectin…………………………………13 1.2.5 Targeting nuclear export: Leptomycin B…………………………………..15 1.2.6 Targeting the proteasome: Epoxomicin……………………………………18 1.3 What is the biological function of eukaryote-active metabolites in nature?...... 21 1.4 Establishing a link between bacterial toxicity and insecticidal metabolites………...21

Chapter 2: Chemical entrapment and killing of insects by bacteria……….………………..24 2.1 Abstract……………………………………………………………………….……...24 2.2 Introduction…………………………………………………………………………..25 2.3 Results………………………………………………………………………………..28 2.3.1 Many streptomycetes make insecticidal metabolites………………………28 2.3.2 Toxicity of Streptomyces spores…………………………………………...30 2.3.3 Cosmomycin-D is the causative agent of killing by WAC-288…………...32 2.3.4 The mechanisms of spore-associated lethality is associated with mechanism of the toxic compound being produced…………………………………………..33 2.3.5 Chemical attraction by Streptomyces cultures and 2-methylisoborneol leads flies to spores …………………………………………………….……………...36 2.4 Discussion……………………………………………………………………………39

Chapter 3 Streptomyces exploration is triggered by fungal interactions and volatile signals……………………………………………………………………………………………42 3.1 Abstract………………………………………………………………………..……..42 3.2 Introduction……………………………...…………………………………………...43 3.3 Results………………………………..………………………………………………45 3.3.1 Physical association with yeast stimulates Streptomyces exploration……..45 3.3.2 The yeast TCA cycle must be intact to stimulate Streptomyces exploration48 3.3.3 Exploration is glucose-repressible and pH-dependent……………………..53 3.3.4 S. venezuelae exploration requires an alkaline stress response…………….57 3.3.5 S. venezuelae explorer cells alkalinize the medium using an airborne volatile organic compound………………………………………………………………..59 3.3.6 S. venezuelae exploratory cells use VOCs to induce exploration in other streptomycetes at a distance……………………………………………………...61

3.3.7 The VOC trimethylamine stimulates Streptomyces exploratory behaviour………………………………………………………………….……...63 3.3.8 TMA induces exploratory growth by raising the pH of the growth medium…………………………………………………………………………..64 3.3.9 TMA can reduce the survival of other bacteria……………………………66 3.4 Discussion……………………………………………………………………………67

Chapter 4 Concluding remarks………………………………………………………….…….71 4.1 Bacteria and their relationship with eukaryotes…………………………………...…71 4.2 Future directions……………………………………………………………….…….71 4.2.1 Behavioural responses of nematodes to live Streptomyces colonies……....71 4.2.2 More screens across multiple Domains of life……………………………..73 4.2.3 Understanding of the effect of volatile compounds on insect behaviour…..74

Materials and methods…………………………………………………………………….…...76 Materials and methods (Chapter 2)……………………………………………….……...76 Materials and methods (Chapter 3)……………………………….……………………...83

Appendix……………………………………………………………………………….…...... …89 A.1 Supplementary figures & tables………………………………………………..……89

References………………………………………………………………………………...……125

v iv

List of figures and tables

Table 1.1 The eukaryotic targets of actinomycete metabolites Fig. 1.1 The eukaryotic targets of actinomycete metabolites is incredibly diverse Fig. 1.2 Doxorubicin: A potent anticancer compound that intercalates DNA Fig. 1.3 Amphotericin B: A potent antifungal compound Fig. 1.4 Rapamycin: Targeting the mammalian Target of Rapamycin (mTOR) pathway Fig. 1.5 Avermectin: Targeting neurotransmission in insects and nematodes Fig. 1.6 Leptomycin B: Inhibiting the nuclear export of protein cargo Fig. 1.7 Epoxomicin, a tripeptide that targets the eukaryotic 20S proteasome Fig. 2.1 Identifying insecticidal bioactivity in actinomycete extracts Fig. 2.2 Actinomycetes pose a threat to larval viability due to the production of insecticidal metabolites Fig. 2.3 Cell death-like activity in D. melanogaster is triggered by the consumption of cosmomycin-D producing spores. Fig. 2.4 Chemical entrapment of adult flies that are attracted to actinomycetal cultures and 2- methylisoborneol Table 2.5 Establishing a link between 2-MIB and insecticidal activity Fig. 3.1 Physical association with yeast triggers Streptomyces exploratory behaviour Fig. 3.2 Video of the leading edge of S. venezuelae explorer cells over a 17 hr time frame Fig. 3.3 S. venezuelae grown beside diverse yeast strains Fig. 3.4 Identifying yeast mutants that lack the ability to stimulate exploratory growth in S. venezuelae Fig. 3.5 Yeast stimulates S. venezuelae exploratory growth by consuming glucose and inhibits it by acidifying the medium Fig. 3.6 TCA cycle is implicated in C. albicans induction of S. venezuelae exploration Fig. 3.7 Exploratory growth in S. venezuelae is stimulated by the absence of dextrose Fig. 3.8 The alkaline stress response is associated with S. venezuelae exploratory behaviour Fig. 3.9 Volatile organic compounds released by S. venezuelae raise the medium pH and induce exploratory growth in physically separated Streptomyces Fig. 3.10 S. venezuelae VOCs inhibit the growth of other bacteria Fig. 3.11 New model for Streptomyces development Fig. 4.1 How C. elegans respond to live actinomycete colonies Table 6.1 Strains, plasmids, media and culture conditions Fig. 6.2 T-maze used to test the preference of pure 2-MIB on adult fruit flies Fig A.2 The effect of Streptomyces extracts on fruit fly larvae Fig A.3 Spores kill flies similar to the effect of the extract Fig. A.4 Purification and structural elucidation of cosmomycin-D Table A.5 Biosynthetic gene clusters in WAC-288 Fig. A.6 Analyzing the cosmomycin-D biosynthetic gene cluster

viv

Fig. A.7 Confirming the lack of antifungal activity of WAC-288 Fig. A.8 Visible spores in Streptomyces-fed larvae Fig A.9 Crude extract of WAC-288 has activity against human cells Fig A.10 WAC-288 is active against mosquito larvae Table A.11 Summary of activity against C. elegans Fig. A.12 Production of nonactins by Cu230555 with paralysis against C. elegans Fig. A.13 Bioactivity-guided purification of larvicidal compounds Fig. A.14 Effect of cosmomycin-d and doxorubicin on 1st instar larvae Fig. A.15 Complete genome of WAC-288 Fig. A.16 Deleting Cosmomycin-D and 2-MIB Biosynthesis Table A.17 Primers used for gene disruption and confirmation Table A.18 Preference assay parameters and raw data Fig. A.19 Biosynthetic gene cluster of 2-methylisoborneol in WAC-288 Fig. A.20 Comparing biosynthetic gene clusters of 2-methylsioborneol between actinomycetes Fig. A.21 Conservation of 2-methylisoborneol synthase in actinomycetes Fig. A.22 Phylogeny of 2-methylisoborneol production Fig. A.23 An evolutionary dead end: Embryos deposited in contaminated food sources have reduced survival. Fig. A.24 Species-level phylogenetic analysis of WAC-288 Fig. A.25 D. melanogaster outbred lines as well as distantly related Drosophila species are susceptible to Streptomyces spores. Fig. A.26 Several Drosophila species are attracted to Streptomyces cultures. Fig. A.27 Mutants of WAC-288 are defective in cosmomycin D production. Fig. A.28 Explorer cells are hydrophilic Fig. A.29 Phylogeny of exploratory streptomycetes Fig. A.30 S. venezuelae grown alone on glucose-deficient medium exhibits similar exploratory growth to S. venezuelae growing next to yeast on glucose medium Fig. A.31 S. venezuelae grown alone raises the pH of glucose-deficient medium Fig. A.32 High pH alone does not stimulate S. venezuelae exploration Fig. A.33 Complementation of explorer mutant phenotypes Table A.34 Effects of media composition on S. venezuelae exploration when grown in the absence of yeast Table A.35 VOCs identified using GC×GC-TOFMS Table A.36 Oligonucleotides used in this study Fig. A.37 The S. venezuelae cydCD mutant strain can explore in response to volatile signals produced by neighbouring explorer cells Fig. A.38 Wild explorer Streptomyces species promote exploration in S. venezuelae using volatile signals Fig A.39 The VOC produced by S. venezuelae explorer cells can be produced by liquid-grown (G-) S. venezuelae and WAC0566 culture

vi vii

Publications

The majority of the work reported in this thesis has been published in the following peer reviewed publications:

Ho, L. K., & Nodwell, J. R. (2016). David and Goliath: chemical perturbation of eukaryotes by bacteria. Journal of industrial microbiology & biotechnology, 43(2-3), 233-248. Ho, L.K., Daniel-Ivad M., Jeedigunta S., Li J., Iliadi, K.G., Boulianne, G.L., Hurd, T., Smibert, C.A. and Nodwell, J. (2019) Chemical entrapment and killing of insects by bacteria. Manuscript Under Review. doi. 10.21203/rs.3.rs-36307/v1 Jones, S. E., Ho, L., Rees, C. A., Hill, J. E., Nodwell, J. R., & Elliot, M. A. (2017). Streptomyces exploration is triggered by fungal interactions and volatile signals. Elife, 6, e21738.

vii viii

Chapter 1 Chemical perturbation of eukaryotes by bacteria

This chapter was published in the following review: Ho, L. K., & Nodwell, J. R. (2016). David and Goliath: chemical perturbation of eukaryotes by bacteria. Journal of industrial microbiology & biotechnology, 43(2-3), 233-248.

1.1 Abstract

Environmental microbes produce biologically active small molecules that have been mined extensively as antibiotics and a smaller number of drugs that act on eukaryotic cells. It is known that there are additional bioactive compounds to be discovered from this source. While the discovery of new antibiotics is challenged by the frequent discovery of known compounds, we contend that the eukaryote-active compounds may be less saturated. Indeed, despite there being far fewer eukaryotic-active natural products these molecules interact with a far richer diversity of molecular and cellular targets.

1.2 Introduction

Actinomycetes are Gram-positive, filamentous bacteria that are ubiquitous throughout the environment. They can be found in almost every ecological niche on Earth, from extremely high altitudes in the Himalayan mountains (Bhattacharjee, 2012) to the deepest oceans of Mariana’s Trench (Pathom-Aree 2006). They include several genera including Micromonospora, Amycolatopsis and Salinospora. However, the most well-known genus of actinomycete is Streptomyces. The most notable feature of this genus is its astounding ability to produce biologically active small molecules referred to as ‘natural products’, ‘secondary metabolites’, or ‘specialized metabolites’. Many of these have been isolated and used as therapeutics (e.g. as antibacterial, antifungal, anticancer, immunosuppressive, and anti-parasitic compounds) in the clinic (Berdy 2005, Clardy 2006, Zotchev 2012). While these bioactive compounds have proven useful in the clinic, it is not clear whether these activities are relevant in nature. There are several reasons why natural products are perceived exclusively as drugs in the clinic. The primary focus in this field since its inception has been on the discovery of antibiotics. This view persists today

as antibiotic resistance continues to be a problem (Baltz 2006, 2008). Drug discovery based on mining metabolites from actinobacteria was based on enormous screens of culture supernatants against pathogenic bacteria and other organisms. This led to the discovery of over 10,000 bioactive compounds, many of which were antibacterial. However, the repeated re-discovery of known antibiotics from this source led to the abandonment of this approach during the 1990s. The prevailing view by the mid-1990s was that there was no new chemical diversity left to discover. But, through the advent of genome sequencing, a vast reservoir of biosynthetic genes for these compounds, including polyketides and non-ribosomal peptides, was shown to be much larger than what had been previously appreciated (Baltz 2008, Kinashi 2011, Bentley 2002, Ikeda 2003, Ohnishi 2008). We now know that each actinomycete genome encodes 20–50 biosynthetic gene clusters for secondary metabolites (Nett 2009)—many of which are unassigned to a product structure or biological activity. Indeed, even secondary metabolites encoded by well-characterized model strains such as Streptomyces coelicolor, Streptomyces griseus and Streptomyces avermitilis remain unknown. As a result, there has been renewed emphasis on the discovery and characterization of these cryptic metabolites through the use of new bioinformatic approaches, innovative culture techniques, genetic manipulation, chemical perturbations and new screening regimens (Craney 2013, 2012, Gomez-Escribano 2011, Yoon 2014, King 2014, Ling 2015, McKenzie 2010, Ochi 2012, Rigali 2008, Spanogiannopoulos 2012, Thaker 2014, Daniel- Ivad 2017).

There are several explanations for why so many secondary metabolites have eluded discovery. One view is that many secondary metabolic genes are expressed at low levels in the laboratory and that their products cannot therefore be easily detected. Another may be that there is ‘screening bias’ in existing discovery regimens. Since most screening protocols are designed to detect antimicrobial compounds it is possible that uncharacterized chemical matter exists that act on other targets that are present in non-microbial organisms (i.e. multicellular eukaryotes). These uncharacterized bioactive compounds could also have nothing to do with antibiotic activity at all, eliciting non-lethal effects that relay important communicative signals to other organisms (Goh 2002, Yim 2007). With this disparity in mind, I compiled a list of actinomycete metabolites that target Eukaryotic organisms and found a diverse set of secondary metabolites that interact with single-

Table 1.1 The eukaryotic targets of actinomycete metabolites. Shown is a representative list of known actinomycete metabolites with molecular targets in Eukaryotes. Antibiotic Producer Primary target(s)

Actinomycin D Streptomyces spp. DNA Bleomycin Streptomyces verticillus DNA, RNA Daunorubicin Streptomyces peucetius DNA Mitomycin Streptomyces spp. DNA Calicheamicin Micromonospora echinospora DNA

Rapamycin Streptomyces hygroscopicus FKBP12, mTOR FK506 Stretpomcyes tsukubaensis FKBP12, calcineurin Ascomycin Streptomyces hygroscopicus FKBP12, calcineurin

Antimycin A Streptomyces spp. Cytochrome C reductase Oligomycin Streptomyces distatochromogenes ATP synthase

Epoxomicin S. hygroscopicus ATCC 53709 20S proteasome Salinosporamide Salinospora spp. 20S proteasome

Avermectin Streptomyces avermitilis GluCl channel Milbemycin Streptomyces bingchenggensis GluCl channel Spinosyn Saccharopolyspora spinosa nACh receptor

Ionomycin Streptomyces conglobatus Ion gradient Nigiricin Streptomyces hygroscopicus Ion gradient Valinomycin Streptomyces spp. Ion gradient

Amphotericin B Streptomyces nodosus Ergosterol Candicidin Streptomyces griseus Ergosterol Natamycin Streptomyces natalensis Ergosterol Nystatin Streptomyces noursei Ergosterol

Bafilomycin Streptomyces griseus V-ATPase Concanamycin Streptomyces neyagawaensis V-ATPase

Lavendustin A Streptomyces griseolavendus Tyrosine kinase Sangivamycin Streptomyces rimosus Protein kinase C Staurosporine Streptomyces staurosporeus Protein kinase C

Borrelidin Streptomyces parvulus Threonyl-tRNA synthase Cycloheximide Streptomyces griseus 60S ribosome Geldanamycin Streptomyces hygroscopicus Hsp90 Leptomycin B Streptomyces spp. CRM1 Rebeccamycin Streptomyces spp. Topoisomerase I Trichostatin A Streptomyces spp. HDAC I & II Tunicamycin Streptomyces spp. UDP-HexNAc

Fig. 1.1 The eukaryotic targets of actinomycete metabolites is incredibly diverse. Shown are representative targets of actinomycete metabolites. These include compounds that have molecular targets in the nucleus, cytoplasm, membrane or specific organelles. Some are universal targets that are present in all living organisms, DNA. Some compounds target conserved pathways throughout the Eukaryotic Kingdom: 60S ribosome, mitochondria. Some target fungal microorganisms like Amphotericin B which targets ergosterol, only present in fungi. Some uniquely target specific differentiated cells of certain multicellular eukaryotes like avermectin which targets receptors on neuromuscular junctions.

-celled and more notably multicellular Eukaryotic organisms (Table 1.1, Fig. 1.1).

What became clear after compiling this list was that the molecular targets within eukaryotes exceed the number of natural product targets known in bacteria. There are a total of 23 unique Eukaryotic targets of actinomycete metabolites. They include the 60S ribosome (cycloheximide), mammalian Target of Rapamycin (rapamycin), V-ATPase (bafilomycin), Hsp90 (geldanamycin), Histone Deacetylases (Trichostatin) and many more. In contrast, the targets of antibacterials are limited to four major pathways: DNA synthesis, RNA synthesis, protein synthesis and cell wall synthesis (Kohanski 2010). For example, tetracycline targets the small 30S ribosomal subunit, chloramphenicol targets the large ribosomal subunit and kirromycin targets EF-Tu. Aside from a few minor antibiotic targets (e.g., platensimycin inhibits fatty acid biosynthesis and daptomycin disrupts the cell membrane) these central components of macromolecular synthesis are the antibacterial targets of virtually all naturally occurring antibiotics that are known at this time. One reason why the search for eukaryotic-active compounds is absent is a lack of screens that can detect chemical perturbations of multicellular eukaryotes. In addition to being excellent modulators of intricate biological pathways for fundamental research, these molecules could also provide leads for new therapeutic agents against diseases caused by eukaryotes. More importantly, these molecules can offer new insight into the relationship between the producer and the target organism in nature.

In the following sections 1.2.1 – 1.2.6 I describe, in detail, a representative set of molecules produced by actinomycetes that have molecular targets in eukaryotes.

1.2.1 Doxorubicin: A potent anticancer compound that intercalates DNA

One of the mainstays of cancer chemotherapy involves the use of the anthracycline drugs epirubicin, pirarubicin, aclarubicin and idarubicin, all of which are derived from the foundational drug doxorubicin. These drugs are routinely used against malignancies such as adult acute leukemia, breast carcinoma, non-Hodgkin’s lymphoma and ovarian carcinoma (Cortez-Funes 2007, Hurley 2002). Indeed, the first clinically approved nano-drug (Doxil®) was a liposomally encapsulated form of doxorubicin used for the treatment of AIDS-induced Kaposi’s sarcoma and solid tumours (Barenholz 2012).

The first member of this class, daunorubicin, was isolated from Streptomyces peucetius in 1963 and found to be effective against murine tumours (Di Marco 1963). However, clinical trials revealed severe cardiotoxicity so the compound was abandoned (Tan 1967). To find a more therapeutically favourable analogue, Arcamone et al. mutagenized S. peucetius and isolated strains that produced an altered, and more clinically favourable form of the drug that was named doxorubicin (Arcamone 1969). Doxorubicin is still toxic however it can be dosed to maximize its anticancer activity and minimize damage to normal tissue. Both compounds are planar tetracyclic structures attached to an amino sugar moiety: doxorubicin differs from daunorubicin by a single hydroxyl group (Fig. 1.2A).

Fig. 1.2 DNA intercalation by the anthracycline antibiotic doxorubicin. (A) The chemical structure of daunorubicin and doxorubicin produced by Streptomyces peucetius. (B) Crystal structure of DNA-doxorubicin associated complexes. The tetracyclic rings intercalate between base pairs while the aminosugar rests in the minor groove of DNA (PDB:1D12)

The earliest indication of doxorubicin’s mechanism of action came from in vivo assays showing reduced RNA synthesis in HeLa cells (Di Marco 1965). In that same year, Calendi et al. observed distinct changes in the physical properties of DNA when incubated with the drug in vitro (Calendi 1965). Indeed, crystal structures (Frederick 1990) and NMR spectroscopy (Zeman 1998) of doxorubicin-DNA complexes show that the drug intercalates between the nitrogenous base pairs by planar insertion (Fig. 1.2B). Indeed, doxorubicin is one of the few actinomycete- derived compounds that has a ubiquitous target present in all forms of life. This also includes viruses— it was recently shown that DNA-intercalators can act as a chemical phage-defence for bacteria, working by endogenously neutralizing injected viral DNA from integrating itself into the bacterial genome (Kronheim 2018).

Doxorubicin was found to induce double strand breaks in the DNA of leukemic cells where the ends of the broken strands were associated with a protein complex. The protein was subsequently identified as topoisomerase II, the homodimeric enzyme responsible for relieving positive supercoiling by a double-strand cleavage and rejoining mechanism (Tewey 1984). This and other work led to a model where doxorubicin intercalates DNA causing topoisomerase II to become trapped resulting in a ternary complex and a double-strand break (Liu 1989). The exact molecular mechanism of this process is not fully understood, however several mutagenesis studies in yeast implicate the CAP-like DNA-binding domain of topoisomerase II as a direct target (Moro 2004, Patel 1997).

This model is widely recognized as doxorubicin’s primary mechanism of targeting proliferative cancerous cells in vivo. However, there is support for alternative mechanisms in the literature. This includes most notably the generation of reactive oxygen species (ROS) (Kim 2006) and gene specific damage (Capranico 1990, Ito 1990). It is possible that these alternative mechanisms occur simultaneously.

1.2.2 Amphotericin B: A potent antifungal compound Many antibiotics target fungal cells (Berdy 2005). The most clinically relevant class in this category are the polyene macrolides, particularly amphotericin B, isolated in 1953 at the Squibb Institute from the fermentation of Streptomyces nodosus (Dutcher 1968). Due to its toxicity, amphotericin B is a last-resort drug used in modern medicine for managing serious systemic fungal infections. Amphotericin B is active against many fungal pathogen species in vitro including Candida albicans (Arthington-Skaggs 2000, Pfaller 1998), Aspergillus fumigatus (Arikan 1999, Espinel-Ingoff 1997), Cryptococcus neoformans (Arthington-Skaggs 2000, Davey 1998), Blastomyces dermatitidis (Li 2000, Sugar 1996), Histoplasma capsulatum (Li 2000), Rhizopus sp. (Espinel-Ingroff 1995, 1997) and Mucroales sp. (Salas 2012). Despite amphotericin B’s long-standing monotherapeutic use over the last 50 years, few resistant strains have emerged. This was shown to be due to the fungal pathogen losing its virulence when resistant to amphotericin B (Vincent 2013). However, a number of amphotericin B-resistant strains of Aspergillus (Sutton 1999), Cryptococcus (Manfredi 2006) and Candida (Yang 2004) have emerged in the clinic in recent years. In addition, amphotericin B treatment is often associated with adverse effects including nephrotoxicity (Wingard 1999) and anemia (Lin 1990, MacGregor 1978, Yeo 2006). Interestingly, amphotericin B-induced anemia has been shown to occur through the inhibition of the transcription factor hypoxia-inducible factor-1 (HIF-1), thereby reducing the expression of erythropoietin (EPO), which controls red blood cell proliferation (MacGregor 1978, Yeo 2006).

Amphotericin B is comprised of an amphipathic macrolactone ring with a mycosamine attachment (Fig. 1.3A). These molecular features work together to bind and extract the fungal specific sterol ergosterol in the membrane like a sponge (Anderson 2014). Hydrogen bonds formed between the mycosamine of amphotericin B and the hydroxyl group present in both ergosterol (fungal) and cholesterol (human) are essential for binding to occur (Palacios 2011). An early, yet no-longer accepted model of amphotericin B’s mechanism of action was the ‘barrel-stave’ (Marty 1975, van Hoogevest 1978). In this model, eight amphotericin B-sterol complexes are aligned perpendicularly to the lipid bilayer forming a channel with the

hydrophobic face on the exterior and the hydrophilic face pointing towards the interior (Fig. 1.3B). K+ ions would then leak out of the cell resulting in membrane depolarization and

Fig. 1.3 Mechanism of Amphotericin B, a potent antifungal compound. (A) The chemical structure of amphotericin (B). (Produced by Streptomyces nodosus). Highlighted are the drug’s molecular features that confer its specificity for ergosterol in fungi rather than cholesterol in mammalian cells. (B) Four models of amphotericin B-ergosterol interactions with the lipid bilayer in fungi.

eventually cell death (Arczewska 2011, Kotler-Brajtburg 1979). Recent studies by Gray et al. have challenged the notion that ion leakage by pore formation is the sole biochemical feature in its mechanism of action (Gray 2012). They found that a chemically modified analogue, C35deOAmB, lacking the ability to form pores, retained its antifungal potency. Likewise, the related polyene natamycin possesses antifungal activity despite its inability to form pores in the membrane (Welscher 2010). An alternative and accepted model therefore, is that amphotericin B binds to the membrane monomerically, parallel to the lipid moieties (adsorption) (de Kruijff

1974, Mouri 2008) or in aggregates (sponge) (Anderson 2014) to sequester ergosterol thereby causing a global reduction of sterol levels in the membrane. This in turn could limit the sterol’s function in maintaining the structural integrity and fluidity of the lipid bilayer as well as enable the function of membrane bound enzymes that influence a wide range of diverse signalling cascades (White 1998, Li 2010). While it is likely that monomeric, aggregated and pore-forming states of amphotericin B occur simultaneously, the ratios at which these formations exist at various concentrations remain unknown.

Ongoing debate about its mechanism of action and toxicity suggests that modification of this drug, or the isolation and investigation of new congeners from other actinomycetes could drive the development of better antifungal drugs. More recently, novel derivatization of amphotericin B using diphenylphosphoryl azide (DPPA) led to two analogues: AmBMU and AmBAU, which were shown to be effective in evading resistance in Candida while having greater selectivity for ergosterol and were thus less toxic to human blood cells (Davis 2015). Notably, this study also revealed that amphotericin B-resistant strains of Candida are non-pathogenic in mice suggesting that mutants with major changes in ergosterol can significantly reduce pathogenicity. In addition, robust methods of synthesizing less toxic analogues of amphotericin B have been developed using the iterative cross-coupling of polyene building blocks which could provide more candidates for improving drug efficacy (Li 2015).

It is widely agreed that additional antifungal drugs are needed to combat resistant strains and improve therapeutic outcomes associated with opportunistic mycoses including candidiasis, cryptococcal meningitis and aspergillosis, which often do not respond well to a limited number of current drug regimens. Indeed, fungal infections that were previously treated successfully with this drug are showing increasing resistance (Robbins 2017, Wiederhold 2017, CDC 2019).

1.2.3 Rapamycin: Targeting the mammalian Target of Rapamycin (mTOR) The macrocylic lactone antibiotic rapamycin has had an enormous impact on medicine and on our understanding of eukaryotic cells. Its story began in 1964 when a Canadian expedition team collected soil samples from Easter Island in the southeastern point of the Polynesian Triangle in the Pacific Ocean. This soil sample was then investigated at Ayerst Laboratories in Montreal where the molecule, rapamycin (from Rapa Nui, the indigenous name for Easter Island), later derived from the isolated strain Streptomyces hygroscopicus, showed remarkable antifungal activity against Candida (Vézina 1975). Persistent efforts led to rapamycin’s rise to acclaim where it was found to possess potent immunosuppressive and antiproliferative properties (Houchens 1983, Martel 1977), leading in turn to further investigation of its mode of action.

Initially, the structurally related immunosuppressant FK506 was found to target the 12-kDa FK506-binding protein (FKBP12), a peptidylprolyl rotamase (Harding 1989, Siekierka 1989). The complex then acquires a gain-of-function ability to suppress the activation of T-cells in the immune system through a third target, calcineurin (Kissinger 1995). Similarly, rapamycin also binds to FKBP12, however, mounting evidence suggested that FK506 and rapamycin varied in their mechanism of immunosuppression in murine T-cells (Bierer 1990, Dumont 1990), suggesting that the tertiary target of the rapamycin-FKBP12 complex was not the same as FK506. A landmark study by Heitman et al. was carried out in the budding yeast Saccharomyces cerevisiae in which genetic screens led to the identification of dominant mutations in TOR1 and TOR2 that were shown to confer rapamycin resistance (Heitman 1991). This suggested that the encoded TOR (target of rapamycin) proteins—paralogous serine/threonine kinase subunits— were the targets of the FKBP-rapamycin complex that ultimately resulted in immunosuppression and growth reduction. It was subsequently found that rapamycin binds proteins in mammalian cells that shared extensive sequence similarity to TOR1, providing not only direct evidence of the rapmaycin-FKBP binding targets but also showing that the mechanistic targets are highly conserved in lower and higher eukaryotes (Brown 1994, Crespo 2002, Sabatini 1994, Sabers 1995). X-ray crystallography further elucidated the drug’s mode of action showing that rapamycin has two binding sites (Banaszynski 2005, Choi 1996) (Fig. 1.4A). Most eukaryotic

organisms possess one TOR protein. The mTOR (mammalian target of rapamycin) is a large (289 kDa) protein that belongs to the phosphoinositide kinase-related kinase (PIKK) family. It associates with other proteins to form two functionally distinct complexes: mTORC1 and mTORC2.

Proteins that act upstream of mTORC1 mediate responses to a variety of intra- and extracellular cues: growth factors (Floyd 2007), oxygen levels (Arsham 2003), energy (Bolster 2002, Kimura 2003), mitogens (Citro 2015, Fang 2001) and amino acids (Blommaart 1995). The current model posits that mTORC1 senses environmental cues and works to positively regulate downstream signals of protein synthesis by controlling components in the translation machinery (Fig. 1.4B).

Fig. 1.4 Targeting the mammalian Target of Rapamycin (mTOR) pathway. (A) The chemical structure and binding regions of rapamycin (Prod. Streptomyces hygroscopicus). (B) In mammals, rapamycin forms a ternary complex with FKBP12 (FK506-binding protein 12) and mTOR in the mTORC1 (mammalian target of rapamycin complex 1). This pathway is implicated in sensing environmental cues that regulate major cellular outputs. The mTORC2 signalling network was initially thought to be rapamycin insensitive (Jacinto 2004, Sarbassov 2004), however, recent studies suggest that mTORC2 does respond to rapamycin in certain cell types after prolonged exposure to the drug (Phung 2006, Sarbassov 2006). Less is known about the mTORC2 pathway, however, it has been shown to associate with the ribosome and is required for activation of cytoskeletal organization (Zinzalla 2011). mTORC2 has been

shown to regulate three kinases: Akt (Sarbassov 2005), serum- and glucocorticoid- induced protein kinase 1 (SKG1) (Garcia-Martinez 2008) and protein kinase C-α (PKCα) (Sarbassov 2004).

In addition to mediating rapamycin’s clinical use for preventing graft rejection after organ transplantation and for treating autoimmune disorders, the components of the mTOR pathway have also been implicated in many other conditions including obesity related type 2 diabetes (Khamzina 2005, Le Bacquer 2007, Polak 2008, Tremblay 2007, Um 2004) and cancer (Guo 2013, Wang 2001, Wong 2004). Indeed, mutations in negative and positive regulators of mTOR signaling are among the most common tumour suppressors and oncogenes that arise in cancer patients. As a result, several rapamycin derivatives (rapalogues) have been approved for the treatment of various cancers (Benjamin 2011). More recently, rapamycin has been explored as a treatment for age related diseases after the drug remarkably was shown to increase the lifespan of yeast (Powers 2006), nematodes (Robida-Stubbs 2012), fruit flies (Bjedov 2010) and mice (Anisimov 2011, Harrison 2009, Miller 2010).

Rapamycin exemplifies the enormous value that eukaryotic targeting compounds can have through the exploration of the drug’s mode of action. In addition to the drug and its derivatives being useful therapeutics with a variety of applications, they serve as chemical probes that can be used to elucidate the inner workings of complex biological pathways.

1.2.4 Avermectin: Targeting neurotransmission in insects and nematodes The avermectins are a class of macrocyclic lactones that have broad-spectrum activity against nematodes and insects, but that lack antimicrobial activity. In the 1970s researchers at the Kitasato Institute isolated Streptomyces avermitilis (also referred to as Streptomyces avermectinius) from a soil sample on a golf course in Shizuoka Prefecture, Japan. The fermentation broth of this microbe was found to have potent activity against helminth parasitic worm Nematospiroides dubius and remarkably cured the worm-infected mice with little to no toxicity (Burg 1979). Soon after, these compounds were identified as a mixture of eight isomers of which avermectins B1a and B1b were found to be the most potent derivatives (Omura 2004) (Fig. 1.5a).

Avermectin disrupts glutamate-gated chloride channels (GluCls) in nematodes (Arena 1991, 1992) and insects (Cully 1996, Kane 2000) that play a critical role in muscle contraction required for locomotion and feeding. The GluCl channel belongs to a Cys-loop receptor family and is comprised of five subunits. These respond to glutamate to allow the influx of chloride ions to transmit an action potential from the presynaptic to the postsynaptic neuron (Fig. 1.5b).

Avermectin disrupts this process by irreversibly inserting itself between the channel’s transmembrane domains, thereby causing ions to constitutively leak through the compromised channel (Hibbs 2011). This results in the hyperpolarization of the neuromuscular synapses causing paralysis and subsequent death. It is selective for nematode parasites because mammals do not have GluCls but instead have the evolutionarily related gamma-aminobutyric acid (GABA) receptor channels (Wolstenholme 2012). While avermectin can bind GABA receptors in the mammalian central nervous system, the pharmacological effectiveness of the drug is owed to its inability to cross the blood–brain barrier (Schinkel 1994, 1996).

Initially, avermectin was studied for use in veterinary medicine and animal husbandry. The medical formulation of the drug, ivermectin, became useful in agriculture, saving livestock affected by ectoparasitic arthropods and endoparasitic helminth nematodes (Campbell 2012). But the most significant contribution that this drug has had was its use to treat river blindness, a disease caused by the parasite Oncocerca volvulus that is transmitted by the black fly. Ivermectin is credited for significantly reducing morbidity and transmission of onchocercal infections in the endemic regions of sub-Saharan Africa and Latin America, preventing an estimated 600,000 cases of river blindness (Boatin 2008).

Interestingly, ivermectin is not the only molecule that can inhibit the proper function of neurotransmission. It belongs to a class of macrocyclic lactones that include milbemycin, and doramectin that have an impressive range of clinical use. Doramectin, for example, is used extensively in agriculture and veterinary medicine to protect cattle from gastrointestinal parasites (Ballweber 1997). Despite their incredible value in modern medicine, their prevalence in nature remains poorly characterized. It is likely that many more variations of ‘mectin’-family of

macrocyclic lactones exist and remains an underexplored area of natural product discovery. To put these compounds into an ecological perspective, the fact that actinomycetes produce a compound that is specific to insects and nematodes (not fungi) suggests that an intimate and antagonistic relationship exists between actinomycetes and these organisms.

1.2.5 Leptomycin B: Inhibiting the nuclear export of protein cargo Like many compounds that target the eukaryotic cell, leptomycin B and its derivatives were originally identified in screens for antifungal and antitumor antibiotics (Hamamoto 1985, Komiyama 1985). In 1994, Nishi et al. identified a mutant of the crm1 (chromosome region maintenance) gene that conferred leptomycin B resistance in fission yeast (Nishi 1994). This gene, previously reported, affected higher order chromosomal structure and resulted in an identical phenotype when mutated compared to leptomycin B-treated cells (Adachi 1989). This provided strong evidence that the molecular target of leptomycin B was CRM1, a protein that belongs to the importin-β-like family of nuclear transport machinery that mediates the export of proteins and RNAs out of the nucleus (Yashiroda 2003).

In order to understand how leptomycin B works, it is important to first recognize the role that the nuclear envelope plays in the cell. That is, the physical separation of the genome and cytoplasm, a central feature of eukaryotic cells. The trafficking of proteins and RNA is a highly coordinated process that takes place across the nuclear envelope, which is contiguous with the endoplasmic reticulum and contains anywhere between 200 and 2000 nuclear pore complexes (NPC) that facilitate bi-directional transport between the nuclear and cytoplasmic compartments.

Later, in a screen carried out by Wolff et al., leptomycin B was identified as an inhibitor of the nuclear export of Rev, a protein required for trafficking of HIV-1 mRNA from the nucleus to the cytoplasm (Wolff 1997). This coincided well with the fact that leptomycin B prevents the cargo- loading of proteins that carry leucine-rich nuclear export signals (NES) that are to be transported to the cytoplasm through the nuclear pore (Fornerod 1997) (Fig. 1.6B). It does so by forming a covalent bond with CRM1 where inactivation is thought to occur by a Michael-type addition between the α, β- unsaturated lactone terminus of the compound and a key cysteine residue that is essential for leptomycin B sensitivity (Kudo 1999).

The specificity of leptomycin B has been used to validate the CRM1-dependent export of many NES- containing proteins, including actin (Wada 1998), cytokines (Ouyang 2013), tyrosine kinases (Taagepera 1998), cyclin-CDK (Hagting 1998, Yang 1998), MDM2/p53 (Freedman 1998), inhibitors of NF-κB transcription (Sachdev 1998) and MHC class II complexes (Chiu 2015). Inhibition by this drug results in the accumulation of these key regulatory proteins, which eventually leads to cell death.

Fig. 1.6 (A) The chemical structure of leptomycin B. (B) Nucleo-cytoplasmic transport of protein cargo with a leucine-rich NES (nuclear export signal) by exportin/CRM1. Leptomycin B inhibits the loading of exportin with the cargo and Ran-GTP by alkylation

Efforts have been made to improve the therapeutic efficacy through the synthesis of leptomycin B semi-synthetic derivatives (Mutka 2009). However, in contrast to many of the well-known actinomycete-derived molecules that target eukaryotic organisms, leptomycin B has gained most of its notoriety as a powerful experimental tool to probe biological complexity.

1.2.6 Epoxomicin: A tripeptide that targets the eukaryotic 20S proteasome The 20S proteasome is found in all eukaryotic cells where it serves to degrade proteins during their natural turn-over cycle or proteins that have been misfolded or have sustained other damage. One way that proteins are targeted for proteolysis is via a post-translational modification called ‘ubiquitination’. This involves the ligation of a small regulatory protein called ubiquitin to the protein; ubiquitin is then recognized by the proteasome resulting in targeting of the modified adduct for degradation (Glickman 2002).

The α’,β’-epoxyketone epoxomicin specifically targets proteasomes. Epoxomicin was discovered in 1992 through a screening programme at Bristol-Myers Squibb in Tokyo, Japan and is produced by the unidentified actinomycete strain Q996-17 where it was initially reported having antitumor activity against B16 melanoma cells in mice (Hanada 1992).

The chemical structure of epoxomicin consists of four linked peptides with an unusual terminal epoxy ketone group (Fig. 1.7A). This chemical moiety is highly reactive and is therefore

Fig. 1.7 Epoxomicin, a tripeptide that targets the eukaryotic 20S proteasome. (A) The chemical structure of epoxomicin. (B) The 20S proteasome comprises of two β-subunit layers flanked by two α- subunit layers. Epoxomicin inhibits the β5-subunit of the core 20S proteasome thereby inhibiting protein degradation. considered the ‘warhead’ or ‘pharmacophore’ of the drug due to the triangular epoxy ring having highly strained 60° bond angles which are more stable once de-cyclized by nucleophilic attack. This inherent instability led to the near abandonment of further development of the drug (Kim 2013). However, efforts to understand the epoxomicin’s mode of action were continued hoping to gain a better understanding of its antitumor activity.

The peptidic nature of epoxomicin allowed Meng et al. to synthesize the drug with ease, which was then biotinylated to chemically attach and immobilize the drug to an affinity column (Meng 1999). This, remarkably, led to the epoxomicin-binding proteins being identified as components of the catalytic β subunits of the 20S proteasome: low-molecular mass polypeptide-7 (LMP7, β5i), subunit X (PSMB5), which confer chymotrypsin-like activity and multicatalytic endopeptidase complex like 1 (MECL1, β2i), subunit Z (β2), which confer trypsin-like activity to the proteasome. Consistent with the fact that epoxomicin preferentially inhibits the β5 subunit of the core proteasomal particle, epoxomicin is highly selective against chymotrypsin- like

activity—that is the inhibition of protein cleavage after aromatic and hydrophobic amino acid residues such as tyrosine, tryptophan and phenylalanine (Elofsson 1999, Meng 1999) (Fig. 6b).

Groll et al. then co-crystallized epoxomicin bound to the yeast 20S proteasome to elucidate the exact molecular mechanism of the epoxomicin-proteasome interaction. The three-dimensional molecular interaction between the drug and the proteasomal catalytic subunit revealed that a covalent linkage with the N-terminal threonine of the proteasome forms a six-membered morpholino ring (Groll 2000, Wei 2012). The structure also showed that epoxomicin fits well into the pocket surrounding the threonine residue in the active site, preferentially binding to the chymotrypsin-like pocket, and at higher concentration than the trypsin-like pocket which has a different function.

To understand epoxomicin’s activity on a cellular level, we will in short, describe the function of the proteasome, the key protease for short-lived proteins regulating a broad variety of cellular processes such as cell cycle progression, gene expression, protein quality control and stress response. Well known proteasomal substrates include cyclins, caspases, p53, p27, BCL2, and nuclear factor κB (NF- κB) (Ho 2016). The inhibition of their proteolysis triggers apoptosis. Thus, chemically induced apoptosis by proteasome inhibitors chemically related to epoxomicin such as Bortezomib (Velcade®) are successfully used to combat the progression of certain cancer cells.

Several lines of evidence suggest a heightened dependency on protein quality-control mechanisms mediated by the ubiquitin–proteasome system in cancer cells (Guzman 2002, Hideshima 2001, Loda 1997). Because of this, epoxomicin in combination with proteasome inhibitors are exceptional candidates as antineoplastic therapeutics that can have a very potent cytotoxic effects on cancer cells. In phase I and II clinical trials, inhibition of the 20S proteasome is highly cytotoxic to plasma cell cancer multiple myeloma (Siegel 2012) and mantle cell lymphoma (O’Connor 2009). The high expression of proteasomes in proliferative blood cells also suggests that proteasome inhibitors are potentially suited to haematopoietic malignancies (Kumatori 1990). The drug form of epoxomicin (Carfilzomib) is now released as an FDA- approved treatment for relapsed multiple myeloma and is currently undergoing phase III clinical

trials (Jagannath 2012, Kim 2013, McCormack 2012, Vij 2012). Presumably, higher expression of proteasomes in blood cells compared to peripheral tissues may diminish the drug’s utility against solid tumors (Deshais 2014).

Epoxomicin is a rare compound that specifically targets a unique process in eukaryotic organisms, namely chymotrypsin-like activity of the proteasome. Similarly, some other actinomycete-derived proteasome inhibitors: lactacystin (Fentany 1995) and salinosporamide (Feling 2003), also inhibit the β5-catalytic subunit of the 20S proteasome which suggests that the proteasome may be a common target for natural products of microbial-origin. There are likely several natural products that inhibit the proteasome that have yet to be discovered.

1.3 What is the biological function of higher eukaryote-active metabolites in nature?

Actinomycetes produce a diverse range of bioactive metabolites that target non-fungal multicellular eukaryotes. Despite our awareness of them, it is still not clear what their biological role is in nature. This is particularly true for molecules that have activity in multicellular eukaryotes like anti-parasitic and insecticidal compounds. Their inhibitory activity suggests that the bacterial producer might be toxic to these multicellular eukaryotes yet there is no evidence that Streptomyces are detrimental or pathogenic to non-fungal multicellular eukaryotes. Indeed, all of the published literature suggest the opposite: the known interactions between Streptomyces and non-fungal eukaryotes are beneficial.

1.4 Establishing a link between bacterial toxicity and insecticidal metabolites.

Bacteria are the most abundant living organisms on Earth. Similarly, insects are the most abundant multicellular eukaryotes on Earth. They have co-existed for more than ~479 million years and thus have played important roles in each other’s evolutionary history (Misof 2014). This gave rise to several types of bacteria-insect interactions known today. Broadly speaking, these interactions can be either good or bad. For example, Bacillus thuringiensis, initially isolated from diseased silkworms, produces insecticidal toxins that cause septicemia to occur in the insect’s gut. It is therefore widely considered to be a deadly opportunistic pathogen to a wide range of insects (Caccia 2016). Contrary to the antagonistic relationships between insects and bacteria there are also several mutualistic interactions that are known as well. Approximately 10% of insects compliment their diet with bacterial mutualists that help them digest cellulose-rich plant matter (Fischer 2013). Other mutualistic relationships have been shown to enhance the reproduction and survival of insects, for example, shield bugs (Graphosoma lineatum) employ γ- proteobacteria that confer fecundity and longevity (Karamipour 2016).

Symbiotic relationships between insects and bacteria are pervasive throughout the literature. Insects that host Streptomyces and other actinomycetes in their microbiomes are common (Cheverette 2019). However, all the known actinomycete-insect relationships are beneficial to

the eukaryote. For example, leaf-cutter ants (Acromyrmex octospinosus) cultivate “gardens” of fungi called Leucogaricus as a food source. These gardens however are susceptible to a microfungal pathogen called Escovopsis. To combat this, leaf-cutter ants form symbiotic relationships with a Streptomyces strain that produces at least two antifungals (candicidin and antimycin) that ward off the microfungal weed Escovopsis that would otherwise contaminate and compromise their food source. (Seipke 2011). A similar relationship exists between Dentroctonus frontalis (bark beetles) and an actinobacterial strain that produces mycangimicin, which also inhibits the growth of undesirable fungal species (Scott 2008). Solitary wasps (genus Philanthus) secrete Streptomyces philanthi from glands in their antennae. In this instance, the insects cover their larval broods with the bacteria to protect them from infection by other microbes during their early development (Kaltenpoth 2005). Red cotton bugs/cotton strainers (genus Dysdercus) employ actinomycete symbionts to synthesize B vitamins to supplement their diet (Salem 2014).

The beneficial nature of these interactions is paradoxical given the highly toxic nature of some actinobacterial secondary metabolites described earlier in this chapter. This includes DNA- intercalating compounds such as daunorubicin and actinomycin D, which are toxic to most living organisms and are used as front-line chemotherapy drugs. Interestingly, this also includes compounds that are specific to insects and not fungi. Compounds such as milbemycin (Merola 2012), avermectin (Lasota 1991), prasinon (Box 1973), doramectin (Rendle 2007), nanchangmycin (Ouyang 1993) and spinosads (Waldron 2000) are selectively toxic to insects targeting specific transmembrane channels in neurons—a feature that is not present in lower fungi (Fig. 2.3).

Fig. 2.3 Actinomycete metabolites with insecticidal activity. Shown are six actinomycete metabolites with exclusive activity against insects. The production of small molecules that either paralyze or are lethal to insects and nematodes suggests that an antagonistic relationship exists between bacteria and higher eukaryotes. Compounds with these unique activities are limited yet there are likely many more to be discovered.

Chapter 2 Chemical entrapment and killing of insects by bacteria

The work carried out in this chapter was submitted for publication as the following manuscript: Ho, L., Daniel-Ivad M., Jeedigunta S., Li J., Iliadi, K.G., Boulianne, G.L., Hurd, T., Smibert, C.A. and Nodwell, J. (2019) Chemical entrapment and killing of insects by bacteria. Manuscript Under Review. doi. 10.21203/rs.3.rs-36307/v1.

2.1 Abstract

Actinobacteria such as the filamentous streptomycetes are widely known for their ability to produce specialized metabolites that include antibacterial and antifungal compounds. In addition, a growing body of work demonstrates that many insects harbour actinobacteria on their bodies and in their nests. The result of these mutualistic relationships is the protection of their offspring or food sources by virtue of the bacterially encoded specialized metabolites. However, some actinobacteria produce molecules that are toxic to insects and the relevance of this toxicity in nature is unknown. We have explored interactions between streptomycetes and the fruit fly Drosophila. We find that many streptomycetes produce specialized metabolites that have potent larvicidal effects against the fly. Larvae that ingest spores of the species that produce these toxic molecules die as a result. Strikingly, the mechanism of toxicity is specific to the bacterium’s chemical arsenal: cosmomycin-D producing cells induce a relatively slow-acting cell death-like response in the larval digestive tract and avermectin producing cells induce rapid onset, whole- body paralysis. We further show that fruit flies are attracted to the volatile terpene 2- methylisoborneol that is produced by most streptomycetes. This interaction can influence their food choice and egg-laying destination such that they preferentially deposit their eggs on contaminated food sources. As a result, the larvae that hatch in this toxic environment are subsequently killed. This phenomena of terpene-mediated attraction and specialized metabolite toxicity likely poses a significant risk to insects in nature.

2.2 Introduction

Actinomycetes are a diverse phylum of Gram-positive bacteria found virtually everywhere on earth. Actinomycetes, including the genus streptomycetes, have been isolated from soil samples on every continent including locations as diverse as the interior of the Lechuguilla cave network, which was sealed off from the Earth’s surface for millions of years (Bhullar 2012), to the mantles of sponge-eating sea slugs in coastal waters of the Indo-Pacific Ocean (Cheney 2016), and beyond (Tokala 2002, Tan 2015, Luo 2016, Bouizgarne 2009, Maataoui 2014, Ma 2018, Kanini 2013).

The defining feature of these organisms is their specialized/secondary metabolism. This enormous ensemble of biochemical pathways generates hundreds of thousands of small molecules that have biological activity against other organisms. Many of these compounds have antibacterial or antifungal activity and are used clinically as antibiotics (Craney 2013, Yoon 2014, Daniel-Ivad 2018). Others, such as the DNA intercalating agents daunorubicin, actinomycin and cosmomycin, can serve as a defense mechanism against bacteriophage infection (Kronheim 2018). A smaller number of compounds are active against eukaryotic cells and are used as anticancer drugs, immune suppressants and anthelminthic drugs (Ho 2016).

Many actinomycetes have been shown to have intimate contact with invertebrates and other multicellular organisms (Van der Meji 2017). For example, Nocardiopsis alba is known to inhabit the microbiomes of molluscs and provide nerve-active toxins that protect the organism from predation (Lin 2013, Shady 2018, Li 2015). Species of Streptomyces and other actinomycetes have also been found in the microbiomes of the honeybee, the diamondback moth and the silkworm (Patil 2010, Engel 2013, Xia 2017). Indeed, bacteria and insects are, respectively, the most abundant living single-celled and multicellular organisms on Earth. They have co-existed for more than ~479 million years and are expected to have played important roles in each other’s evolutionary history (Misof 2014).

All of the known actinomycete-insect relationships are beneficial. For example, Acromyrmex octospinosus (leaf-cutter ants) depend on a fungus called Leucogaricus as a food source. This

fungal cultivar is susceptible to a microfungal weed called Escovopsis. To counter the growth of Escovopsis, leaf-cutter ants have formed symbiotic relationships with Streptomyces strains that are known to produce at least two antifungal compounds (candicidin and antimycin) that selectively inhibit Escovopsis growth, thereby protecting the ants fungal source (Seipke 2011). A similar relationship exists between Dentroctonus frontalis (bark beetles) and an actinobacterial strain that produces mycangimicin, which also inhibits the growth of undesirable fungal species (Scott 2008). Solitary wasps (genus Philanthus) secrete Streptomyces philanthi from glands in their antennae. In this instance, the insects cover their larval broods with the bacteria so as to protect them from infection by other microbes during their early development (Kaltenpoth 2005). It is likely that this is the tip of the iceberg and that many more such mutualistic relationships exist in nature.

The beneficial nature of these interactions is striking given the highly toxic nature of some actinobacterial secondary metabolites. This includes DNA intercalating compounds such as daunorubicin and actinomycin D, which are toxic to most living organisms and are used as front- line chemotherapy drugs. Indeed, milbemycin (Merola 2012), avermectin (Lasota 1991), prasinon (Box 1973), doramectin (Rendle 2007), nanchangmycin (Ouyang 1993) and spinosads (Waldron 2000) are selectively toxic to helminths (parasitic worms), non-parasitic worms and insects. At the most extreme, the molecular targets of milbemycin, avermectin and the spinosads are present in invertebrates but absent from humans, lower eukaryotes and bacteria. To our knowledge the role of these toxic compounds in nature (if any) has not previously been addressed experimentally.

Furthermore, most streptomycetes produce volatile compounds that can influence insect behaviour. One example of this is geosmin, which confers an ‘earthy’-smell to the soil and has been shown to repel flies from contaminated food sources (Klausen 2005, Stensmyr 2012). In fact, many species are capable of producing terpenoid molecules. The biological role of these volatile compounds, particularly that of the terpenoid alcohol 2-methylisoborneol remains, to a large extent, unexplored.

In this work, we used laboratory strains of the fruit fly Drosophila melanogaster, as well as outbred lines and more distantly related fruit fly species, to explore the interactions between insects and the actinomycetes of the genus Streptomyces. We demonstrate that many Streptomyces species produce metabolites that are toxic to the fly. Importantly, we find that the spores of Streptomyces species that produce these toxic molecules kill larvae that ingest them and that the mechanisms of killing are specific to the toxic metabolites they produce. Finally, we demonstrate that 2-methylisoborneol, a volatile terpene that is also produced by many streptomycetes, can attract flies such that they frequently feed and lay eggs on food sources that are contaminated by toxic spores. The result of this attraction is that the flies lay their eggs on the contaminated media, which results in the death of the resulting larvae.

This is the first demonstration that a widely distributed actinomycetes species can have such a deleterious effect on insects. It suggests that toxic specialized metabolites have likely had a significant impact on the evolution of both bacteria and insects.

2.3 Results

2.3.1 Many streptomycetes make insecticidal metabolites

To compare the prevalence of secondary metabolites active against higher eukaryotes to those active against microbes we created crude small molecule extracts from 56 Streptomyces strains and tested them for bioactivity against Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Candida albicans and Drosophila melanogaster. To avoid bias based on known secondary metabolism in the well-established model systems we selected the streptomycetes randomly from the Wright Actinomycetes Collection (Wright 2017). All of the species we used were wild isolates that had not been previously characterized – at the outset of this work the genome sequences and secondary metabolic potential of all of them were unknown. Focusing first on the microbial screens (Fig 2.1A), where we assessed the ability of extracts to inhibit >90% growth, I found that 25 extracts were active against B. subtilis, two were active against E. coli, 8 were active against S. cerevisiae and 5 were active against C. albicans. This is consistent with

many previous screens (Berdy 2005) and confirms that antibacterial activity against Gram- positive bacteria is very common while activity against lower eukaryotic fungi and Gram- negative bacteria is less so.

To assay the activity of the extracts against Drosophila, I seeded twenty newly hatched first instar larvae into tubes containing a control food source or a food source supplemented with Streptomyces extract. I then monitored their progression through to pupation and eclosion to adult flies for 14 days. Extracts from 7 strains WAC-240, -237, 144 -303, -288, -210, -211 and - 213 had potent inhibitory activity against the growth and development of D. melanogaster such that no larvae developed into adult flies (Fig. A.2). In their place we observed dead, desiccated larvae that had arrested growth at various stages of development. One potent insecticidal extract was derived from strain WAC-288 (Fig 2.1B). This work demonstrates that insect-toxic specialized metabolites are common but not more common than those that have antibiotic activity against Gram negative bacteria and lower fungi.

Cosmomcyin D

Fig. 2.1 Identifying insecticidal bioactivity in actinomycete extracts. (A) A set of 56 crude extracts derived from the Wright Actinomycete Collection (WAC) were generated and tested for growth inhibition against model prokaryote (E. coli, B. subtilis), yeast (S. cerevisiae, C. albicans) and insect (D. melanogaster) model organisms. Shown is a visualization of each extract’s inhibitory activity against corresponding model organisms where values of microbial growth are relative to the DMSO control. Asterisks (*) indicate extracts that had larvicidal activity whereby no larvae developed into adult flies. (B) Shown is the activity of an extract from WAC-288 which inhibited the development of D. melanogaster larvae into adult flies. (C) The molecule with larvicidal activity was purified from WAC-288 its identity was confirmed via tandem MS/MS fragmentation analysis. The parent ion and the masses of corresponding fragments were identified (Fig. A.4). (D) Biosynthetic gene cluster identified from the sequenced genome of WAC-288 corresponding to cosmomycin-D production (GenBank CP027022.1) (E) The chemical structure of the antibiotic cosmomycin-D.

2.3.2 Toxicity of Streptomyces spores We then asked whether the streptomycetes that produce insect-toxic extracts are themselves harmful to Drosophila. We chose 6 Streptomyces strains that had generated fly-toxic extracts (WAC-211, 213, 237, 240, 288 and 303) and another 6 (WAC-173, 175, 183, 190, 287 and 302) that generated non-toxic extracts and conducted feeding experiments with fly larvae. We prepared spores from these 12 strains, washed them twice in PBS to remove media and then added each of them to fly growth medium. We seeded the spore treated and control tubes with larvae and allowed them to feed and develop for 14 days. The contrast between the two groups was dramatic (Fig. 2.2A): spores of WAC-173, 160 WAC-175, WAC-183, WAC-190, WAC- 287 and WAC-302 had little or no effect on fly development: 60% to 100% of the larvae in each culture

Fig. 2.2 Actinomycetes pose a threat to larval viability due to the production of insecticidal metabolites. (A) Survival rates of D. melanogaster larvae that were fed live spores of various actinomycete strains. The effect of WAC strains that produced fly toxic extracts are in red compared to strains that did not produce fly-toxic extracts in blue. (n = 10) (B and C) Survival of larvae that were fed wild type WAC-288 compared to strains with different cosmomycin-D biosynthetic genes deleted (n = 5). (D) Survival of larvae that were fed the avermectin producer S. avermitilis wild type compared to the effect of the avermectin deficient mutant SUKA22 (n = 10). Midlines of all graphs represent the mean. Error bars of all graphs indicate standard deviation of ten biological replicates.

proceeded through normal development to generate healthy adults in 14-days. In contrast, WAC- 211, WAC-213, WAC-237, WAC-240, WAC-288 and WAC-303 had lethal effects on the larvae (as was the case with the extracts) such that over 80% of larvae had arrested development and died prior to developing to adulthood. This demonstrates that the spores of species that produce toxic compounds are also toxic to fly larvae. To our knowledge, this is the first demonstration that any streptomycete has the ability to poison higher eukaryotes. WAC-288 spores were particularly potent against larvae. We observed reduced mobility of the spore fed larvae within 3-6 hours of ingestion and a rapidly worsening condition such that all larvae were motionless, desiccated and non-viable within ~24 hours.

To determine whether this effect was specific to domesticated D. melanogaster we repeated the experiment with WAC-288 and larvae of 6 wild D. melanogaster isolates. As shown in Fig. A.25, the result was the same: the six wild D. melanogaster strains were equally sensitive to WAC-288 spores such that all of the larvae were killed prior to completing development. We further repeated the experiment with D. virilis, D. suzukii, D. yakuba, D. simulans and D. pseudoobscura. Again the result was the same: the larvae of all five species died in the presence of the Streptomyces spores; none of them completed development to adults. This is the first demonstration that live streptomycetes can poison a multicellular eukaryote.

2.3.3 Cosmomycin-D is the causative agent of killing by WAC-288 To understand the basis of this toxicity, we isolated the insecticidal compound from WAC-288 using bioactivity-guided fractionation. The compound absorbed light at λ = 494 nm, a characteristic of anthracyclines (Szafraniec 2016) and had a red hue. It had a parent ion mass-to- charge ratio of m/z 1189 [M + H]+ from which we calculated a chemical formula of C60H89N2O22. We carried out tandem mass spectrometry on this compound and observed fragments m/z 1071, 941, 831 and 701 [M + H]+ (Fig. 2.1C, Fig. A.4). Similar mass and fragmentation patterns have been reported previously for the red-pigmented compound cosmomycin-D (Kronheim 2018, Ando 1985, Kelso 2009, Hirayama 1987). As a complimentary approach, we sequenced the

WAC-288 genome and analyzed the 7.4 Mbp sequence using the antiSMASH tool that predicts secondary metabolite biosynthetic gene clusters. We found that the strain encodes 24 putative biosynthetic gene clusters for secondary metabolites (Table. A.5). One of these biosynthetic gene clusters was predicted to generate cosmomycin-D based on a high degree of sequence homology (97%) and organization of genes within the cluster present in S. olindensis (Rojas 2014).

To determine whether the cosmomycin-D biosynthetic genes were responsible for the toxicity of WAC-288 spores to fly larvae we constructed mutations in orf1219 (encodinga PadR-like regulator), orf1222 (encoding a β-keto acyl synthase) and orfD1245 (encoding a predicted cluster-situated regulator) (Fig. A.16). We confirmed that the three mutants were defective in producing cosmomycin by LC-MS (Fig. A.27) and then compared the capacity of their spores to kill fly larvae to the parent strain. The result (Fig. 2.2B, C) indicated that all three mutants had lost their ability to kill larvae. The yields of viable adult flies were similar to the negative control in all three cases with 70%-95% mature flies. In contrast, spores from the wild-type parent, WAC-288, killed all of the larvae in the culture. This confirms that cosmomycin-D is necessary for the insecticidal activity of WAC-288. To determine whether this phenomenon applies to any other well-characterized streptomycetes we examined the effect of spores of S. avermitilis, the producer of avermectin, an inhibitor of invertebrate locomotion (Omura 2004, Laing 2017). As a control we used SUKA-22, an S. avermitilis mutant that is unable to produce this compound (Komatsu 2013) (Fig. 2.2D). Consistent with the mode of action of avermectin, S. avermitilis spores were also toxic to the fly larvae. The phenotypic effect, however, was distinct from that of WAC-288. In this case we observed complete paralysis of all larvae within 10 minutes of ingestion: the larvae ceased locomotor movement, a well-known effect of avermectin. Consistent with the cause of this being avermectin, SUKA-22 had no effect on larval phenotype, survival or development. Taken together, these data demonstrate that the spores of streptomycetes that produce insecticidal compounds are toxic to invertebrates and confirms that this toxicity is due to specific secondary metabolites.

2.3.4 The mechanisms of spore-associated lethality are associated with the mechanism of the toxic compound being produced.

Many DNA intercalators cause programmed cell death in eukaryotic cells: this, for example, is why doxorubicin, a molecule that shares the same anthracycline scaffold as cosmomycin D, is useful as a chemotherapeutic drug (Tacar 2013). Programmed cell death, or apoptosis is a process by which cells undergo cell shrinkage, nuclear condensation and membrane blebbing that ultimately results in compartmentalization/distruction of the cell the response to stress or other cues. In mammalian cells, external stressors like DNA-damage eventually leads to the activation of the apoptosis initiator caspase-9 and executioners: caspase-7 and caspase-3. This process also occurs in Drosophila melanogaster however it is carried out by Dronc, a capsase-9 homolog and two caspase-3 homologs, Dcp-1 and DrICE (Fuchs 2011).

To determine whether WAC-288 spores induce the production of caspase proteins, we carried out an experiment in which we fed spores of the cosmomycin-D producing parent or the cosmomycin-D defective ∆cosD-orf1222 mutants to third instar larvae. We dissected out the digestive tracts of the larvae 6 hours after feeding and assayed cell death using a marker of capase-9-like Dronc activityin Drosophila melanogaster (Fan 2010). We found that feeding spores of WAC-288 resulted in the activation of Dronc-like activity primarily in cells of the posterior end of the midgut and hindgut, suggestive of a cell death-like phenomenon in this region of the animal’s digestive tract (Fig. 2.3A-E). A similar result was observed when pure cosmomycin-D was present in larval food sources (Fig. 2.3F). In contrast, the ∆cosD-orf1222 mutant did result in Dronc activation in cells of the digestive tract (Fig 2.3G). This suggests that WAC-288 kills fly larvae by compromising their digestive tracts with cosmomycin-D.

To determine whether this effect is shared by S. avermitilis we carried out the same experiment comparing the effect between wild-type strain of S. avermitilis and WAC-288. We again found that a phenotypic effect of feeding with S. avermitilis was much quicker than with WAC-288 – the larvae were paralyzed within minutes. In marked contrast to the effect of WAC-288, dissected digestive tracts from larvae that had fed on wild type S. avermitilis for the same duration did not display activated cell death-like activity despite showing accumulation of spores

in the gut (Fig 2.3H, I). This is consistent with the distinct mechanism of action of avermectin, where muscle paralysis occurs via the inhibition of the invertebrate-specific glutamate-gated chloride channel at neuromuscular junctions (Meyers 2015). These data demonstrate that the mechanisms of invertebrate killing by Streptomyces spores are determined by specialized metabolites produced by each species. Moreover, WAC-288 and S. avermitilis are evolutionarily distant at the species-level, which suggests that insecticidal activity is not determined by a single phenotype in Streptomyces (Fig. A.24).

Fig. 2.3 Cell death-like activity in D. melanogaster is triggered by the consumption of cosmomycin-D producing spores. (A) Third instar larvae that have fed on media containing spores of WAC-288. After feeding, larvae were dissected and processed for fluorescence microscopy for the detection of Dronc activation. Specific regions of the (B) anterior and (C) posterior/hindgut were identified and visualized. Closer images of the (D) anterior midgut shows lower levels of Dronc activation compared to the (E) posterior midgut which displays higher levels of activation. (F) Activation of Dronc activation in posterior midgut of larvae that fed on food containing 1 mg of pure cosmomycin-D isolated from WAC-288. (G) No activation in the posterior midgut of larvae that were fed spores of the cosmomycin-D deficient mutant ∆cosD-orf1222. (H) Spores of S. avermitilis are visible and accumulate in the posterior midgut and hindgut. (I) Lack of Dronc activation within the indicated regions of larval guts that were fed S. avermitilis.

2.3.5 Chemical attraction by Streptomyces cultures and 2-methylisoborneol leads flies to spores. Most streptomycetes produce at least one of the earthy-odorant volatile compounds 2- methylisoborneol (2-MIB) or geosmin – many (including WAC-288 and S. avermitilis) produce both. We find that the production of 2-MIB is widespread and highly conserved throughout the genus (Fig A.20, A.21, A.22). While geosmin is known to influence fly behaviour via repulsion (Stensmyr 2012), the biological effect of 2-methylisoborneol on flies has not be described. We thus tested 2-methylisoborneol for effects on adult flies and found that low concentrations (10 µg/mL at the source) of compound attracted the flies (67% of total flies preferred 2-MIB, p<0.001) whereas high concentrations (2,000 µg/mL at the source) repelled them (4.7% preferred 2-MIB, p<0.001) (Fig. 2.4B). The repulsion of adult flies was similar to the effect of geosmin that has been observed by other groups. However, attraction, as observed with 2-MIB was not observed with geosmin as previsouly reported by Stensmyr et al.

To determine whether flies were attracted to spore-contaminated food sources and whether this was due to the production of 2-MIB, flies were placed in a closed container containing two food sources. One source was a control that lacked Streptomyces spores, the other contained either wild type WAC-288 or a mutant unable to produce 2-methylisoborneol. Flies were allowed to choose between the different food sources for 24 hours with their choice being evident by their final physical location at the experimental end point. Furthermore, we observed the success of their progeny in both conditions by incubating the embryos that were deposited in the

A B

C D

Fig. 2.4 Chemical entrapment of adult flies that are attracted to actinomycetal cultures and 2- methylisoborneol. (A) Chemical structure of 2-MIB. (B) Preference of adult flies to pure 2-MIB. Number of flies that preferred positions closer towards either the control (grey) or 2-MIB odorant (Orange: darker colour corresponds to higher concentrations) was calculated as a percentage of total flies within the T-maze. Error bars indicate standard deviation of all biological and technical replicates. (C, D) Adult flies placed an enclosed space selected between a control (PBS, grey) or contaminated food source. Contaminated food sources contained liquid culture of either the wild type (red) or a 2-MIB deletion mutant (purple) of WAC-288. Error bars indicate standard deviation. Subsequent progeny did not survive when laid in contaminated food sources (Fig. A.23)

fly media. We observed more flies trapped near the medium containing wild-type WAC-288 culture, compared to medium lacking added bacteria (76% WT, 24% control, p-value<0.05, n = 6). This was consistent with the attractive properties of 2-methylisoborneol at lower concentrations of pure molecule (10 µg/mL). In contrast, in a similar experiment in which the food contained the 2-methylisoborneol defective strain, this preference was absent (55% ∆2-mib- orf919, 44% control, p-value = n.s., n = 9) (Fig. 2.4C).

The consequence of the attraction to the wild-type train was significant. Eggs that were laid in the uncontaminated medium generated viable adult progeny, as expected. In contrast, all of the progeny that were laid and hatched in the presence of WAC-288 died prior to pupation (Fig. A.23). In this case, therefore, the consequence of attraction to 2-methylisoborneol was a complete failure to generate viable progeny.

To determine whether this attractive effect is widespread in the Drosophila genus we repeated this food choice experiment with wild D. melanogaster outbred lines as well as five other distantly related Drosophila species (Fig. A.26). As with the domesticated laboratory strain of D. melanogaster, the wild strain (DGRP cross 1), D. virilus, D. yakuba, D. simulans and D pseudoobscura were attracted towards the WAC-288 contaminated food source. The one exception was D. suzukii, which exhibited a slight but not statistically significant repulsion from the WAC-288 contaminated food source. Therefore, most wild and domesticated species of Drosophila are attracted to 2-MIB producing streptomycetes, even though the strain produces compounds that are exceptionally harmful.

2.4 Discussion We have demonstrated that insecticidal specialized metabolites are relatively common in streptomycetes, more so than previously estimated (Berdy 2008). They are less common than anti-Gram-positive antibacterials but they are as prevalent as compounds that are active against Gram-negative bacteria and lower eukaryotes such as S. cerevisiae and C. albicans. We demonstrate a clear correlation between the production of these molecules in cell free extracts and the capacity of ingested spores to kill fly larvae. The observed lethality is due to the presence of the biosynthetic genes for the insecticidal compounds. Indeed, the onset of toxicity and mechanism of action between the two strains WAC-288 and S. avermitilis is determined by the metabolites in question: cell death in the digestive tract over a 24-hour period and rapid muscle paralysis within minutes, respectively. We also find that at least one of the Streptomyces volatile compounds, 2-methylisoborneol, can serve to attract adult flies such that they preferentially lay their eggs on contaminated food source, with catastrophic results for their progeny. Notably, both the killing and, attraction effects are conserved in outbred Drosophila melanogaster lines and other Drosophila species.

The killing of insects by Streptomyces ingestion is clearly distinct from bacterial virulence. Indeed, aside from some plant pathogens such as Streptomyces scabies (Seipke 2008, Sarwar 2018), and strains such as S. somaliensis and S. sudanensis which cause rare subcutaneous infections in humans (Quintana 2008, Arenas 2017), streptomycetes are regarded as avirulent; the absence of homologous virulence genes or pathogenicity islands in their chromosomes supports this (Ohnishi 2008, Ikeda 2003, Bentley 2002). Rather we suggest that Streptomyces- mediated killing is analogous to the relationship between humans and the Clostridia that cause food poisoning (Clostridium perfringens) or frequently fatal infections of the digestive tract (Clostridium difficile) (Kiu 2018, Voth 2005). The difference being that while Clostridia exert their effect via protein-based endotoxins, Streptomyces use small molecule-based strategies. These are novel insights in Streptomyces-insect biology.

Many insecticidal streptomycetes also produce 2-MIB (Table 2.5). For example, S. bingchenggensis, which produces meilingmycin and nanchangmycin, Saccharopolyspora spinosa, which produces spinosads, also make 2-MIB. Streptomyces cineroruber, which is

another producer of cosmomycin-D, also possess clear homologues of the biosynthetic enzymes for 2-MIB. This suggests that the potential for insect attraction to potentially lethal streptomycetes is widespread in nature.

Table 2.5 Establishing a link between 2-MIB and insecticidal activity. Strains identified as 2-MIB producers that also encode the production of compounds that are toxic to insects.

Identified 2-MIB producer Encoded toxin(s) Streptomyces bingchenggensis BCW-1 Meilingmycin, nanchangimicin Saccharopolyspora spinosa NRRL 18395 Spinosad Streptomyces griseus subsp. griseus NBRC 13350 Nonactin, Cycloheximide Streptomyces cinereoruber strain ATCC 19740 Cosmomycin-D

This might suggest that these streptomycetes benefit from attracting and metabolising insects in nature. Indeed, Streptomyces are known to be able to to metabolize N-acetylglucosamine, which is not only a monomer of bacterial cell walls, but also a monomer of chitin, which is the major polymer of insect biomass (Świątek, 2012).

One important consideration concerns the effect of cosmomycin-D. In previous work, we helped to demonstrate that this compound has potent anti-bacteriophage activity (Kronheim 2018). We agree with the conclusion in that work that, from the perspective of the producer bacterium, the anti-bacteriophage activity of cosmomycin-D is likely to be very important in an evolutionary sense. The extraordinary degree of bacterial cell killing by bacteriophages (~15-40% of bacteria are killed this way every day) (Keen 2015) and the prevalence of proteinaceous bacteriophage protective mechanisms suggest that this protective effect is a central one in this case (Ishino 2018, Rath 2015). However, as we have shown, a relatively high proportion of streptomycetes have toxic enough effects that they can eliminate an entire generation of fly progeny – the attraction effect of 2-methylisoborneol would be expected to increase this risk in nature. Assuming that 2-methylisoborneol attracts insects in nature, then it would do so to their considerable detriment with a relatively high frequency. This has surely had an evolutionary impact on insect feeding.

This raises interesting questions concerning the acquisition of beneficial bacterial species by ants, bark beetles, wasps and other insects. The benefit of these mutualistic relationships in the protection of developing progeny and food sources should be highly selective. In this scenario, the attraction to 2-methylisoborneol would be selective for the insect as it would help it to find a microbe that protects its food source or its offspring. Alternatively, in scenarios we have described here, where 2-methylisobormeol attracts insects to a toxic microbe, the attractive effect is beneficial for the streptomycete. In this case, it attracts insects, which they then kill, providing the bacteria with a food source. There may be unknown mechanisms that allow insects to differentiate between beneficial and toxic Streptomyces species. Alternatively, it may be that the risk we have described here is the evolutionary price that some insects must pay in order to live productively with beneficial species.

Chapter 3 Streptomyces exploration is triggered by fungal interactions and volatile signals.

The following chapter contains work carried out in collaboration with Stephanie Jones and Marie Elliot that was published in:

Jones, S. E., Ho, L., Rees, C. A., Hill, J. E., Nodwell, J. R., & Elliot, M. A. (2017). Streptomyces exploration is triggered by fungal interactions and volatile signals. eLife, 6, e21738.

Work carried out by Stephanie Jones and myself are denoted with S.J. and L.H respectively.

3.1 Abstract

It has long been thought that the life cycle of Streptomyces bacteria encompasses three developmental stages: vegetative hyphae, aerial hyphae and spores. Here, we show interactions between Streptomyces and fungi trigger a previously unobserved mode of Streptomyces development. We term these Streptomyces cells ‘explorers’, for their ability to adopt a non- branching vegetative hyphal conformation and rapidly transverse solid surfaces. Fungi trigger Streptomyces exploratory growth in part by altering the composition of the growth medium, and Streptomyces explorer cells can communicate this exploratory behaviour to other physically separated streptomycetes using an airborne volatile organic compound (VOC). These results reveal that interkingdom interactions can trigger novel developmental behaviours in bacteria, here, causing Streptomyces to deviate from its classically-defined life cycle. Furthermore, this work provides evidence that VOCs can act as long-range communication signals capable of propagating microbial morphological switches.

3.2 Introduction

Our current understanding of microbial growth and development stems largely from investigations conducted using single-species cultures. It is becoming clear, however, that most bacteria and fungi exist as part of larger polymicrobial communities in their natural settings (Scherlach 2013; Traxler 2015). Microbial behavior is now known to be modulated by neighbouring organisms, where interspecies interactions can have profound and diverse consequences, including modifying virulence of human pathogens (Peleg 2010), altering antibiotic resistance profiles of mixed-species biofilms (Oliveira 2015), enhancing bacterial growth (Romano 2005), and increasing production of specialized/secondary metabolites by fungi and bacteria (Schroeckh 2009; Stubbendieck 2016). Consequently, an important next step in advancing our developmental understanding of microbes will be to expand our investigations to include multi-species cultures, and in doing so, unveil new and unexpected microbial growth strategies.

The soil is a heterogeneous environment that is densely populated with bacteria and fungi, and as such, represents an outstanding system in which to study the effects of bacterial-fungal interactions. Within the polymicrobial communities occupying the soil, Streptomyces represent the largest genus of the ubiquitous actinomycetes group. These Gram-positive bacteria are renowned for both their complex developmental life cycle (Elliot 2008) and their ability to produce an extraordinary range of specialized/secondary metabolites having antibiotic, antifungal, antiparasitic, and anticancer properties (Hopwood 2007).

The Streptomyces life cycle encompasses three developmental stages (Fig. 3.1A). First, a spore germinates to generate one or two germ tubes. These grow by apical tip extension and hyphal branching, ultimately forming a dense vegetative mycelial network that scavenges for nutrients. Second, in response to signals that may be linked to nutrient depletion, non-branching aerial hyphae extend into the air away from the vegetative cells. These aerial hyphae are coated in a hydrophobic sheath that enables escape from the aqueous environment of the vegetative mycelium (Claessen 2003; Elliot 2003), and their emergence coincides with the onset of

Fig 3.1 Physical association with yeast triggers Streptomyces exploratory behaviour. (A) Developmental life cycle of Streptomyces. Germ tubes emerge from a single spore, and grow by apical tip extension and hyphal branching, forming a dense network of branching vegetative hyphae. In response to unknown signals, non-branching aerial hyphae coated in a hydrophobic sheath, escape into the air. Aerial hyphae differentiate into chains of dormant, stress-resistant non-motile spores. The bld gene products are required for the transition from vegetative growth to aerial hyphae formation, while the whi gene products are required for the differentiation of aerial hyphae into spore chains. (B) S. venezuelae grown alone (top row) and beside S. cerevisiae (middle row) on YPD (yeast extract-peptone- dextrose) medium over 14 days. Bottom panels: scanning electron micrographs of S. venezuelae grown alone (left), S. venezuelae on S. cerevisiae (middle), and S. venezuelae beside S. cerevisiae (right) for 14 days on YPD agar medium. White bars: 5 µm. (C) S. venezuelae explorer cells growing up a rock embedded in agar (left), and over a polystyrene barrier within a divided petri dish (right, and schematic below). (D) S. venezuelae wild type and developmental mutants grown beside S. cerevisiae on YPD agar medium for 14 days. Top: S. cerevisiae, together with wild type and ∆bld mutant strains (bld mutants cannot raise aerial hyphae and sporulate). Bottom: S. cerevisiae grown next to ∆whi mutant strains (whi mutants can raise aerial hyphae but fail to sporulate). (S.J.)

specialized/secondary metabolism within the vegetative cells (Kelemen 1998). Aerial development requires the activity of the ‘bld’ gene products, where mutations in these genes result in colonies lacking the fuzzy/hydrophobic characteristics of wild type. The final developmental stage involves the differentiation of aerial hyphae into spores through a synchronous cell division and cell maturation event. This process is governed by the whi (for ‘white’) gene products, whose mutants fail to form mature, pigmented spores (McCormick 2012). In addition to being highly stress-resistant, spores also provide a means of dispersing Streptomyces to new environments, as all characterized Streptomyces cell types are non-motile.

In this work, we identify a novel interaction between Streptomyces venezuelae and fungal microbes that induces a previously unknown mode of bacterial growth. We refer to this as ‘exploratory growth’, whereby cells adopt a non-branching vegetative hyphal conformation that can rapidly traverse both biotic and abiotic surfaces. We show that part of the mechanism by which fungi induce exploratory growth involves glucose depletion of the growth medium. Remarkably, this novel mode of growth can be communicated to other – physically separated – streptomycetes through a volatile compound. Volatile signalling further alters cell propagation and survival of other bacteria.

3.3 Results

3.3.1 Physical association with yeast stimulates rapid Streptomyces exploration.

To explore interactions between Streptomyces and fungi, we cultured Streptomyces venezuelae alone or beside the yeast Saccharomyces cerevisiae on solid agar (Fig. 3.1B), and incubated these cultures for 14 days. As expected, during this time S. venezuelae on its own formed colonies of normal size. In contrast, when S. venezuelae was grown beside S. cerevisiae, its growth was radically different. During the first five days, the cells appeared to consume S. cerevisiae, before initiating a rapid outgrowth that led to S. venezuelae colonizing the entire surface of a 10 cm agar plate after 14 days. Remarkably, growth did not cease when physical obstructions were encountered: S. venezuelae cells were able to spread over rocks and polystyrene barriers (Fig. 3.1C).

To gain insight into this phenomenon, we visualized the leading edge of the rapidly migrating S. venezuelae cells (Fig. 3.2). We found the leading edge initially progressed at a rate of ~1.5 µm/min. This is an order of magnitude faster than would be explained by growth alone, given that hyphal tip extension has been calculated to occur at a rate of 0.13 µm/min (Richards 2012). We refer to this rapid movement as 'exploratory growth', and these spreading cells as 'explorers', based on their ability to effectively transverse both biotic and abiotic surfaces. To further investigate the morphology of these explorer cells, we used scanning electron microscopy (SEM) to visualize S. venezuelae grown alone, S. venezuelae at the yeast interface, and S. venezuelae explorer cells, after 14 days of growth (Fig. 3.1B). We found S. venezuelae alone grew vegetatively, albeit without any obvious branches (branching vegetative cells were observed during growth on other media types, as expected), whereas S. venezuelae growing on S. cerevisiae raised aerial hyphae and sporulated. Microscopic analysis of explorer cells revealed that they failed to branch and were reminiscent of aerial hyphae. Unlike aerial hyphae, however, these filaments were hydrophilic, based on their inability to repel aqueous solutions (Fig. A.29).

To determine whether exploratory growth required classic developmental regulators (the bld and whi gene products), we grew a suite of S. venezuelae developmental mutants beside S. cerevisiae to evaluate whether these mutations impacted colony spreading (Fig. 3.1D).

Four S. venezuelae bld mutants (bldC, D, M, N) and five S. venezuelae whi mutants (whiB, D, G, H, I) were inoculated beside S. cerevisiae. Unexpectedly, all developmental mutant strains displayed a similar exploratory behaviour as wild type after 14 days, although the bldN mutant exhibited slower exploration than the other strains. The mutant strains did, however, differ in their growth on yeast, with the bld mutants failing to raise aerial hyphae, and the whi mutants failing to sporulate. This demonstrated that exploratory growth was distinct from the canonical Streptomyces life cycle, and represented a new form of growth for these bacteria.

To determine whether this exploratory behaviour was unique to S. venezuelae, we inoculated other commonly studied streptomycetes beside S. cerevisiae. We found that well- studied Streptomyces species, including S. coelicolor, S. avermitilis, S. griseus, and S. lividans, failed to exhibit an analogous spreading behaviour when plated next to S. cerevisiae. We next tested 200 wild Streptomyces isolates, growing each beside S. cerevisiae. Of these, 19

Fig. 3.2 Video of the leading edge of S. venezuelae explorer cells over a 17 hr time frame. After 4 days of pre-incubated growth, video of S. venezuealae exploratory growth was captured moving outwards from the initial spot next to S. cerevisiae. Shown is a video capturing four time points (0.00 hrs [yellow], 5.00 hrs [purple], 12.00 hrs [red] and 17.00 hrs [green]) throuought a 17 hour time course of S. venezuaelae exploratory growth. Dotted lines show the leading edge of the S. venezuelae explorer cells, while solid lines show the progression of the furthest point of the edge at different time points. (L.H.)

strains (~10%) exhibited exploratory growth similar to S. venezuelae. To determine whether this behaviour was confined to a particular Streptomyces lineage, we performed a phylogenetic analysis of these explorer-competent strains using rpoB sequences, and included non-exploratory model Streptomyces species as outgroups (Fig. A.30). We found S. venezuelae and these wild Streptomyces did not form a monophyletic group, suggesting that exploratory growth is wide-spread in the streptomycetes.

We next sought to determine whether Streptomyces exploratory behaviour could be triggered by other fungi. S. venezuelae was inoculated beside laboratory strains of Candida albicans, Candida parapsilosis, and Crypotococcus neoformans, and beside wild soil isolates of S. cerevisiae, Zygosaccharomyces florentinus, Saccharomyces castellii, Pichia fermentans and Debaryomyces hansenii (Fig. 3.3). We observed that all species, apart from C. neoformans and P. fermentans, induced S. venezuelae exploratory behaviour. This indicated that a broad range of microbial fungi could trigger exploratory growth.

3.3.2 The yeast TCA cycle must be intact to stimulate S. venezuelae exploration To understand how fungi could stimulate exploration, we took advantage of an S. cerevisiae haploid knockout collection containing 4309 individual knockout strains. Each S. cerevisiae mutant was pinned on top of S. venezuelae. After 10 days, yeast mutants that lacked the ability to induce S. venezuelae exploratory growth were identified and confirmed individually (Fig. 3.4). We identified 16 mutants that were unable to promote S. venezuelae exploration (Fig. 3.5A). Of these, 13 had mutations affecting mitochondrial function, including eight in genes coding for enzymes in the tricarboxylic acid (TCA) cycle (Fig. 3.5A), three in genes whose products contribute to the mitochondrial retrograde signalling pathway, as well as two whose products are involved in alternative mitochondrial metabolic pathways.

Fig. 3.3 S. venezuelae grown beside diverse yeast strains. S. venezuelae was grown beside the indicated yeast strains on YPD agar medium for 14 days. Z. florentinus, S. castellii, S. cerevisiae, D. honsenii, and P. fermentas are soil isolates, while C. parapsilosis, C. albicans and C. neoformans are laboratory strains. Yeast strains able to induce S. venezuelae exploratory growth are labelled in blue text, and yeast strains unable to induce S. venezuelae exploratory growth are shown in red. (C. parapsilosis, C. albicans, C. neoformans performed by L.H., all others by S.J.)

Fig. 3.4 Identifying yeast mutants that lack the ability to stimulate exploratory growth in S. venezuelae. (A) Each haploid yeast deletion mutant was spotted onto a culture of S. venezuelae. (B) Yeast mutant hits were detected where Streptomyces venezuelae lacked exploratory growth within ~5 mm of the yeast’s surrounding area (L.H.).

Fig. 3.5 Yeast stimulates S. venezuelae exploratory growth by consuming glucose and inhibits it by acidifying the medium. (A) S. cerevisiae mutants that fail to stimulate S. venezuelae exploratory growth. Left: functional grouping of the exploration-deficient S. cerevisiae mutations. Asterisks indicate genes also identified in C. albicans as affecting S. venezuelae exploratory growth. Right: Mutations in S. cerevisiae TCA cycle-associated genes affect exploration after citrate production. For each interaction, the indicated S. cerevisiae mutant was grown beside wild type S. venezuelae for seven days on YPD agar medium. (B) Glucose concentration and pH associated with wild type and mutant S. cerevisiae strains grown on YPD agar medium. Glucose concentrations (grey bars) and pH (blue squares) were measured from medium alone, and beneath wild type, ∆LPD1 or ∆KGD2 S. cerevisiae strains grown on YPD medium for seven days. All values represent the mean ± standard error for four replicates. (C) Top: schematic of the experimental set up, with S. cerevisiae grown to the left of S. venezuelae on YPD medium. Two replicates are grown on each agar plate. Bottom: wild type, ∆LPD1, and ∆KGD2 S. cerevisiae strains grown for 14 days beside wild type S. venezuelae on unbuffered YPD agar and YPD agar buffered to pH 7.0 with MOPS. (D) Wild type S. cerevisiae spotted beside wild type S. venezuelae and grown for 14 days on YPD agar medium plates supplemented with acetate or citrate, each buffered to pH 5.5. (A. Carried out by L.H., B – C by S.J.)

Fig. 3.6 TCA cycle is implicated in C. albicans induction of S. venezuelae exploration. Tetracycle-repressible C. albicans mutants (tetO-LPD1/lpd1Δ and tetO-KGD2/kgd2Δ) were spotted beside S. venezuelae at various concentration of tetracycline. Induction of mutation prevented S. venezuelae from exploring. (L.H., Teresa O’Meara and Leah Cowen: acknowledgement for providing Candida strains used in this figure)

We confirmed that these two genes were also necessary for inducation of the exploratory phenotype by Candida albicans. These were two strains generously provided by the Cowen lab from the GRACE (gene replacement and conditional expression) collection that carry a deletion in one allele of each gene and replacement of the remaining promoter of the native allele with a tetracycline-repressible promoter (tetO-LPD1/lpd1Δ and tetO-KGD2/kgd2Δ). The addition of tetracycline, and thus repression, resulted in strains that failed to stimulate S. venezuelae exploratory behaviour. As the products of these two genes act in the TCA cycle (Fig.

3.6), these data collectively suggest that fungal respiration, and in particular TCA cycle function, influences exploratory growth in S. venezuelae.

3.3.3 Exploration is glucose-repressible and pH-dependent

In considering how TCA cycle defects could influence S. venezuelae behaviour, we hypothesized that glucose uptake and/or consumption might play a role. We measured glucose levels of a YPD agar control, and compared this with YPD agar underneath S. cerevisiae. Uninoculated medium had 3.8 times as much glucose as S. cerevisiae-associated agar (Fig. 3.5B), confirming that S. cerevisiae consumed glucose during growth on YPD agar. This suggested that either glucose depletion by yeast, or some product of glucose metabolism, may trigger S. venezuelae exploratory growth.

To test these possibilities, we first asked whether exploratory growth could be triggered by lowering glucose concentrations. We found that medium that lacked glucose permitted S. venezuelae exploration, irrespective of whether yeast was present (Fig. 3.7A). This implied that glucose repressed exploratory growth. We then tested the effect of S. venezuelae exploratory growth on media with different concentrations of glucose. Here, we saw a dose-dependent response where high concentrations (1-4%) repressed exploration while low concentrations (0- 0.5%) induced exploratory growth. The optimal concentration that stimulated the largest colony size 0.25% suggesting that S. venezuelae still requires glucose to grow yet has a well attenuated response to glucose (Fig. 3.7B).

We also tested glucose consumption by the S. cerevisiae LPD1 and KGD2 mutants. The products of these genes, along with that of KGD1, comprise the 2-oxoglutarate dehydrogenase complex responsible for converting 2-oxoglutarate into succinyl-CoA in the TCA cycle (Przybyla- Zawislak 1999) (Fig. 3.5A). We found wild-type, ∆LPD1 and ∆KGD2 S. cerevisiae strains consumed similar levels of glucose (Fig. 3.5B), suggesting that other factors must be inhibiting S. venezuelae exploration when grown adjacent to these TCA cycle mutants.

All TCA cycle-associated S. cerevisiae mutants that failed to stimulate S. venezuelae exploratory behaviour were blocked after the production of citrate in the TCA cycle (Fig. 3.5A). We hypothesized that this disruption might result in an accumulation of organic acids, and that S. cerevisiae mutants secreted these acids to maintain a neutral intracellular pH. We measured the pH of wild type, ∆LPD1, and ∆KGD2 strains when grown on YPD (G+) agar, and found wild type S. cerevisiae raised the agar pH from 7.0 to 7.5, whereas both TCA cycle mutants lowered the agar pH to 5.5 (Fig 3.5B).

To test whether acid secretion by the S. cerevisiae LPD1 and KGD2 mutants prevented S. venezuelae exploratory growth, the two mutants were grown beside S. venezuelae on non- buffered YPD agar, and equivalent medium buffered to pH 7.0 (Fig. 3.5C). After 14 days growth on non-buffered plates, the S. cerevisiae mutants failed to stimulate S. venezuelae exploratory behaviour, whereas the same strains on buffered agar – which would counter the pH-lowering effects of the secreted acids – could now promote S. venezuelae exploration. To further verify this pH-dependent effect, we grew wild-type S. cerevisiae beside S. venezuelae on YPD agar supplemented with citrate or acetate (Fig. 3.5D). We found that after 14 days, S. venezuelae spreading was inhibited, confirming that secreted acids inhibited S. venezuelae exploration.

Collectively, these results suggested that S. venezuelae exploratory growth is a glucose- and acid-repressible phenomenon. Consistent with these observations, we also determined that S. venezuelae exploration was associated with a significant rise in pH: as S. venezuelae consumed the yeast, the medium pH rose from 7.0 to 8.0, and once S. venezuelae exploratory growth initiated (day 5), the pH rose further to 9.5 (Fig. 3.8A). This increase in pH was also observed for S. venezuelae grown on G- medium (in the absence of yeast) (Fig. A.32), suggesting that the rise in pH was mediated by the Streptomyces cells. To determine whether high pH was sufficient to promote exploration, we inoculated S. venezuelae cells on YPD agar medium buffered to pH 9.0. Exploration was not induced under these growth conditions (Fig. A.33). These data indicated that alkaline conditions were important but not sufficient for exploration, and further suggested that an adaptation phase was required during the transition to exploratory growth.

Fig. 3.7 Exploratory growth in S. venezuelae is stimulated by the absence of dextrose. (A) Four identically spotted plates after 4 days with S. venezuelae alone (left), S. venezuelae + S. cerevisiae (middle) and S. cerevisiae alone (right) grown on different combinations of YPD component deficient agar. The contrast between conditions is visible between all except dextrose deficient media where S. venezuaelae is able to initiate exploratory growth on its own in the absence of yeast (B) Shown is S. venezuelae spotted on YPD agar containing different concentrations of dextrose. At lower dilutions of dextrose (0 – 0.5 %) in the agar of YPD, S. venezuelae is able to initiate exploratory growth in complete absence of yeast. The striking pattern and size is most prominent at 0.25% dextrose. (L.H.)

Fig. 3.8 The alkaline stress response is associated with S. venezuelae exploratory behaviour.

(A) The surface area and medium pH associated with S. venezuelae explorer cells beside S. cerevisiae on YPD agar were measured and plotted every day for 14 days. (B) Schematic of the method used to identify genes required for S. venezuelae exploratory growth. S. venezuelae spores were subject to chemical mutagenesis, then screened on G- agar (no glucose, exploration-permissive without S. cerevisiae) for a lack of exploratory growth. Static colonies (beige) were grown beside S. cerevisiae (pink) on YPD medium to confirm a lack of exploratory growth. Genomic DNA was isolated from strains unable to initiate exploratory growth on G- agar, and when inoculated beside S. cerevisiae on YPD medium. Whole genome sequencing was performed to identify mutations responsible for the lack of exploratory growth. (C) Morphology of a mutant cytochrome bd oxidase S. venezuelae strain (∆cydCD) and the corresponding complemented strain grown on YPD agar for 14 days. (D) Transcript levels for alkaline stress-responsive genes in S. venezuelae explorer cells (grown beside S. cerevisiae on YPD medium), divided by levels for non-exploratory S. venezuelae cells (grown alone on YPD medium). Transcript levels were normalized and differential expression was log2-transformed. The associated sven gene numbers are shown above the bar graphs. (S.J)

3.3.4 S. venezuelae exploration requires an alkaline stress response

To investigate the genetic basis for this phenomenon we employed chemical mutagenesis, and screened for S. venezuelae mutants that failed to display exploratory behaviour when grown on medium with no glucose (G-) where yeast is not required (Fig. 3.8B). Candidate non-spreading mutant colonies were identified, and were tested in association with S. cerevisiae on YPD (G+) medium to confirm their inability to spread. Of the 48 exploration-defective mutants identified on G− medium, only three were also unable to spread when grown on YPD medium beside S. cerevisiae. This indicated that exploratory growth on G− agar may have distinct genetic requirements from exploratory growth on YPD (G+) medium.

We sequenced the genomes of wild type S. venezuelae and the three non-spreading mutants of interest (those unable to spread on both G- medium alone and YPD (G+) medium beside S. cerevisiae). Each mutant harbored point mutations in the sven_3713-3716 operon. This operon is predicted to encode subunits of the cytochrome bd oxidase complex (cydA/sven_3713 and cydB/sven_3714), along with an ABC transporter required for cytochrome

assembly (cydCD/sven_3715) (Brekasis and Paget, 2003). One strain had a mutation in sven_3715 (H673Y), while the other two strains had mutations in sven_3713 (Q186stop) and were likely clonal. To ensure that these mutations were responsible for the exploration-defective phenotype, we complemented the exploratory growth defect in each mutant with a cosmid carrying an intact cydABCD operon, and confirmed that exploration was restored (Fig. A.34). We also deleted cydCD in a wild-type S. venezuelae background, and confirmed that this strain was unable to initiate exploration when grown beside S. cerevisiae. As before, spreading could be restored to the mutant after introducing cydABCD on an integrating plasmid vector (Fig. 3.8C). These data indicated that the cytochrome bd oxidase complex was essential for S. venezuelae exploration.

S. venezuelae, like many other bacteria, encodes two cytochrome oxidase complexes. The cytochrome bd oxidase catalyzes terminal electron transfer without a concomitant pumping of protons across the membrane, while the cytochrome bc1-aa3 complex requires proton transfer from the cytoplasm. The cytochrome bd oxidase functions as part of the alkaline stress response in other bacteria (Krulwich 2011). As we had established that alkaline conditions were a prerequisite for S. venezuelae exploration, we questioned whether other alkaline stress- responsive genes might be associated with exploratory growth. Using RNA-sequencing (RNA- seq), we examined the transcription profiles of S. venezuelae alone, compared with S. venezuelae exploratory cells grown beside S. cerevisiae on YPD medium (Fig. 3.8D). The five gene clusters mostly highly upregulated in S. venezuelae explorer cells encoded the ATP synthase complex (sven_5018-26; 7.6-fold increase relative to non-spreading), two predicted cation/proton antiporter complexes (95.9- and 85.3-fold increase relative to non-spreading for sven_5668-72 and sven_5764-68, respectively), and two peptide transporters (17.4- and 38.3- fold increase relative to non-spreading for sven_4759-63 and sven_5150-54, respectively) (Fig. 3.8D).

Higher expression of the cation/proton antiporters, alongside increased ATP synthesis, would be expected to enhance proton uptake into the cell; equivalent genes are upregulated as part of the alkaline stress response in other bacteria (Krulwich 2011). Amino acid catabolism is also upregulated under alkaline growth conditions in other bacteria (Padan 2005). Given the dramatically increased expression of the peptide transporters, we confirmed that exploratory

growth required an amino acid source (Table A.35). Collectively, these results suggest that exploration is coupled with a metabolic reprogramming that permits robust growth under highly alkaline conditions.

3.3.5 S. venezuelae explorer cells alkalinize the medium using an airborne volatile organic compound S. venezuelae exploration is associated with high pH conditions, and our data suggested this rise in pH was promoted by S. venezuelae itself. We hypothesized that this pH effect could be mediated either through the secretion of diffusible basic compounds, or through the release of volatile organic compounds (VOCs). To differentiate between these possibilities, we set up a two-compartment petri plate assay, where S. venezuelae was grown beside S. cerevisiae on YPD agar in one compartment, while the adjacent compartment contained uninoculated YPD agar (Fig. 3.9A). As a negative control, we set up an equivalent set of plates, only with S. venezuelae alone (no yeast) on YPD agar in the first compartment. In each case, the two compartments were separated by a polystyrene barrier. After 10 days, we measured the pH of the uninoculated YPD compartment, and found the compartment adjacent to S. venezuelae alone remained at pH 7.0, whereas the one adjacent to S. venezuelae explorer cells had risen from pH 7.0 to 9.5, indicating the explorer cells produced a basic VOC (Fig. 3.9A).

Fig. 3.9 Volatile organic compounds released by S. venezuelae raise the medium pH and induce exploratory growth in physically separated Streptomyces. (A) Effect of S. venezuelae explorer cells on pH of physically separated medium. Each compartment is separated by a polystyrene barrier. S. venezuelae and S. cerevisiae were grown in the left compartment of one plate (left), while S. venezuelae alone was grown in the left compartment of the other plate (right). After 10 days, bromothymol blue pH indicator dye was spread on the agar in the right compartment of each plate. Blue indicates VOC-induced alkalinity. (B) S. venezuelae was grown alone on YP (G- agar) in the left compartment, while the right compartment contained uninoculated YP (G-) agar. After seven days, the same pH indicator dye as in Figure 3.9A was spread over the agar in the right compartment. Blue represents a rise in pH above 7.6. (C) Left: S. venezuelae alone was inoculated in each compartment. Right: S. venezuelae was grown beside S. cerevisiae in the left compartment, and S. venezuelae alone was grown in the right compartment. All strains were grown on YPD (G+) agar medium for 10 days. (D) Top left: Wild Streptomyces isolate WAC0566 was grown alone in each compartment. Top right: WAC0566 was grown beside S. cerevisiae in the left compartment, and grown alone in the right compartment. Bottom left: S. venezuelae was grown beside S. cerevisiae in the left compartment, and WAC0566 was grown alone in the right compartment. Bottom right: WAC0566 was grown beside S. cerevisiae in the left compartment, while S. venezuelae was grown alone in the right compartment. All strains were cultured on YPD (G+) agar medium for 10 days. (E) Schematic of the plate-based assay used to assess the effects of volatile-emitting solutions (and controls) on nearby Streptomyces colonies. H2O, TMA, or ammonia solutions were placed in a blue plastic dish, and S. venezuelae was spotted around each dish on YPD medium. Plates were incubated at room temperature for seven days. (F) Surface area and pH of S. venezuelae colonies grown on YPD medium around small dishes containing H2O or TMA solutions, as shown in Figure 3.9E. S. venezuelae was grown at room temperature for seven days on either unbuffered YPD medium or YPD medium buffered to pH 7.0 using MOPS. All values represent the mean ± standard error for four replicates. (S.J)

To verify that the VOC was produced by S. venezuelae explorers and not by S. cerevisiae, we repeated the two-compartment assay with S. venezuelae grown alone on G- agar, a condition that also induced exploratory behaviour. We found that S. venezuelae growing alone on G- agar could alkalinize the adjacent YPD compartment. This confirmed that a basic VOC was produced by S. venezuelae explorer cells (Fig. 3.9B).

3.3.6 S. venezuelae exploratory cells use VOCs to induce exploration in other streptomycetes at a distance

Bacterial VOCs can influence a wide range of cellular behaviours. To determine whether the VOC produced by explorer cells represented an exploration-promoting signal for physically separated Streptomyces colonies, we leveraged our two-compartment assay, inoculating one with S. venezuelae beside S. cerevisiae on YPD agar, and the adjacent compartment with S. venezuelae on the same medium (a condition where exploration by S. venezuelae otherwise

requires yeast association). As expected, after 10 days, the S. cerevisiae-associated cells were actively spreading. Remarkably, the adjacent S. venezuelae cells (in the absence of yeast) had also initiated exploratory growth (Fig. 3.9C). As a negative control, S. venezuelae alone was grown in both compartments on YPD agar; spreading was not observed for cells grown in either compartment after 10 days (Fig. 3.9C). These data implied that S. venezuelae explorer cells released a VOC that effectively promoted exploratory growth in distantly located S. venezuelae cells. We tested whether our exploration-deficient cydCD mutant was able to respond to this VOC, and observed that despite its inability to explore when grown next to yeast, this mutant was capable of exploration when stimulated by neighbouring explorer cells (Fig. A.38).

To determine whether S. venezuelae explorers used VOCs to potentiate exploration in other species, we again used our two-compartment assay. We cultured S. venezuelae with S. cerevisiae in one compartment, and tested whether these cells could stimulate exploratory growth of the wild Streptomyces isolate WAC0566 in the adjacent compartment (Fig. 3.9D) (WAC0566 initiates exploratory growth when cultured next to yeast, but fails to spread on its own; Fig. 3.9D). Negative control plates were set up in the same way as before, with WAC0566 alone in both compartments. After 10 days, WAC0566 grown adjacent to S. venezuelae explorers initiated exploratory growth, and this was not seen for the negative control (Fig. 3.9D). This indicated that exploratory growth could be communicated to unrelated streptomycetes.

We tested the volatile-mediated communication between these strains in a reciprocal experiment, and found that S. venezuelae exploration could also be stimulated by a VOC produced by yeast- associated WAC0566 (Fig. 3.9D). This inter-species promotion of S. venezuelae exploration was observed for at least 13 other wild Streptomyces strains (Fig. A.39). Importantly, VOC communication of exploratory growth was confined to those species with exploratory capabilities (S. coelicolor failed to respond to the VOC elicitor).

3.3.7 The VOC trimethylamine stimulates Streptomyces exploratory behaviour

We determined that the exploration-promoting VOC could be produced by liquid-grown (G-) cultures, and that it stimulated exploratory growth by both S. venezuelae and WAC0566 (Fig. A.40). To rule out the possibility that any liquid-grown culture could promote exploration, we also grew S. venezuelae and WAC0566 in YPD (G+) liquid medium, and found these cultures were unable to stimulate exploration. This suggested that VOC production was glucose- repressible, and its production correlated with growth conditions that promoted exploration.

To determine the identity of the VOC, we grew S. venezuelae and WAC0566 in G+ and G- liquid culture for three days. We collected the supernatants of each culture, and assayed them using two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC- TOFMS). From this, 1400 unique compounds were identified. To determine which compound(s) were responsible for promoting exploration, we applied a stringent filter, requiring the compound(s) to be: (i) present in at least 50% of S. venezuelae and WAC0566 exploration- inducing (G-) cultures; (ii) present in at least 10-fold greater abundance in exploration-inducing (G-) cultures versus static (G+) cultures; and (iii) have at least a 60% similarity score to known compounds in the 2011 National Institute of Standards and Technology (NIST) Mass Spectral Library. We arrived at a list of 21 candidate compounds (Table A.36). Of these, 12 were not detected in the negative controls (G+ cultures). Within this group of 12, only four were detected in 100% of S. venezuelae and WAC0566 exploration-promoting cultures: trimethylamine (TMA), thiocyanic acid, 6-methyl-5-hepten-2-one, and 2-acetylthiazole. Notably, TMA was >10 fold more abundant than the other three compounds, and thus we focussed our initial investigations on this molecule.

TMA is a volatile nitrogen-containing metabolite with a high pKa (9.81). As we knew S. venezuelae produced a basic VOC, we hypothesized that TMA was responsible for promoting exploration. To test this possibility, we placed commercially-available TMA in a small plastic container at the centre of a YPD (G+) agar plate, and then inoculated S. venezuelae at defined positions around this container (Fig. 3.9E). After seven days, S. venezuelae cultured adjacent to the TMA-emitting solutions had initiated exploratory growth, while those grown next to a water-

containing control failed to spread. This implied that TMA was the VOC used by S. venezuelae and WAC0566 to elicit exploratory growth.

TMA production is not well understood, although recent work has revealed two mechanisms by which it can be generated from quaternary amines. Acinetobacter sp. employ a carnitine oxygenase (product of the cntAB gene cluster) in converting L-carnitine into TMA (Zhu 2014), while Desulfovibrio desulfuricans converts choline into TMA using a choline-trimethylamine lyase (encoded by the cutCD genes) (Craciun 2012). S. venezuelae lacks any gene with similarity to cntA, and thus does not use an equivalent pathway to generate TMA. It does possess homologues of cutCD; however, these genes were more highly expressed (~5 fold) in static S. venezuelae cultures (where no TMA was ever detected), than in spreading cultures. This suggested that these gene products may not direct TMA production in S. venezuelae. TMA can also be produced upon biogenic reduction of trimethylamine N-oxide (TMAO) by TMAO reductases. Bacteria known to carry out this reaction typically encode one or more TMAO reductase operons, including some combination of torSTRCAD (or torSTRCADE), torYZ, dmsABC, and ynfEFGH (Dunn 2008; McCrindle 2005). S. venezuelae encodes homologs to some of these genes [specifically torA (top hit: SVEN_1326), dmsAB (top hit: SVEN_3040-3039), and ynfEFG (top hit: SVEN_3040, 3040 and 3039)]. In our RNA seq data, however, all of these genes (along with more divergent homologs) were expressed at extremely low levels, with equivalent levels for each gene being observed in both static and exploratory cultures. This suggested these gene products were unlikely to be involved in converting TMAO to TMA in S. venezuelae.

3.3.8 TMA induces exploratory growth by raising the pH of the growth medium To confirm that TMA could raise the pH of the growth medium in the same way as explorer cells, we measured the pH of non-inoculated YPD agar around dishes containing TMA, and found the pH rose from 7.0 to 9.5. To test whether TMA induced exploratory growth by raising the pH, we repeated our plate assays described in Figure 4E, and buffered the agar to 7.0 using 50 or 200 mM MOPS (Fig. 3.9F). The pH of these plates rose to 8.0 (as opposed to 9.5 on non-buffered plates), and TMA failed to induce S. venezuelae exploration to the same extent as on non-

buffered plates. To further validate the pH-mediated effect of TMA, we tested whether ammonia (another basic VOC) had the same effect (Fig. 3.9E). After seven days, ammonia induced S. venezuelae exploratory growth, suggesting that VOC-mediated alkalinity stimulated Streptomyces exploration.

3.3.9 TMA can reduce the survival of other bacteria

TMA can alter the developmental program of streptomycetes, and is known to modify the antibiotic resistance profiles of bacteria (Letoffe 2014). Given the antibiotic production capabilities of Streptomyces bacteria, we wondered whether the release of TMA might also inhibit the growth of other bacteria. To explore this possibility, we set up a small petri dish of YPD agar inside a larger dish of YPD agar (Fig. 3.10A). S venezuelae and S. cerevisiae (exploratory cultures) or S. venezuelae alone (static cultures) were inoculated on the smaller dish, and plates were incubated for 10 days. The soil-dwelling bacteria Bacillus subtilis or Micrococcus luteus were then spread on the larger petri dish. Growth of B. subtilis and M. luteus in association with exploratory or static S. venezuelae cultures was then assessed after overnight incubation. B. subtilis and M. luteus colony numbers were reduced by an average of 17.4% and 25.1%, respectively, on plates exposed to VOCs produced by exploratory S. venezuelae, relative to those grown adjacent to static cultures (Fig. 3.10B). We determined that the pH of medium adjacent to exploratory S. venezuelae had risen to 9.5, suggesting that TMA and its pH-modulatory effects could be responsible for the growth- inhibition of these bacteria.

To directly test the inhibitory potential of TMA, we set up an equivalent assay, where the TMA- producing S. venezuelae-S. cerevisiae combination was substituted with aqueous TMA solutions of varying concentrations. We spread B. subtilis, and M. luteus around the TMA-containing receptacles, and after seven days, quantified growth (Fig. 3.10C). We observed an approximately 50% drop in viable cells when exposed to 0.9% TMA, and in the case of B. subtilis, a further drop in viability was observed as TMA concentrations increased. This confirmed that TMA adversely affected the growth and survival of other soil bacteria.

Fig. 3.10 S. venezuelae VOCs inhibit the growth of other bacteria. (A) S. venezuelae was grown beside S. cerevisiae (left) or alone (right) on YPD agar in a small dish placed within a larger dish containing YPD medium. After 10 days, an indicator strain (B. subtilis or M. luteus) was spread around the dish. (B) Quantification of B. subtilis and M. luteus colonies following growth adjacent to static or explorer S. venezuelae cultures. Values represent the mean ± standard error for three replicates. The asterisk (*) indicates p<0.05, as determined by a Student’s t-test. (C) Quantification of B. subtilis and M. luteus survival following incubation around small dishes containing TMA solutions at concentrations ranging from 0–22.5%. Plates were incubated at room temperature for two days. Percent survival indicates the OD600 of strains around wells containing 0.9%, 5.6%, or 22.5% TMA solutions compared to the OD600 of strains around wells containing H2O (100% survival). Values represent the mean ± standard error for three biological replicates, and each biological replicate is the average of four technical replicates. The asterisks (***) indicate p<0.005, as determined by a Student’s t-test. (S.J)

3.4 Discussion

The canonical multicellular lifecycle of Streptomyces bacteria begins with fungus-like hyphal growth, and ends with sporulation (Fig. 3.1A). In this system, spore dispersal is the sole means by which these bacteria can establish themselves in new environments. Here, we demonstrate a new developmental behavior for Streptomyces that provides them with an alternative means of colonizing new habitats. In response to fungal neighbours and nutrient (glucose) depletion, Streptomyces can escape the confines of their classically defined lifecycle, and initiate exploratory growth. Exploratory growth is remarkably relentless: explorer cells are not limited by inanimate barriers, and can grow over abiotic surfaces. Explorer cells alter their local environment through the release of the alkaline, volatile compound TMA. Emitting TMA not only promotes exploratory behaviour by the producing cells, it also functions as an airborne signal that elicits an exploratory response in physically distant streptomycetes, and provides further fitness benefits by inhibiting the growth of other bacteria.

Metabolic cues trigger a developmental switch

S. venezuelae exploration is triggered by two key metabolic cues: glucose depletion and a rise in pH. We observed exploratory growth under low glucose conditions. In low-glucose areas of the soil, Streptomyces may initiate exploratory growth in an attempt to colonize environments with more readily available nutrients, whereas in high-glucose areas (e.g. near plant roots, or in association with fruit) (Kliewer 1965; Lugtenberg 1999; Romano 2005), exploration may be less advantageous, initiating only after nearby fungi – or other microbes – consume the existing glucose supply. Microbial alteration of nutrient profiles is likely to be common in the soil environment (e.g. Romano 2005), and we expect that the exploratory growth away from glucose- depleted areas would provide a benefit analogous to that of motility systems in other bacteria. Although the mechanism underlying exploration remains to be elucidated, it may be linked to sliding motility given its apparently passive nature (no appendages involved), and the fact that Streptomyces are known surfactant producers.

S. venezuelae exploration is also promoted by a self-induced rise in extracellular pH. Alkaline growth conditions trigger morphological switches in a range of fungi, including the human

pathogens C. albicans, C. neoformans, and Aspergillus fumigatus (Bertuzzi 2014; Davis 2000; O'Meara 2014). This is this first time this phenomenon has been observed in bacteria.

Volatile compounds promote communication and enhance competition

Exploratory growth by Streptomyces cells is coordinated by the airborne compound TMA. TMA can further induce exploration in physically distant streptomycetes. Importantly, this volatile signal is not limited to S. venezuelae, and can be both transmitted and sensed by other Streptomyces species. Consequently, it is possible for Streptomyces to respond to TMA produced by other bacteria and initiate exploratory growth under conditions where glucose concentrations are high and/or glucose-titrating organisms are absent. Developmental switching in response to VOC eavesdropping has not been previously reported, but exploiting community goods in this way is not unprecedented. For example, quorum signals and siderophores produced by one organism can be taken up or used by others (Lyons 2015; Traxler 2012). The VOC repertoire of microorganisms appears to be vast (Chuankun 2004; Insam 2010; Kai 2009; Schöller 2002; Schulz 2007; Wilkins 2009). Volatile compounds have historically been implicated in the ‘avoidance responses’ of fungi, promoting their growth away from inanimate objects (Cohen 1975; Gamow 1982). Increasingly, these compounds are now being found to have important roles in communication between physically separated microbes (Audrain 2015; Bernier 2011; Briard 2016; Kim 2013; Letoffe 2014; Schmidt 2015, 2016; Tyc 2015; Wang 2013; Wheatley 2002). A range of fungi use the volatile alkaline compound ammonia to induce morphological switches in other fungi, and to mediate inhibition of neighbouring colonies (Palková 1997). Our observations suggest that VOCs may also be key bacterial morphological determinants, communicating developmental switches both within and between different microbial species.

In addition to serving as communication signals, VOCs may also provide their producing organisms with a competitive advantage in the soil. Volatile molecules can modulate the antibiotic resistance profiles of bacteria (Letoffe 2014), and can themselves have antifungal or antibacterial activity (Schmidt 2015). TMA is a particularly potent example. Here, we show that exposure of other bacteria to TMA inhibits their growth, while previous work has revealed that TMA exposure increases bacterial sensitivity to aminoglycoside antibiotics.

Notably, Streptomyces synthesize an extraordinary range of antibiotics, including many aminoglycosides. Thus in the soil, Streptomyces-produced TMA may have direct antibacterial activity, in addition to sensitizing bacteria to the effect of Streptomyces-produced antibiotics. The ability of Streptomyces to modulate the growth of other soil-dwelling bacteria during exploratory growth would maximize their ability to colonize new environments, and exploit whatever nutrients are present.

Ecological implications for exploratory growth within microbial communities

Exploratory growth represents a powerful new addition to the Streptomyces developmental repertoire, and one that appears to be well-integrated into the existing life cycle. When grown next to yeast, explorer cells emerge from a mass of sporulating cells (Fig. 3.11). This functional differentiation represents an effective bet-hedging strategy, whereby spreading explorer cells scavenge nutrients for the group, while the sporulating cells provide a highly resistant genetic repository, ensuring colony survival in the event of failed exploration. Explorer cells resemble vegetative hyphae, in that their surface is hydrophilic; however, unlike traditional vegetative hyphae, explorer cells do not appear to branch. We presume that explorer cells dispense with frequent branching as a trade-off for the ability to rapidly spread to new environments. Exploratory growth also occurs independently of the typical bld- and whi-developmental determinants, supporting the notion that this is a unique growth strategy. It is possible, however, given the slower exploration observed for bldN mutants (where bldN encodes a sigma factor), that BldN regulon members help to facilitate the exploration process.

Fig. 3.11 New model for Streptomyces development. When S. venezuelae is grown alone on glucose-rich medium S. venezuelae exploratory growth is repressed (left). When S. venezuelae is grown beside S. cerevisiae or other yeast on glucose-rich medium (right), the yeast metabolizes glucose, relieving the repression of S. venezuelae exploration. S. venezuelae explorer cells produce the volatile pheromone TMA, which raises the pH of the medium from 7.0 to 9.5. Explorer cells activate alkaline stress genes to withstand the alkaline pH. TMA, and its associated medium alkalinisation, can induce exploratory growth in physically separated Streptomyces. (Artwork and concept by S.J and partial concept by L.H.)

While we observed exploratory growth in a subset of Streptomyces species, it is possible that this capability is more broadly conserved and is stimulated by different conditions than those investigated here. Indeed, microbes are abundant in the soil, and interactions between different organisms within these communities are likely to be more the norm than the exception. Our work illustrates the importance of inter-species interactions in bacterial development, as a key to revealing novel growth strategies. It also emphasises the need to consider long-range communication strategies, in the form of volatile compounds, which may play widespread roles in regulating development and metabolic activities in microbial communities.

Chapter 4 Concluding Remarks

4.1 Bacteria and their relationship with eukaryotes

Bacteria and eukaryotes are two major Domains in the tree of life that have co-existed for millions of years in complex communities. They are constantly interacting, sending signals, forming co-operative partnerships, and competing with one another. One of the critical ways in which these interactions take place is through bioactive small molecules that are produced by bacteria and fungi. There has been a lot of effort in the past 70 years to identify these molecules—there are over 50,000 of microbial origin that are currently known (Berdy 2008). But despite our awareness of these chemical compounds, we still lack a clear understanding of their function and biological significance in nature. In particular there is a gap in our understanding of how these bacterially-produced small molecules impact complex higher eukaryotes. In this thesis I characterize some of these interactions in detail. This work provides new insight into the relationship between the two Domains with far reaching ecological implications and applications.

4.2 Future Directions

There are several avenues I envision for the continuation of this project. Each with their own impacts and feasibility. Below is an outlook on proposed routes to take in the future.

4.2.1 Behavioural responses of nematodes to live Streptomyces colonies.

Caenorhabditis elegans, or the roundworm as they are colloquially known, has been used for nearly 50 years as a robust model in biological research (Leung 2008). They have several well- characterized collective and individual behaviours that can be triggered by small molecules (Burns 2015, Lucanic 2018, Srinivasan 2012). Here I describe my preliminary work on the effect of Streptomyces on C. elegans. More specifically, I sought to assess what behavioural responses C. elegans might have to various strains of actinomycetes in collaboration with Dr. Peter Roy and Dr. Andrew Burns at the Donnelly Centre at the University of Toronto.

In addition to testing crude bacterial extracts, we developed an assay where C. elegans was exposed to live actinomycete colonies on nutrient agar. In this assay 5 plates containing 12 colonies each were grown on solid agar for 7 days—long enough to sufficiently produce metabolites in the substrate media. We then added ~1,000 worms on six locations on the plate (Fig. 4.1A). Interestingly, there were

Fig. 4.1 C. elegans respond to live Streptomyces colonies. (A) Shown is an example of a plate used for this assay. Twelve bacterial colonies were first grown on a rectangular nutrient agar plate for 7 days. Then, C. elegans was added in 6 areas in the plate. Four behavioural responses were observed: (B) attraction where hundreds of worms swarmed the bacterial strain (C) aversion where worms completely avoided being near the strain (D) egg-laying, where worms would deposit clumps of embryos near the bacterial colony and (E) paralysis where worms became immobilized and formed clumps near the colony. C. elegans responded this way to the wild type (WT) Streptomyces avermitilis, (F) however they did not become paralyzed when near SUKA22, a mutant which does not produce the antiparasitic/anthelmintic compound, avermectin.

four major phenotypes observed: attraction, aversion, paralysis and egg-laying. The first phenotype, attraction, was where worms would frantically swarm the colony. This was observed when worms were near WAC-208 (Fig. 4.1B), -209, 292 and Streptomyces venezuelae. In contrast, the second phenotype that I observed was aversion. This was apparent when worms were exposed to 5 strains: S. hygroscopicus, S. coelicolor, WAC 303, 217 and 246 (Fig. 4.1C). Here, worms would completely avoid being within ~1 cm of the colony, presumably due to the production of a toxic compound that C. elegans was able to detect. The third phenotype was egg- laying (Fig. 4.1D). This was where worms would collectively deposit clumps of eggs near the colony and was frequently induced by 9 different strains (Table A.11). Finally, we observed paralysis. This was where worms became completely immobilized, forming clumps of 10 – 20 worms near the colony. This occurred near Streptomyces avermitilis, a strain which produces avermectin, a known inhibitor of neurotransmission which kills helminths (parasitic worms) (Fig. 4.1E). However, when worms were exposed to a mutant of S. avermitilis that does not produce avermectin, paralysis was abolished (Fig. 4.1F). This was a clear indication that paralysis was being triggered by the production of avermectin. Anthelmintics such as avermectin (Ivermectin) are becoming less efficacious in treating diseases caused by parasites and are thus still desperately needed in clinical and agricultural settings (Effawal, 2019). Comprehensive screens to rapidly identify strains that trigger paralysis as presented here would likely reveal a vast set of novel avermectin-like compounds produce by Streptomyces. In the same way identifying bacterially-derived compounds that perturb flies uncovers the nature of their relationship with insects, this effort would lead to new insight into the nature of Streptomyces-nematode interactions in the soil. Another viable option to continue this work would be to identify genes of interest in Streptomyces strains that are responsible for unique phenotypes such as attraction. This could be carried out with by screening a library of S. venezuelae mutants generated with modern CRISPR- Cas editing techniques (Alberti 2019).

4.2.2 More screens across multiple Domains of life. In Chapter 2, I have carried out a screen where, in addition to testing bacterial extracts for activity against other microorganisms, I have also tested extracts on higher eukaryotes. This was carried out by developing novel assays to assess both the lethal and non-lethal perturbations of extracts against fruit flies and worms. This form of screening across multiple Domains of life can be useful in several ways, for example in finding effective antifungals. Since fungi and humans

are both eukaryotes, several drug targets are known to be present in both organisms. It is often described as one of the major hurdles to finding compounds that can kill pathogenic fungi, but not the human host. Indeed, pathogenic fungi remain a highly neglected global health crisis, affecting 1.5 million people each year (Robbins 2017, Bongomin 2017, Almeida 2019, Casadevall 2017, 2018). One way around this is by looking for compounds in extracts that kill yeasts but not nematodes or flies. Extracts like WAC-262, -265 and -276 that fit this criteria of bioactive specificity could contain compounds that are effective antifungal drugs.

This criteria can also be adapted to find effective antibacterial compounds. In collaboration with Scott McCauley, a former PhD student in our lab, I tested a synthetic antibiotic called En-7 against flies. While En-7 had activity against methicillin-resistant Staphylococcus aureus it did not kill flies. This suggests that this molecule could be an effective antibacterial compound with few side effects in humans or animals (McCauley, 2019).

Another way this screening technique can be useful is by looking for compounds that are specific to higher eukaryotes. These compounds are more likely to be novel because they would have not been detected by early screens against common laboratory microorganisms. In this screen, I identified four extracts that killed higher eukaryotes but not lower eukaryotes. As I mentioned in the first chapter, there is a huge incentive to continue this effort. These are compounds that are not only useful in the clinic as antiparasitic or insecticidal compounds but they can also be used as chemical probes that allow us to study pathways that are exclusive to higher eukaryotes.

In addition to the hits identified in this screen, there are also over 20,000 WAC strains and thousands of other well-characterized and uncharacterized bacteria and fungi from the environment that could be screened for lethal and non-lethal activities. The advent of screening for bioactivity across multiple Domains of life provides an extra layer of insight that contrasts with the screens carried out by others in the past.

4.2.3 Understanding of the effect of volatile compounds on insect behaviour. More can be done to understand the effect of microbial volatile compounds on insect behaviour. Regarding 2-MIB specifically one question that comes to mind is whether the olfactory sensory

network that governs a fly’s ability to sense geosmin is the same for 2-MIB. Moreover, does 2- MIB affect other insects? Do other volatile compounds produced by Streptomyces or any other microbe perturb insects in this way as well? More broadly, what is the ecological relevance of these compounds?

Materials & methods

Materials and methods (Chapter 2)

Strains, plasmids, media and culture conditions

TM Media Type Recipe (per 1 L dH2O) (Solid = 2% BD Bacto agar) LB Standard YPD Standard MYM 4g Maltose, 4g yeast extract, 10g malt extract, 500ml Tap water R5M (modified) 50% maltose used from recommended amount for large scale liquid cultures of WAC-288 (Keiser 2000) SAM (Neu 2001) R2YE (Shepherd 2010) MS 20g Mannitol, 20g Soya Flour TSB Tryptone 17g, Soy 3g, NaCl 5g, K2HPO4 2.5g, glucose 2.5g,

Organism Strain E. coli K-12 E. coli DH5α (pOJ260 host) B. subtilis 168 S. cerevisiae BY4741 C. albicans CaLC155 C. elegans N2 D. melanogaster Canton-S, w1118

Actinomycetes S. coelicolor M145 S. venezuelae Wild-type S. hygroscopicus Wild-type S. avermitilis Wild-type, SUKA22 WAC Collection Cubist (Cu) Collection Merck & Co. *All actinomycetes were grown on MYM unless otherwise indicated.

Plasmid Reference pOJ260 (Bierman, 1992)

Extract preparation

Fifty-six strains from the Wright Actinomycete Collection (WAC) were randomly selected for screening. Strains were cultured on 25 mL petri dishes of Maltose-Yeast Extract-Malt Extract (MYM) agar medium (Kieser, 2000) for seven days. Following growth, lawns were macerated, submerged in n-butanol and sonicated for 10 minutes. Extracts were left overnight then solvent was filtered and fully evaporated. Concentrated crude extracts were suspended in 500 µL DMSO

(for microbes) or dH2O (for flies) for testing (Flies were highly sensitive to DMSO). Three technical replicates were carried out in the antimicrobial and fly assays.

Antimicrobial screening

Strains were grown and extracted as described above. 5 µL of extract in DMSO was added to either 95 µL of either LB or YPD. 100 µL of 1:1000 dilutions of overnight cultures of E. coli, B. subtilis, S. cerevisiae, or C. albicans were added to each respective well in a 96-well plate.

Readouts of OD600 were recorded after 24 hours and technical replicates were carried out in triplicate.

Screening against D. melanogaster

Stocks of Canton-S (Drosophila melanogaster) were maintained and used for all assays. Embryos were collected on apple juice agar supplemented with nipagin with yeast paste. Embryos were synchronized by collecting in a 6-hour time-window after being laid. Once embryos had hatched the assay was prepared by placing 20 first instar larvae into Instant Drosophila Medium (Carolina Biological Supply Company Formula 4-24) mixed with equal volumes of suspended extract-containing solution in 0.75 mL dH2O in 12 x 75 mm (5 mL, round bottom) polystyrene tubes with cotton plugs. Larvae were incubated for 14 days on a 12-hour day-night cycle in a 60% humidity-controlled room at 25°C. For initial screens assays were carried out in using three technical replicates of extracts. Hits were considered as tubes containing no adult flies after 14 days.

Purification of cosmomycin-D

A 5µL aliquot of WAC-288 spore stock was sub-cultured on MYM agar for 7 days. Colonies were selected and grown in 4 x 700 mL liquid R5 media containing -50% glucose (Kieser, 2000) shaking at 200 rpm in baffled flasks for 7 days. Cultures were sonicated for 10 minutes and centrifuged at 20,000 x g to remove the cell pellet. Spent media was filtered and continuously mixed with 20 g of Diaion® HP-20 Resin overnight. Resin was packed into an empty column cartridge and flash chromatography was performed using the Reverleris X2 system (Grace). Reverse-phase HPLC was carried out with a 250 x 4.6 mm Luna C18 5 μm column (Phenomenex) on the Alliance HPLC system (Waters). LC-MS/MS data were obtained using an Acquity UPLC (Waters) with an inline/Xevo G2-S qTOF (Waters).

Flash Purification method: Flow rate: 10 mL/min. MeOH elution was collected between 50 – 90 min:

Time (min) %H2O %MeOH 0 100 0 60 0 100 90 0 100

HPLC Purification method:

Time (min) %H2O %MeCN 0 90 10 1 90 10 12 80 20 20 70 30 25 60 40 35 5 95 40 90 10

Throughout purification, the chemical presence of cosmomycin-D was determined either by (1.) A red hue (2.) sharp peak at 494 nm.

Small-scale larval bioassay was carried out in a microcentrifuge cap with 15 µL of dH2O and

5µL of fractions suspended in 250 uL dH2O. Twenty first instar larvae were placed into the droplet and covered with parafilm. After 48 hours non-motile larvae were considered non-viable.

Spore feeding assay against D. melanogaster Spore-feeding assays were carried out as described in extract screening. Each strain was grown on 25 mL of MYM agar and tested individually as ten biological replicates. After growth, spores were suspended in a 0.85% saline solution, centrifuged 13,000 x g for 5 minutes, and resuspended in PBS buffer prior to addition to fly media. Survival was quantified as a percentage of the number of adults that eclosed after 14 days.

Microscopy and antibody staining of larval guts To visualize spores in the larval gut, 3rd instar larvae were washed in PBS for 20 minutes. They were then placed in spore-laden fly food and allowed to feed for 6 hours. Larvae were washed in PBS, whole guts were dissected. For TEM, guts were suspended in 25% glutaraldehyde fixative solution overnight at 4ºC. Cross-sections along the midgut were prepared and stained with toluidine blue. Samples were visualized on the FEI Tecnai 20 at The Hospital for Sick Children in Toronto, Canada. For fluorescence microscopy,guts from spore-fed larvae were dissected in ice cold PBS, fixed in 4% paraformaldehyde in PBST (PBS, 1% v/v triton) for 45 min, rinsed with PBST, incubated in PBST for 1 hour, incubated in PBSTB (0.2% triton, 1% BSA) for 1 hour and incubated with agitation overnight at 4ºC in PBSTB containing antibodies against cleaved (activated) caspase-3 (Asp175) #9661 (Cell Signaling Technology #9661) at a 1:400 dilution. Guts were removed form the primary antibody solution and washed twice for 30 min in PBSTB, incubated with PBSTB and Cy™3 AffiniPure Donkey Anti-Mouse IgG (Jackson ImmunoResearch 715-165-151)secondary antibody diluted 1:500 overnight at 4ºC. Guts were washed with PBST three times for 30 min each. DAPI (NucBlue™ Fixed Cell ReadyProbes™ Reagent) was used as a counterstain during the last wash then washed 3 additional times for 10 min in PBS. Buffer was removed and samples were suspended in Vectashield (Vector Laboratories, H-1000) mounting medium for 1 hour at room temperature or stored at 4ºC. Samples were visualized on a Lecia confocal fluorescent microscope and images were minimally

processed in Fiji (ImageJ). A single plane was acquired for all images approximately in the middle of the tissue. Tile scan images were taken of guts at 10X using the 405 and 552 laser lines. The same laser power was used to acquire all images for consistency. Assays were reproduced in duplicate.

Adult preference assays Testing fly preference for pure 2-MIB

A T-maze apparatus (Ali, 2011) was used for testing pure 2-MIB (Toronto Research Chemicals) dissolved in mineral oil. Each of the 10 – 14 trials were sequentially alternated on both sides in darkness at room temperature under infrared light for two minutes. Two-tailed P- values were calculated based on preference values calculated by dividing the number of flies on each side by the total in the maze.

Fig. 6.2 T-maze used to test the preference of pure 2- Testing fly preference for bacterial cultures MIB on adult fruit flies.

For culture preference assays adult flies were starved for 4 hours prior to being placed in a polystyrene 14 cm (height), 12 cm (radius) cylinder enclosure with a mesh net top for 24 hours. Flies had to select between food source traps with 1.5 g of fly media with 3 mL of PBS control or the indicated strain grown in liquid R5 culture for 10 days. After a 24 hour period, the %Total Preference was calculated by dividing the number of flies in a tube containing the test condition by the total number of flies found in the test and PBS control condition. PBS vs WT preference comprised of 6 replicates (3 biological replicates, 2 technical replicates for each biological replicate). The result was so significant that more replicates were not warranted. PBS vs. 2-MIB mutant preference was carried out in a total of 13 replicates (3 biological replicates, 3-4 technical replicates for each biological replicate). The variability made multiple replicates necessary. Two- tailed P-values were calculated based on %Total Preference values of each paired condition. A

P-value less that 0.05 was considered significant for this study. Tubes were cleared of adult flies and incubated for 14 days to determine progeny survival.

Bioinformatics, linking 2-MIB production to toxins

Sub-cultured WAC-288 strains were grown in tryptic soy broth media for 2 days. gDNA was isolated using a method adapted from Nikodinovic et al. (without achromopeptidase) (Nikodinovic, 2003). gDNA was sequenced using Pacific Biosciences (PacBio) RS II Sequencing Technology (Genome Quebec) (Rhoads, 2015). Biosynthetic gene clusters in the consensus sequence were predicted using antiSMASH (Blin, 2019). The genome sequence was deposited to National Center for Biotechnology Information (NCBI) database which is available via the genebank accession CP027022.1.

To predict potential biosynthetic gene clusters corresponding to cosmomycin D and 2-MIB production in WAC-288, AntiSMASH (Blin, 2019) was used. 2-MIB biosynthetic gene clusters were identified in other strains by using BLAST for the 2-MIB terpene synthase gene. Identifying strains that encode both 2-MIB and a possible insect toxin was carried out by querying combined terpene synthase of 2-MIB and core genes encoding compounds that would potentially be broadly toxic to higher eukaryotes (Ho, 2016). The genomes of the top 50 hits from this query were analyzed via AntiSMASH to detect compounds encoded in the genome with known insecticidal activity or other toxic effects.

Inactivation of cosmomycin-D and 2-methylisoborneol biosynthesis.

Three genes of three cosmomycin-D biosynthetic genes (cosD -orf1219, -orf1222, -orf1245) and one biosynthetic gene within the 2-methylisoborneol cluster (2-mib-919) were selected for disruption. They were individually introduced into separate pOJ260 plasmids which has a AprR cassette (Bierman 1992, Thomas 2003). Plasmids were transformed into E. coli ET12567 and conjugated into WAC-288. AprR strains were selected and correct deletions were confirmed with PCR.

Phylogenetic analysis

The complete genome of WAC-288 was sequenced with Single Molecule, Real-Time (SMRT) Sequencing developed by Pacific Biosciences. The consensus sequence was submitted to antiSMASH for the detection of cosmomycin-D and 2-MIB biosynthetic gene clusters. Other strains that encode 2-MIB were found by carrying out a BLAST search of the 2-MIB terpene synthase gene or amino acid sequence in WAC-288. Identifying strains that encode 2-MIB and insect toxins was carried out by combining the 2-MIB terpene synthase with core genes encoding compounds with known insecticidal activity. The genomes of the Top 50 hits from a BLAST search of the 2-MIB terpene synthase alone were also run through antiSMASH to detect compounds with possible insecticidal activity.

Live actinomycete colony assay with C. elegans.

Rectangular plates (OmniTray: Nunc International) containing 30 mL of MYM agar were used to grow actinomycete strains from either the WAC, Cubist or known-streptomycete collections. Spore stocks were diluted in 50µL 0.95% sterile saline and spotted on agar plates and allowed to dry. A total of 12 strains were spotted on each plate (3 rows, 4 columns) and grown at standard conditions for 7 days. After growth and metabolite production on the agar plate, ~1000 starved N2 C. elegans were seeded position in 6 equivalent positions. Each colony was visualized under a light microscope after 24 and 48 hours at room temperature.

Testing outbred fruit flies and other Drosophila species.

Twelve stocks of D. melanogaster from the Drosophila Genetic Reference Panel (DGRP) (Mackay 2012) were crossed in 6 pairs (See table below). Those crossed fly stocks along with D. virilis, D. pseudoobscura, D. yakuba, D. suzukii, and D. simulans were tested in spore susceptibility and culture preference assays in the same manner as previously described with domesticated Canton-S D. melanogaster stocks.

Cross Female Male 1 DGRP-843 x DGRP-417 2 DGRP-291 x DGRP-517 3 DGRP-57 x DGRP-399 4 DGRP-799 x DGRP-208 5 DGRP-345 x DGRP-491 6 DGRP-357 x DGRP-195

Materials and methods (Chapter 3) Strains, plasmids, media and culture conditions

Strains, plasmids and primers used in this study are listed in Table A.37. S. venezuelae ATCC 10712 was grown on MYM (maltose-yeast extract-malt extract) agar medium for spore stock generation. Spreading was investigated during growth on the surface of YPD (yeast extract- peptone-dextrose/glucose) agar, glucose-deficient YP (G-) agar, yeast extract agar supplemented with different amino acid sources (tryptone or 2% casamino acids) or YPD/G- agar medium supplemented with citrate, acetate, borate or MOPS buffer. All strains were grown at 30°C, apart from the TMA experiments which were conducted at room temperature in a fume hood. S. cerevisiae strain BY4741 (MATa; his3∆1; leu2∆0 ura3∆0 met15∆0) was grown on the same spreading-investigative media at 30°C or room temperature. Prior to plating S. venezuelae and S. cerevisiae together, S. venezuelae was cultured in liquid MYM at 30°C, while S. cerevisiae was grown in liquid YPD at 30°C overnight. Three microliters of S. venezuelae cultures were applied to the right of 3 µL S. cerevisiae on the surface of YPD agar medium, and plates were then incubated at 30°C or room temperature for up to 14 days

Scanning electron microscopy (SEM) and light microscopy

SEM was used to examine strains grown on YPD or MYM agar for up to 14 days. Samples were prepared and visualized using a TEMSCAN LSU scanning electron microscopy as described previously (Haiser et al., 2009). To monitor the rate of exploratory growth (Video 1), an

Olympus SZX12 Sterioscope and CoolSNAP HQ photometric camera were used to capture 70 frames of growth over the course of 17 hr.

Phylogenetic analyses rpoB (Guo et al., 2008) was amplified from each of the 19 exploration-competent wild isolates using primers RpoBPF and RpoBPR (Table A.37), before being sequenced using RpoBF1 and RpoBR1 (Table A.37). Trimmed rpoB sequences were aligned using Mafft version 7.2.6.6. A maximum likelihood tree was built using RAxML version 8.2.4 (Stamatakis, 2006), using a GTRGAMMA model of nucleotide substitution, with 500 bootstrap replicates to infer support values of nodes. Outputs were visualized using FigTree.

Yeast library screening

Overnight cultures of S. venezuelae were spotted onto rectangular plates containing YPD agar (OmniTray: Nunc International) using a 384-pin replicator. Each strain of a S. cerevisiae BY4741 haploid deletion library was inoculated beside an individual S. venezuelae colony using a 384-pin replicator. Plates were grown for five days at 30°C and screened for an absence of S. venezuelae exploratory growth. Yeast mutants unable to stimulate S. venezuelae exploratory growth were re-tested on individual YPD agar plates. For C. albicans deletion screens, C. albicans GRACE collection tetracycline repressible deletion mutants (Roemer et al., 2003) were inoculated beside S. venezuelae on YPD agar plates. Mutants were induced using 1 or 5 µg/mL tetracycline, which is below the minimum inhibitory concentration of tetracycline for S. venezuelae.

Glucose assays and measurement of pH

Measurements of glucose levels beneath S. cerevisiae colonies and in YPD alone were performed using a Glucose (GO) Assay Kit (Sigma). For all experiments, pH levels of solid agar were measured using one or a combination of pH sticks and the pH indicator dye bromothymol blue (Sigma, St Louis, MO).

Chemical mutagenesis and whole-genome sequencing

8 Approximately 10 S. venezuelae spores were added to 1.5 mL 0.01 M KPO4 at pH 7.0. Spores were centrifuged and resuspended in 1.5 mL 0.01 M KPO4 at pH 7.0. The spores were then divided into two 750 µL aliquots in screw-cap tubes. As a control, 25 µL H2O was added to one aliquot, while 25 µL ethyl methanesulfonate (EMS, Sigma, M0880) was added to the other aliquot. Tubes were vortexed for 30 s, and incubated shaking at 30°C for 1 hr, with an additional inversion being performed every 10 min. Spores were centrifuged at 3381 ×g for 3 min at room temperature, prior to being resuspended in 1 mL freshly made and filter-sterilized 5% w/v sodium thiosulfate solution. Spores were washed twice in 1 mL H2O, after which they were

−4 −8 resuspended in 1 mL H2O. For each tube, a dilution series ranging from 10 to 10 was made using H2O, and 100 µL of each dilution was then spread onto MYM agar plates and incubated for three days at 30°C. Individual colonies were counted to ensure that survival of the EMS-treated spores was, at most, 50% that of the untreated (H2O) control. Colonies were collected from plates inoculated with EMS-treated spores, and were screened for loss of spreading capabilities on G- agar plates. Select mutants were then tested for their inability to spread when plated next to yeast; those mutants that also failed to initiate spreading in the presence of S. cerevisiae were grown in liquid MYM, and chromosomal DNA was extracted using the Norgen Biotek Bacterial Genomic DNA Isolation kit for downstream sequencing.

Using the Illumina Nextera XT DNA sample preparation kit, DNA libraries were prepared for three non-exploratory S. venezuelae mutants, alongside their wild type S. venezuelae parent. Whole genome-sequencing was performed on an Illumina MiSeq instrument (Illumina, San Diego, CA, USA) using 150 bp paired-ends reads. Reads were aligned to the S. venezuelae reference genome using Bowtie 2 (Langmead and Salzberg, 2012) and were converted to BAM files using SAMtools (Li et al., 2009). Single nucleotide polymorphisms (SNPs) were called using SAMtools mpileup and bcftools, and SNP locations, read depth, and identities were generated using VCFtools (Danecek et al., 2011).

Construction of cydCD (cytochrome bd oxidase) deletion strain and mutant complementation

An in-frame deletion of sven_3715-3716 was generated using ReDirect technology (Gust et al., 2003). The coding sequence was replaced by an oriT-containing apramycin resistance cassette.

The gene deletion was verified by PCR, using combinations of primers located upstream, downstream and internal to the deleted genes (see Table A.37). The cydCD mutant phenotype was complemented using a DNA fragment encompassing the WT genes, sven_3713-3714, and associated upstream and downstream sequences (see Table A.37), cloned into the integrating plasmid vector pSET152. To control for any phenotypic effects caused by plasmid integration, pSET152 alone was introduced into wild type and the cydCD mutant strains, and these strains were used for phenotypic comparison with the complemented mutant strain.

RNA isolation, library preparation and cDNA sequencing

RNA was isolated as described previously from two replicates of S. venezuelae explorer cells growing beside S. cerevisiae for 14 days, and two replicates of S. venezuelae alone grown for 24 hr on YPD agar plates (we were unable to isolate high quality RNA from S. venezuelae alone at later time points). For all four replicates, ribosomal RNA (rRNA) was depleted using a Ribo-zero rRNA depletion kit. cDNA and Illumina library preparation were performed using a NEBnext Ultra Directional Library Kit, followed by sequencing using unpaired-end 80 base-pair reads using the HiSeq platform. Reads were aligned to the S. venezuelae genome using Bowtie 2 (Langmead and Salzberg, 2012), then sorted, indexed, and converted to BAM format using SAMtools (Li et al., 2009). BAM files were visualized using Integrated Genomics Viewer (Robinson, 2011), and normalization of transcript levels and analyses of differential transcript levels were conducted using Rockhopper (McClure et al., 2013). RNA-seq data has been deposited in NCBI’s Gene Expression Omnibus and are accessible through GEO Series accession number GSE86378 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=idmrgcmexranpun&acc=GSE86378).

Analysis of volatile metabolites via GC×GC-TOFMS

S. venezuelae and WAC0566 were grown in liquid YPD (G+) or YP (G-) for three days. For each strain and condition, six biological replicates were grown, and for each, three technical replicates were analyzed. Four milliliters of each culture supernatant were transferred to 20 mL air-tight headspace vials, which were stored at −20°C prior to volatile analysis. Headspace volatiles were concentrated on a 2 cm triphasic Divinylbenzene/Carboxen/Polydimethylsiloxane

(DVB/CAR/PDMS) solid-phase microextraction (SPME) fiber (Supelco, Bellenfonte, PA) (30 min, 50°C, 250 rpm shaking). Volatile molecules were separated, identified, and relatively quantified using two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC-TOFMS), as described previously (Bean et al., 2012; Rees et al., 2016). The GC×GC- TOFMS (Pegasus 4D, LECO Corporation, St. Joseph, MI) was equipped with a rail autosampler (MPS, Gerstel, Linthicum Heights, MD) and fitted with a two-dimensional column set consisting of an Rxi−624Sil (60 m × 250 μm×1.4 μm (length × internal diameter × film thickness); Restek, Bellefonte, PA) first column followed by a Stabilwax (Crossbond Carbowax polyethylene glycol; 1 m × 250 μm×0.5 μm; Restek, Bellefonte, PA) second column. The main oven containing column one was held at 35°C for 0.5 min, and then ramped at 3.5 °C/min from 35°C to 230°C. The secondary oven containing column 2, and the quad-jet modulator (2 s modulation period, 0.5 s alternating hot and cold pulses), were heated in step with the primary oven with +5°C and +25°C offset relative to the primary oven, respectively. The helium carrier gas flow rate was 2 mL/min. Mass spectra were acquired over the range of 30 to 500 a.m.u., with an acquisition rate of 200 spectra/s. Data acquisition and analysis was performed using ChromaTOF software, version 4.50 (LECO Corp.).

Identification of candidate volatile signals

Chromatographic data was processed and aligned using ChromaTOF. For peak identification, a signal-to-noise (S/N) cutoff was set at 100, and resulting peaks were identified by a forward search of the NIST 2011 Mass Spectral Library. For the alignment of peaks across chromatograms, maximum first and second-dimension retention time deviations were set at 6 s and 0.15 s, respectively, and the inter-chromatogram spectral match threshold was set at 600. Analytes that were detected in greater than half of exploration-promoting Streptomyces cultures (grown in G- medium) and not detected in media controls or S. venezuelae grown in G+ medium (failed to promote exploration), were considered candidate molecules associated with the phenotype of interest.

Assays for volatile-mediated phenotypes

Aqueous solutions (1.5 mL) of commercially available TMA solutions (Sigma), ammonia solutions (Sigma) or water (negative control) were added to small, sterile plastic containers and placed in a petri dish containing 50 mL YPD agar. TMA solutions were typically diluted to 11.5% w/v, although concentrations as low as 0.9% were able to promote spreading and inhibit the growth of other bacteria. Ammonia solutions of 0.1–1 M were used, and all were able to induce spreading. S. venezuelae was inoculated around the small vessels, after which the large petri dish was closed and incubated in the fume hood at room temperature for up to 10 days. For buffering experiments, YPD plates were supplemented with 50 or 200 mM MOPS buffer (pH 7.0). Medium pH was measured as above, while colony surface areas were measured using ImageJ (Abràmoff et al., 2004). For bacterial survival assays around TMA-containing vessels, B. subtilis and M. luteus strains were grown overnight in LB medium, before being subcultured to an OD600 of 0.8. One hundred microliters of each culture were then spread on YPD agar plates, adjacent to water or TMA-containing vessels. For assays to measure how S. venezuelae explorer VOCs affect the survival of other bacteria, S. venezuelae was grown alone or beside S. cerevisiae in a small petri dish containing YPD agar. This small dish was placed inside a larger dish containing YPD agar. Plates were grown for 10 days, before B. subtilis and M. luteus were subcultured to an OD600 of 0.8, and diluted 1/10 000. Fifty microliters of each culture were then spread on the larger plate containing YPD agar, and colonies were quantified after overnight growth.To test the effect of TMA on B. subtilis and M. luteus growth, these indicator strains were grown overnight in LB medium, before being subcultured to an OD600 of 0.8. One hundred microlitres were spread around wells containing 1.5 mL solutions of TMA at different concentrations on YPD (water control, 0.9%, 5.6% and 22.5%). Plates were incubated for two days at room temperature in the fume hood, before cells were scraped into 2 mL YPD and vigorously mixed. Dilution series were used to measure the OD600 of the resulting cell suspensions. Error bars indicate standard error of three biological replicates, and four technical replicates of each.

Appendix A.1 Supplementary figures & tables

Fig A.2 The effect of Streptomyces extracts on fruit fly larvae. (A) Each of the 7 tubes shown contains fly media with either a buffer control (PBS) or a bacterial extract. Twenty larvae were placed into each tube and left to feed for 12 days. A total of six extracts 211, 213, 237, 240, 288 and 303 were toxic to larvae such that none of them were able to develop into adults. Purple arrows in the control point to 3 successful adults. Green arrows point to 4 unhatched pupae which were visible in the control and in extracts 211 and 213. Red arrows point to two dead larvae that are visible in food containing the extract 213. (B) After 3 days, larvae that were exposed to food containing the toxic bacterial extract from 288 became small and desiccated. (C) Larvae that were fed diluted samples of bacterial extract 288 reached a later stage of development before dying. Shown are three dead late-stage larvae that fed on diluted samples of 288 bacterial extract. This reflects how lower concentrations of the extract resulted in later stages of development before dying. (D) After 20 days in clean food containing no extract, larvae (black arrows) are alive and motile. Four were also able to develop into pupae (green arrows). In contrast, when larvae were placed in food containing bacterial extract, they avoided eating and ended up dead and desiccated ~1 cm above the surface of the food (red arrows).

A. Extract B. Spores

Fig A.3 Spores kill flies similar to the effect of the extract. I serially diluted either (A) bacterial extract or (B) spores and placed those dilutions into fly food containing fly larvae. The effect of Streptomyces extract and spores on fruit fly development were the same. Fly food with the highest concentrations of extract or spores (left 4 tubes in both boxes) resulted in no larvae developing into adults. Food with the lowest concentration of extract or spores (right 3 tubes in both boxes) resulted in ~60% of larvae reaching adulthood.

B C

E D

Fig. A.4 Purification and structural elucidation of cosmomycin-D. (A) The tandem MS/MS shows the fragmentation pattern of cosmomycin-D. Six major fragments are shown with the fully in-tact molecule on the right. Each subsequent peak to the left of the full molecule M+H+ are highlighted fragments. (B) The UV chromatogram at 494 nm showing the presence of pure cosmomycin-D eluting between 16-18 minutes. (C) This table lists the 7 fragments of cosmomycin-D generated using tandem mass spectrometry. The parent ion has a mass corresponding to the fully in-tact molecule. Compounds 1-7 are the other major product ions of this molecule. (D) Chemical structure of cosmomycin-D. (E) Dotted red lines denote fragmentation of cosmomycin-D. Line bend direction indicates the fragment that is being considered. (This work was carried out in collaboration with Martin Daniel-Ivad).

Cluster Type % Similarity Predicted Molecule 1 Terpene - - 2 NRPS - - 3 Melanin - - 4 NRPS - - 5 Terpene 100 2-methylisoborneol 6 Terpene - - 7 Butyrolactone - - 8 Type II PKS- 97 Cosmomycin-D Oligosaccharide 9 Butyrolactone-NRPS - - 10 Terpene 100 Isorenieratene 11 Bacteriocin - - 12 Siderophore - - 13 Melanin - - 14 Phenazine-NRPS - - 15 Type I PKS-NRPS - - 16 Siderophore 100 Desferrioxamine B 17 Type I PKS - - 18 Type II PKS-Terpene 83 (Spore pigment) 19 NRPS 80 Scabichelin 20 NRPS - - 21 Terpene 100 Geosmin 22 Ectoine 100 Ectoine 23 NRPS - - 24 Terpene - -

Table A.5 Biosynthetic gene clusters in WAC-288. After sequencing the complete 7.4 Mbp genome of WAC-288, I used the bioinformatic prediction tool antiSMASH to identify 24 biosynthetic gene clusters for specialized/secondary metabolites. Shown are all 24 clusters. Clusters that I have marked in red indicate the two compounds of interest for this chapter 2-methylisoborneol and cosmomycin-D. (The complete genome is publicly available in the NCBI database with the genbank code: CP027022.1)

Abbreviation Domain

2,3DH 2,3-dehydratase Fig. A.6 Analyzing the cosmomycin-D biosynthetic 3,4DH 3,4-dehydratase 3-AmT 3-aminotransferase gene cluster. (A) Here I have compared the biosynthetic 3KR 3-ketoreductase gene cluster of cosmomycin-D between WAC-288 and 4,6DH 4,6-dehydratase Streptomyces olindensis. The organization of genes 4KR 4-ketoreductase AT Acyltransferase within the both clusters are similar. They both contain of C9KR C9 ketoreductase two major sections that I have labelled in green and red CLF Chain length factor Cyc Type II polyketide cyclase boxes. They have 10 and 14 genes respectively. While E Epimerase the red section remains the same in both strains, the GTr (x3) Glycosyltransferase green section is flipped in the reverse direction and KSIII Ketosynthase III KSα Ketosynthase α transposed to the opposite side of the cluster (B) I used N,N-MT N,N-dimethyltransferase an online tool called the PRediction Informatics for OMT Carboxy-O-methyltransferase Ox Anthrone-type oxygenase Secondary Metabolomes (PRISM) to predict the Ox Oxidoreductase functional domains of each gene product. When I Glucose-1-phosphate SibI compared the functional domains of each gene within thymidylyltransferase T Thiolation both clusters, all of them were identical with the exception of one extra regulatory gene (MtmR) present in S. olindensis. (Left Table) Abbreviations for domains found in the cosmomycin-D biosynthetic gene cluster in WAC-288. Reference table describing PRISM (Skinnider 2017) annotated domains for the cluster. Purple represents tailoring enzymes for saccharide chains, yellow boxes are core biosynthetic genes within the Type II polyketide synthase, green are glucosyltransferase domains and grey are other functional domains.

Fig. A.7 Confirming the lack of antifungal activity of WAC-288. A disk-diffusion assay showing extracts of actinomycete strains tested on various fungi. Zones of inhibition are apparent in all cases of WAC-303 and WAC-240. No antifungal activity was observed with WAC-288 extract.

Fig. A.8 Visible spores in Streptomyces-fed larvae. Fly larvae were fed either a (A) control (PBS) or (B) Streptomyces spores in their food. After feeding, guts were dissected out and processed for transmission electron microscopy (TEM). The red-dotted lines are the approximate locations cross-sections were made for (C) and (D). (E) This is an electron microscopy image of (D) where I could see spore in the lumen (L). Spores were separated from the edges of the gut where the microvilli (MV) were.

Fig A.9 Crude extract of WAC-288 has activity against human cells. (A) HEK293 cells exposed to WAC-288 extract display cell rounding and abnormal nuclei (B) Quantification of activity from various concentrations show reduced viability of HEK293 cells. The context being that this extract would not be a suitable insecticide to use around humans.

Fig A.10 WAC-288 is active against mosquito larvae. (A) Aedes agypti larvae thrive in liquid media before entering pupation. (B) Assays were carried out in 24-well plates, each well containing 10 – 20 late stage larvae. (C) Decreased contractile motility was observed with larvae that were exposed to 1 mg/mL of crude extract derived from WAC-288 (movie available upon request).

Table A.11 Summary of activity against C. elegans. Actinomycete strains that induced C. elegans phenotypic responses with either extract or live colony assay.

Extract Live colony Lethal WAC 240 Attraction S. venezuelae, WAC 292, 208, 209 Growth defect WAC 262, 77, 248 Aversion S. hygroscopicus, S. coelicolor M145, Cu501601, WAC 303, 217, 246 Degradation WAC 255 Paralysis S. avermitilis, Cu601337, Cu230555 Egg-laying WAC 205, 275, 282, 204 Egg-laying WAC 262, 276, 288, 270g, 291, 292, 296, 301, Cu501610 Hyperactive WAC 275 Lethality WAC 270w, 295

Fig. A.12 Production of nonactins by Cu230555 with avermectin-like paralysis activity against C. elegans. (A) LC-MS trace of crude extract generated from fermentation of Cu230555. (B) Visible aggregates of immobilized C. elegans appear next to Cu230555 after 24 hrs. (C) The chemical structures of the nonactin ionophore series.

Fig. A.13 Bioactivity-guided purification of larvicidal compounds. Small-scale detection of larvicidal activity was developed using 1st instar larvae that were placed in a 20 µl droplet (15 µl water + 5 µl of diluted sample of interest, i.e. HPLC fraction). Fractions with activity inhibited larval development after 48 hrs (shown in red).

Fig. A.14 Effect of cosmomycin-d and doxorubicin on 1st instar larvae. A small-droplet assay was carried to assay the effect of pure cosmomycin-D (P1, P2 and P3 analogues of unconfirmed structure, P2 being the most abundant form from HPLC purification fractions) and pure doxorubicin. Strong inhibitory effects were observed after 48 hour exposure to cosmomycin-D however no effect was observed with doxorubicin despite having a similar core structure.

100

Fig. A.15 Complete genome of WAC-288. Map of linear 7.4 Mbp genome that was sequenced. GC content measured as a high (green) or low (purple) ratio. Two biosynthetic gene cluster prediction tools were used to identify putative gene clusters encoding insecticidal molecules: antiSMASH, and Prism. Twenty-four biosynthetic gene clusters were detected and are shown at their respective locations along the genome map. Coding sequences (CDS) encoding putative proteins were detected using RAST (Rapid Annotation using Subsystem Technology) and are indicated in light blue at the bottom.

101

102

Fig. A.16 Abolishing the production of cosmomycin-D and 2-MIB in WAC-288. Schematic of (A) genes for (B) insertional fragment mutagenesis. Plasmid pOJ260 with an apramycin resistance gene (AprR) was cloned with (C - E) cosmomycin-D biosynthetic genes or (F) 2-MIB terpenes synthase (teal). Target-directed integration of the plasmid by homologous recombination into the chromosomal DNA of WAC-288 inactivated the target gene to effectively abolish cosmomycin-D or 2-MIB production. Forward and reverse insertion primers are indicated as blue arrows as 1, and 2 respectively. Primers used to confirm proper insertion are indicated as arrows A-D (See Table S3 below for primer sequences).

Table A.17 Primers used for gene disruption and confirmation. Primers used for disruption (1: forward, 2: reverse) are indicated for each ORF. Primers for confirmation (Primers A and B are standard primers of pOJ260 (4), C: forward, D: reverse).

Product ORF Insert primers Confirmation Primers 1219 1:GGCCAGTGCCAAGCTTCCACACGATTGCTGGTCCTCG C:GGTACCTGCCTCATGGAGAA 2:GCGCGGCCGCGGATCCAGGAGATCCGCTCCCTCAGCAG D:CTCCAGGAAGCCCTCGTC 1222 1:GGCCAGTGCCAAGCTTGCATCGGGACCAAGCAGTTCTG C:CGACCGGTACGTCAACATC Cosmomycin D 2:GCGCGGCCGCGGATCCCGGTCATGTGGTAGGCGTTGC D:GTAGCGGTCGGGGTCGAAGG 1245 1:GGCCAGTGCCAAGCTTGGGAGCTATGGGACGAGGACC C:TGTCTGAAGCTGACCTCTGG 2:GCGCGGCCGCGGATCCGAGGTGGTTCACCAGGTTGAC D:GACGCCGGTGCGGTTCGTG 2-MIB 919 1:CGGCCAGTGCCAAGCTTGCTGTAGCGGTAGGTGTTGG C:GTGGTGGTCGTGTCGGTGC 2:CGCGCGGCCGCGGATCCCGAAAGCGTTCCCGAAGTC D:GCACCAGCCCGTTCAGCAC

103

Table A.18 Preference assay parameters and raw data.

After a 24 hour period, where 퐹푇 is the number of flies in a tube containing food contaminated as the test condition (Wildtype or 2-MIB knockout culture of WAC-288) and 퐹퐶 is the number of flies found in the PBS control food condition. Two-tailed P-value was calculated based on % preference values of each control-culture paired condition (WT vs. PBS, P two-tail was equal to 0.0140 and 2- MIB vs. PBS, P two-tail was equal to 0.1233). A P-value less that 0.05 was considered significant for this study. 푭 푻 = % 푷풓풆풇풆풓풆풏풄풆 푭푻 + 푭푪

PBS control Raw data 1c 2c 3c 4c 5c 6c 7c 8c 9c Wildtype 156 49 97 29 3 5 Δ2MIB-919 169 60 37 82 52 90 56 116 75

% 1c 2c 3c 4c 5c 6c 7c 8c 9c ave stdev Wildtype 42.162 23.902 33.798 37.179 2.2556 2.8902 23.698 17.421 Δ2MIB-919 48.986 42.857 20.33 51.25 39.394 51.429 47.458 53.953 41.667 44.147 10.196

Treated Raw data 1t 2t 3t 4t 5t 6t 7t 8t 9t Wildtype 214 156 190 49 130 168 Δ2MIB-919 176 80 145 78 80 85 62 99 105

% 1t 2t 3t 4t 5t 6t 7t 8t 9t ave stdev Wildtype 57.838 76.098 66.202 62.821 97.744 97.11 76.302 17.421 Δ2MIB-919 51.014 57.143 79.67 48.75 60.606 48.571 52.542 46.047 58.333 55.853 10.196

104

Fig. A.19 Biosynthetic gene cluster of 2-methylisoborneol in WAC-288. The 19.8 kbp gene cluster of 2-MIB in WAC-288 comprises of three genes: a transcriptional regulator (grey), synthase/cyclase (blue), and a methyltransferase (red).

105

Δ2-MIB orf919

Fig. A.20 Comparing biosynthetic gene clusters of 2-methylsioborneol between actinomycetes. A BLAST search was carried out using the terpene cyclase of 2-MIB in WAC-288. The three-gene biosynthetic cluster of each 2-MIB producer was compared between six well-known Streptomyces strains and 6 other actinomycete genera.

106

Fig. A.21 Conservation of 2-methylisoborneol synthase in actinomycetes. The protein sequence of 2-MIB synthase in WAC-288 was aligned (ClustalW) and compared to 2-MIB synthases in other Streptomyces species and related actinomycetes from a BLAST query. Asterisks (*) denote highly conserved residues. The protein was found to be highly conserved throughout actinomycetes and also found in one Pseudomonas species.

107

Fig. A.22 Phylogeny of 2-metheylisoborneol production. A BLAST query for amino acid sequence of 2-MIB synthase in WAC-288 was carried out in three searches. The first with no exclusions where most hits belonged to Streptomyces genera. The second with an exclusion on Streptomyces where most hits were other actinomycetes such as Saccharopolyspora and a few others shown. The third was a search excluding all actinomycetes where 2-MIB synthases were found (with a relatively low degree of sequence similarity ~77%).

108

Fig. A.23 Embryos deposited in contaminated food sources have reduced survival. Following a 24h selection period between a control (PBS) food source and one treated with wild type WAC-288 spores, adult flies were removed from tubes and incubated for an additional 12 days to test whether viable progeny could be generated. Shown are progeny that survived in respective food sources after incubation. Despite more flies having a preference for the contaminated food source, no progeny were able to survive under WAC-288 contaminated food conditions.

109

Fig. A.24 Species-level phylogenetic analysis of WAC-288 A contiguous sequence of six housekeeping genes (16S rRNA, rpoB, atpD, gyrB, recA and trpB) was used to phylogenetically identify WAC-288 in relation to other Streptomyces species. Asterisks (*) indicate strains of interest (WAC-288 and S. avermitilis). This phylogeny was constructed to show that insecticidal activity is not likely to be conserved due to the evolutionary distance between the two the Streptomyces species. The phylogeny was inferred using the Maximum Likelihood method and Tamura-Nei model (Tamura 1993). Bootstrap consensus was inferred from 50 replicates (Felsenstein 1985). The percentage of replicate trees in which the associated taxa clustered together on the bootstrap test are shown next to the branches. Evolutionary analysis was conducted in Mega X (Kumar 2018).

110

Fig. A.25 D. melanogaster outbred lines as well as distantly related Drosophila species are susceptible to Streptomyces spores. Larvae of various Drosophila species were placed in, and fed on either control fly media containing PBS (-) or WAC-288 spore-containing fly media (+). End points were taken after 14 days of incubation where differences in the number of larvae developing into adult flies was visible. Feeding Drosophila species with WAC288 spores in each case lead to the entire larvae population having no survival.

111

112

Fig. A.26 Several Drosophila species are attracted to Streptomyces cultures. (A) A variety of Drosophila species were trapped over 24 hours a control food source or a wild type WAC- 288 spore containing food source to determine fly preference. Food preference is represented by the bar graphs indicating the number of flies found in either the PBS control (grey) or treated (red) food sources. (Right) The same experiment was carried out between a control food source (grey) or food source containing a mutant spores unable to produce 2-MIB (purple). Error bars indicate the standard deviation between 2 biological replicates with 3 technical replicates for each biological replicate. The graph represents the average of these replicates (B) Shown are six representative endpoints of the preference assays that were carried out.

Result: Fig. A.26 Preference is conserved in Drosophila. We found that 5/6 other species (D. virilis, D. yakuba, D. simulans, D. pseudoobscura, DGRP Cross 1 but not D. suzukii) were also significantly attracted to food contaminated with a liquid culture of wild type WAC-288. Furthermore, of these flies that were attracted to the wild type culture of WAC-288, three of them lost this preference when given the choice between a control food source and a food source containing the 2-MIB knockout strain. These include the non-domesticated flies (Cross 1), D. virilis and D. simulans. While not all Drosophila species responded similarly—this may be due to their inherent variations in olfaction, it remains clear that the detection of volatile compounds produced by Streptomyces is highly conserved in the Drosophila genus.

113

Fig. A.27 Mutants of WAC-288 are defective in cosmomycin D production. Shown is an ion extracted mass chromatogram corresponding to cosmomycin (m/z 1189.5 +/- 0.5 Da) of crude extracts prepared from each cosmomycin D mutant generated in WAC-288. A peak corresponding to cosmomycin D was only observed in the wild type strain

114

Fig. A.28 Explorer cells are hydrophilic. S. venezuelae growing on top of S. cerevisiae cells raise hydrophobic aerial hyphae and spores. These structures effectively repel aqueous droplets (bromophenol blue dye dissolved in water). In contrast, explorer cells are hydrophilic, and application of aqueous droplets (as above) results in liquid dispersion.

115

Fig. A.29 Phylogeny of exploratory streptomycetes. The phylogeny was created using aligned rpoB sequences from wild Streptomyces isolates (WAC strains) that exhibited exploratory growth. For comparison, we included the non-spreading S. coelicolor, S. lividans, S. avermitilis, S. griseus and S. clavuligerus. A maximum likelihood tree was built using RaxML with a GTRGAMMA model of nucleotide substitution, with 500 bootstrap replicates to infer support values of nodes. Output was created using FigTree.

116

Fig. A.30 S. venezuelae grown alone on glucose-deficient medium exhibits similar exploratory growth to S. venezuelae growing next to yeast on glucose medium. S. venezuelae was grown either alone or beside S. cerevisiae on G+ (glucose-containing) agar medium, and alone on G- (no glucose). Two replicates were spotted per plate, and plates were incubated for 10 days.

Fig. A.31 S. venezuelae grown alone raises the pH of glucose-deficient medium. S. venezuelae was grown alone on G- (no glucose) or G+ (glucose-containing) agar medium containing the pH indicator bromothymol blue. Two replicates were inoculated on each plate, and these were grown for 14 days.

117

Fig. A.32 High pH alone does not stimulate S. venezuelae exploration. S. venezuelae was grown alone on YPD agar medium buffered to pH 9.0 using 50, 100 or 200 mM borate. Two replicates were inoculated on each plate, and these were grown for 14 days.

Fig. A.33 Complementation of explorer mutant phenotypes. Top row: EMS (ethyl methanesulfonate) mutagenesis-derived S. venezuelae explorer mutants containing point mutations in the cydABCD operon, grown beside S. cerevisiae. Bottom row: Explorer mutants complemented with a cosmid carrying the wild type cydABCD operon. Two replicates were inoculated on each plate.

118

Table A.34 Effects of media composition on S. venezuelae exploration when grown in the absence of yeast.

Glucose represses exploratory A peptide source is required to induce Various behaviour exploratory behaviour peptide sources induce exploratory behaviour Maltose ✔ ✔ ✔ Yeast extract ✔ ✔ ✔ ✔ ✔ ✔ ✔ ✔ ✔ ✔ Malt extract Amino acid ✔(p) ✔(p) ✔(p) ✔(p) ✔(p) ✔(p) ✔(p) ✔(c) ✔(t) source* Glucose ✔ ✔ ✔ ✔ ✔ pH 6 5 5 5 5 9 9.5 6.5 8.5 8 8 9.5 9.5 Exploratory ✔ ✔ ✔ ✔ ✔ behaviour

*: p = peptone, c = casaminoacids, t = tryptone

119

Table A.35 VOCs identified using GC×GC-TOFMS.

G- G+ % of % of Compound TIC average TIC average G- samples G+ samples 1,5-Heptadiene, 2,5-dimethyl-3-methylene- 157486 909 69.00 83.33 2,5-Cyclohexadien-1-one, 4-ethyl-3,4-dimethyl- 58829 0 53.85 0 2-Acetylthiazole 27658 0 100.00 0 2-Methylisoborneol 3963625 76398 100.00 100 3-Caren-10-al 111806 354 53.85 33.33 4-Hydroxy-3-hexanone 10995 0 53.85 0 5-Hepten-2-one, 6-methyl- 13963 0 100.00 0 Acetamide, N-(2-methylpropyl)- 59056 0 61.54 0 Acetonitrile, (dimethylamino)- 4501 0 76.92 0 Aniline, N-methyl- 1084056 43298 100.00 100 Butanoic acid, 3-methyl- 64178 1273 69.23 16.67 Dimethyl trisulfide 4289376 43303 100.00 100 Disulfide, dimethyl 15430045 460968 100.00 100 Disulfide, methyl (methylthio)methyl 5610 0 53.85 0 Furan, 2-methyl- 33530 1608 100.00 100 Hexanenitrile 5956 0 84.62 0 N-(3-Methylbutyl)acetamide 37841 0 92.31 0 Propane, 1-bromo-2-methyl- 4981 218 53.85 16.67 Tetrasulfide, dimethyl 24737 0 76.92 0 Thiocyanic acid, methyl ester 43203 0 100.00 0 Trimethylamine 453549 0 100.00 0 TIC = Total Ion Chromatogram (GC peak area, = measure of abundance)

120

Table A.36 Oligonucleotides used in this study

Name Sequence (5′ to 3′) Use

Sven3715 Up TCAAGATCATGACCTGGTGC Confirmation of ∆cydCD mutation

Sven3715 CAGGAGCTGGGGCACTCGG Confirmation of ∆cydCD mutation Down

Sven3715 in CTTCTGGAAGGACCCCACC Confirmation of ∆cydCD mutation

CGCCGAGACCCACTAGCCGGTCCTGTCCAGGGA Creation of ∆cydCD strain; Sven3715 Fwd GCAATGATTCCGGGGATCCGTCGACC confirmation of ∆cydCD mutation

GACGCGGCGGCGGTCATGGCTTGAGCCTAGTAA Creation of ∆cydCD strain; Sven3715 Rev GTCCTATGTAGGCTGGAGCTGCTTC confirmation of ∆cydCD mutation

GAGCGCATGACCACCCAGGACGTCGAGGC Amplification of rpoB from WAC rpoBPF strains and S. venezuelae

CCTCGTAGTTGTGACCCTCCCACGGCATGA Amplification of rpoB from WAC rpoBPR strains and S. venezuelae

TTCATGGACCAGAACAACC Sequencing of rpoB from WAC rpoBF1 strains and S. venezuelae

CGTAGTTGTGACCCTCCC Sequencing of rpoB from WAC rpoBR1 strains and S. venezuelae

121

Fig. A.37 The S. venezuelae cydCD mutant strain can explore in response to volatile signals produced by neighbouring explorer cells. Left: Wild type (WT) S. venezuelae was grown beside S. cerevisiae in the left compartment, and the S. venezuelae cydCD mutant strain was grown alone in the right compartment. Middle: Wild type S. venezuelae was grown beside S. cerevisiae in the left compartment, and wild type S. venezuelae was grown alone in the right compartment. Right: The cydCD mutant was grown adjacent to S. cerevisiae in the left compartment (where it sporulated but did not spread), while wild type S. venezuelae was grown alone in the right compartment. All strains were grown on YPD (G+) agar medium for 10 days.

122

Fig. A.38 Wild explorer Streptomyces species promote exploration in S. venezuelae using volatile signals. Using our two-quadrant assay, 13 independent wild Streptomyces isolates (WAC strains) were inoculated on G- agar, adjacent to S. venezuelae inoculated on G+ agar medium (where no exploration was observed on its own). Each WAC strain was able to promote S. venezuelae exploration through the release of a volatile compound.

123

Fig A.39 The VOC produced by S. venezuelae explorer cells can be produced by liquid-grown (G-) S. venezuelae and WAC0566 cultures. All strains were grown in 48-well plates, with (l) indicating liquid cultures (top rows), and (s) indicating solid YPD agar (bottom rows). Liquid cultures were either G+ (glucose-containing) or G- (no glucose), while all solid medium was G+ (exploration repressive condition). Plates were grown shaking for three days. For all plates, we monitored exploration by strains growing on G+ agar (bottom rows), in response to VOCs produced by the liquid-grown cultures. The top panel shows S. venezuelae (left) and the wild Streptomyces strain WAC0566 (right) grown in G+ liquid (a condition where the VOC of interest is not expected to be produced). The middle panel shows the same strains, only grown in G- liquid (where the VOC was predicted to be produced). The bottom panel shows the test for interspecies VOC production/response, with S. venezuelae and WAC0566 grown in G- liquid, opposite WAC0566 and S. venezuelae, respectively.

124

References

Abada, E. A. E., Sung, H., Dwivedi, M., Park, B. J., Lee, S. K., & Ahnn, J. (2009). C. elegans behavior of preference choice on bacterial food. Molecules and cells, 28(3), 209-213.

Abramoff MD, Magalha ̃es PJ. 2004. Image processing with ImageJ.Biophotonics International11:33–42.

Adachi Y, Yanagida M (1989) Higher order chromosome structure is affected by cold-sensitive mutations in a Schizosaccharomyces pombe gene crm1+ which encodes a 115-kD protein preferentially localized in the nucleus and its periphery. J Cell Biol 108(4):1195–1207

Alberti, F., & Corre, C. (2019). Editing streptomycete genomes in the CRISPR/Cas9 age. Natural product reports, 36(9), 1237-1248.

Ali, Y. O., Escala, W., Ruan, K., & Zhai, R. G. (2011). Assaying locomotor, learning, and memory deficits in Drosophila models of neurodegeneration. JoVE (Journal of Visualized Experiments), (49), e2504. Almeida, F., Rodrigues, M. L., & Coelho, C. (2019). The still underestimated problem of fungal diseases worldwide. Frontiers in microbiology, 10.

Almeida, F., Wolf, J. M., & Casadevall, A. (2015). Virulence-associated enzymes of Cryptococcus neoformans. Eukaryotic cell, 14(12), 1173-1185.

Amaresan, N., Kumar, K., Naik, J. H., Bapatla, K. G., & Mishra, R. K. (2018). Streptomyces in Plant Growth Promotion: Mechanisms and Role. In New and Future Developments in Microbial Biotechnology and Bioengineering (pp. 125-135). Elsevier.

Ambati, R. R., Phang, S. M., Ravi, S., & Aswathanarayana, R. G. (2014). Astaxanthin: sources, extraction, stability, biological activities and its commercial applications—a review. Marine drugs, 12(1), 128-152. Anagnostou, C., Dorsch, M., & Rohlfs, M. (2010). Influence of dietary yeasts on Drosophila melanogaster life‐history traits. Entomologia Experimentalis et Applicata, 136(1), 1-11.

Anderson TM et al (2014) Amphotericin forms an extramembranous and fungicidal sterol sponge. Nat Chem Biol 10(5):400–406

Ando, T., et al. (1985). Cosmomycin D, a new anthracycline antibiotic. Agricultural and Biological Chemistry, 49(1), 259-262.

Anisimov VN, Zabezhinski MA, Popovich IG et al (2011) Rapamycin increases lifespan and inhibits spontaneous tumorigenesis in inbred female mice. Cell Cycle 10(24):4230–4236

125

Arcamone F, Cassinelli G, Fantini G, Grein A, Orezzi P, Pol C, Spalla C (1969) Adriamycin, 14- hydroxydaunomycin, a new antitumor antibiotic from S. peucetius var. caesius. Biotechnol Bioeng 11(6):1101–1110

Arczewska M, Gagos M (2011) Molecular organization of antibiotic amphotericin B in dipalmitoylphosphatidylcholine monolayers induced by K(+) and Na(+) ions: the Langmuir technique study. Biochim Biophys Acta 11:2706–2713

Arena JP, Liu KK, Paress PS, Cully DF (1991) Avermectin-sensitive chloride currents induced by Caenorhabditis elegans RNA in Xenopus oocytes. Mol Pharmacol 40(3):368–374

Arena JP, Liu KK, Paress PS, Schaeffer JM, Cully DF (1992) Expression of a glutamate-activated chloride current in Xenopus oocytes injected with Caenorhabditis elegans RNA: evidence for moduluation by avermectin. Brain Res Mol Brain Res 15(3–4):339–348

Arenas, R., Fernandez Martinez, R. F., Torres-Guerrero, E., & Garcia, C. (2017). Actinomycetoma: an update on diagnosis and treatment. Cutis, 99(2), E11-15.

Arikan S, Lozano-Chiu M, Paetznick V, Nangia S, Rex JH (1999) Microdilution susceptibility testing of amphotericin B, itraconazole, and voriconazole against clinical isolates of Aspergillus and Fusarium species. J Clin Microbiol 37:3946–3951

Arsham AM, Howell JJ, Simon MC (2003) A novel hypoxia-inducible factor-independent hypoxic response regulating mammalian target of rapamycin and its targets. J Biol Chem 278(32):29655– 29660

Arthington-Skaggs BA, Motley M, Warnock DW, Morrison CJ (2000) Comparative evaluation of PASCO and national committee for clinical laboratory standards M27-A broth microdilution methods for antifungal drug susceptibility testing of yeasts. J Clin Microbiol 38(6):2254–2260

Audrain B, Le ́toffe ́ S, Ghigo JM. 2015. Airborne bacterial interactions: Functions out of thin air?Frontiers inMicrobiology6:1–5

Avalos, M., Garbeva, P., Raaijmakers, J.M. et al. Production of ammonia as a low-cost and long- distance antibiotic strategy by Streptomyces species. ISME J (2019) doi:10.1038/s41396-019- 0537-2

Baginski M, Resat H, Borowski E (2002) Comparative molecular dynamics simulations of amphotericin B-cholesterol/ergosterol membrane channels. Biochim Biophys Acta 1567(1–2):63–78

Baginski M, Tempczyk A, Borowski E (1989) Comparative conformational analysis of cholesterol and ergosterol by molecular mechanics. Eur Biophys J 17(3):159–166

126

Baldin V, Cans C, Knibiehler M, Doucommun B (1997) Phosphorylation of human CDC25B phosphatase by CDK1-cyclin A triggers its proteasome-dependent degradation. J Biol Chem 272(52):32731–32734 Ballweber, L. R., Smith, L. L., Stuedemann, J. A., Yazwinski, T. A., & Skogerboe, T. L. (1997). The effectiveness of a single treatment with doramectin or ivermectin in the control of gastrointestinal nematodes in grazing yearling stocker cattle. Veterinary parasitology, 72(1), 53- 68. Baltz RH (2006) Marcel Faber roundtable: is our antibiotic pipeline unproductive because of starvation, constipation or lack of inspiration? J Ind Microbiol Biotechnol 33:507–513

Baltz RH (2008) Renaissance in antibacterial discovery from actinomycetes. Curr Opin Pharmacol 8:557–563 Baltz, R. H. (2007). Antimicrobials from actinomycetes: back to the future. Microbe-American Society For Microbiology, 2(3), 125.

Banaszynski LA, Liu CW, Wandless TJ (2005) Characterization of the FKBP. rapamycin. FRB ternary complex. J Am Chem Soc 127(13):4715–4721

Barenholz Y (2012) Doxil®–the first FDA-approved nano-drug: lessons learned. J Control Release 160(2):117–134 Bean HD, Dimandja J-MD, Hill JE. 2012. Bacterial volatile discovery using solid phase microextraction and comprehensive two-dimensional gas chromatography–time-of-flight mass spectrometry. Journal of Chromatography B 901:41–46

Begon, M. 1982. Yeast andDrosophila. In: The Genetics and Biology ofDrosophila, Vol. 3 (Ashburner, M., H.L. Carson and J.N. Thompson Jr, eds), pp. 345–384, Academic Press, New York.

Benjamin D, Colombi M, Moroni C, Hall MN (2011) Rapamycin passes the torch: a new generation of mTOR inhibitors. Nat Rev Drug Discov 10:868–880

Bentley SD, Chater KF, Cerdeno-Tarrago AM et al (2002) Complete genome sequence of the model actinomycete Streptomyces coelicolor A3 (2). Nature 417(6885):141–147

Bentley, S. D., Chater, K. F., Cerdeño-Tárraga, A. M., Challis, G. L., Thomson, N. R., James, K. D., ... & Bateman, A. (2002). Complete genome sequence of the model actinomycete Streptomyces coelicolor A3 (2). Nature, 417(6885), 141.

Berdy J (2005) Bioactive microbial metabolites. J Antibiot 58(1):1–26.Beretta L, Gingras AC, Svitkin YV, Hall MN, Sonenberg N (1996) Rapamycin blocks the phosphorylation of 4E-BP1 and inhibits cap-dependent initiation of translation. EMBO J 15:658–664

127

Bérdy, J. (2012). Thoughts and facts about antibiotics: where we are now and where we are heading. The Journal of antibiotics, 65(8), 385.

Bernardi R, Liebermann DA, Hoffman B (2000) Cdc25A stability is controlled by the ubiquitin- proteasome pathway during cell cycle progression and terminal differentiation. Oncogene 19(20):2447–2454 Bernier SP, Le ́toffe ́ S, Delepierre M, Ghigo JM. 2011. Biogenic ammonia modifies antibiotic resistance at adistance in physically separated bacteria.Molecular Microbiology81:705–716

Bertuzzi M, Schrettl M, Alcazar-Fuoli L, Cairns TC, Mun ̃oz A, Walker LA, Herbst S, Safari M, Cheverton AM, ChenD, Liu H, Saijo S, Fedorova ND, Armstrong-James D, Munro CA, Read ND, Filler SG, Espeso EA, Nierman WC,Haas H, et al. 2014. The pH-responsive PacC transcription factor ofAspergillus fumigatusgoverns epithelialentry and tissue invasion during pulmonary aspergillosis.PLoS Pathogens10:e1004413

Bhattacharjee, K., Banerjee, S., & Joshi, S. R. (2012). Diversity of Streptomyces spp. in Eastern Himalayan region–computational RNomics approach to phylogeny. Bioinformation, 8(12), 548.

Bhullar, K. et al. (2012). Antibiotic resistance is prevalent in an isolated cave microbiome. PloS one, 7(4), e34953. Bierer BE, Mattila PS, Standaert RF, Herzenberg LA, Burakoff SJ, Crabtree G, Schreiber SL (1990) Two distinct signal transmission pathways in T lymphocytes are inhibited by complexes formed between an immunophilin and either FK506 or rapamycin. Proc Natl Acad Sci USA 87(23):9231–9235 Bierman, M., et al. (1992). Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene, 116(1), 43-49.

Bjedov I, Toivonen JM, Kerr F, Slack C, Jacobson J, Foley A, Partridge L (2010) Mechanisms of life span extension by rapamycin in the fruit fly Drosophila melanogaster. Cell Metab 11(1):35–46

Blin, K. et al. (2019). antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline. Nucleic acids research.

Blommaart EF, Luiken JJ, Blommaart PJ, van Woerkom GM, Meijer AJ (1995) Phosphorylation of ribosomal protein S6 is inhibitory for autophagy in isolated rat hepatocytes. J Biol Chem 270:2320–2326 Boatin B (2008) The onchocerciasis control programme in West Africa (OCP). Ann Trop Med Parasitol 102 Suppl 1:13–17 Bobek, J., Šmídová, K., & Čihák, M. (2017). A waking review: old and novel insights into the spore germination in Streptomyces. Frontiers in microbiology, 8, 2205.

Bokhove, M., Claessen, D., de Jong, W., Dijkhuizen, L., Boekema, E. J., & Oostergetel, G. T. (2013). Chaplins of Streptomyces coelicolor self-assemble into two distinct functional amyloids. Journal

128

of structural biology, 184(2), 301-309.

Bolster DR, Crozier SJ, Kimball SR, Jefferson LS (2002) AMP-activated protein kinase suppresses protein synthesis in rate skeletal muscle through down-regulated mammalian target of rapamycin (mTOR) signaling. J Biol Chem 277(27):23977–23980

Bongomin, F., Gago, S., Oladele, R. O., & Denning, D. W. (2017). Global and multi-national prevalence of fungal diseases—estimate precision. Journal of fungi, 3(4), 57.

Bos, L. D., Sterk, P. J., & Schultz, M. J. (2013). Volatile metabolites of pathogens: a systematic review. PLoS pathogens, 9(5), e1003311.

Bouizgarne, B., et al. (2009). Streptomyces marokkonensis sp. nov., isolated from rhizosphere soil of Argania spinosa L.International journal of systematic and evolutionary microbiology, 59(11), 2857-2863. Box, S. J., Cole, M., & Yeoman, G. H. (1973). Prasinons A and B: Potent insecticides from Streptomyces prasinus. Appl. Environ. Microbiol., 26(5), 699-704.

Brajtburg J, Powderly WG, Kobayashi G, Medoff G (1990) Amphotericin B: current understanding of mechanisms of action. Antimicrob Agents Chemother 34(2):183–188

Brekasis D, Paget MS. 2003. A novel sensor of NADH/NAD+ redox poise in Streptomyces coelicolor A3(2). The EMBO Journal 22:4856–4865

Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77(1), 71-94.

Briard B, Heddergott C, Latge ́ JP. 2016. Volatile compounds emitted byPseudomonas aeruginosastimulategrowth of the fungal pathogenAspergillus fumigatus.mBio7:e00219

Brown EJ, Albers MW, Shin TB, Ichikawa K, Keith CT, Lane WS, Schreiber SL (1994) A mammalian protein targeted by G1-arresting rapamycin-receptor complex. Nature 369(6483):756–758

Brunn GJ, Hudson CC, Sekulic A, Williams JM, Hosoi H, Houghton PJ, Lawrence JC Jr, Abraham RT (1997) Phosphorylation of the translational repressor PHAS-I by the mammalian target of rapamycin. Science 277(5322):99–101

Burg RW, Miller BM, Baker EE et al (1979) Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob Agents Chemother 15(3):361–367

Burns, A. R., Luciani, G. M., Musso, G., Bagg, R., Yeo, M., Zhang, Y., ... & Stasiuk, S. (2015). Caenorhabditis elegans is a useful model for anthelmintic discovery. Nature Communications, 6(1), 1-11.

129

Burnett PE, Barrow RK, Cohen NA, Snyder SH, Sabatini DM (1998) RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1. Proc Natl Acad Sci USA 95(4):1432–1437

Caccia, S., Di Lelio, I., La Storia, A., Marinelli, A., Varricchio, P., Franzetti, E., ... & Ferré, J. (2016). Midgut microbiota and host immunocompetence underlie Bacillus thuringiensis killing mechanism. Proceedings of the National Academy of Sciences, 113(34), 9486-9491.

Cafaro, M. J., Poulsen, M., Little, A. E., Price, S. L., Gerardo, N. M., Wong, B., ... & Currie, C. R. (2011). Specificity in the symbiotic association between fungus-growing ants and protective Pseudonocardia bacteria. Proceedings of the Royal Society B: Biological Sciences, 278(1713), 1814-1822. Calendi E, Di Marco A, Reggiani M, Scarpinato B, Valentini L (1965) On physico-chemical interactions between daunomycin and nucleic acids. Biochim Biophys Acta 103:25–49

Campbell WC (2012) History of avermectin and ivermectin, with notes on the history of other macrocyclic lactone antiparasitic agents. Curr Pharm Biotechnol 13(6):853–865

Capranico G, Kohn KW, Pommier Y (1990) Local sequence requirements for DNA cleavage by mammalian topoisomerase II in the presence of doxorubicin. Nucl Acids Res 18:6611–6619

Casadevall, A. (2017). Don't forget the fungi when considering global catastrophic biorisks. Health security, 15(4), 341-342.

Casadevall, A. (2018). Fungal diseases in the 21st Century: the near and far horizons. Pathogens & immunity, 3(2), 183. CDC. Antibiotic Resistance Threats in the United States, 2019. Atlanta, GA: U.S. Department of Health and Human Services, CDC; 2019.

Cheney, K. L., et al. (2016). Choose your weaponry: Selective storage of a single toxic compound, latrunculin A, by closely related nudibranch molluscs. PLoS One, 11(1), e0145134.

Chevrette, Marc G., et al. "The antimicrobial potential of Streptomyces from insect microbiomes." Nature communications 10.1 (2019): 516.

Chiu E, Gold T, Fettig V, LeVasseur MT, Cressman DE (2015) Identification of a nuclear export sequence in the MHC CIITA. J Immunol 194(12):6102–6111

Choi J, Chen J, Schreiber SL, Clardy J (1996) Structure of the FKBP12-rapamycin complex interacting with the binding domain of human FRAP. Science 273(5272):239–242

Chuankun X, Minghe M, Leming Z, Keqin Z. 2004. Soil volatile fungistasis and volatile fungistatic compounds. Soil Biology and Biochemistry 36:1997–2004

130

Čihák, M., Kameník, Z., Šmídová, K., Bergman, N., Benada, O., Kofroňová, O., ... & Bobek, J. (2017). Secondary metabolites produced during the germination of Streptomyces coelicolor. Frontiers in microbiology, 8, 2495.

Citro S, Miccolo C, Meloni L, Chiocca S (2015) PI3K/mTOR mediate mitogen-dependent HDAC1 phosphorylation in breast cancer: a novel regulation of estrogen receptor expression. J Mol Cell Biol 7(2):132–142 Citron, C. A., Gleitzmann, J., Laurenzano, G., Pukall, R., & Dickschat, J. S. (2012). Terpenoids are widespread in actinomycetes: a correlation of secondary metabolism and genome data. ChemBioChem, 13(2), 202-214.

Claessen D, Rink R, de Jong W, Siebring J, de Vreugd P, Boersma FG, Dijkhuizen L, Wo ̈sten HA. 2003. A novelclass of secreted hydrophobic proteins is involved in aerial hyphae formation inStreptomyces coelicolorbyforming amyloid-like fibrils.Genes & Development17:1714–1726

Clardy, J., Fischbach, M. A. & Walsh, C. T New antibiotics from bacterial natural products. Nat. Biotechnol. 24, 1541–1550 (2006).

Clark, J. M., Scott, J. G., Campos, F., & Bloomquist, J. R. (1995). Resistance to avermectins: extent, mechanisms, and management implications. Annual review of entomology, 40(1), 1-30.

Cohen RJ, Jan YN, Matricon J, Delbru ̈ck M. 1975. Avoidance response, house response, and wind responses ofthe sporangiophore ofPhycomyces.The Journal of General Physiology66:67–95

Cortes-Funes H, Coronado C (2007) Role of anthracyclines in the era of targeted therapy. Cardiovasc Toxicol 7(2):56–60 Craciun S, Balskus EP. 2012. Microbial conversion of choline to trimethylamine requires a glycyl radical enzyme. Proceedings of the National Academy of Sciences 109:21307–21312

Craney A, Ahmed S, Nodwell J (2013) Towards a new science of secondary metabolism. J Antibiot (Tokyo) 66(7):387–400

Craney A, Ozimok C, Pimentel-Elardo SM, Capretta A, Nodwell JR (2012) Chemical perturbation of secondary metabolism demonstrates important links to primary metabolism. Chem Biol 19(8):1020–1027 Crespo JL, Hall MN (2002) Elucidating TOR signaling and rapamycin action: lessons from Saccharomyces cerevisiae. Microbiol Mol Biol Rev 66(4):579–591

Cully DF, Paress PS, Liu KK, Schaeffer JM, Arena JP (1996) Identification of a Drosophila melanogaster glutamate-gated chloride channel sensitive to the antiparasitic agent avermectin. J Biol Chem 271(33):20187–20191

131

Currie, C. R., Scott, J. A., Summerbell, R. C., & Malloch, D. (1999). Fungus-growing ants use antibiotic-producing bacteria to control garden parasites. Nature, 398(6729), 701.

Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo MA, Handsaker RE, Lunter G, Marth GT, Sherry ST, McVean G, Durbin R, 1000 Genomes Project Analysis Group. 2011. The variant call format and VCFtools. Bioinformatics 27:2156–2158

Daniel-Ivad, M., Pimentel-Elardo, S., & Nodwell, J. R. (2018). Control of specialized metabolism by signaling and transcriptional regulation: opportunities for new platforms for drug discovery?. Annual review of microbiology, 72, 25-48.

Davey KG, Holmes AD, Johnson EM, Szekely A, Warnock DW (1998) Comparative evaluation of FUNGITEST and broth microdilution methods for antifungal drug susceptibility testing of Candida species and Cryptococcus neoformans. J Clin Microbiol 36:926–930

Davies, J. (2006). Where have all the antibiotics gone?. Canadian Journal of Infectious Diseases and Medical Microbiology, 17(5), 287-290.

Davies, J., & Ryan, K. S. (2011). Introducing the parvome: bioactive compounds in the microbial world. ACS chemical biology, 7(2), 252-259.

Davis D, Edwards JE, Mitchell AP, Ibrahim AS. 2000. Candida albicans RIM101 pH response pathway is required for host-pathogen interactions. Infection and Immunity 68:5953–5959

Davis SA, Vincent BM, Endo MM, Whitesell L, Marchillo K, Andes DR, Linquist S, Burke MD (2015) Nontoxic antimicrobials that evade drug resistance. Nat Chem Biol 11(7):481–487 de Kruijff B, Demel RA (1974) Polyene antibiotic-sterol interactions in membranes of Acholeplasma laidlawii cells and lecithin liposomes. III. Molecular structure of polyene antibiotic-cholesterol complexes. Biochim Biophys Acta 339:57–70 de Lima Procópio, R. E., da Silva, I. R., Martins, M. K., de Azevedo, J. L., & de Araújo, J. M. (2012). Antibiotics produced by Streptomyces. The Brazilian Journal of infectious diseases, 16(5), 466- 471. Demain, A. L., & Sanchez, S. (2009). Microbial drug discovery: 80 years of progress. The Journal of antibiotics, 62(1), 5. Denton, D., Mills, K., & Kumar, S. (2008). Methods and protocols for studying cell death in Drosophila. Methods in enzymology, 446, 17-37.

Deshais RJ (2014) Proteotoxic crisis, the ubiquitin-proteasome system, and cancer therapy. BMC Biol 12:94

132

Desper, R., & Gascuel, O. (2004). Theoretical foundation of the balanced minimum evolution method of phylogenetic inference and its relationship to weighted least-squares tree fitting. Molecular Biology and Evolution, 21(3), 587-598.

Di Marco A, Gaetani M, Dorigotti L, Soldati M, Bellini O (1963) Studi sperimentali sull ‘attivita’ antineoplastica del nuovo antibiotic daunomicina. Tumori 49:203–217

Di Marco A, Silvestrini R, Di Marco S, Dasdia T (1965) Inhibiting effect of the new cytotoxic antibiotic daunomycin on nucleic acids and mitotic activity of HeLa cells. J Cell Biol 27(3):545–550

Dickschat, J. S., Nawrath, T., Thiel, V., Kunze, B., Müller, R., & Schulz, S. (2007). Biosynthesis of the Off‐flavor 2‐Methylisoborneol by the Myxobacterium Nannocystis exedens. Angewandte Chemie International Edition, 46(43), 8287-8290.

Drew, R. A. I., Courtice, A. C., & Teakle, D. S. (1983). Bacteria as a natural source of food for adult fruit flies (Diptera: Tephritidae). Oecologia, 60(3), 279-284.

Dumont FJ, Melino MR, Staruch MJ, Koprak SL, Fischer PA, Sigal NH (1990) The immunosuppressive macrolides FK-506 and rapamycin act as reciprocal antagonists in murine T cells. J Immunol 144(4):1418–1424 Dumont FJ, Staruch MJ, Koprak SL, Melino MR, Sigal NH (1990) Distinct mechanisms of suppression of murine T cell activation by the related macrolides FK-506 and rapamycin. J Immunol 144(1):251–258 Dunn AK, Stabb EV. 2008. Genetic analysis of trimethylamine N-oxide reductases in the light organ symbiont Vibrio fischeri ES114. Journal of Bacteriology 190:5814–5823

Dutcher JD (1968) The discovery and development of amphotericin B. Dis Chest 54(Suppl 1):296–298

Elfawal, M. A., Savinov, S. N., & Aroian, R. V. (2019). Drug Screening for Discovery of Broad- spectrum Agents for Soil-transmitted nematodes. Scientific reports, 9(1), 1-12.

Elliot MA, Buttner MJ, Nodwell JR. 2008. Multicellular development in Streptomyces. In: Whitworth D (Ed). Myxobacteria: Multicellularity and Differentiation. ASM Press. p. 419–439

Elliot MA, Karoonuthaisiri N, Huang J, Bibb MJ, Cohen SN, Kao CM, Buttner MJ. 2003. The chaplins: a family of hydrophobic cell-surface proteins involved in aerial mycelium formation in Streptomyces coelicolor. Genes & Development 17:1727–1740

Elofsson M, Splittgerber U, Myung J, Mohan R, Crews CM (1999) Towards subunit-specific proteasome inhibitors: synthesis and evaluation of peptide alpha’, beta’-epoxyketones. Chem Biol 6(11):811–822 Engel, M. S., & Grimaldi, D. A. (2004). New light shed on the oldest insect. Nature, 427(6975), 627.

133

Engel, P., & Moran, N. A. (2013). The gut microbiota of insects–diversity in structure and function. FEMS microbiology reviews, 37(5), 699-735.

Enoch DA, Ludlam HA, Brown NM (2006) Invasive fungal infections: a review of epidemiology and management options. J Med Microbiol 55(7):809–818

Espinel-Ingroff A, Bartlett M, Bowden R, Chin NX, Cooper C Jr, Fothergrill A et al (1997) Muticenter evaluation of proposed standardized procedure for antifungal susceptibility testing of filamentous fungi. J Clin Microbiol 35:139–143

Espinel-Ingroff A, Dawson K, Pfaller M, Analissie E, Breslin B et al (1995) Comparative and collaborative evaluation of standardization of antifungal susceptibility testing for filamentous fungi. Antimicrob Agents Chemother 39:314–319

Essarioui, A., LeBlanc, N., Kistler, H. C., & Kinkel, L. L. (2017). Plant community richness mediates inhibitory interactions and resource competition between Streptomyces and Fusarium populations in the rhizosphere. Microbial ecology, 74(1), 157-167.

Fäldt, J., Jonsell, M., Nordlander, G., & Borg-Karlson, A. K. (1999). Volatiles of bracket fungi Fomitopsis pinicola and Fomes fomentarius and their functions as insect attractants. Journal of chemical ecology, 25(3), 567-590.

Fan, Y., & Bergmann, A. (2010). The cleaved-Caspase-3 antibody is a marker of Caspase-9-like DRONC activity in Drosophila. Cell Death & Differentiation, 17(3), 534-539.

Fang Y, Vilella-Bach M, Bachmann R, Flanigan A, Chen J (2001) Phosphatidic acid-mediated mitogenic activation of mTOR signaling. Science 294(5548):1942–1945

Feling RH, Buchanan GO, Mincer TJ, Kauffman CA, Jensen PR, Fenical W (2003) Salinosporamide A: a highly cytotoxic proteasome inhibitor from a novel microbial source, a marine bacterium of the new genus Salinospora. Angew Chem Int Ed 42(3):355–357

Felsenstein J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783-791.

Fenteany G, Standaert RF, Lane WS, Choi S, Corey EJ, Schreiber SL (1995) Inhibition of proteasome activities and subunit-specific amino-terminal threonine modification by lactacystin. Science 268(5211):726–731 Firtel RA, Meili R (2000) Dictyostelium: a model for regulated cell movement during morphogenesis. Curr Opin Genet Dev 10(4):421–427

134

Fischer, R., Ostafe, R., & Twyman, R. M. (2013). Cellulases from insects. In Yellow Biotechnology II (pp. 51-64). Springer, Berlin, Heidelberg.

Floyd S, Favre C, Lasorsa FM et al (2007) The insulin-like growth factor-I-mTOR signaling pathway induces the mitochondrial pyrimidine nucleotide carrier to promote cell growth. Mol Biol Cell 18(9):3545–3555 Fornerod M, Ohno M, Yoshida M, Mattaj IW (1997) CRM1 is an export receptor for leucine-rich nuclear export signals. Cell 90(6):1051–1060

Frederick CA, Williams LD, Ughetto G, van der Marel GA, van Boom JH, Rich A, Wang AH (1990) Structural comparison of anticancer drug-DNA complexes: adriamycin and daunomycin. Biochemistry 29(10):2538–2549

Freedman DA, Levine AJ (1998) Nuclear export is required for degradation of endogenous p53 by MDM2 and human papillomavirus E6. Mol Cell Biol 18(12):7288–7293

Furlan, R. L., et al. (2004). DNA-binding properties of cosmomycin D, an anthracycline with two trisaccharide chains. The journal of Antibiotics, 57(10), 647-654.

Gamow RI, Bo ̈ttger B. 1982. Avoidance and rheotropic responses in phycomyces. Evidence for an ’avoidancegas" mechanism.The Journal of General Physiology79:835–848

Garcia-Martinez JM, Alessi DR (2008) mTOR complex 2 (mTORC2) controls hydrophobic motif phosphorulation and activation of serum- and glucocorticoid-induced protein kinase 1 (SKG1). Biochem J 416:375–385

Gerber, B., & Stocker, R. F. (2006). The Drosophila larva as a model for studying chemosensation and chemosensory learning: a review. Chemical senses, 32(1), 65-89.

Gershenzon, J., & Dudareva, N. (2007). The function of terpene natural products in the natural world. Nature chemical biology, 3(7), 408.

Gerwitz DA (1999) A critical evaluation of the mechanisms of action proposed for the antitumor effects of the anthracycline antibiotics adriamycin and daunorubicin. Biochem Pharmacol 57(7):727– 741 Ghannoum MA, Rice LB (1999) Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin Microbiol Rev 12(4):501–517

Giglio, S., Chou, W. K. W., Ikeda, H., Cane, D. E., & Monis, P. T. (2010). Biosynthesis of 2- methylisoborneol in cyanobacteria. Environmental science & technology, 45(3), 992-998.

135

Giordano, B. V., Kaur, S., & Hunter, F. F. (2017). West Nile virus in Ontario, Canada: A twelve-year analysis of human case prevalence, mosquito surveillance, and climate data. PloS one, 12(8), e0183568. Glickman MH, Ciechanove A (2002) The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev 82(2):373–428

Goh, E. B., Yim, G., Tsui, W., McClure, J., Surette, M. G., & Davies, J. (2002). Transcriptional modulation of bacterial gene expression by subinhibitory concentrations of antibiotics. Proceedings of the National Academy of Sciences, 99(26), 17025-17030.

Gomez-Escribano JP, Bibb MJ (2011) Engineering Streptomyces coelicolor for heterologous expression of secondary metabolite gene clusters. Microb Biotechnol 4(2):207–215

Gray KC et al (2012) Amphotericin primarily kills yeast by simply binding ergosterol. Proc Natl Acad Sci USA 109:2234–2239

Groll M, Kim KB, Kairies N, Huber R, Crews CM (2000) Crystal structure of epoxomicin: 20S proteasome reveals a molecular basis for selectivity of α’, β’-epoxyketone proteasome inhibitors. J Am Chem Soc 122(6):1237–1238

Guertin DA, Stevens DM, Thoreen CC, Burds AA, Kalaany NY et al (2006) Ablation in mice of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is required for signaling to Akt-FOXO and PKCalpha, but not S6K1. Dev Cell 11:859–871

Guo Y, Chekaluk Y, Zhang J, Du J, Gray NS, Wu CL, Kwiatkowski DJ (2013) TSC1 involvement in bladder cancer: diverse effects and therapeutic implications. J Pathol 230(1):17–27

Guo Y, Zheng W, Rong X, Huang Y. 2008. A multilocus phylogeny of the Streptomyces griseus 16S rRNA gene clade: use of multilocus sequence analysis for streptomycete systematics. International Journal of Systematic and Evolutionary Microbiology 58:149–159

Gust B, Challis GL, Fowler K, Kieser T, Chater KF. 2003. PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. PNAS 100:1541–1546.

Guzman ML, Swiderski CF, Howard DS, Grimes BA, Rossi RM, Szilvassy SJ, Jorand CT (2002) Preferential induction of apoptosis for primary human leukemic stem cells. Proc Natl Acad Sci USA 99(25):16220–16225

Haeder, S., Wirth, R., Herz, H., & Spiteller, D. (2009). Candicidin-producing Streptomyces support leaf- cutting ants to protect their fungus garden against the pathogenic fungus Escovopsis. Proceedings of the National Academy of Sciences, 106(12), 4742-4746.

136

Hagting A, Karlsson C, Clute P, Jackman M, Pines J (1998) MPF localization is controlled by nuclear export. EMBO J 17(14):4127–4138

Haiser HJ, Yousef MR, Elliot MA. 2009. Cell wall hydrolases affect germination, vegetative growth, and sporulation in Streptomyces coelicolor. Journal of Bacteriology 191:6501–6512

Halton, M. (2018) Petrichor: why does rain smell so good? BBC, URL: https://www.bbc.com/news/science-environment-44904298 December 21, 2019

Hamamoto T, Gunji S, Tsuji H, Beppu T (1983) Leptomycins A and B, new antifungal antibiotics. I. Taxonomy of the producing strain and their fermentation purification and characterization. J Antibiot Tokyo 36(6):639–645

Hamaoto T, Uozumi T, Beppu T (1985) Leptomycins A and B, new antifungal antibiotics. III. Mode of action of leptomycin B on Schizosaccharomyces pombe. J Antibiot Tokyo 38(11):1573–1580

Hanada M, Sugawara K, Kaneta K, Toda S, Nishiyama Y, Tomita K, Yamamoto H, Konishi M, Oki T (1992) Epoxomicin, a new antitumor agent of microbial origin. J Antibiot Tokyo 45(11):1746– 1752 Hara K, Yonezawa K, Weng QP, Kozlowski MT, Belham C, Avruch J (1998) Amino acid sufficiency and mTOR regulate p70 S6 kinase and eIF-4EBP1 through a common effector mechanism. J Biol Chem 273:14484–14494

Harding MW, Galat A, Uehling DE, Schreiber SL (1989) A receptor for the immunosuppressant FK506 is a cis–trans peptidyl-prolyl isomerase. Nature 341:758–760

Harrison DE, Strong R, Sharp ZD et al (2009) Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. Nature 460(7253):392–395

Heitman J, Movva NR, Hall MN (1991) Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253(5022):905–909

Hibbs RE, Gouaux E (2011) Principles of activation and permeation in an anion-selective Cys-loop receptor. Nature 474(7349):54–60

Hideshima T, Richardson P, Chauhan D, Palombella VJ, Elliott PJ, Adams J, Anderson KC (2001) The proteasome inhibitor PS-341 inhibits growth, induces apoptosis, and overcomes drug resistance in human multiple myeloma cells. Cancer Res 61(7):3071–3076

Hirayama, K., et al. (1987). Field desorption tandem mass spectrometry of anthracycline antibiotics, cosmomycin A, B, A′, B′, C and D. Biomedical & environmental mass spectrometry, 14(7), 305- 312.

137

Ho, L. K., & Nodwell, J. R. (2016). David and Goliath: chemical perturbation of eukaryotes by bacteria. Journal of industrial microbiology & biotechnology, 43(2-3), 233-248.

Hopwood DA. 2007. Streptomyces in Nature and Medicine. Oxford University Press.

Houchens DP, Ovejera AA, Riblet SM, Slagel DE (1983) Human brain tumor xenografts in nude mice as a chemotherapy model. Eur J Cancer Clin Oncol 19(6):799–805

Hryciw DH, Pollock CA, Poronnik P (2005) PKC-alpha-mediated remodeling of the actin cytoskeleton is involved in constitutive albumin uptake by proximal tubule cells. Am J Physiol Renal Physiol 288(6):F1227–F1235 Huang W, Zhang Z, Han X, Tang J, Wang J, Dong S, Wang E (2002) Ion channel behaviour of amphotericin B in sterol-free and cholesterol- or ergosterol-containing supported phosphatidylcholine bilayer model membranes investigated by electrochemistry and spectroscopy. Biophys J 83(6):3245–3255

Hui, S., Ghergurovich, J. M., Morscher, R. J., Jang, C., Teng, X., Lu, W., ... & White, E. (2017). Glucose feeds the TCA cycle via circulating lactate. Nature, 551(7678), 115.

Hurley LH (2002) DNA and it associated processes as targets for cancer therapy. Nat Rev Cancer 2(3):188–200 Ibrahim, M. A., Griko, N., Junker, M., & Bulla, L. A. (2010). Bacillus thuringiensis: a genomics and proteomics perspective. Bioengineered bugs, 1(1), 31-50.

Ikeda H, Ishikawa J, Hanamoto A et al (2003) Complete genome sequence and comparative analysis of the industrial microorganism Streptomyces avermitilis. Nat Biotech 21:526–531

Inoki K, Li Y, Xu T, Guan KL (2003) Rheb GTPase is a direct target of TSC2 GAP activity and regulates mTOR signaling. Genes Dev 17:1829–1834

Inoki K, Li Y, Zhu T, Wu J, Guan KL (2002) TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4:646–657

Insam H, Seewald MSA. 2010. Volatile organic compounds (VOCs) in soils. Biology and Fertility of Soils 46:199– 213 Ishino, Y., Krupovic, M., & Forterre, P. (2018). History of CRISPR-Cas from encounter with a mysterious repeated sequence to genome editing technology. Journal of bacteriology, 200(7), e00580-17. Ito H, Miller SC, Billingham ME, Akimoto H, Torti SV, Wade R, Gahlmann R, Lyons G, Kedes L, Torti FM (1990) Doxorubicin selectively inhibits muscle gene expression in cardiac muscle cells in vivo and in vitro. Proc Natl Acad Sci USA 87:4275–4279

138

Jacinto E, Facchinetti V, Liu D, Soto N, Wei S, Jung SY, Huang Q, Qin J, Su B (2006) SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorulation and substrate specificity. Cell 127(1):125–137

Jacinto E, Loweith R, Schmidt A, Lin S, Ruegg MA, Hall A, Hall MN (2004) Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 6:1122– 1128 Jagannath S, Vij R, Stewart AK et al (2012) An open-label single-arm pilot phase II study (PX-171-003- A0) of low-dose, single-agent carfilzomib in patients with relapsed and refractory multiple myeloma. Clin Lymphoma Myeloma Leuk 12(5):310–318

Jones, S. E., Ho, L., Rees, C. A., Hill, J. E., Nodwell, J. R., & Elliot, M. A. (2017). Streptomyces exploration is triggered by fungal interactions and volatile signals. Elife, 6, e21738.

Jüttner, F., & Watson, S. B. (2007). Biochemical and ecological control of geosmin and 2- methylisoborneol in source waters. Appl. Environ. Microbiol., 73(14), 4395-4406.

Kai M, Haustein M, Molina F, Petri A, Scholz B, Piechulla B. 2009. Bacterial volatiles and their action potential. Applied Microbiology and Biotechnology 81:1001–1012

Kaletta T, Hengartner MO (2006) Finding function in novel targets: C. elegans as a model organism. Nat Rev Drug Discov 5(5):387–398

Kaletta, T., & Hengartner, M. O. (2006). Finding function in novel targets: C. elegans as a model organism. Nature reviews Drug discovery, 5(5), 387.

Kaltenpoth, M., Göttler, W., Herzner, G., & Strohm, E. (2005). Symbiotic bacteria protect wasp larvae from fungal infestation. Current Biology, 15(5), 475-479.

Kane NS, Hirschberg B, Qian S et al (2000) Drug-resistant Drosophila indicate glutamate-gated chloride channels are targets for the antiparasitics nodulisporic acid and ivermectin. Proc Natl Acad Sci USA 97(25):13949–13954

Kanini, G. S., Katsifas, E. A., Savvides, A. L., & Karagouni, A. D. (2013). Streptomyces rochei ACTA1551, an indigenous Greek isolate studied as a potential biocontrol agent against Fusarium oxysporum f. sp. lycopersici. BioMed research international, 2013.

Karamipour, N., Fathipour, Y., & Mehrabadi, M. (2016). Gammaproteobacteria as essential primary symbionts in the striped shield bug, Graphosoma lineatum (Hemiptera: Pentatomidae). Scientific reports, 6, 33168. Kaur, T., Vasudev, A., Sohal, S. K., & Manhas, R. K. (2014). Insecticidal and growth inhibitory potential of Streptomyces hydrogenans DH16 on major pest of India, S podoptera litura

139

(Fab.)(Lepidoptera: Noctuidae). BMC microbiology, 14(1), 227.

Keen, E. C. (2015). A century of phage research: bacteriophages and the shaping of modern biology. Bioessays, 37(1), 6-9. Kelemen GH, Buttner MJ. 1998. Initiation of aerial mycelium formation in Streptomyces. Current Opinion in Microbiology 1:656–662

Kelemen, G. H., & Buttner, M. J. (1998). Initiation of aerial mycelium formation in Streptomyces. Current opinion in microbiology, 1(6), 656-662.

Kelso, C., Rojas, J. D., Furlan, R. L., Padilla, G., & Beck, J. L. (2009). Characterisation of anthracyclines from a cosmomycin D-producing species of Streptomyces by collisionally- activated dissociation and ion mobility mass spectrometry. European Journal of Mass Spectrometry, 15(2), 73-81.

Khamzina L, Veilleux A, Bergeron S, Maretta A (2005) Increased activation of the mammalian target of rapamycin pathway in liver and skeletal muscle of obese rats: possible involvement in obesity- linked insulin resistance. Endocrinology 146:1473–1481

Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., and Hopwod, D.A. (2000) Practical Streptomyces Genetics. Norwich: The John Innes Foundation.

Kim KB, Crews CM (2013) From epoxomicin to carfilzomib: chemistry, biology, and medical outcomes. Nat Prod Rep 30(5):600–604

Kim KS, Lee S, Ryu CM. 2013. Interspecific bacterial sensing through airborne signals modulates locomotion and drug resistance. Nature Communications 4:1809

Kim SY, Kim SJ, Kim BJ, Rah SY, Chung SN, Im MJ, Kim UH (2006) Doxorubicin-induced reactive oxygen species generation and intracellular Ca2+ increase are reciprocally modulated in rat cardiomyocytes. Exp Mol Med 38(5):535–545

Kimura N, Tokunaga C, Dalal S et al (2003) A possible linkage between AMP-activated protein kinase (AMPK) and mammalian target of rapamycin (mTOR) signalling pathway. Genes Cells 8(1):65– 79 Kinashi, H Giant linear plasmids in Streptomyces: a treasure trove of antibiotic biosynthetic clusters. J. Antibiot. (Tokyo) 64, 19–25 (2011).Return to ref 4 in article

King AM, Reid-Yu SA, Wang W et al (2014) Aspergillomarasmine A overcomes metallo-β-lactamase antibiotic resistance. Nature 510(7506):503–506

140

Kirst, H. A. (2010). The spinosyn family of insecticides: realizing the potential of natural products research. The Journal of antibiotics, 63(3), 101.

Kissinger CR, Parge HE, Knighton DR et al (1995) Crystal structures of human calcineurin and the human FKBP12–FK506–calcineurin complex. Nature 378(6557):641–644

Klausen, C., Nicolaisen, M. H., Strobel, B. W., Warnecke, F., Nielsen, J. L., & Jørgensen, N. O. (2005). Abundance of actinobacteria and production of geosmin and 2-methylisoborneol in Danish streams and fish ponds. FEMS microbiology ecology, 52(2), 265-278.

Kliewer W. 1965. Changes of concentration of glucose, fructose and total soluble solids in flowers and berries of Vitis vinifera. American Journal of Enology and Viticulture 16:101–110.

Koch, M. S., Ward, J. M., Levine, S. L., Baum, J. A., Vicini, J. L., & Hammond, B. G. (2015). The food and environmental safety of Bt crops. Frontiers in plant science, 6, 283.

Kohanski MA, Dwyer DJ, Collins JJ (2010) How antibiotics kill bacteria: from targets to networks. Nat Rev Microbiol 8(6):423–435

Kolar, L., Eržen, N. K., Hogerwerf, L., & van Gestel, C. A. (2008). Toxicity of abamectin and doramectin to soil invertebrates. Environmental Pollution, 151(1), 182-189

Komatsu M, Komatsu K, Koiwai H et al (2013) Engineered Streptomyces avermitilis for heterologous expression of biosynthetic gene cluster for secondary metabolites. ACS Synth Biol 2(7):384–396

Komiyama K, Okada K, Hirokawa Y, Masuda K, Tomisaka S, Umezawa I (1985) J Antibiot Tokyo 38(2):224–229 Koornneef M, Meinke D (2010) The development of Arabidopsis as a model plant. Plant J 61(6):909– 921 Kotler-Brajtburg J, Medoff G, Kobayashi GS, Boggs S, Schlessinger D, Pandey RC, Rinehart KL Jr (1979) Classification of polyene antibiotics according to chemical structure and biological effects. Antimicrob Agents Chemother 15(5):716–722

Kronheim, S., Daniel-Ivad, M., Duan, Z., Hwang, S., Wong, A. I., Mantel, I., ... & Maxwell, K. L. (2018). A chemical defence against phage infection. Nature, 564(7735), 283.

Krulwich TA, Sachs G, Padan E. 2011. Molecular aspects of bacterial pH sensing and homeostasis. Nature Reviews Microbiology 9:330–343

Kudo N, Matsumori N, Taoka H et al (1999) Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue in the central conserved region. Proc Natl Acad Sci USA 96(16):9112–9117

141

Kudo, N., Matsumori, N., Taoka, H., Fujiwara, D., Schreiner, E. P., Wolff, B., ... & Horinouchi, S. (1999). Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue in the central conserved region. Proceedings of the National Academy of Sciences, 96(16), 9112-9117. Kumatori A, Tanaka K, Inamura N, Sone S, Ogura T, Matsumoto T, Tachikawa T, Shin S, Ichihara A (1990) Abnormally high expression of proteasomes in human leukemic cells. Proc Natl Acad Sci USA 87(18):7071–7075

Kuramae, E. E., Robert, V., Snel, B., Weiß, M., & Boekhout, T. (2006). Phylogenomics reveal a robust fungal tree of life. FEMS Yeast Research, 6(8), 1213-1220.

Kurtzman, C. P., & Fell, J. W. (2006). Yeast systematics and phylogeny—implications of molecular identification methods for studies in ecology. In Biodiversity and ecophysiology of yeasts (pp. 11-30). Springer, Berlin, Heidelberg.

Kylsten, P., Kimbrell, D. A., Daffre, S., Samakovlis, C., & Hultmark, D. (1992). The lysozyme locus in Drosophila melanogaster: different genes are expressed in midgut and salivary glands. Molecular and General Genetics MGG, 232(3), 335-343.

Lacombe-Harvey, M. È., Brzezinski, R., & Beaulieu, C. (2018). Chitinolytic functions in actinobacteria: ecology, enzymes, and evolution. Applied microbiology and biotechnology, 102(17), 7219-7230.

Laing, R., Gillan, V., & Devaney, E. (2017). Ivermectin–old drug, new tricks?. Trends in parasitology, 33(6), 463-472. Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nature Methods 9:357– 359. Lasota, J. A., & Dybas, R. A. (1991). Avermectins, a novel class of compounds: implications for use in arthropod pest control. Annual review of entomology, 36(1), 91-117.

Le Bacquer O, Petroulakis E, Paglialunga S, Poulin F, Richard D, Cianflone K, Sonenberg N (2007) Elevated sensitivity to diet-induced obesity and insulin resistance in mice lacking 4E-BP1 and 4E-BP2. J Clin Invest 117:387–396

Lemos, F. A., & Terra, W. R. (1991). Digestion of bacteria and the role of midgut lisozyme in some insect larvae. Comparative biochemistry and physiology. B. Comparative biochemistry, 100(2), 265-268. Letoffe S, Audrain B, Bernier SP, Delepierre M, Ghigo JM. 2014. Aerial exposure to the bacterial volatilecompound trimethylamine modifies antibiotic resistance of physically separated bacteria by raising culturemedium pH.mBio5:e00944-13

Leung, M. C., Williams, P. L., Benedetto, A., Au, C., Helmcke, K. J., Aschner, M., & Meyer, J. N. (2008). Caenorhabditis elegans: an emerging model in biomedical and environmental toxicology.

142

Toxicological sciences, 106(1), 5-28.

Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup. 2009. The sequence alignment/Map format and SAMtools. Bioinformatics 25:2078–2079

Li J, Grillo AS, Burke MD (2015) From synthesis to function via iterative assembly of N- methyliminodiacetic acid boronate building blocks. Acc Chem Res 48(8):2297–2307

Li RK, Ciblak MA, Nordoff N, Pasarell L, Warnock DW, McGinnis MR (2000) In vitro activities of voriconazole, itraconazole, and amphotericin B against Blastomyces dermatidis, Coccidioides immitis, and Histoplasma capsulatum. Antimicrob Agents Chemother 44:1743–1746

Li X, Gianoulis TA, Yip KY, Gerstein M, Snyder M (2010) Extensive in vivo metabolite–protein interactions revealed by large-scale systematic analyses. Cell 143(4):639–650

Li, C. H., Cheng, Y. W., Liao, P. L., Yang, Y. T., & Kang, J. J. (2010). Chloramphenicol causes mitochondrial stress, decreases ATP biosynthesis, induces matrix metalloproteinase-13 expression, and solid-tumor cell invasion. Toxicological Sciences, 116(1), 140-150.

Li, J., Kim, S. G., & Blenis, J. (2014). Rapamycin: one drug, many effects. Cell metabolism, 19(3), 373- 379. Li, Z., et al. (2015). Actinomycetes from the South China Sea sponges: isolation, diversity and potential for aromatic polyketides discovery. Frontiers in microbiology, 6, 1048.

Lin AC, Goldwasser E, Bernard EM, Chapman SW (1990) Amphotericin B blunts erythropoietin response to anemia. J Infect Dis 161(2):348–351

Lin, Z., et al. (2013). A bacterial source for mollusk pyrone polyketides. Chemistry & biology, 20(1), 73-81. Ling LL, Schneider T, Peoples AJ et al (2015) A new antibiotic kills pathogens without detectable resistance. Nature 517(7535):455–459

Ling YH, Liebes L, Ng B, Buckley M, Elliott PJ, Adams J, Jiang JD, Muggia FM, Perez-Soler R (2002) PS-341, a novel proteasome inhibitor, induces Bcl-2 phosphorylation and cleavage in association with G2-M phase arrest and apoptosis. Mol Cancer Ther 1(10):841–849

Liu LF (1989) DNA topoisomerase poisons as antitumor drugs. Annu Rev Biochem 58:351–375

Liu, T. B., Wang, Y., Baker, G. M., Fahmy, H., Jiang, L., & Xue, C. (2013). The glucose sensor-like protein Hxs1 is a high-affinity glucose transporter and required for virulence in Cryptococcus neoformans. PloS one, 8(5), e64239.

143

Liu, Z., & Butow, R. A. (2006). Mitochondrial retrograde signaling. Annu. Rev. Genet., 40, 159-185.

Loda M, Cukor B, Tam SW, Lavin P, Fiorentino M, Draetta GF, Jessup JM, Pagano M (1997) Increased proteasome-dependent degradation of the cyclin-dependent kinase inhibitor p27 in aggressive colorectal carcinomas. Nat Med 3(2):231–234

Lugtenberg BJ, Kravchenko LV, Simons M. 1999. Tomato seed and root exudate sugars: composition, utilization by Pseudomonas biocontrol strains and role in rhizosphere colonization. Environmental Microbiology 1:439– 446

Luo, X., Sun, Y., Xie, S., Wan, C., & Zhang, L. (2016). Streptomyces indoligenes sp. nov., isolated from rhizosphere soil of Populus euphratica. International journal of systematic and evolutionary microbiology, 66(6), 2424-2428.

Lyons NA, Kolter R. 2015. On the evolution of bacterial multicellularity. Current Opinion in Microbiology 24:21– 28

Ma, J., et al. (2018). Violacin A, a new chromanone produced by Streptomyces violaceoruber and its anti-inflammatory activity. Bioorganic & medicinal chemistry letters, 28(5), 947-951.

Maataoui, H., Iraqui, M., Jihani, S., Ibnsouda, S., & Haggoud, A. (2014). Isolation, characterization and antimicrobial activity of a Streptomyces strain isolated from deteriorated wood. African Journal of Microbiology Research, 8(11), 1178-1186.

MacGregor RR, Bennett JE, Erslev AJ (1978) Erythropoietin concentration in amphotericin B-induced anemia. Antimicrob Agents Chemother 14(2):270–273

Mackay, T. F., et al. (2012). The Drosophila melanogaster genetic reference panel. Nature, 482(7384), 173-178.

Maki CG, Huibregtse JM, Howley PM (1996) In vivo ubiquitination and proteasome-mediated degradation of p53. Cancer Res 56(11):2649–2654

Manfredi R, Fulgaro C, Sabbatani S, Legnani G, Fasulo G (2006) Emergence of amphotericin B- resistant Cryptococcus laurentii meningoencephalitis shortly after treatment for Cryptococcus neoformans meningitis in a patient with AIDS. AIDS Patient Care STDS 20(4):227–232

Martel RR, Klicius J, Galet S (1977) Inhibition of the immune response by rapamycin, a new antifungal antibiotic. Can J Physiol Pharmacol 55(1):48–51

Martin, R. J., & Robertson, A. P. (2010). Control of nematode parasites with agents acting on neuro- musculature systems: lessons for neuropeptide ligand discovery. In Neuropeptide Systems as

144

Targets for Parasite and Pest Control (pp. 138-154). Springer, Boston, MA.

Martín-Sánchez, L., Singh, K. S., Avalos, M., van Wezel, G. P., Dickschat, J. S., & Garbeva, P. (2019). Phylogenomic analyses and distribution of terpene synthases among Streptomyces. Beilstein journal of organic chemistry, 15, 1181–1193. doi:10.3762/bjoc.15.115

Marty A, Finkelstein A (1975) Pores formed in lipid bilayer membranes by nystatin, differences in its one-sided and two-sided action. J Gen Physiol 65(4):515–526

McAuley, S. (2019) Discovery of Novel Antibiotics via Streptomyces sporulation. University of Toronto. Acquired from TSpace: http://hdl.handle.net/1807/97547 on January 23, 2020

McClure R, Balasubramanian D, Sun Y, Bobrovskyy M, Sumby P, Genco CA, Vanderpool CK, Tjaden B. 2013. Computational analysis of bacterial RNA-Seq data. Nucleic Acids Research 41:e140

McCormack PL (2012) Carfilzomib: in relapsed, or relapsed and refractory, multiple myeloma. Drugs 72(15):2023–2032 McCormick JR, Fla ̈rdh K. 2012. Signals and regulators that govern Streptomyces development.FEMSMicrobiology Reviews36:206–231

McCrindle SL, Kappler U, McEwan AG. 2005. Microbial dimethylsulfoxide and trimethylamine-N- oxide respiration. Advances in Microbial Physiology 50:147–198

McIlwain, D. R., Berger, T., & Mak, T. W. (2013). Caspase functions in cell death and disease. Cold Spring Harbor perspectives in biology, 5(4), a008656.

McKellar, C. E., & Wyttenbach, R. A. (2017). A protocol demonstrating 60 different Drosophila behaviors in one assay. Journal of Undergraduate Neuroscience Education, 15(2), A110.

McKenzie NL, Thaker M, Koteva K, Hughes DW, Wright GD, Nodwell JR (2010) Induction of antimicrobial activities in heterologous streptomycetes using alleles of the Streptomyces coelicolor gene absA1. J Antibiot Tokyo 53(4):177–192

Meng L, Mohan R, Kwok BHB, Eloffson M, Sin N, Crews CM (1999) Epoxomicin, a potent and selective proteasome inhibitor, exhibits in vivo anti-inflammatory activity. Proc Natl Acad Sci USA 96(18):10403–10408

Meng, L., Mohan, R., Kwok, B. H., Elofsson, M., Sin, N., & Crews, C. M. (1999). Epoxomicin, a potent and selective proteasome inhibitor, exhibits in vivo antiinflammatory activity. Proceedings of the National Academy of Sciences, 96(18), 10403-10408.

Merola, V. M., & Eubig, P. A. (2012). Toxicology of avermectins and milbemycins (macrocylic lactones) and the role of P-glycoprotein in dogs and cats. Veterinary Clinics: Small Animal

145

Practice, 42(2), 313-333.

Metcalfe, A. C., Krsek, M., Gooday, G. W., Prosser, J. I., & Wellington, E. M. H. (2002). Molecular analysis of a bacterial chitinolytic community in an upland pasture. Appl. Environ. Microbiol., 68(10), 5042-5050. Meyers, J. I., Gray, M., Kuklinski, W., Johnson, L. B., Snow, C. D., Black, W. C., ... & Foy, B. D. (2015). Characterization of the target of ivermectin, the glutamate-gated chloride channel, from Anopheles gambiae. Journal of Experimental Biology, 218(10), 1478-1486.

Miller RA, Harrison DE, Astle CM et al (2010) Rapamycin, but not resveratrol or simvastatin, extends life span of genetically heterogeneous mice. J Gerontol A Biol Sci Med Sci 66(2):191–201

Misof, B., et al. (2014). Phylogenomics resolves the timing and pattern of insect evolution. Science, 346(6210), 763-767. Misof, B., Liu, S., Meusemann, K., Peters, R. S., Donath, A., Mayer, C., ... & Niehuis, O. (2014). Phylogenomics resolves the timing and pattern of insect evolution. Science, 346(6210), 763-767.

Moro S, Beretta GL, Dal Ben D, Nitiss J, Palumbo M, Capranico G (2004) Interaction model for anthracycline activity against DNA topoisomerase II. Biochemistry 43(23):7503–7513

Moro, C. V., Tran, F. H., Raharimalala, F. N., Ravelonandro, P., & Mavingui, P. (2013). Diversity of culturable bacteria including Pantoea in wild mosquito Aedes albopictus. BMC microbiology, 13(1), 70. Mouri R, Konoki K, Matsumori N, Oishi T, Murata M (2008) Complex formation of amphotericin B in sterol-containing membranes as evidenced by surface plasmon resonance. Biochemistry 47:7807–7815 Mutka SC, Yang WQ, Dong SD, Ward SL, Craig DA, Timmermans PB, Murli S (2009) Identification of the nuclear export inhibitors with potent anticancer activity in vivo. Cancer Res 69(2):510–517

Naujokat C, Sezer O, Zinke H, Leclere A, Hauptmann S, Possinger K (2000) Proteasome inhibitors induced caspase-dependent apoptosis and accumulation of p21WAF1/Cip1 in human immature leukemic cells. Eur J Haematol 65:221–236

Nazari, B., Saito, A., Kobayashi, M., Miyashita, K., Wang, Y., & Fujii, T. (2011). High expression levels of chitinase genes in Streptomyces coelicolor A3 (2) grown in soil. FEMS microbiology ecology, 77(3), 623-635.

Nett, M., Ikeda, H., & Moore, B. S. (2009). Genomic basis for natural product biosynthetic diversity in the actinomycetes. Natural product reports, 26(11), 1362-1384.

Neu, J. M., & Wright, G. D. (2001). Inhibition of sporulation, glycopeptide antibiotic production and resistance in Streptomyces toyocaensis NRRL 15009 by protein kinase inhibitors. FEMS

146

microbiology letters, 199(1), 15-20.

Nikodinovic, J., Barrow, K. D., & Chuck, J. A. (2003). High yield preparation of genomic DNA from Streptomyces. Biotechniques, 35(5), 932-936.

Nishi K, Yoshida M, Fujiwara D, Shishikawa M, Horinouchi S, Beppu T (1994) Leptomycin B targets a regulatory cascade of crm1, a fission yeast nuclear protein, involved in control of higher order chromosome structure and gene expression. J Biol Chem 269(9):6320–6324

O’Connor OA, Stewart AK, Vallone M, Molineaux CJ, Kunkel LA, Gerecitano JF, Orlowski RZ (2009) A phase 1 dose escalation study of the safety and pharmacokinetics of the novel proteasome inhibitor carfilzomib (PR-171) in patients with hematologic malignancies. Clin Cancer Res 15(22):7085–7091 O’Meara TR, Xu W, Selvig KM, O’Meara MJ, Mitchell AP, Alspaugh JA. 2014. The Cryptococcus neoformans Rim101 transcription factor directly regulates genes required for adaptation to the host. Molecular and Cellular Biology 34:673–684.

Ochi K, Hosaka T (2012) New strategies for drug discovery: activation of silent or weakly expressed microbial gene clusters. Appl Microbiol Biotechnol 97(1):87–98

Ohnishi Y, Ishikawa J, Hara H et al (2008) Genome sequence of the streptomycin-producing microorganism Streptomyces griseus IFO 13350. J Bacteriol 190:4050–4060

Oliveira NM, Martinez-Garcia E, Xavier J, Durham WM, Kolter R, Kim W, Foster KR. 2015. Biofilm formation as a response to ecological competition. PLoS Biology 13:e1002191

Omura S, Crump A (2004) The life and times of ivermectin—a success story. Nat Rev Microbiol 2(12):984–989 Ouyang S, Hsuchou H, Kastin AJ, Pan W (2013) TNF stimulates nuclear export and secretion of IL-15 by acting on CRM1 and ARF6. PLoS One 8(8):e69356

Ouyang, L., Tu, G., Gao, Y., Zhang, P., & Xie, X. (1993). Two insecticidal antibiotics produced by Streptomyces nanchangensis. J Jiangxi Agricul Univ, 15, 148-153.

Padan E, Bibi E, Ito M, Krulwich TA. 2005. Alkaline pH homeostasis in bacteria: New insights. Biochimica Et Biophysica Acta (BBA) - Biomembranes 1717:67–88

Palacios DS et al (2011) Synthesis-enables functional group deletions reveal key underpinnings of amphotericin B ion channel and antifungal activities. Proc Natl Acad Sci USA 108:6733–6738

Palkova ́Z, Janderova ́ B, Gabriel J, Zika ́nova ́ B, Pospı ́sekM, Forstova ́ J. 1997. Ammonia mediates communicationbetween yeast colonies.Nature390:532–536

147

Palma, L., Muñoz, D., Berry, C., Murillo, J., & Caballero, P. (2014). Bacillus thuringiensis toxins: an overview of their biocidal activity. Toxins, 6(12), 3296-3325.

Palombella VJ, Rando OJ, Goldberg AL, Manitatis T (1994) The ubiquitinproteasome pathway is required for processing the NF-κB1 precursor protein and the activation of NF-κB. Cell 78(5):773–785 Pandey UB, Nichols CD (2011) Human disease models in Drosophila melanogaster and the role of the fly in therapeutic drug discovery. Pharmacol Rev 63(2):411–436

Patel S, Sprung AU, Keller BA, Heaton VJ, Fisher LM (1997) Identification of yeast DNA topoisomerase II mutants resistant to the antitumor drug doxorubicin: implications for the mechanisms of doxorubicin action and cytotoxicity. Mol Pharmacol 52(4):658–666

Pathom-Aree, W., Stach, J. E., Ward, A. C., Horikoshi, K., Bull, A. T., & Goodfellow, M. (2006). Diversity of actinomycetes isolated from Challenger Deep sediment (10,898 m) from the Mariana Trench. Extremophiles, 10(3), 181-189.

Patil, P. B., Zeng, Y., Coursey, T., Houston, P., Miller, I., & Chen, S. (2010). Isolation and characterization of a Nocardiopsis sp. from honeybee guts. FEMS microbiology letters, 312(2), 110-118. Peleg AY, Hogan DA, Mylonakis E. 2010. Medically important bacterial-fungal interactions. Nature Reviews Microbiology 8:340–349.

Pfaller MA, Arikan S, Lozano-Chu M et al (1998) Clinical evaluation of the ASTY colorimetric microdilution panel for antifungal susceptibility testing. J Clin Microbiol 36:2609–2612

Pfaller MA, Pappas PG, Wingard JR (2006) Invasive Fungal Pathogesn: current epidemiological trends. Clin Infect Dis 43(Suppl 1):S3–S14

Phung TL, Ziv K, Dabydeen D et al (2006) Pathological angiogenesis is induced by sustained Akt signaling and inhibited by rapamycin. Cancer Cell 10:159–170

Polak P, Cybulski N, Feige JN, Auwerx J, Ruegg MA, Hall MN (2008) Adipose-specific knockout of raptor results in lean mice with enhanced mitochondrial respiration. Cell Metab 8:399–410

Polke, M., Leonhardt, I., Kurzai, O., & Jacobsen, I. D. (2018). Farnesol signalling in Candida albicans– more than just communication. Critical reviews in microbiology, 44(2), 230-243.

Porter, A. G., & Jänicke, R. U. (1999). Emerging roles of caspase-3 in apoptosis. Cell death and differentiation, 6(2), 99.

148

Powers RW 3rd, Kaeberlein M, Caldwell SD, Kennedy BK, Fields S (2006) Extension of chronological life span in yeast by decreased TOR pathway signaling. Genes Dev 20(2):174–184

Prem Anand, A. A., Vennison, S. J., Sankar, S. G., Gilwax Prabhu, D. I., Vasan, P. T., Raghuraman, T., ... & Vendan, S. E. (2010). Isolation and characterization of bacteria from the gut of Bombyx mori that degrade cellulose, xylan, pectin and starch and their impact on digestion. Journal of Insect Science, 10(1), 107.

Przybyla-Zawislak B, Gadde DM, Ducharme K, McCammon MT. 1999. Genetic and biochemical interactions involving tricarboxylic acid cycle (TCA) function using a collection of mutants defective in all TCA cycle genes. Genetics 152:153–166.

Public Health Ontario (2017) Vector-Borne Diseases, Summary Report. https://www.publichealthontario.ca/-/media/documents/vector-borne-diseases-2017.pdf?la=en

Quintana, E. T., Wierzbicka, K., Mackiewicz, P., Osman, A., Fahal, A. H., Hamid, M. E., ... & Goodfellow, M. (2008). Streptomyces sudanensis sp. nov., a new pathogen isolated from patients with actinomycetoma. Antonie Van Leeuwenhoek, 93(3), 305-313.

Rabe, P., Citron, C. A., & Dickschat, J. S. (2013). Volatile terpenes from actinomycetes: a biosynthetic study correlating chemical analyses to genome data. ChemBioChem, 14(17), 2345-2354.

Rath, D., Amlinger, L., Rath, A., & Lundgren, M. (2015). The CRISPR-Cas immune system: biology, mechanisms and applications. Biochimie, 117, 119-128.

Readio JD, Bittman R (1982) Equilibrium binding of amphotericin B and its methyl ester and borate complex to sterols. Biochim Biophys Acta 685(2):219–224

Rees CA, Smolinska A, Hill JE. 2016. The volatile metabolome of Klebsiella pneumoniae in human blood. Journal of Breath Research 10:27101

Reinders, J., Zahedi, R. P., Pfanner, N., Meisinger, C., & Sickmann, A. (2006). Toward the complete yeast mitochondrial proteome: multidimensional separation techniques for mitochondrial proteomics. Journal of proteome research, 5(7), 1543-1554.

Ren, S., Sampath, V., Rhee, Y. H., & Kim, S. (2009). Synthesis of UV active 2-methylisoborneol for water pollutant detection. Toxicology and Environmental Health Sciences, 1(3), 163-168.

Rendle, D. I., Cottle, H. J., Love, S., & Hughes, K. J. (2007). Comparative study of doramectin and fipronil in the treatment of equine chorioptic mange. Veterinary Record, 161(10), 335-338.

149

Rhoads, A., & Au, K. F. (2015). PacBio sequencing and its applications. Genomics, proteomics & bioinformatics, 13(5), 278-289.

Richards DM, Hempel AM, Fla ̈rdh K, Buttner MJ, Howard M. 2012. Mechanistic basis of branch-site selection infilamentous bacteria.PLoS Computational Biology8:e1002423

Rigali S, Titegmeyer F, Barends S, Mulder S, Thomae AW, Hopwood DA, van Wezel GP (2008) Feast or famine: the global regulator DasR links nutrient stress to antibiotic production by Streptomyces. EMBO Rep 9(7):670–675

Robbins, N., Caplan, T., & Cowen, L. E. (2017). Molecular evolution of antifungal drug resistance. Annual review of microbiology, 71, 753-775.

Robida-Stubbs S, Glover-cutter K, Lamming DW, Mizunuma M, Narasimhan SD, Neumann-Haefelin E, Sabatini DM, Blackwell TK (2012) TOR signaling and rapamycin influence longevity by regulating SKN-1/Nrf and DAF-16/FoxO. Cell Metab 15(5):713–724

Robinson JT, Thorvaldsdo ́ ttir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrativegenomics viewer.Nature Biotechnology29:24–26

Roemer, T., Jiang, B., Davison, J., Ketela, T., Veillette, K., Breton, A., … & Martel, N. (2003). Large‐ scale essential gene identification in Candida albicans and applications to antifungal drug discovery. Molecular microbiology, 50(1), 167-181.

Rojas, J. D., Starcevic, A., Baranas̆ ić, D., Ferreira-Torres, M. A., Contreras, C. A., Garrido, L. M., ... & Long, P. F. (2014). Genome sequence of Streptomyces olindensis DAUFPE 5622, producer of the antitumoral anthracycline cosmomycin D. Genome Announc., 2(3), e00541-14.

Romano JD, Kolter R. 2005. Pseudomonas-Saccharomyces interactions: influence of fungal metabolism on bacterial physiology and survival. Journal of Bacteriology 187:940–948

Sabatini DM, Erdjument-Bromage H, Lui M, Tempst P, Snyder SH (1994) RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is homologous to yeast TORs. Cell 78(1):35–43

Sabers CJ, Martin MM, Brunn GJ, Williams JM, Dumont FJ, Wiederrecht G, Abraham RT (1995) Isolation of a protein target of the FKBP12-rapamycin complex in mammalian cells. J Biol Chem 270(2):815–822

Sachdev S, Hannink M (1998) Loss of IkappaB alpha-mediated control over nuclear import and DNA binding enables oncogenic activation of c-Rel. Mol Cell Biol 18(9):5445–5456

150

Salas V, Pastor FJ, Calvo E, Alvarez E, Sutton DA, Mayayo E, Fothergill AW, Rinaldi MG, Guarro J (2012) In vitro and in vivo activities of posaconazole and amphotericin B in a murine invasive infection by Mucor circinelloides: poor efficacy of posaconazole. Antimicrob Agents Chemother 56(5):2246–2250 Salem, H., Bauer, E., Strauss, A. S., Vogel, H., Marz, M., & Kaltenpoth, M. (2014). Vitamin supplementation by gut symbionts ensures metabolic homeostasis in an insect host. Proceedings of the Royal Society B: Biological Sciences, 281(1796), 20141838.

Sannino, D. R., Dobson, A. J., Edwards, K., Angert, E. R., & Buchon, N. (2018). The Drosophila melanogaster gut microbiota provisions thiamine to its host. MBio, 9(2), e00155-18.

Sarbassov DD, Ali SM, Kim DH et al (2004) Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol 14:1296–1302 Sarbassov DD, Ali SM, Sengupta S, Sheen JH, Hsu PP, Bagley AF, Markhard AL, Sabatini DM (2006) Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB. Mol Cell 22:159–168

Sarbassov DD, Guertin DA, Ali SM, Sabatini DM (2005) Phosphorylation and regulation of Akt/PKB by the rictor mTOR complex. Science 307(5712):1098–1101

Sarkissian, T., Timmons, A., Arya, R., Abdelwahid, E., & White, K. (2014). Detecting apoptosis in Drosophila tissues and cells. Methods, 68(1), 89-96.

Sarwar, A., Latif, Z., Zhang, S., Zhu, J., Zechel, D. L., & Bechthold, A. (2018). Biological control of potato common scab with rare isatropolone C compound produced by plant growth promoting Streptomyces A1RT. Frontiers in Microbiology, 9, 1126.

Scherlach K, Graupner K, Hertweck C. 2013. Molecular bacteria-fungi interactions: effects on environment, food, and medicine. Annual Review of Microbiology 67:375–397

Scherlach, K., Graupner, K., & Hertweck, C. (2013). Molecular bacteria-fungi interactions: effects on environment, food, and medicine. Annual review of microbiology, 67, 375-397.

Schinkel AH, Smit JJ, van Tellingen O, Beijnen JH, Wagenaar E, van Deemter L et al (1994) Disruption of the mouse mdr1a P-glycoprotein gene leads to a deficiency in the blood-brain barrier and to increased sensitivity to drugs. Cell 77(4):491–502

Schinkel AH, Wagenaar Mol CA, van Deemter L (1996) P-glycoprotein in the blood-brain barrier of mice influences the brain penetration and pharmacological activity of many drugs. J Clin Investig 97(11):2517 Schmidt R, Cordovez V, de Boer W, Raaijmakers J, Garbeva P. 2015. Volatile affairs in microbial interactions. The ISME Journal 9:1–7

151

Schmidt R, Etalo DW, de Jager V, Gerards S, Zweers H, de Boer W, Garbeva P. 2016. Microbial small talk: Volatiles in fungal-bacterial Interactions. Frontiers in Microbiology 6:1495

Schmidt, R., Cordovez, V., De Boer, W., Raaijmakers, J., & Garbeva, P. (2015). Volatile affairs in microbial interactions. The ISME journal, 9(11), 2329.

Scholler CEG, Gu ̈rtler H, Pedersen R, Molin S, Wilkins K. 2002. Volatile Metabolites from Actinomycetes.Journalof Agricultural and Food Chemistry50:2615–2621

Schrempf, H. (2001). Recognition and degradation of chitin by streptomycetes. Antonie Van Leeuwenhoek, 79(3-4), 285-289.

Schroeckh V, Scherlach K, Nu ̈tzmann HW, Shelest E, Schmidt-Heck W, Schuemann J, Martin K, Hertweck C,Brakhage AA. 2009. Intimate bacterial-fungal interaction triggers biosynthesis of archetypal polyketides inAspergillus nidulans.PNAS106:14558–14563

Schulenburg, H., & Félix, M. A. (2017). The natural biotic environment of Caenorhabditis elegans. Genetics, 206(1), 55-86.

Schulz S, Dickschat JS. 2007. Bacterial volatiles: the smell of small organisms. Natural Product Reports 24:814– 842 Scott, J. J., et al. (2008). Bacterial protection of beetle-fungus mutualism. Science, 322(5898), 63-63.

Seipke, R. F., Barke, J., Brearley, C., Hill, L., Yu, D. W., Goss, R. J., & Hutchings, M. I. (2011). A single Streptomyces symbiont makes multiple antifungals to support the fungus farming ant Acromyrmex octospinosus. PLoS one, 6(8).

Seipke, R. F., & Loria, R. (2008). Streptomyces scabies 87-22 possesses a functional tomatinase. Journal of bacteriology, 190(23), 7684-7692.

Serbus, L. R., Casper-Lindley, C., Landmann, F., & Sullivan, W. (2008). The genetics and cell biology of Wolbachia-host interactions. Annual review of genetics, 42, 683-707.

Shady, N. H., et al. (2018). A new antitrypanosomal alkaloid from the Red Sea marine sponge Hyrtios sp. The Journal of antibiotics, 71(12), 1036.

Shanmugam I, Cheng G, Terranova PF, Thrasher JB, Thomas CP, Li B (2007) Serum/glucocorticoid- induced protein kinase-1 facilitates androgen receptor-dependent cell survival. Cell Death Differ 14(12):2085–2094 Shepherd, M. D., Kharel, M. K., Bosserman, M. A., & Rohr, J. (2010). Laboratory maintenance of Streptomyces species. Current protocols in microbiology, 18(1), 10E-1.

152

Siegel DS, Martin T, Wang M et al (2012) A phase 2 study of single-agent carfilzomib (PX-171-003-A1) in patients with relapsed and refractory multiple myeloma. Blood 120(14):2817–2825

Siekierka JJ, Hung SHY, Pie M, Lin CS, Sigal NH (1989) A cytosolic binding protein for the immunosuppressant FK506 has peptidyl-prolyl isomerase activity but is distinct from cyclophilin. Nature 341:755–757 Skinnider, M. A., Merwin, N. J., Johnston, C. W., & Magarvey, N. A. (2017). PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. Nucleic acids research, 45(W1), W49-W54.

Spanogiannopoulos P, Thaker M, Koteva K, Waglechner N, Wright GD (2012) Characterization of a rifampin-inactivating glycosyltransferase from a screen of environmental actinomycetes. Antimicrob Agents Chemother 56(10):5061–5069

Srinivasan, J., Von Reuss, S. H., Bose, N., Zaslaver, A., Mahanti, P., Ho, M. C., ... & Schroeder, F. C. (2012). A modular library of small molecule signals regulates social behaviors in Caenorhabditis elegans. PLoS biology, 10(1).

Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688–2690

Stensmyr, M. C., et al. (2012). A conserved dedicated olfactory circuit for detecting harmful microbes in Drosophila. Cell, 151(6), 1345-1357.

Stubbendieck RM, Straight PD. 2016. Multifaceted interfaces of bacterial competition. Journal of Bacteriology 198:2145–2155

Sugar AM, Liu XP (1996) In vitro activity of voriconazole against selected fungi. Med Mycol 36:239– 242 Sutton DA, Sanche SE, Revankar SG, Fothergill AW, Rinaldi MG (1999) In vitro amphotericin B resistance in clinical isolates of Aspergillus terrus, with a head-to-head comparison to voriconazole. J Clin Microbiol 37(7):2343–2345

Suurnäkki, S., Gomez-Saez, G. V., Rantala-Ylinen, A., Jokela, J., Fewer, D. P., & Sivonen, K. (2015). Identification of geosmin and 2-methylisoborneol in cyanobacteria and molecular detection methods for the producers of these compounds. Water research, 68, 56-66.

Suzuki Y, Nakabayashi Y, Takahashi R (2001) Ubiquitin-protein ligase activity of X-linked inhibitor of apoptosis protein promotes proteasomal degradation of caspase-3 and enhances its anti-apoptotic effect in Fas-induced cell death. Proc Natl Acad Sci USA 98(15):8662–8667

153

Świątek, M. A., Tenconi, E., Rigali, S., & van Wezel, G. P. (2012). Functional analysis of the N- acetylglucosamine metabolic genes of Streptomyces coelicolor and role in control of development and antibiotic production. Journal of bacteriology, 194(5), 1136-1144.

Szafraniec, E., et al. (2016). Spectroscopic studies of anthracyclines: Structural characterization and in vitro tracking. Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy, 169, 152-160. Taagepera S, McDonald D, Loeb JE, Whitaker LL, McElroy AK, Wang JY, Hope TJ (1998) Nuclear- cytoplasmic shuttling of C-ABL tyrosine kinase. Proc Natl Acad Sci USA 95(13):7457–7462

Tacar, O., Sriamornsak, P., & Dass, C. R. (2013). Doxorubicin: an update on anticancer molecular action, toxicity and novel drug delivery systems. Journal of pharmacy and pharmacology, 65(2), 157-170. Tan C, Tasaka H, Yu KP, Murphy ML, Kamofsky DA (1967) Daunomycin, an antitumor antibiotic, in the treatment of neoplastic disease. Clinical evaluation with special reference to childhood leukemia. Cancer 20(3):333–353

Tan, L. T. H., et al. (2015). Investigation of antioxidative and anticancer potentials of Streptomyces sp. MUM256 isolated from Malaysia mangrove soil. Frontiers in microbiology, 6, 1316.

Tee AR, Manning BD, Roux PP, Cantley LC, Blenis J (2003) Tuberous sclerosis complex gene products, tuberin and hamartin, control mTOR signaling by acting as a GTPase-activating protein complex toard Rheb. Curr Biol 13:1259–1268

Tewey KM, Rowe TC, Yang L, Halligan BD, Liu LF (1984) Adriamycin-induced DNA damage mediated by mammalian topoisomerase II. Science 226:466–468

Thaker MN, Waglechner N, Wright GD (2014) Antibiotic resistance-mediated isolation of scaffold- specific natural producers. Nat Protoc 9(6):1469–1479

Thomas, M. G., Chan, Y. A., & Ozanick, S. G. (2003). Deciphering tuberactinomycin biosynthesis: isolation, sequencing, and annotation of the viomycin biosynthetic gene cluster. Antimicrobial agents and chemotherapy, 47(9), 2823-2830.

Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids research, 22(22), 4673-4680.

Tokala,

154

Tokala, R.K., et al. (2002). Novel plant-microbe rhizosphere interaction involving Streptomyces lydicus WYEC108 and the pea plant (Pisum sativum). Applied and environmental microbiology, 68(5), 2161-2171. Tokuda, G., Watanabe, H., Matsumoto, T., & Noda, H. (1997). Cellulose digestion in the wood-eating higher termite, Nasutitermes takasagoensis (Shiraki): distribution of cellulases and properties of endo-β-1, 4-gIucanase. Zoological science, 14(1), 83-94.

Traxler MF, Kolter R. 2015. Natural products in soil microbe interactions and evolution. Natural Products Reports 32:956–970

Traxler MF, Seyedsayamdost MR, Clardy J, Kolter R. 2012. Interspecies modulation of bacterial development through iron competition and siderophore piracy. Molecular Microbiology 86:628– 644 Tremblay F, Brule S, Hee Um S, Li Y, Masuda K, Roden M, Sun XJ, Krebs M, Polakiewicz RD, Tomas G, Maretta A (2007) Identification of IRS-1 Ser-1101 as a target of S6K1 in nutrient- and obesity-induced insulin resistance. Proc Natl Acad Sci USA 104:14056–14061

Tyc O, Zweers H, de Boer W, Garbeva P. 2015. Volatiles in Inter-Specific bacterial interactions. Frontiers in Microbiology 6:1412

Um SH, Frigerio F, Watanabe M, Picard F, Joaquin M et al (2004) Absence of S6 K protects against age- and diet-induced obesity while enhancing insulin sensitivity. Nature 431:200–205

Van der Meij, A., Worsley, S. F., Hutchings, M. I., & van Wezel, G. P. (2017). Chemical ecology of antibiotic production by actinomycetes. FEMS microbiology reviews, 41(3), 392-416. van Hoogevest P, de Kruijff B (1978) Effect of amphotericin B on cholesterol-containing liposomes of egg phosphatidylcholine and didocosenoyl phosphatidylcholine. A refinement of the model for the formation of pores by amphotericin B in membranes. Biochim Biophys Acta 511(3):397–407

Vasudevan, D., & Ryoo, H. D. (2016). Detection of cell death in Drosophila tissues. In Programmed Cell Death (pp. 131-144). Humana Press, New York, NY.

Vertut-Croquin A, Bolard J, Chabbert M, Gary-Bobo C (1983) Differences in the interaction of the polyene antibiotic amphotericin B with the cholesterol- or ergosterol-containing phospholipid vesicles. A circular dichroism and permeability study. Biochemistry 22(12):2939–2944

Vézina C, Kudelski A, Sehgal SN (1975) Rapamycin (AY-22,989), a new antifungal antibiotic. I. Taxonomy of the producing streptomycete and isolation of the active principle. J Antibiot 28:721–726 Vij R, Wang M, Kaufman JL et al (2012) An open-label, single-arm, phase 2 (PX-171-004) study of single-agent carfilzomib in bortezomib-naive patients with relapsed and/or refractory multiple

155

myeloma. Blood 199(24):5661–5670

Vincent BM, Lancaster AK, Scherz-Shouval R, Whitesell L, Lindquist S (2013) Fitness trade-offs restict the evolution of resistance to amphotericin B. PLoS Biol 11(10):e1001692

Vlamakis, H., Chai, Y., Beauregard, P., Losick, R., & Kolter, R. (2013). Sticking together: building a biofilm the Bacillus subtilis way. Nature Reviews Microbiology, 11(3), 157.

Vurukonda, S. S. K. P., Giovanardi, D., & Stefani, E. (2018). Plant growth promoting and biocontrol activity of Streptomyces spp. as endophytes. International journal of molecular sciences, 19(4), 952. Wada A, Fukuda M, Mishima M, Nishida E (1998) Nuclear export of actin: a novel mechanism regulating the subcellular localization of a major cytoskeletal protein. EMBO J 17(6):1635–1641

Wang C, Wang Z, Qiao X, Li Z, Li F, Chen M, Wang Y, Huang Y, Cui H. 2013. Antifungal activity of volatile organic compounds from Streptomyces alboflavus TD-1. FEMS Microbiology Letters 341:45–51 Wang S, Lloyd RV, Hutzler MJ, Rosenwald IB, Safran MS, Patwardhan NA, Khan A (2001) Expression of eukaryotic translation initiation factors 4E and 2α correlates with the progression of thyroid carcinoma. Thyroid 11(12):110–117

Wang, H., Wang, X., Ke, Z. J., Comer, A. L., Xu, M., Frank, J. A., ... & Luo, J. (2015). Tunicamycin- induced unfolded protein response in the developing mouse brain. Toxicology and applied pharmacology, 283(3), 157-167.

Wang, S., Konorev, E. A., Kotamraju, S., Joseph, J., Kalivendi, S., & Kalyanaraman, B. (2004). Doxorubicin induces apoptosis in normal and tumor cells via distinctly different mechanisms intermediacy of H2O2-and p53-dependent pathways. Journal of Biological Chemistry, 279(24), 25535-25543. Wang, Z., Xu, Y., Shao, J., Wang, J., & Li, R. (2011). Genes associated with 2-methylisoborneol biosynthesis in cyanobacteria: isolation, characterization, and expression in response to light. PLoS One, 6(4), e18665.

Watanabe, K., Kanaoka, Y., Mizutani, S., Uchiyama, H., Yajima, S., Watada, M., ... & Hattori, Y. (2019). Interspecies Comparative Analyses Reveal Distinct Carbohydrate-Responsive Systems among Drosophila Species. Cell reports, 28(10), 2594-2607.

Wei D, Lei B, Tang M, Zhan CG (2012) Fundamental reaction pathway and free energy profile for inhibition of proteasome by epoxomicin. J Am Chem Soc 134(25):10436–10450

Welscher YM, Jones L, van Leeuwen MR, Dijksterhuis J, de Kruijff B, Eitzen G, Breukink E (2010) Natamycin inhibits vacuole fusion at the priming phase via a specific interaction with ergosterol.

156

Antimicrob Agents Chemother 54(6):2618–2625

Wheatley RE. 2002. The consequences of volatile organic compound mediated bacterial and fungal interactions. Antonie Van Leeuwenhoek 81:357–364

White TC, Marr KA, Bowden RA (1998) Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin Microbiol Rev 11(2):382–402

Wiederhold, N. P. (2017). Antifungal resistance: current trends and future strategies to combat. Infection and drug resistance, 10, 249.

Wilkins K, Scho ̈ller C. 2009. Volatile organic metabolites from selected streptomyces strains.Actinomycetologica23:27–33

Wingard JR, Kubilis P, Lee L, Yee G, White M, Walshe L, Bowden R, Anaissie E, Hiemenz J, Lister J (1999) Clinical significance of nephrotoxicity in patients treated with amphotericin B for suspected or proven aspergillosis. Clin Infect Dis 29(6):1402–1407

Wolff B, Sanglier JJ, Wang Y (1997) Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA. Chem Biol 4(2):139–147

Wolstenholme AJ (2012) Glutamate-gated chloride channels. J Biol Chem 287:40232–40238

Wong AS, Kim SO, Leung PC, Auersperg N, Pelech SL (2004) Profiling of protein kianses in the neoplastic transformation of human ovarian surface epithelium. Gynecol Oncol 82(2):305–311

Wright GD. (2017). WACDB Wright Actinomycete Collection. Retrieved from http://www.thewrightlab.com/wright-actinomycete-collection

Xia, X., et al. (2017). Metagenomic sequencing of diamondback moth gut microbiome unveils key holobiont adaptations for herbivory. Frontiers in microbiology, 8, 663.

Yamada, Y., Kuzuyama, T., Komatsu, M., Shin-ya, K., Omura, S., Cane, D. E., & Ikeda, H. (2015). Terpene synthases are widely distributed in bacteria. Proceedings of the National Academy of Sciences, 112(3), 857-862.

Yang J, Bardes ES, Moore JD, Brennan J, Powers MA, Kornbluth S (1998) Control of cyclin B1 localization through regulated binding of the nuclear export factor CRM1. Genes Dev 12(14):2131–2143 Yang YL, Ho YA, Cheng HH, Ho M, Lo HJ (2004) Susceptibilities of Candida species to amphotericin B and fluconazole: the emergence of fluconazole resistance in Candida tropicalis. Infect Control

157

Hosp Epidemiol 25(1):60–64

Yang, F., Kemp, C. J., & Henikoff, S. (2015). Anthracyclines induce double-strand DNA breaks at active gene promoters. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, 773, 9-15.

Yashiroda Y, Yoshida M (2003) Nucleo-cytoplasmic transport of proteins as a target of therapeutic drugs. Curr Med Chem 10:741–748

Yemini, E., Jucikas, T., Grundy, L. J., Brown, A. E., & Schafer, W. R. (2013). A database of Caenorhabditis elegans behavioral phenotypes. Nature methods, 10(9), 877.

Yeo EJ, Ryu JH, Cho YS, Chun YS, Huang LE, Kim MS, Park JW (2006) Amphotericin B blunts erythropoietin response to hypoxia by reinforcing FIH-mediated repression of HIF1. Blood 107(3):916–923 Yim, G., Wang, H. H., & Davies, J. (2006). The truth about antibiotics. International Journal of Medical Microbiology, 296(2-3), 163-170.

Yoon V, Nodwell JR (2014) Activating secondary metabolism with stress and chemicals. J Ind Microbiol Biotechnol 41(2):415–424

Zeman SM, Phillips DR, Crothers DM (1998) Characterization of covalent adriamycin-DNA adducts. Proc Natl Acad Sci USA 95(20):11561–11565

Zhu Y, Jameson E, Crosatti M, Schafer H, Rajakumar K, Bugg TDH, Chen Y. 2014. Carnitine metabolism to trimethylamine by an unusual Rieske-type oxygenase from human microbiota. PNAS 111:4268–4273

Zinzalla V, Stracka D, Oppliger W, Hall MN (2011) Activation of mTORC2 by association with the ribosome. Cell 144(5):757–768

Zotchev, S. B Marine actinomycetes as an emerging resource for the drug development pipelines. J. Biotechnol. 158, 168–175 (2012).

158

Explicit copyright permission was not required for reproduction of the following articles in this thesis:

Ho, L. K., & Nodwell, J. R. (2016). David and Goliath: chemical perturbation of eukaryotes by bacteria. Journal of industrial microbiology & biotechnology, 43(2-3), 233-248.

Ho, L., Daniel-Ivad M., Jeedigunta S., Li J., Iliadi, K.G., Boulianne, G.L., Hurd, T., Smibert, C.A. and Nodwell, J. (2019) Chemical entrapment and killing of insects by bacteria. Manuscript Submitted for Publication. Jones, S. E., Ho, L., Rees, C. A., Hill, J. E., Nodwell, J. R., & Elliot, M. A. (2017). Streptomyces exploration is triggered by fungal interactions and volatile signals. elife, 6, e21738.

159