US 20200299658A1 INI ( 19 ) United States ( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2020/0299658 A1 Hekele et al . ( 43 ) Pub . Date : Sep. 24 , 2020 ( 54 ) ENGINEERED NUCLEASES THAT TARGET C12N 5/071 ( 2006.01 ) HUMAN AND CANINE FACTOR VIII GENES C12N 15/113 ( 2006.01 ) AS A TREATMENT FOR HEMOPHILIA A A61K 48/00 ( 2006.01 ) ( 71 ) Applicant: Precision BioSciences , Inc. , Durham , A61K 9/127 ( 2006.01 ) NC (US ) ( 52 ) U.S. CI . CPC ( 72 ) Inventors : Armin Hekele , Cary, NC ( US ) ; C12N 9/22 ( 2013.01 ) ; C12N 15/86 Clayton Beard , Durham , NC ( US ) ; ( 2013.01 ) ; C12N 5/067 ( 2013.01 ) ; C12N Derek Jantz , Durham , NC (US ); James 570672 ( 2013.01 ) ; C12N 15/113 ( 2013.01 ) ; Jefferson Smith , Morrisville , NC ( US ) ; A61K 38/02 ( 2013.01 ) ; A61K 9/127 ( 2013.01 ) ; Victor Bartsevich , Durham , NC (US ) C12N 2750/14143 ( 2013.01 ) ; C12N 2310/20 ( 73 ) Assignee : Precision BioSciences , Inc. , Durham , ( 2017.05 ) ; CI2N 2800/80 ( 2013.01 ) ; A61K NC (US ) 48/005 ( 2013.01 ) ( 21 ) Appl. No .: 16 / 760,902 ( 57 ) ABSTRACT ( 22 ) PCT Filed : Nov. 1 , 2018 The present invention encompasses engineered nucleases which recognize and cleave a recognition sequence within ( 86 ) PCT No .: PCT / US2018 / 058692 the int22h - 1 sequence of a Factor VIII gene . The present $ 371 ( c ) ( 1 ), invention also encompasses methods of using such engi ( 2 ) Date : Apr. 30 , 2020 neered nucleases to make genetically -modified cells , and the use of such cells in a pharmaceutical composition and in Related U.S. Application Data methods for treating hemophilia A. Further, the invention ( 60 ) Provisional application No. 62 / 580,031 , filed on Nov. encompasses pharmaceutical compositions comprising 1 , 2017 . engineered nuclease proteins , nucleic acids encoding engi Publication Classification neered nucleases , or genetically -modified cells of the inven ( 51 ) Int . Ci . tion , and the use of such compositions for treating of CI2N 9/22 ( 2006.01 ) hemophilia A. C12N 15/86 ( 2006.01 ) Specification includes a Sequence Listing. Patent Application Publication Sep. 24 , 2020 Sheet 1 of 15 US 2020/0299658 A1 A. Telomeric HIR * H1F H2 / 3R H2 H3F ? + H2 / 3R F8 1-22 int22h - 1 CLIC2 int22h - 2 int22h - 3 H1R > + H3F H2E > + H2 / 3R H1F- + H2 / 3R F8 1-22 int22h - 1 int22h - 2 CLIC2 int22h - 3 B. Telomeric HIR ? H1F H2 / 3R - + H3F H2 + H2 / 3R F8 1-22 int22h - 1 CLIC2 int22h - 3 int22h - 2 HIR < H2F H3E- + H2 / 3R H1F - + H2 / 3R th F8 1-22 int22h - 1 int22h - 3 CLIC2 int22h - 2 FIGURE 1 Patent Application Publication Sep. 24 , 2020 Sheet 2 of 15 US 2020/0299658 A1 FXR 17 FOR 18 Half - Site Half - Site F8R 17-18 ( human ) CTCCCAGGAGTACITCTCCAGG SEQ ID NO : 9 Recognition Sequence GAGGGTCCTCATGAAGAGGTCC SEQ ID NO : 10 FOR 17 FXR 18 Half - Site Half - Site F8R 17-18 ( canine ) CTCCCAGGAGTACTTCTCCAGC SEQ ID NO : 11 Recognition Sequence GAGGGTCCTCATGAAGAGGTCG SEQ ID NO : 12 FIGURE 2 Patent Application Publication Sep. 24 , 2020 Sheet 3 of 15 US 2020/0299658 A1 First Subunit Second Subunit HVR1 Linker HVR2 Second Subunit First Subunit HVR2 Linker HVR1 FIGURE 3 Patent Application Publication Sep. 24 , 2020 Sheet 4 of 15 US 2020/0299658 A1 CH , Cº ? New CHQ - 23 /24 Target ( control) Sequence Target Sequence Determine percentage GFP * by How cytornetry Cleave Cleave New 23/24 Taiget Target Sequence Sequence FIGURE 4 Patent Application Publication Sep. 24 , 2020 Sheet 5 of 15 US 2020/0299658 A1 A. 18 % 16 % 14 % -------- .-- - . %GFP 9 % ................. ...... HumanF8R17-18RecognitionSequence 4 % ................ ....... 2 % ------ 0 % 1 FOR17-18bs CH013-24 FOR17-18x.1 F8R17-18x.2 F8R17-18x.79 F8R17-18x.88 B. 18 % 16 % %GFP 9 % CanineF8R17-18RecognitionSequence 4 % 2 % FOR17-18%.1 F&R17-18bs CH023-24 FSR17-18x.2 F&R17-18x.79 FØR17-18.88 FIGURE 5 Patent Application Publication Sep. 24 , 2020 Sheet 6 of 15 US 2020/0299658 A1 A. 14 % 12 % 10 % 8 % %GFP 9 % HumanF8R17-18RecognitionSequence 4 % 2 % 0 % F8R17-18bs CHO23-24 17-18x.1F8R FOR17-1811.35 B. 14 % 12 % 10 % 8 % %GFP 6 % CanineF8R17-18RecognitionSequence 4 % 2 % 0 % F8R17-18bs CH013-24 FOR17-18x.1 FSR17-18L1.35 FIGURE 6 Patent Application Publication Sep. 24 , 2020 Sheet 7 of 15 US 2020/0299658 A1 A. 14 % 12 % 10 % 8 % %GFP 9 % HumanF8R17-18RecognitionSequence 4 % 2 % 0 % F8R17-18bs CHO23-24 FSR17-18.88 FOR17-1812.23 B. 16 % 14 % 12 % 10 % GFP% 8 % 6 % CanineF8R17-18RecognitionSequence 4 % 2 % 0 % F8R17-18bs ESCH013-24 F8R17-18.88 F8R17-18L2.23 FIGURE 7 Patent Application Publication Sep. 24 , 2020 Sheet 8 of 15 US 2020/0299658 A1 A. 80 OL 60 50 40 %GFP 30 HumanF8R17-18RecognitionSequence 20 10 0 1 mock FOR17-18x:1 F8R17-18x.2 F8R17-18x,79 F8R17-18.88 CH023-24 B. 09 OS 40 %GFP 30 CanineF8R17-18RecognitionSequence 20 10 MSI mock2 F8R17-18x.1 F8R17-18x.2 FOR17-18x,79 F8R17-18x.88 CHO23-24 FIGURE 8 Patent Application Publication Sep. 24 , 2020 Sheet 9 of 15 US 2020/0299658 A1 1.8 1.6 1.4 1.2 1 O FSR 17-18h 0.8 RelativeActivityIndex N FOR 17-18C 0.6 1 Off - Target 0.4 0.2 0 Mock CH023-34 FSR17-18L1.35 17-18L.553FSR FBR17-181.615 17-181.626FSR FIGURE 9 Patent Application Publication Sep. 24 , 2020 Sheet 10 of 15 US 2020/0299658 A1 A. 1 2 3 4 5 6 7 8 9 H3D / H1D JI B. H1U / H1D FIGURE 10 Patent Application Publication Sep. 24 , 2020 Sheet 11 of 15 US 2020/0299658 A1 A. 1 2 3 4 5 6 7 8 9 10 11 12 H1U / H1D B. HU H3D / H1D FIGURE 11 Patent Application Publication Sep. 24 , 2020 Sheet 12 of 15 US 2020/0299658 A1 A. 1 2 3 4 5 6 [00.0 2000 U1 / D1 QUOR 2 230xd SOK -7011 9000 100.9 DI 90 B. 2009 SUO 03/01 . zare: -7000 00 02 FIGURE 12 Patent Application Publication Sep. 24 , 2020 Sheet 13 of 15 US 2020/0299658 A1 A. 1 2 3 4 5 $ 900 U1 / D1 impose MOO NON 100 $ B. U3 / U1 093 FIGURE 13 Patent Application Publication Sep. 24 , 2020 Sheet 14 of 15 US 2020/0299658 A1 112 105 16 84 70 63 infusionAAVafterdays FIGURE14 49 42 normalhigh 35 28 normallow 21 14 lyre.FOR OL 60 50 30 20 0 ] min [ time clotting Patent Application Publication Sep. 24 , 2020 Sheet 15 of 15 US 2020/0299658 A1 Day 0 Day 117 FIGURE 15 US 2020/0299658 A1 Sep. 24 , 2020 1 ENGINEERED NUCLEASES THAT TARGET intron 22 of the Factor VIII gene . This inversion arises when HUMAN AND CANINE FACTOR VIII GENES an ~ 9.5 kb segment of intron 22 , referred to as int22h - 1, AS A TREATMENT FOR HEMOPHILIA A recombines with one of two repeat copies ( referred to as int22h - 2 and int22h - 3, respectively ) which are positioned FIELD OF THE INVENTION approximately 400 kb and 500 kb telomeric to the Factor [ 0001 ] The invention relates to the field of molecular VIII gene on the X chromosome. Following recombination , biology and recombinant nucleic acid technology. In par exons 1-22 of the Factor VIII gene become inverted in the ticular, the invention relates to engineered nucleases having genome relative to exons 23-26 , resulting in the expression specificity for a recognition sequence within intron 22 of a of a truncated , inactive Factor VIII protein that lacks the Factor VIII gene, and particularly within the int22h - 1 amino acids encoded by exons 23-26 ( Sauna et al . ( 2015 ) sequence . Such engineered nucleases are useful in methods Blood 125 ( 2 ) : 223-228 ) . for treating hemophilia A characterized by an inversion of ( 0007 ] The upstream repeat copy involved in exon 1-22 inversion is oriented in the opposite direction as int22h - 1 . exons 1-22 in the Factor VIII gene . Early studies suggested that int22h - 2 and int22h - 3 were both REFERENCE TO A SEQUENCE LISTING in reverse orientation relative to int22h - 1, allowing for SUBMITTED AS A TEXT FILE VIA EFS - WEB recombination to occur with either repeat sequence . This was referred to as Type I inversion and Type II inversion . [ 0002 ] The instant application contains a Sequence Listing However, more recent evidence indicates that int22h - 2 and which has been submitted in ASCII format via EFS - Web and int22h - 3 are found in an inverse orientation to one another is hereby incorporated by reference in its entirety. Said on the X chromosome, and are part of an imperfect palin ASCII copy , created on Oct. 31 , 2018 , is named drome ( FIG . 1 ) . Recombination of sequences within this P109070027W000 -SEQ -MJT , and is 90,208 bytes in size . palindrome allows int22h - 2 and in22h - 3 to swap places in the genome and , consequently, change their orientation BACKGROUND OF THE INVENTION relative to int22h - 1 . As a result, the int22h - 1 sequence can , [ 0003 ] Hemophilia A is a common genetic bleeding dis in different circumstances , recombine with the int22h - 2 order with an incidence of 1 in 5000 males worldwide. This repeat or the int22h - 3 repeat , depending on which is in the genetic disease can result from various mutations within the opposite orientation to int22h - 1 ( Bagnall et al . ( 2006 ) Jour coagulation Factor VIII ( F8 ) gene located on the X chro nal of Thrombosis and Haemostasis 4 : 591-598 ) . mosome , which include large deletions, insertions, inver [ 0008 ] Of note , intron 22 of the Factor VIII gene contains sions , and point mutations. Clinically, hemophilia A can be a CpG island that acts as a bi - directional promoter for two classified based on relative Factor VIII activity in the further genes , referred to as F8A1 ( Factor VIII - associated 1 ) patient's plasma as mild ( 5-30 % activity ; 50 % of patients ), and F8B .