DOCSLIB.ORG

( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2020/0299658 A1 Hekele Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2020/0299658 A1 Hekele Et Al US 20200299658A1 INI ( 19 ) United States ( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2020/0299658 A1 Hekele et al . ( 43 ) Pub . Date : Sep. 24 , 2020 ( 54 ) ENGINEERED NUCLEASES THAT TARGET C12N 5/071 ( 2006.01 ) HUMAN AND CANINE FACTOR VIII GENES C12N 15/113 ( 2006.01 ) AS A TREATMENT FOR HEMOPHILIA A A61K 48/00 ( 2006.01 ) ( 71 ) Applicant: Precision BioSciences , Inc. , Durham , A61K 9/127 ( 2006.01 ) NC (US ) ( 52 ) U.S. CI . CPC ( 72 ) Inventors : Armin Hekele , Cary, NC ( US ) ; C12N 9/22 ( 2013.01 ) ; C12N 15/86 Clayton Beard , Durham , NC ( US ) ; ( 2013.01 ) ; C12N 5/067 ( 2013.01 ) ; C12N Derek Jantz , Durham , NC (US ); James 570672 ( 2013.01 ) ; C12N 15/113 ( 2013.01 ) ; Jefferson Smith , Morrisville , NC ( US ) ; A61K 38/02 ( 2013.01 ) ; A61K 9/127 ( 2013.01 ) ; Victor Bartsevich , Durham , NC (US ) C12N 2750/14143 ( 2013.01 ) ; C12N 2310/20 ( 73 ) Assignee : Precision BioSciences , Inc. , Durham , ( 2017.05 ) ; CI2N 2800/80 ( 2013.01 ) ; A61K NC (US ) 48/005 ( 2013.01 ) ( 21 ) Appl. No .: 16 / 760,902 ( 57 ) ABSTRACT ( 22 ) PCT Filed : Nov. 1 , 2018 The present invention encompasses engineered nucleases which recognize and cleave a recognition sequence within ( 86 ) PCT No .: PCT / US2018 / 058692 the int22h - 1 sequence of a Factor VIII gene . The present $ 371 ( c ) ( 1 ), invention also encompasses methods of using such engi ( 2 ) Date : Apr. 30 , 2020 neered nucleases to make genetically -modified cells , and the use of such cells in a pharmaceutical composition and in Related U.S. Application Data methods for treating hemophilia A. Further, the invention ( 60 ) Provisional application No. 62 / 580,031 , filed on Nov. encompasses pharmaceutical compositions comprising 1 , 2017 . engineered nuclease proteins , nucleic acids encoding engi Publication Classification neered nucleases , or genetically -modified cells of the inven ( 51 ) Int . Ci . tion , and the use of such compositions for treating of CI2N 9/22 ( 2006.01 ) hemophilia A. C12N 15/86 ( 2006.01 ) Specification includes a Sequence Listing. Patent Application Publication Sep. 24 , 2020 Sheet 1 of 15 US 2020/0299658 A1 A. Telomeric HIR * H1F H2 / 3R H2 H3F ? + H2 / 3R F8 1-22 int22h - 1 CLIC2 int22h - 2 int22h - 3 H1R > + H3F H2E > + H2 / 3R H1F- + H2 / 3R F8 1-22 int22h - 1 int22h - 2 CLIC2 int22h - 3 B. Telomeric HIR ? H1F H2 / 3R - + H3F H2 + H2 / 3R F8 1-22 int22h - 1 CLIC2 int22h - 3 int22h - 2 HIR < H2F H3E- + H2 / 3R H1F - + H2 / 3R th F8 1-22 int22h - 1 int22h - 3 CLIC2 int22h - 2 FIGURE 1 Patent Application Publication Sep. 24 , 2020 Sheet 2 of 15 US 2020/0299658 A1 FXR 17 FOR 18 Half - Site Half - Site F8R 17-18 ( human ) CTCCCAGGAGTACITCTCCAGG SEQ ID NO : 9 Recognition Sequence GAGGGTCCTCATGAAGAGGTCC SEQ ID NO : 10 FOR 17 FXR 18 Half - Site Half - Site F8R 17-18 ( canine ) CTCCCAGGAGTACTTCTCCAGC SEQ ID NO : 11 Recognition Sequence GAGGGTCCTCATGAAGAGGTCG SEQ ID NO : 12 FIGURE 2 Patent Application Publication Sep. 24 , 2020 Sheet 3 of 15 US 2020/0299658 A1 First Subunit Second Subunit HVR1 Linker HVR2 Second Subunit First Subunit HVR2 Linker HVR1 FIGURE 3 Patent Application Publication Sep. 24 , 2020 Sheet 4 of 15 US 2020/0299658 A1 CH , Cº ? New CHQ - 23 /24 Target ( control) Sequence Target Sequence Determine percentage GFP * by How cytornetry Cleave Cleave New 23/24 Taiget Target Sequence Sequence FIGURE 4 Patent Application Publication Sep. 24 , 2020 Sheet 5 of 15 US 2020/0299658 A1 A. 18 % 16 % 14 % -------- .-- - . %GFP 9 % ................. ...... HumanF8R17-18RecognitionSequence 4 % ................ ....... 2 % ------ 0 % 1 FOR17-18bs CH013-24 FOR17-18x.1 F8R17-18x.2 F8R17-18x.79 F8R17-18x.88 B. 18 % 16 % %GFP 9 % CanineF8R17-18RecognitionSequence 4 % 2 % FOR17-18%.1 F&R17-18bs CH023-24 FSR17-18x.2 F&R17-18x.79 FØR17-18.88 FIGURE 5 Patent Application Publication Sep. 24 , 2020 Sheet 6 of 15 US 2020/0299658 A1 A. 14 % 12 % 10 % 8 % %GFP 9 % HumanF8R17-18RecognitionSequence 4 % 2 % 0 % F8R17-18bs CHO23-24 17-18x.1F8R FOR17-1811.35 B. 14 % 12 % 10 % 8 % %GFP 6 % CanineF8R17-18RecognitionSequence 4 % 2 % 0 % F8R17-18bs CH013-24 FOR17-18x.1 FSR17-18L1.35 FIGURE 6 Patent Application Publication Sep. 24 , 2020 Sheet 7 of 15 US 2020/0299658 A1 A. 14 % 12 % 10 % 8 % %GFP 9 % HumanF8R17-18RecognitionSequence 4 % 2 % 0 % F8R17-18bs CHO23-24 FSR17-18.88 FOR17-1812.23 B. 16 % 14 % 12 % 10 % GFP% 8 % 6 % CanineF8R17-18RecognitionSequence 4 % 2 % 0 % F8R17-18bs ESCH013-24 F8R17-18.88 F8R17-18L2.23 FIGURE 7 Patent Application Publication Sep. 24 , 2020 Sheet 8 of 15 US 2020/0299658 A1 A. 80 OL 60 50 40 %GFP 30 HumanF8R17-18RecognitionSequence 20 10 0 1 mock FOR17-18x:1 F8R17-18x.2 F8R17-18x,79 F8R17-18.88 CH023-24 B. 09 OS 40 %GFP 30 CanineF8R17-18RecognitionSequence 20 10 MSI mock2 F8R17-18x.1 F8R17-18x.2 FOR17-18x,79 F8R17-18x.88 CHO23-24 FIGURE 8 Patent Application Publication Sep. 24 , 2020 Sheet 9 of 15 US 2020/0299658 A1 1.8 1.6 1.4 1.2 1 O FSR 17-18h 0.8 RelativeActivityIndex N FOR 17-18C 0.6 1 Off - Target 0.4 0.2 0 Mock CH023-34 FSR17-18L1.35 17-18L.553FSR FBR17-181.615 17-181.626FSR FIGURE 9 Patent Application Publication Sep. 24 , 2020 Sheet 10 of 15 US 2020/0299658 A1 A. 1 2 3 4 5 6 7 8 9 H3D / H1D JI B. H1U / H1D FIGURE 10 Patent Application Publication Sep. 24 , 2020 Sheet 11 of 15 US 2020/0299658 A1 A. 1 2 3 4 5 6 7 8 9 10 11 12 H1U / H1D B. HU H3D / H1D FIGURE 11 Patent Application Publication Sep. 24 , 2020 Sheet 12 of 15 US 2020/0299658 A1 A. 1 2 3 4 5 6 [00.0 2000 U1 / D1 QUOR 2 230xd SOK -7011 9000 100.9 DI 90 B. 2009 SUO 03/01 . zare: -7000 00 02 FIGURE 12 Patent Application Publication Sep. 24 , 2020 Sheet 13 of 15 US 2020/0299658 A1 A. 1 2 3 4 5 $ 900 U1 / D1 impose MOO NON 100 $ B. U3 / U1 093 FIGURE 13 Patent Application Publication Sep. 24 , 2020 Sheet 14 of 15 US 2020/0299658 A1 112 105 16 84 70 63 infusionAAVafterdays FIGURE14 49 42 normalhigh 35 28 normallow 21 14 lyre.FOR OL 60 50 30 20 0 ] min [ time clotting Patent Application Publication Sep. 24 , 2020 Sheet 15 of 15 US 2020/0299658 A1 Day 0 Day 117 FIGURE 15 US 2020/0299658 A1 Sep. 24 , 2020 1 ENGINEERED NUCLEASES THAT TARGET intron 22 of the Factor VIII gene . This inversion arises when HUMAN AND CANINE FACTOR VIII GENES an ~ 9.5 kb segment of intron 22 , referred to as int22h - 1, AS A TREATMENT FOR HEMOPHILIA A recombines with one of two repeat copies ( referred to as int22h - 2 and int22h - 3, respectively ) which are positioned FIELD OF THE INVENTION approximately 400 kb and 500 kb telomeric to the Factor [ 0001 ] The invention relates to the field of molecular VIII gene on the X chromosome. Following recombination , biology and recombinant nucleic acid technology. In par exons 1-22 of the Factor VIII gene become inverted in the ticular, the invention relates to engineered nucleases having genome relative to exons 23-26 , resulting in the expression specificity for a recognition sequence within intron 22 of a of a truncated , inactive Factor VIII protein that lacks the Factor VIII gene, and particularly within the int22h - 1 amino acids encoded by exons 23-26 ( Sauna et al . ( 2015 ) sequence . Such engineered nucleases are useful in methods Blood 125 ( 2 ) : 223-228 ) . for treating hemophilia A characterized by an inversion of ( 0007 ] The upstream repeat copy involved in exon 1-22 inversion is oriented in the opposite direction as int22h - 1 . exons 1-22 in the Factor VIII gene . Early studies suggested that int22h - 2 and int22h - 3 were both REFERENCE TO A SEQUENCE LISTING in reverse orientation relative to int22h - 1, allowing for SUBMITTED AS A TEXT FILE VIA EFS - WEB recombination to occur with either repeat sequence . This was referred to as Type I inversion and Type II inversion . [ 0002 ] The instant application contains a Sequence Listing However, more recent evidence indicates that int22h - 2 and which has been submitted in ASCII format via EFS - Web and int22h - 3 are found in an inverse orientation to one another is hereby incorporated by reference in its entirety. Said on the X chromosome, and are part of an imperfect palin ASCII copy , created on Oct. 31 , 2018 , is named drome ( FIG . 1 ) . Recombination of sequences within this P109070027W000 -SEQ -MJT , and is 90,208 bytes in size . palindrome allows int22h - 2 and in22h - 3 to swap places in the genome and , consequently, change their orientation BACKGROUND OF THE INVENTION relative to int22h - 1 . As a result, the int22h - 1 sequence can , [ 0003 ] Hemophilia A is a common genetic bleeding dis in different circumstances , recombine with the int22h - 2 order with an incidence of 1 in 5000 males worldwide. This repeat or the int22h - 3 repeat , depending on which is in the genetic disease can result from various mutations within the opposite orientation to int22h - 1 ( Bagnall et al . ( 2006 ) Jour coagulation Factor VIII ( F8 ) gene located on the X chro nal of Thrombosis and Haemostasis 4 : 591-598 ) . mosome , which include large deletions, insertions, inver [ 0008 ] Of note , intron 22 of the Factor VIII gene contains sions , and point mutations. Clinically, hemophilia A can be a CpG island that acts as a bi - directional promoter for two classified based on relative Factor VIII activity in the further genes , referred to as F8A1 ( Factor VIII - associated 1 ) patient's plasma as mild ( 5-30 % activity ; 50 % of patients ), and F8B .
Load more

Recommended publications
  • F8A2 Antibody (N-Term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap11393a
    苏州工业园区双圩路9号1幢 邮 编 ： 215000 电 话 ： 0512-88856768 F8A2 Antibody (N-term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP11393a Specification F8A2 Antibody (N-term) - Product info Application WB Primary Accession P23610 Other Accession NP_001007525.1, NP_001007524.1, NP_036283.2 Reactivity Human Host Rabbit Clonality Polyclonal Isotype Rabbit IgG Clone Names RB29381 F8A2 Antibody (N-term) - Additional info Gene ID 474383;474384;8263 F8A2 Antibody (N-term) (Cat. Other Names #AP11393a) western blot analysis in CEM Factor VIII intron 22 protein, CpG island protein, F8A1, F8A cell line lysates (35ug/lane).This demonstrates the F8A2 antibody Target/Specificity detected the F8A2 protein (arrow). This F8A2 antibody is generated from rabbits immunized with a KLH conjugated synthetic peptide between 12-40 amino acids from the N-terminal region of human F8A2. Dilution WB~~1:1000 Format Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C in small aliquots to prevent freeze-thaw cycles. Precautions F8A2 Antibody (N-term) is for research use only and not for use in diagnostic or therapeutic procedures. F8A2 Antibody (N-term) - Protein Information Name F8A1 Function RAB5A effector molecule that is involved in vesicular trafficking of early endosomes (PubMed:<a href="http://www.uniprot.org/citations/16476778" target="_blank">16476778</a>). Mediates the recruitment of HTT by RAB5A onto early endosomes. The HTT- F8A1/F8A2/F8A3-RAB5A complex stimulates early endosomal interaction with actin filaments and inhibits interaction with microtubules, leading to the reduction of endosome motility (PubMed:<a href="http://www.uniprot.org/citations/16476778" target="_blank">16476778</a>).
    [Show full text]
  • Downloaded from [266]
    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
    [Show full text]
  • Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
    LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research.
    [Show full text]
  • WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Differential Expression of COVID-19-Related Genes in European Americans and African Americans
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.09.143271; this version posted June 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Differential expression of COVID-19-related genes in European Americans and African Americans Urminder Singh1 and Eve Syrkin Wurtele1,* 1Bioinformatics and Computational Biology Program, Center for Metabolic Biology, and Department of Genetics Development and Cell Biology, Iowa State University, Ames, IA, 50011, USA *[email protected] ABSTRACT The Coronavirus disease 2019 (COVID-19) pandemic has affected African American populations disproportionately in regards to both morbidity and mortality. A multitude of factors likely account for this discrepancy. Gene expression represents the interaction of genetics and environment. To elucidate whether levels of expression of genes implicated in COVID-19 vary in African Americans as compared to European Americans, we re-mine The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) RNA-Seq data. Multiple genes integral to infection, inflammation and immunity are differentially regulated across the two populations. Most notably, F8A2 and F8A3, which encode the HAP40 protein that mediates early endosome movement in Huntington’s Disease, are more highly expressed by up to 24-fold in African Americans. Such differences in gene expression can establish prognostic signatures and have critical implications for precision treatment of diseases such as COVID-19. We advocate routine inclusion of information such as postal code, education level, and profession (as a proxies for socioeconomic condition) and race in the metadata about each individual sampled for sequencing studies.
    [Show full text]
  • Insight Into the Function of X-Linked Lymphocyte Regulated 3 (XLR3)
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 7-16-2015 Insight into the Function of X-linked Lymphocyte Regulated 3 (XLR3) and the Mechanism Regulating its Imprinted Expression Robert James Foley University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Foley, Robert James, "Insight into the Function of X-linked Lymphocyte Regulated 3 (XLR3) and the Mechanism Regulating its Imprinted Expression" (2015). Doctoral Dissertations. 845. https://opencommons.uconn.edu/dissertations/845 Insight into the Function of X‐linked Lymphocyte Regulated 3 (XLR3) and the Mechanism Regulating its Imprinted Expression Robert J. Foley University of Connecticut 2015 The Synaptonemal Complex Protein 3 (SYCP3), a key component of the synaptonemal complex in mammalian meiosis, has many closely related X‐linked homologs on the X chromosome of which the functions are unclear. In rodentia, these genes comprise the Xlr superfamily of proteins and studies elucidating spatial and temporal profiles of these homologs reveal primarily testis specific function. The following study provides evidence for murine testis and ovary function of a newly discovered Xlr superfamily protein, X‐linked Lymphocyte Regulated 3 (XLR3). In addition to showing the immunolocalization of the XLR3 protein at the condensed X and Y chromosomes throughout Meiotic Sex Chromosome Inactivation (MSCI), preliminary experiments behind the mechanism controlling expression of the imprinted Xlr3b/4b/4c copies reveals a differentially methylated region (DMR) in the adjacent single copy Factor 8 associated gene A (F8a) consistent with differential binding of the master regulator of chromatin conformation factor CTCF.
    [Show full text]
  • Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham a Thesis Submitted in Conformity
    Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto © Copyright by Edward James Higginbotham 2020 i Abstract Characterizing Genomic Duplication in Autism Spectrum Disorder Edward James Higginbotham Master of Science Graduate Department of Molecular Genetics University of Toronto 2020 Duplication, the gain of additional copies of genomic material relative to its ancestral diploid state is yet to achieve full appreciation for its role in human traits and disease. Challenges include accurately genotyping, annotating, and characterizing the properties of duplications, and resolving duplication mechanisms. Whole genome sequencing, in principle, should enable accurate detection of duplications in a single experiment. This thesis makes use of the technology to catalogue disease relevant duplications in the genomes of 2,739 individuals with Autism Spectrum Disorder (ASD) who enrolled in the Autism Speaks MSSNG Project. Fine-mapping the breakpoint junctions of 259 ASD-relevant duplications identified 34 (13.1%) variants with complex genomic structures as well as tandem (193/259, 74.5%) and NAHR- mediated (6/259, 2.3%) duplications. As whole genome sequencing-based studies expand in scale and reach, a continued focus on generating high-quality, standardized duplication data will be prerequisite to addressing their associated biological mechanisms. ii Acknowledgements I thank Dr. Stephen Scherer for his leadership par excellence, his generosity, and for giving me a chance. I am grateful for his investment and the opportunities afforded me, from which I have learned and benefited. I would next thank Drs.
    [Show full text]
  • 1 SUPPLEMENTAL DATA Figure S1. Poly I:C Induces IFN-Β Expression
    SUPPLEMENTAL DATA Figure S1. Poly I:C induces IFN-β expression and signaling. Fibroblasts were incubated in media with or without Poly I:C for 24 h. RNA was isolated and processed for microarray analysis. Genes showing >2-fold up- or down-regulation compared to control fibroblasts were analyzed using Ingenuity Pathway Analysis Software (Red color, up-regulation; Green color, down-regulation). The transcripts with known gene identifiers (HUGO gene symbols) were entered into the Ingenuity Pathways Knowledge Base IPA 4.0. Each gene identifier mapped in the Ingenuity Pathways Knowledge Base was termed as a focus gene, which was overlaid into a global molecular network established from the information in the Ingenuity Pathways Knowledge Base. Each network contained a maximum of 35 focus genes. 1 Figure S2. The overlap of genes regulated by Poly I:C and by IFN. Bioinformatics analysis was conducted to generate a list of 2003 genes showing >2 fold up or down- regulation in fibroblasts treated with Poly I:C for 24 h. The overlap of this gene set with the 117 skin gene IFN Core Signature comprised of datasets of skin cells stimulated by IFN (Wong et al, 2012) was generated using Microsoft Excel. 2 Symbol Description polyIC 24h IFN 24h CXCL10 chemokine (C-X-C motif) ligand 10 129 7.14 CCL5 chemokine (C-C motif) ligand 5 118 1.12 CCL5 chemokine (C-C motif) ligand 5 115 1.01 OASL 2'-5'-oligoadenylate synthetase-like 83.3 9.52 CCL8 chemokine (C-C motif) ligand 8 78.5 3.25 IDO1 indoleamine 2,3-dioxygenase 1 76.3 3.5 IFI27 interferon, alpha-inducible
    [Show full text]
  • African Americans and European Americans Exhibit Distinct Gene
    www.nature.com/scientificreports OPEN African Americans and European Americans exhibit distinct gene expression patterns across tissues and tumors associated with immunologic functions and environmental exposures Urminder Singh1,2,3, Kyle M. Hernandez4,5, Bruce J. Aronow6 & Eve Syrkin Wurtele1,2,3* The COVID-19 pandemic has afected African American populations disproportionately with respect to prevalence, and mortality. Expression profles represent snapshots of combined genetic, socio- environmental (including socioeconomic and environmental factors), and physiological efects on the molecular phenotype. As such, they have potential to improve biological understanding of diferences among populations, and provide therapeutic biomarkers and environmental mitigation strategies. Here, we undertook a large-scale assessment of patterns of gene expression between African Americans and European Americans, mining RNA-Seq data from 25 non-diseased and diseased (tumor) tissue-types. We observed the widespread enrichment of pathways implicated in COVID-19 and integral to infammation and reactive oxygen stress. Chemokine CCL3L3 expression is up-regulated in African Americans. GSTM1, encoding a glutathione S-transferase that metabolizes reactive oxygen species and xenobiotics, is upregulated. The little-studied F8A2 gene is up to 40-fold more highly expressed in African Americans; F8A2 encodes HAP40 protein, which mediates endosome movement, potentially altering the cellular response to SARS-CoV-2. African American expression signatures, superimposed on single cell-RNA reference data, reveal increased number or activity of esophageal glandular cells and lung ACE2-positive basal keratinocytes. Our fndings establish basal prognostic signatures that can be used to refne approaches to minimize risk of severe infection and improve precision treatment of COVID-19 for African Americans.
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • African Americans and European Americans Exhibit Distinct Gene Expression Patterns Across Tissues and Tumors That Are Associated
    African Americans and European Americans exhibit distinct gene expression patterns across tissues and tumors that are associated with immunologic and infectious functions and environmental exposures Urminder Singh Iowa State University Kyle Hernandez University of Chicago Bruce Aronow Cincinnati Children's Hospital Medical Center https://orcid.org/0000-0001-5109-6514 Eve Wurtele ( [email protected] ) Iowa State University Research Article Keywords: COVID-19, African American populations, gene expression proles, European Americans Posted Date: October 8th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-88890/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Scientic Reports on May 21st, 2021. See the published version at https://doi.org/10.1038/s41598-021-89224-1. African Americans and European Americans exhibit distinct gene expression patterns across tissues and tumors that are associated with immunologic and infectious functions and environmental exposures Urminder Singh1,2,3, Kyle M. Hernandez4,5, Bruce J. Aronow6, and Eve Syrkin Wurtele1,2,3* 1Bioinformatics and Computational Biology Program, Iowa State University, Ames, IA, 50011, USA 2Center for Metabolic Biology, Iowa State University, Ames, IA, 50011, USA 3Genetics Development and Cell Biology, Iowa State University, Ames, IA, 50011, USA 4Department of Medicine, University of Chicago, Chicago, IL, 60637 5Center for Translational Data Science, University of Chicago, Chicago, IL, 60637 6Biomedical Informatics, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH 45229 *[email protected] ABSTRACT The COVID-19 pandemic has affected African American populations disproportionately with respect to prevalence, morbidity, and mortality.
    [Show full text]
  • Nested Genes in the Human Genome
    Genomics 86 (2005) 414 – 422 http://www.paper.edu.cn Nested genes in the human genome Peng Yua,b,c,*, Dalong Maa,b, Mingxu Xua,b,. aLaboratory of Medical Immunology, School of Basic Medical Sciences, Peking University, Beijing 100083, People’s Republic of China bCenter for Human Disease Genomics, Peking University, Beijing 100083, People’s Republic of China cCenter for Bioinformatics, Peking University, Beijing 100083, People’s Republic of China Received 29 March 2005; accepted 15 June 2005 Available online 3 August 2005 Abstract Here we studied one special type of gene, i.e., the nested gene, in the human genome. We collected 373 reliably annotated nested genes. Two-thirds of them were on the strand opposite that of their host gene. About 58% coding nested gene pairs were conserved in mouse and some were even maintained in chicken and fish, while nested pseudogenes were poorly conserved. Ka/Ks analysis revealed that nested genes were under strong selection, although they did not demonstrate greater conservation than other genes. With microarray data we observed that two partners of one nested pair seemed to be expressed reciprocally. A significant proportion of nested genes were tissue-specifically expressed. Gene ontology analysis demonstrated that quite a number of nested genes participated in cellular signal transduction. Based on these observations, we think that nested genes are a group of genes with important physiological functions. D 2005 Elsevier Inc. All rights reserved. Keywords: Nested gene; Gene-within-a-gene; Overlapping gene; Evolution; Comparative analysis; Inverse expression Nested gene, or gene-within-a-gene, refers to a gene that In addition to coding genes, pseudogenes and snoRNA is contained in another gene.
    [Show full text]