PURB (1-312, His-Tag) Human Protein – AR51506PU-N | Origene

Total Page：16

File Type：pdf, Size：1020Kb

PURB (1-312, His-Tag) Human Protein – AR51506PU-N | Origene

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AR51506PU-N PURB (1-312, His-tag) Human Protein Product data: Product Type: Recombinant Proteins Description: PURB (1-312, His-tag) human recombinant protein, 0.5 mg Species: Human Expression Host: E. coli Tag: His-tag Predicted MW: 35.6 kDa Concentration: lot specific Purity: >95% by SDS - PAGE Buffer: Presentation State: Purified State: Liquid purified protein Buffer System: 20 mM Tris-HCl buffer (pH 8.0) containing 0.15M NaCl, 20% glycerol, 1mM DTT Preparation: Liquid purified protein Protein Description: Recombinant human PURB protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. Storage: Store undiluted at 2-8°C for one week or (in aliquots) at -20°C to -80°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. RefSeq: NP_150093 Locus ID: 5814 UniProt ID: Q96QR8 Cytogenetics: 7p13 Synonyms: PURBETA Summary: This gene product is a sequence-specific, single-stranded DNA-binding protein. It binds preferentially to the single strand of the purine-rich element termed PUR, which is present at origins of replication and in gene flanking regions in a variety of eukaryotes from yeasts through humans. Thus, it is implicated in the control of both DNA replication and transcription. Deletion of this gene has been associated with myelodysplastic syndrome and acute myelogenous leukemia. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 PURB (1-312, His-tag) Human Protein – AR51506PU-N Product images: This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

Copy Link

Recommended publications

Genes of the Escherichia Coli Pur Regulon Are Negatively Controlled
JOURNAL OF BACTERIOLOGY, Aug. 1990, p. 4555-4562 Vol. 172, No. 8 0021-9193/90/084555-08$02.00/0 Copyright © 1990, American Society for Microbiology Genes of the Escherichia coli pur Regulon Are Negatively Controlled by a Repressor-Operator Interactiont BIN HE,' ALLAN SHIAU,' KANG YELL CHOI,' HOWARD ZALKIN,1* AND JOHN M. SMITH2 Department ofBiochemistry, Purdue University, West Lafayette, Indiana 47907,' and Seattle Biomedical Research Institute, Seattle, Washington 981092 Received 1 March 1990/Accepted 22 May 1990 Fusions of lacZ were constructed to genes in each of the loci involved in de novo synthesis of IMP. The expression of each pur-lacZ fusion was determined in isogenic purR and purR+ strains. These measurements indicated 5- to 17-fold coregulation of genes purF, purHD, purC, purMN, purL, and purEK and thus confirm the existence of a pur regulon. Gene purB, which encodes an enzyme involved in synthesis of IMP and in the AMP branch of the pathway, was not regulated by purR. Each locus of the pur regulon contains a 16-base-pair conserved operator sequence that overlaps with the promoter. The purR product, purine repressor, was shown to bind specifically to each operator. Thus, binding of repressor to each operator of pur regulon genes negatively coregulates expression. In all organisms there are 10 steps for de novo synthesis of more, the effector molecules that act as coregulators have IMP, the first purine nucleotide intermediate in the pathway. not been identified. Nucleotides have been assumed to be IMP is a branch point metabolite which is converted to the effector molecules, but the purine bases hypoxanthine adenine and quanine nucleotides (Fig.
[Show full text]
Adenylosuccinate Lyase of Bacillus Subtilis Regulates the Activity of The
Proc. Nati. Acad. Sci. USA Vol. 89, pp. 5389-5392, June 1992 Biochemistry Adenylosuccinate lyase of Bacillus subtilis regulates the activity of the glutamyl-tRNA synthetase (purB/adenylosuccinate AMP-lyase/glutamate-tRNA ligase) NATHALIE GENDRON, ROCK BRETON, NATHALIE CHAMPAGNE, AND JACQUES LAPOINTE* DUpartement de Biochimie, Facultd des Sciences et de Gdnie, Universitt Laval, Qudbec, Canada, GlK 7P4 Communicated by H. E. Umbarger, February 21, 1992 (received for review November 27, 1991) ABSTRACT In Bacillus subtilis, the glutamyl-tRNA syn- Table 1. Bacterial strains used thetase [L-glutamate:tRNAGlU ligase (AMP-forming), EC Strain Genotype Ref. 6.1.1.17] is copurified with a polypeptide of Mr 46,000 that influences its affinity for its substrates and increases its ther- E. coli DH5a 080dlacZAM15, endAI, recAl, 11 mostability. The gene encoding this regulatory factor was hsdR17 (RK-, MK+), supE44, cloned with the aid of a 41-mer oligonucleotide probe corre- thi-l, A-, gyrA, relAI, F-, sponding to the amino acid sequence of an NH2-terminal A&(IacZYA-argF) U169 ofthis factor. The nucleotide sequence ofthis gene and E. coli JK268 F-, trpE61, trpA62, tna-5, 12 segment purB58, A- the physical map of the 1475-base-pair fragment on which it E. coli JM101 supE thi-1 A(lac-proAB) 13 was cloned are identical to those of purB, which encodes the F'[traD36 proAB+ Iaclq adenylosuccinate lyase (adenylosuccinate AMP-lyase, EC lacZAM15] 4.3.2.2), an enzyme involved in the de novo synthesis of B. subtilis 1A1* trpC2 14 purines. This gene complements the purB mutation of Esche- richia coli JK268, and its presence on a multicopy plasmid behind the trc promoter in the purB- strain gives an adenylo- extract (10).
[Show full text]
Predicting Transcription Factor Specificity with All-Atom Models Sahand Jamal Rahi1, Peter Virnau2,*, Leonid A
Published online 1 October 2008 Nucleic Acids Research, 2008, Vol. 36, No. 19 6209–6217 doi:10.1093/nar/gkn589 Predicting transcription factor specificity with all-atom models Sahand Jamal Rahi1, Peter Virnau2,*, Leonid A. Mirny1,3 and Mehran Kardar1 1Department of Physics, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139, USA, 2Staudinger Weg 7, Institut fu¨ r Physik, 55099 Mainz, Germany and 3Harvard-MIT Division of Health Sciences and Technology, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139, USA Downloaded from https://academic.oup.com/nar/article/36/19/6209/2410008 by guest on 02 October 2021 Received May 4, 2008; Revised August 29, 2008; Accepted September 2, 2008 ABSTRACT needs to have a set of known sites bound by the protein. Given these known sites, the parameters are inferred using The binding of a transcription factor (TF) to a DNA either a widely used Berg–von Hippel approximation (1), operator site can initiate or repress the expression or by other recently proposed methods (2–4). This consti- of a gene. Computational prediction of sites recog- tutes a physical basis for many widely used bioinformatics nized by a TF has traditionally relied upon knowl- techniques that rely on a particular form of the energy edge of several cognate sites, rather than an ab function known as a position-speciﬁc weight matrix initio approach. Here, we examine the possibility (PWM). of using structure-based energy calculations that All these methods require a priori knowledge of the require no knowledge of bound sites but rather sites (or at least longer sequences containing these sites) start with the structure of a protein–DNA complex.
[Show full text]
PURB Antibody (C-Term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP12051B
10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PURB Antibody (C-term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP12051B Specification PURB Antibody (C-term) - Product Information Application IF, WB, FC,E Primary Accession Q96QR8 Other Accession Q68A21, O35295, NP_150093.1 Reactivity Human Predicted Mouse, Rat Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Antigen Region 260-289 PURB Antibody (C-term) - Additional Information Gene ID 5814 Other Names Fluorescent image of A549 cell stained with Transcriptional activator protein Pur-beta, PURB Antibody Purine-rich element-binding protein B, PURB (C-term)(Cat#AP12051b).A549 cells were fixed with 4% PFA (20 min), permeabilized Target/Specificity with Triton X-100 (0.1%, 10 min), then This PURB antibody is generated from incubated with PURB primary antibody (1:25, rabbits immunized with a KLH conjugated 1 h at 37℃). For secondary antibody, Alexa synthetic peptide between 260-289 amino Fluor® 488 conjugated donkey anti-rabbit acids from the C-terminal region of human antibody (green) was used (1:400, 50 min at PURB. 37℃).Cytoplasmic actin was counterstained with Alexa Fluor® 555 (red) conjugated Dilution IF~~1:10~50 Phalloidin (7units/ml, 1 h at 37℃).PURB WB~~1:1000 immunoreactivity is localized to Nucleus FC~~1:10~50 significantly. Format Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C in small aliquots to prevent freeze-thaw cycles.
[Show full text]
Dissertation
Regulation of gene silencing: From microRNA biogenesis to post-translational modifications of TNRC6 complexes DISSERTATION zur Erlangung des DOKTORGRADES DER NATURWISSENSCHAFTEN (Dr. rer. nat.) der Fakultät Biologie und Vorklinische Medizin der Universität Regensburg vorgelegt von Johannes Danner aus Eggenfelden im Jahr 2017 Das Promotionsgesuch wurde eingereicht am: 12.09.2017 Die Arbeit wurde angeleitet von: Prof. Dr. Gunter Meister Johannes Danner Summary ‘From microRNA biogenesis to post-translational modifications of TNRC6 complexes’ summarizes the two main projects, beginning with the influence of specific RNA binding proteins on miRNA biogenesis processes. The fate of the mature miRNA is determined by the incorporation into Argonaute proteins followed by a complex formation with TNRC6 proteins as core molecules of gene silencing complexes. miRNAs are transcribed as stem-loop structured primary transcripts (pri-miRNA) by Pol II. The further nuclear processing is carried out by the microprocessor complex containing the RNase III enzyme Drosha, which cleaves the pri-miRNA to precursor-miRNA (pre-miRNA). After Exportin-5 mediated transport of the pre-miRNA to the cytoplasm, the RNase III enzyme Dicer cleaves off the terminal loop resulting in a 21-24 nt long double-stranded RNA. One of the strands is incorporated in the RNA-induced silencing complex (RISC), where it directly interacts with a member of the Argonaute protein family. The miRNA guides the mature RISC complex to partially complementary target sites on mRNAs leading to gene silencing. During this process TNRC6 proteins interact with Argonaute and recruit additional factors to mediate translational repression and target mRNA destabilization through deadenylation and decapping leading to mRNA decay.
[Show full text]
Accumulated Degeneration of Transcriptional Regulation Contributes to Disease Development and Detrimental Clinical Outcomes of Alzheimer’S Disease
bioRxiv preprint doi: https://doi.org/10.1101/779249; this version posted September 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Accumulated degeneration of transcriptional regulation contributes to disease development and detrimental clinical outcomes of Alzheimer's disease Guofeng Meng1,*, Dong Lu1, Feng Yu1, Jijia Sun1, Chong Ding1, Yan Sun2, Xuan Liu1, Jiapei Dai2, Wenfei jin3, and Weidong Zhang1,* 1Institute of interdisciplinary integrative Medicine Research, shanghai University of Traditional Chinese Medicine, shanghai, China 2Wuhan Institute for Neuroscience and Neuroengineering (WINN), South-Central University for Nationalities, Wuhan 430074, China 3Department of Biology, Southwest University of Science and Technology, Shenzhen, China *Correspondence: [email protected] and [email protected] Abstract Alzheimer's disease (AD) is extremely complex for both causal mechanism and clinical manifestation, requiring efforts to uncover its diversity and the corresponding mechanisms. Here, we applied a modelling analysis to investigate the regulation divergence among a large-scale cohort of AD patients. We found that transcription regulation tended to get degenerated in AD patients, which contributed to disease development and the detrimental clinical outcomes, mainly by disrupting protein degradation, neuroinflammation, mitochondrial and synaptic functions. To measure the accumulated effects,we came up with a new concept, regulation loss burden, which better correlated with AD related clinical manifestations and the ageing process. The epigenetic studies to multiple active regulation marks also supported a tendency of regulation loss in AD patients.
[Show full text]
The Cytogenetics of Hematologic Neoplasms 1 5
The Cytogenetics of Hematologic Neoplasms 1 5 Aurelia Meloni-Ehrig that errors during cell division were the basis for neoplastic Introduction growth was most likely the determining factor that inspired early researchers to take a better look at the genetics of the The knowledge that cancer is a malignant form of uncon- cell itself. Thus, the need to have cell preparations good trolled growth has existed for over a century. Several biologi- enough to be able to understand the mechanism of cell cal, chemical, and physical agents have been implicated in division became of critical importance. cancer causation. However, the mechanisms responsible for About 50 years after Boveri’s chromosome theory, the this uninhibited proliferation, following the initial insult(s), fi rst manuscripts on the chromosome makeup in normal are still object of intense investigation. human cells and in genetic disorders started to appear, fol- The fi rst documented studies of cancer were performed lowed by those describing chromosome changes in neoplas- over a century ago on domestic animals. At that time, the tic cells. A milestone of this investigation occurred in 1960 lack of both theoretical and technological knowledge with the publication of the fi rst article by Nowell and impaired the formulations of conclusions about cancer, other Hungerford on the association of chronic myelogenous leu- than the visible presence of new growth, thus the term neo- kemia with a small size chromosome, known today as the plasm (from the Greek neo = new and plasma = growth). In Philadelphia (Ph) chromosome, to honor the city where it the early 1900s, the fundamental role of chromosomes in was discovered (see also Chap.
[Show full text]
Dynamic Changes in RNA–Protein Interactions and RNA Secondary Structure in Mammalian Erythropoiesis
Published Online: 27 July, 2021 | Supp Info: http://doi.org/10.26508/lsa.202000659 Downloaded from life-science-alliance.org on 30 September, 2021 Resource Dynamic changes in RNA–protein interactions and RNA secondary structure in mammalian erythropoiesis Mengge Shan1,2 , Xinjun Ji3, Kevin Janssen5 , Ian M Silverman3 , Jesse Humenik3, Ben A Garcia5, Stephen A Liebhaber3,4, Brian D Gregory1,2 Two features of eukaryotic RNA molecules that regulate their and RNA secondary structure. These techniques generally either post-transcriptional fates are RNA secondary structure and RNA- use chemical probing agents or structure-specific RNases (single- binding protein (RBP) interaction sites. However, a comprehen- stranded RNases (ssRNases) and double-stranded RNases [dsRNa- sive global overview of the dynamic nature of these sequence ses]) to provide site-specific evidence for a region being in single- or features during erythropoiesis has never been obtained. Here, we double-stranded configurations (4, 5). use our ribonuclease-mediated structure and RBP-binding site To date, the known repertoire of RBP–RNA interaction sites has mapping approach to reveal the global landscape of RNA sec- been built on a protein-by-protein basis, with studies identifying ondary structure and RBP–RNA interaction sites and the dynamics the targets of a single protein of interest, often through the use of of these features during this important developmental process. techniques such as crosslinking and immunoprecipitation se- We identify dynamic patterns of RNA secondary structure and RBP quencing (CLIP-seq) (6). In CLIP-seq, samples are irradiated with UV binding throughout the process and determine a set of corre- to induce the cross-linking of proteins to their RNA targets.
[Show full text]
A Catalogue of Stress Granules' Components
Catarina Rodrigues Nunes A Catalogue of Stress Granules’ Components: Implications for Neurodegeneration UNIVERSIDADE DO ALGARVE Departamento de Ciências Biomédicas e Medicina 2019 Catarina Rodrigues Nunes A Catalogue of Stress Granules’ Components: Implications for Neurodegeneration Master in Oncobiology – Molecular Mechanisms of Cancer This work was done under the supervision of: Clévio Nóbrega, Ph.D UNIVERSIDADE DO ALGARVE Departamento de Ciências Biomédicas e Medicina 2019 i ii A catalogue of Stress Granules’ Components: Implications for neurodegeneration Declaração de autoria de trabalho Declaro ser a autora deste trabalho, que é original e inédito. Autores e trabalhos consultados estão devidamente citados no texto e constam na listagem de referências incluída. I declare that I am the author of this work, that is original and unpublished. Authors and works consulted are properly cited in the text and included in the list of references. _______________________________ (Catarina Nunes) iii Copyright © 2019 Catarina Nunes A Universidade do Algarve reserva para si o direito, em conformidade com o disposto no Código do Direito de Autor e dos Direitos Conexos, de arquivar, reproduzir e publicar a obra, independentemente do meio utilizado, bem como de a divulgar através de repositórios científicos e de admitir a sua cópia e distribuição para fins meramente educacionais ou de investigação e não comerciais, conquanto seja dado o devido crédito ao autor e editor respetivos. iv Part of the results of this thesis were published in Nunes,C.; Mestre,I.; Marcelo,A. et al. MSGP: the first database of the protein components of the mammalian stress granules. Database (2019) Vol. 2019. (In annex A). v vi ACKNOWLEDGEMENTS A realização desta tese marca o final de uma etapa académica muito especial e que jamais irei esquecer.
[Show full text]
Identification of High-Copy-Number Inhibitors
IDENTIFICATION OF HIGH-COPY-NUMBER INHIBITORS OF Pl PLASMID STABILITY Natalie Erdmann A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular and Medical Genetics University of Toronto O Copyright by Natalie Erdmann (1998) National ïibrary Bibliothèque nationale du Canada Acquisitions and Acquisitions et Bibliographie Services seMces bibliographiques 395 Wellington Street 395, rue wermgtori ûüaw%ON K1AûN4 CRhwaON KlAW canada canada The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Lïbrary of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, dimiuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de reproduction sur papier ou sur format électronique. The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts hmit Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Identification of High-Copy-Number Inhibitors of Pl Plasmid Stability by Natalie Erdmann Master of Science, Graduate Department of Molecular and Medical Genetics, University of Toronto, 1998 ABSTRACT Pl is a low-copy-number plasmid that requires an active partition system for stable maintenance in Escherichia coli. The Pl par operon contains two cotranscribed genes, parA and parB, and a downstrearn cis-acting site, parS.
[Show full text]
(PURB) (NM 033224) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC101337 Pur B (PURB) (NM_033224) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Pur B (PURB) (NM_033224) Human Untagged Clone Tag: Tag Free Symbol: PURB Synonyms: PURBETA Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_033224, the custom clone sequence may differ by one or more nucleotides ATGGCGGACGGCGACAGCGGCAGCGAGCGCGGCGGCGGCGGTGGGCCGTGCGGGTTCCAGCCCGCGTCCC GCGGCGGCGGCGAGCAAGAGACGCAGGAGCTGGCCTCGAAGCGGCTGGACATCCAGAACAAGCGCTTCTA CTTAGATGTGAAGCAGAACGCCAAGGGCCGCTTCCTCAAGATCGCCGAGGTGGGCGCGGGCGGTTCCAAG AGCCGCCTCACGCTGTCCATGGCGGTGGCCGCCGAGTTCCGCGACTCGCTGGGCGACTTCATAGAACACT ACGCGCAGCTGGGCCCTAGCAGCCCCGAGCAGCTGGCGGCTGGCGCCGAGGAGGGCGGCGGGCCGCGGCG CGCGCTCAAGAGCGAATTCTTGGTGCGTGAGAACCGCAAGTACTACCTGGACCTCAAGGAGAACCAGCGC GGCCGCTTCCTGCGCATCCGCCAAACGGTCAACCGCGGCGGTGGCGGCTTCGGCGCGGGCCCCGGGCCGG GCGGCTTGCAGAGCGGCCAGACCATCGCGCTGCCTGCGCAGGGCCTCATCGAGTTCCGCGACGCGCTGGC GAAGCTCATAGACGACTACGGAGGCGAGGACGACGAGCTGGCAGGCGGCCCGGGAGGCGGCGCCGGGGGC CCAGGGGGCGGCCTGTATGGAGAGCTCCCGGAGGGCACCTCCATCACCGTGGACTCCAAGCGCTTCTTCT TCGATGTGGGCTGCAACAAATACGGGGTGTTTCTGCGAGTGAGCGAGGTGAAGCCGTCCTACCGCAATGC CATCACCGTACCCTTCAAAGCCTGGGGCAAGTTCGGAGGCGCCTTTTGCCGGTATGCGGATGAGATGAAA GAAATCCAGGAACGACAGAGGGATAAGCTTTATGAGCGACGTGGTGGGGGCAGCGGCGGCGGCGAAGAGT CAGAGGGTGAGGAGGTGGATGAGGATTGA
[Show full text]
Product Data Sheet
For research purposes only, not for human use Product Data Sheet PURB siRNA (Mouse) Catalog # Source Reactivity Applications CRM3347 Synthetic M RNAi Description siRNA to inhibit PURB expression using RNA interference Specificity PURB siRNA (Mouse) is a target-specific 19-23 nt siRNA oligo duplexes designed to knock down gene expression. Form Lyophilized powder Gene Symbol PURB Alternative Names Transcriptional activator protein Pur-beta; Purine-rich element-binding protein B; Vascular actin single-stranded DNA-binding factor 2 p44 component Entrez Gene 19291 (Mouse) SwissProt O35295 (Mouse) Purity > 97% Quality Control Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency. Components We offers pre-designed sets of 3 different target-specific siRNA oligo duplexes of mouse PURB gene. Each vial contains 5 nmol of lyophilized siRNA. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. Our siRNA oligos are also chemically modified (2’-OMe) at no extra charge for increased stability and enhanced knockdown in vitro and in vivo. Application key: E- ELISA, WB- Western blot, IH- Immunohistochemistry,
[Show full text]