IDENTIFICATION OF HIGH-COPY-NUMBER INHIBITORS
OF Pl PLASMID STABILITY
Natalie Erdmann
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Molecular and Medical Genetics
University of Toronto
O Copyright by Natalie Erdmann (1998) National ïibrary Bibliothèque nationale du Canada Acquisitions and Acquisitions et Bibliographie Services seMces bibliographiques 395 Wellington Street 395, rue wermgtori ûüaw%ON K1AûN4 CRhwaON KlAW canada canada
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Lïbrary of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, dimiuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts hmit Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Identification of High-Copy-Number Inhibitors of Pl Plasmid Stability
by Natalie Erdmann
Master of Science, Graduate Department of Molecular and Medical Genetics, University of Toronto, 1998
ABSTRACT
Pl is a low-copy-number plasmid that requires an active partition system for stable maintenance in Escherichia coli. The Pl par operon contains two cotranscribed genes, parA and parB, and a downstrearn cis-acting site, parS. ParA and ParB are both essential for partition, but overproduction of either protein disturbs partition and destabilizes P 1.
Partition must position Pl plasmids so that each daughter cell receives one copy.
Bacterial host factors are believed to participate in the positionhg process. A genetic screen using a hi&-copy library of E. coli genes was performed to identiQ host factors, as it was anticipated that overproduction of key host proteins would disrupt the partition process and destabilize P 1. 1 identified ten gene products that destabilize Pl when overproduced, but are not directly required for partition. Subsequent tests were performed to elucidate the functions of these gene products, but their roles in Pl partition remain unknown. ACKNOWLEDGEMENTS
1 have to thank my supe~sor,Dr. Barbara E. Funnell, for her continued guidance and support, and for making my graduate school experience one of intellectual and personal growth.
I am also grateful to my supervisory committee members, Dr. Andrew Spence and Dr. Johanna
Rommens, for their advice and expertise.
1 am indebted to my lab-mates - Jennifer Surtees, Megan Davey, and Jean Yves Bouet - for their boundless help and generosity in answering my (seemingiy) endless questions. Thanks also to my Med Gen fiiend, fellow shopaholic, and confidante, Beaûice Seguin.
To Cathy, Jenn, Blake, and Kerry - thank-you for your friendship and for providing me with what linle social life 1 had ... and to Michael, for distracting me when 1 should have working.
Finally, 1 would like to express my deepest gratitude to my family - Mom,Dad, and
Mark. 1 owe any success 1 have to their examples of hard work and dedication. and their constant encouragemenf support, and pride.
iii TABLE OF CONTENTS
Abstract
Acknowledgements
Table of Contents
List of Figures and Tabtes
Chapter 1 General Introduction - Escherichia coli chromosome partition and ce11 division - Plasmid stability models - The P 1 partition system - Involvement of host factors
Chapter 2 Materiah and Methods
Chapter 3 Results -Chamterization of library inserts - Examining the roies of the interference genes in Pl partition - Effects on E. coli gross morphology - Effects on P 1 copy number - Effects on Par protein expression - Interactions of library plasmid gene products
Chapter 4 Discussion -Interference genes -Essential par components -Future directions
Figures
Tables
Re ferences List of Figures and Tables
Figure 1. Models for active plasmid partition
Figure 2. The sop/par family of partition operons for plasrnids P 1, P7, and F
Figure 3. The porS site of P 1
Figure 4. A model of Pl plasmid partition
Figure 5. Potential roles for host factors in Pl plasmid partition
Figure 6. Vectors
Figure 7. The test plasrnid pBEF2 18
Figure 8. Replication Test plasrnids
Figure 9. Bacterid DNA inserts of final library candidates
Figure 10. Characterization of potential partition inhibitors
Figure 11. Determination of copy nurnbers of Replication Test plasmids
Figure 12. Effect of library plasrnids on par gene expression
Table 1. List of abbreviations
Table 2. Bacterial strains
Table 3. Categorization of blue phenotypes produced by librq plasmids
Table 4. Summary of library inserts CHAPTER 1
GENERAL INTRODUCTION The bacterial chromosome encodes al1 of the essentiai information for the bacterial ceIl
and therefore requires a highly accurate segregation system to ensure that it is stably maintained
fiom generation to generation. The process of segregation in bacteria, called partition, in which
daughter chromosomes are separated and positioned prior to septum formation and ce11 division,
involves mechanisms that are largely unknown. Segregation factors resembling those involved
in mitosis in eukaryotes have not yet been identified in bacteria.
Like the bacterial chromosome, low-copy-number plasmids require an active partition system to guarantee that each daughter ce11 receives at least one copy of the plasmid. Plasmids are extrachromosomal, usuaily circular DNA duplexes that are not essential for the host, but cm
be beneficial for the ce11 by providing antibiotic resistance genes and virulence factors. For example, the pINV family of plasmids allow Shigellaflemeri and enteroinvasive species of
Escherichia coli to enter epithelial cells and cause intestinal disease (Sasakawa et uZ., 1986;
Makino et al., 1988). Plasmids are also usually much smaller and less complex than the chromosome, making them easier to manipulate and analyze. These characteristics make plasmids convenient models for the midy of the partition process.
A variety of low-copy-number plasmids possess homologous partition systems, and I have used the Pl plasmid to investigate an important aspect of partition: the identification of potential host factors that position the newly replicated DNA molecules on each side of the division plane. Such factors are believed to be essential cornponents for partition, and 1 have performed a genetic screen in Escherichia coli to idena them.
Because plasmids often use bacterially encoded components for their own survival, it seems likely that the partition systems of plasrnids and bacterial chromosomes may share some components adorsteps. If not, it would at lest be expected that there are comparable components that perform equivalent functions in segregation. For this reason, examination of
2 the partition mechanisms in a variety of systems is important to gain an understanding of dlof the required elements for active segregation.
Escheridia coli chromosome partition and ceil division
Separation of catenanes and resolution of dimers after DNA replication. DNA replication is initiated at oriC by a multienzyme complex including the DnaA initiator protein,
RNA polymerase, DNA gyrase, DNA Polymerase III holoenzyme, single-stranded binduig protein (SSB), histone-like protein (HU), DnaB helicase, DnaC protein, and DnaG primase. and proceeds bidirectionally (Kornberg and Baker, 1992). Termination of replication occurs when the two replication forks meet at the temiinus region. Mer DNA replication is completed the daughter chromosomes are often present as catenanes or as circular dimers. These structures result fiom incomplete topological uniinking durhg replication or fiom homologous recornbination, respectively. They must be completely unlinked and resolved into single, circuiar chromosomes to allow partition to be completed. Decatenation of catenanes is carried out primarily by the type 2 topoisomerase, topoisomerase IV (topo IV), encoded by the parc and parE genes. The Parc subunit of topo IV appears to be associated with the cytoplasmic membrane, implying that the decatenating machinery is localized at the membrane (Kato et al.,
1992). Overexpression of the other known bacterial type 2 topoisomerase, DNA gyrase, can partially suppress the growth defect observed in topo IV mutants. This observation indicates that DNA gyrase and topo N may have functional overlap, although DNA gyrase7smain role is to catalyze the ATP-dependent negative supercoiling of DNA to relieve ovenvinding during replication. Zechiedrich and Conarelli (1995) demonstrated that DNA gyrase is approximately
100-fold less efficient than topo N in unlinking replicated daughter plasmids in vivo, indicating that topo N is the critical decatenase in Escherichia coli Chromosornal dimers are resolved into monomers by a site-specific recombination event at the replication terrninus region. Resolution is catalyzed by the bacterial XerC-XerD recombinase at the terminal dif (deletion-induced- -filamentation) site (Clerget, 199 1; Blakely et al., 199 1; Kuempel et al., 1991). Strains containing mutations in xerC, xerD, and Mifform filamentous cells and are defective in chromosome segregation. This defect is suppressed by recA mutations, illustrating that dimerization occurs as a result of homologous recombination.
Similarly, the ColEl plasmid utilizes XerC-XerD recombinase at its cer site, illustrating that host ce11 chromosomes and plasmids share cornmon components in theV maintenance systems
(Surnmers and Sherratt, 1984).
Partition of daughter chromosomes. Monomeric, uncatenated daughter chromosomes must then be partitioned to opposite sides of the division plane. In a simple scenario, there are four basic components of the partition system (fiom RotMeld, 1994): a specific cis-ac~g
DNA site to which the partition machinery attaches, a sequence-specific adapter protein that connects the DNA to the partition factors, a tethering structure that holds, pushes, or pulls each daughter chromosome, and a fixed cellular attachrnent site that anchon the daughter chromosomes. It is also feasible that the third and fourth components are actually a single unit that serves a dual function of tethering and anchoring newly replicated chromosomes.
The fmt and second components, the centromere-like sequence and the adapter protein, have not been identified for the E. dichromosome. They have, however, been found for several unit-copy plasmids, which will be discussed in a later section.
The only candidates identified so far that meet the qualifications of the third component, the tethering factor/complex, are MukB, MukE, and MukF, whose genes are organized in an operon. mukB, mukE, and mukF mutants are unable to grow at temperatures above 30°C, and produce a high proportion of anucleate cells and multinucleate cells with abnormal nucleoid distribution (Hiraga et al., 1989; Yamanaka et al., 1996). MukB is a 177-kDa protein that exists as a homodimer in solution. It has a flexible rod-and-hinge structure with globular domains at each terminus (Niki et al., 1992). The amino teminus has a putative nucleotide binding sequence, and the carboxy-terminus contains three putative zinc fingers, suggesting that the protein may interact with other proteins andor DNA (Niki et al., 199 1). Purified MukB possesses Zn"-dependent ATPIGTP-binding activity, and a non sequence-specific DNA-binding activity dependent on the carboxyl terminal region (Niki et al., 1992; Sdeh et al.. 1996). The overail structure and properties of MukB show sirnilarities to the heavy chains of the eukaryotic myosin and kinesin motor proteins, suggesting that it may act as a force-generating structure that binds DNA and pushes or pulls it towards the ce11 poles. However, because the DNA-binding activity appears to be non-specific (Niki et al ., 1992) and MukB has been implicated in chromosome condensation (Yamanaka et al., 1994; Hu et al., 1996), MukB's contribution to partition may be via an effect on nucleoid structure.
MukF is a 50.5-kDa protein that has a leucine zipper domain in the middle of the protein and an acidic amino acid cluster domain in the C-terminal region. Both regions are critical for chromosome partition, suggesting that MukF may fom homo- or heterodirners (Yamanaka et al., 1996). Unlike MukB or MukE, overproduction of MukF also causes anucleate ce11 production. This eaect is enhanced by the simultaneous overproduction of MukB and MukE, indicating interactions among these three proteins (Yamanaka et al., 1996). To date, the structure or hction of MukE has not been characterized.
Neither MukB nor MukF contain putative tmns-membrane domains, which suggests that there is a fourth required element for partition. The fourth component, the fixed cellular attachent site, would be required to anchor each daughter chromosome to the appropriate
5 daughter ce11 during ce11 division. This component likely interacts, directly or indirectly, with the rigid celi envelope peptidoglycan, the only known skeletal smicture in bacteria. To date, there are no candidates for the anchoring element in any chromosornai or plasmid partition system.
It has been recently demonstrated that the oriC region of the E. dinucleoid is specifically localized at the ce11 poles until fier replication, when one copy of the origin moves to middle of the cell, where the new pole will be formed at ce11 division (Gordon et ai.. 1997).
In a senes of experiments carried out using chromosomes containhg multiple copies of the lac operator inserted near the ongin and bound by a green fluorescent protein (GFP)-Lac1 repressor fusion, the origin region was visualized by fluorescence microscopy. Inhibition of septum formation with the antibiotic cephalexin produced filamentous cells with oriC positioned where the ce11 poles would have been formed in the absence of dmg. This observation indicates that at least the first steps of partition of the chromosome are independent of septum formation and ce11 division, and that the localizing factors for oriC are associated, or become associated, with the ce11 poles (Gordon et al., 1997). Similar patterns of chromosomal localization have been observed in Bacillus subtilis (Lin et al., 1997; Webb et al., 1997) and Caulobacter crescentus
(Mohl and Gober, 1997), suggesting that different bacterial species use analogous partition rnechanisms. It is also of interest that B. subtilis and C. crescentus encode homologs of the Pl plasmid partition proteins ParA and ParB that cmbe identified by sequence alignrnent, whereas
E. coli does not (discussed below).
Cell division. The earliest known event in bacterial ce11 division is the formation of a dynamic ring structure on the ùiner membrane at the fbture site of septation (Bi and Lutkenhaus,
199 1). The "2-ring" is composed of polymerized FtsZ, an essential tubulin-like protein with
GTPase activity (Bi and Lutkenhaus, 1991; RayChaudhuri and Park, 1992; DeBoer et al.,
6 19%;). Other essential ce11 division genes,ftsA. fisQ, #si, @SN, flsL. fisF andfisK, have been identified by the isolation of temperature-sensitive mutants that fonn filaments at the non- permissive temperature (Fs = -filamenting temperature -sensitive (Hirota et al., 1968)). The products of these genes appear to act after formation of the 2-ring (for review, see Lutkenhaus and Addinall, 1997). Otherfrs-designated genes, includingJ.sH,fisJ JsY, #SE, andjisX, appear to have indirect roles in ce11 division (Bi and Lutkenhaus, 1992). A current mode1 of ce11 division (Lutkenhaus, 1993) proposes that during the ce11 cycle, a nucleation site for FtsZ polymerization foms and serves to locaiize GTP-bound FtsZ and orient its polymerization. The formation of the 2-ring leads to the recruitment of the other ce11 division proteins, although only that of FtsA and FtsN has been demon-ted (Addinall and Lutkenhaus, 1996; Addinall et al.,
1997). The roles of most of these gene products, encoding penpheral (FtsA) and integral (FtsW,
FtsN, FtsL, FtsQ) membrane proteins are unknown, dthough they are assumed to contribute to the stabilization andor constriction of the 2-ring. An important event during septation is synthesis of peptidoglycan. PBP3, encoded by#sI, is an integral membrane protein and is the only knownfis product associated with septal-specific biosynthesis (Spratt, 1975; Bowler and
Spratt, 1989).
A novel integral membrane protein, ZipA, has been recently implicated in the formation adorfûnction of the 2-ring and is essential for cell division (Hale and deBoer, 1997). A ZipA-
GFP fusion is localized to the division site in a ring structure prior to and during septum formation, and it binds directly to FtsZ in vitro and in vivo. These discoveries have led to the proposd that ZipA may recruit FtsZ monomers to the division site, initiate polymerization, andor directly connect the FtsZ ring to the bermembrane. It is also possible that ZipA coordinates membrane constriction involving FtsZ with peptidoglycan synthesis involving
PBP3, although Merexperimentation is required to confimi any of these hypotheses.
7 Other known genes involved in septum localization during ce11 division are minC, rninD, and minE. MinC and MinD inhibit septation at the ce11 poles, while MinE acts as a MinCD antagonist that prevents division inhibition at the midceil division site (DeBoer et al., 1989).
Mutations in minCD lead to the formation of anucleate rninicells, which form as a resdt of polar septum formation (DeBoer et al., 1989). It is, therefore, believed that these factors are at least partially responsible for location of the division site at rnid-ce11 by acting as antagonists to FtsZ.
This view is supported by reports that increased production of FtsZ suppresses inhibition by
MinCD (Bi and Lutkenhaus, 1990), and overexpression of MinCD prevents FtsZ localization at the division site (Bi and Lutkenhaus, 1993). Interactions between the min gene products have been demonstrated with the yeast two-hybrid system, but an interaction between any of the Min proteins and FtsZ was not observed, indicating that the proteins may compete for a site rather than bind each other directly (Huang et al., 1996). Aiso, MinD shares homology with a family of ATPases involved in low-copy-number plasmid partition, including ParA of Pl and SopA of
F (Motabelli-Vershareh et al., 1990). However, MinD is not involved in chromosome partition
hctions (Dassain and Bouché, 1994).
Plasmid stabüity models
Plasmids place a metabolic burden on the host ce11 and could, therefore, be considered
molecular parasites. They are not essential for their host unless they provide or enhance specific
benefit, such as antibiotic resistance. There are two general categories of plasmid stability
systems: passive systems that rely on random distribution of daughter plasmids, and active
systems that ensure that each daughter ce11 will receive a plasmid copy at ce11 division. Low-
copy-number plasmids, such as P 1 and F, do not rely on constant selection for maintenance by
the host, but encode their own stable inheritance mechanisms. Passive partition and other plasmid maintenance systems. Stringent control of replication is an essential component of any plasmid stability system. An obvious way a plasmid can increase its chances of being distributed to both daughter cells is by elevation of copy number such that random distribution will be sufficient for stable maintenance of plasmids through host ce11 division. Plasmids may increase their probability of being stably inherited by decreasing their metabolic demands on the host, that is, by Limiting their copy number. For example, the pEB 1 14 plasmid in B. subtilir contains a mutation in the replication initiation gene rep (l that reduces its copy number leadhg to an increase in its stability (Leonhardt, 1990). In very low-copy-number plasrnids, random distribution is not suficient for stable inheritance, and such plasmids require active partition systems (discussed below). Nevertheless, &gent replication systems are essential to ensure that there are enough copies to randornly or actively segregate to both daughter cells.
Several plasmids utilize multimer resolution systems to maximize the number of independently segregating units. For instance, Pl uses Cre recombinase at the loxP site (Austin et al., 1981) to perform a similar function as that performed by the XerC-XerD recombinase at the ColE 1 cer site (Summers and Sherratt, 1984) and the E. coli difsite (Clerget, 1991; Blakely et al., 1991; Kuempel et al., 1991).
Another stability mechanism is a "killer" or "addictiony' system, in which a plasmid- encoded toxin kills or decreases the growth rate of cells that did not inherit the same plasmid producing an antidote. An example of this system is found on the RI plasmid. The plasmid encodes a stable hok mRNA toxin that can only be repressed by the unstable sok antisense RNA
(Gerdes et al., 1990). Plasmid-free segregants, therefore, allow the hok mRNA to be translated into a lethai protein after sufficient decay of the inhibitory sok RNA. The F and Pl plasmids also encode analogous killer systems in which protein toxins (CcdB and Doc) and corresponding
9 antidotes (CcdA and Phd) are involved (Jaffé et al., 1985; Hiraga et al., 1986; Lehnheri: et al.,
1993)-
Active partition systems. An active partition system increases the segregationd stability of a plasmid during ce11 division. This system actively positions low-copy-number plasmids on each side of the division plane, so that each daughter ce11 receives at lest one copy.
Another feature of active partition, or par, systems in plasmids is incornpatibility. hcompatibility is the inability of two or more plasmids to be stably maintained in the same ce11 line due to non-independent segregation (Novick, 1969). The incompatibility deteminant is a specific cis-acting site on the plasmid, the centromere-like sequence, which allows plasmids to bind, directly or indirectly, a membrane attachent site or another apparatus that allows daughter plasmids to be separated into daughter cells. Therefore, incompatible plasmids contain like cis elements that will compete with each other and segregate erratically until populations arise that contain one or the other plasmid, but not both.
There are two generai models for active partition of daughter plasmids (Figure 1): in one model, there are unique membrane receptors for each known plasmid type, and in the second model, pairing of daughter plasmids occurs at the division septum followed by separation and segregation towards opposite ce11 poles. In the first model (Figure 1, path A), each replicated plasmid binds to a host receptor at each end of the cell via its cis-acting site. Because this site rnay be different for each type of plasmid, the host would require a unique receptor for every unique type of cis-acting site. However the presence of unique sites for at least 26 known plasmid incompatibility groups (Novick, 1969) seems unlikely, thus weakening the validity of this model. The possibility that daughter plasmids attach to unique sites on the host chromosome and are partitioned accordingly has been disproven for both F and Pl (Ezaki et al.,
1991 ; Funnell and Gagnier, 1995). Using mukB mutants defective in chromosome partition, it
1O was demonstrated that both F and Pl can be stably distrïbuted to both nucleate and anucleate cells, indicating that these plasmids use, at least in part, a separate and/or independent partition machinery from the host chromosome.
In the second model (Figure 1, path B; Austin and Abeles, 1983b), replicated daughter plasmids pair at their cis-acting sites, via their plasmid-encoded site-specific adapter proteins.
This paired set of plasmids can then bind to a non-unique host receptor in the cell, and be properly positioned into each daughter ce11 pnor to septum formation. Incompatible plasmids sharing like cis-acting sites can pair with each other, leading to non-independent segregation.
This model is preferred over the first because specificity is encoded by the plasmid.
Two major active partition systems are ciassified as the IncFII family and the sop/par family. Systems of either family comprise a cis-acting site and (usually) two tram-acting factors, an A protein and a B protein. The IncFII farnily includes the R1 and NRI low-copy- nurnber plasmids. They encode two tram-acting proteins (ParM and ParR in RI and StbA and
StbB in NRI) and a cis-acting site (parcin RI) at which one or both proteins act (Gerdes and
Molin, 1986; Tabuchi et al., 1988; Min et al.. 1988). These partition systems appear to have a similar organization to the sop/par family (see below), although the protein and DNA sequences are not homologous (Tabuchi et al., 1988). The cis-acting site is located upstream of the frans- acting genes in both RI and M%1 (Gerdes and Molin, 1986; Tabuchi et al., 1988).
The best-characterized members of the sop/par family are F, P 1, and P7. Their partition systems called sop (stability- of plasmid) in F and par in P 1 and P7, have identical organizations on the plasmid (Figure 2). Each system contains three essential components: two cotranscribed pans-acting factors, the A and B proteins, and a downstrearn cis-acting site (Ogura and Hiraga,
1983; Mori et al., 1986; Austin and Abeles, 1983% b; Abeles et d.,1985; Martin et al., 1987;
Ludtke et al., 1989). Transcription of A and B is repressed by A, and this repression is
11 enhanced by B, indicating an interaction between these proteins (Friedman and Austin, 1988;
Mon et al., 1989; Hayes et al., 1994). The B protein binds directly to the cis-acting site, to form what is called the partition complex. Formation of the partition complex is believed to be one of the earliest steps in partition. In F, sopA and sopB encode the A and B proteins, respectively, and the cis-acting site is designated sopC (Ogura and Hiraga, 1983). In Pl and P7, the par region contains parA and pmB, and the cis-acting site, purs (Austin and Abeles, 1983 b; Ludtke et al., 1989). Although the partition protek and cis-acting sites fiom P 1 and P7 are homologous, they are not able to cross-complement (Ludtke et al., 1989). This suggests that conservation has been important to maintain specific DNA-protein and protein-protein interactions, but that some divergence in the tm-and cis-acting components has been required to maintain each plasmid.
Another key component in each of these active partition systems mut be a host-encoded structure(s) that separates andor positions paired daughter plasmids on each side of the division plane prier to ce11 division. No host factors that provide these essential functions have yet been identified for any of the active partition families.
Homologous par systerns in B. subtilis and crescentus. No homologs of the plasrnidpar genes have been identified on the E. coli genome (except MinD. see previous discussion) aithough it is expected that there are equivaient factors that provide partition functions. In contrast, proteins similar to ParA and ParB have recently been shown to be involved in chromosomal segregation of Bacillm subtilis and Caulobacter crescentus. B. subtilis Soj and SpoOJ are ParA and ParB homologs (-50% similarity to plasrnid Par proteins), respectively, that are required for sportdation and chromosomal partitionkg during vegetative growth (Ireton et al., 1994). The genes soj and spoOJ are cotranscribed fiom an operon autoregulated by Soj, but only SpoOJ appears to be required for partition (Sharpe and Errington,
12 1996; Lin et al., 1997). Immunofluorescence microscopy and fluorescence microscopy experiments using a green fluorescent protein (GFP)-SpoOJ fusion have revealed that SpoOJ binds a region near the chromosomal origin and localizes to the ce11 poles in dividing cells. This localization of SpoOJ suggests that it directs partition of the daughter nucleoids in conjunction with other unidentified cellular components (Lin et al., 1997; Webb et al., 1997).
In C. crescentuî, the parAB operon lies adjacent to the origin of replication. Its organization is identical to that of the Pl par operon, including the presence of a downstream A
+ T-rich region to which ParB may bhd (Mohl and Gober, 1997). C. mescentus ParA is 50% identical in predicted amho acid sequence to B. mbtilis Soj, and 15-2 1% identical to ParA fÎom the sop/par family of plasmids, dong the entire length of the proteins. The predicted amino acid sequence of C. crescentzu ParB has 45% identity to B. subtilis SpoOJ, and 20-25% identity to unit-copy-plasrnid ParB homologs. C. crescentm parA and purB are essential for ce11 growth, while overexpression of porA andlor parB senously disrupts chromosome segregation and ce11 division. Their gene expression, measured by the transcription rate of a PUA-LacZ fusion, is under ce11 cycle control and peaks in late predivision cells, although cellular levels of ParA and
ParB do not fluctuate significantly. These observations demonstrate the requirement for critical concentrations of these proteins for proper function in the ce11 cycle. Lmmunofluorescence microscopy showed that as DNA replication proceeds, ParA and ParB are localized to one, then both of the ce11 poles immediately prior to ce11 division. These results suggest that ParA and
ParB are directing daughter chromosome movement to the ce11 poles, possibly as part of a bacterial rnitotic apparatus (Mohl and Gober, 1997).
The Pl partition system
P 1 is a temperate phage of E. coli, and the P 1 prophage exists as a unit-copy plasmid: that is, there is one to two copies per chromosome (Prentki et al.. 1977). The copy nurnber of
13 P 1 is under the stringent control of the rep region (Chattomj et al., 1985). The rep region is a segment of approximateiy 1.5 kb that contains the replication ongin, the repA gene encoding a replication protein, and the incA region that controls copy number. The ongin and incA regions contain five and nine 19-bp repeats, respectively, to which the RepA protein binds (Abeles,
1986). Deleting two of the five repeats in the origin inactivates replication, whereas deleting seven or al1 of the nine repeats fiom incA increases Pl copy number from one to four or eight, respectively (Chattoraj er al., 1984; Austin et al., 1985). Therefore, binding of RepA to the origin initiates replication, and NlCA serves to titrate extra copies of RepA away fkom the origin, to maintain copy nurnber (Pal et al., 1986).
Despite its single copy nurnber, the Pl plasmid is lost in less than 1 in 10,000 ce11 division cycles, and this stable maintenance is due to the P 1 par operon (Rosner, 1972; Austin et al.. 198 1 ;Abeles et al., 1985). The par operon encodes ParA and ParB that act on the centromere-like site, pars (Figure 2). a) The ParA protein. The Pl ParA protein plays two roles in partition: an autoregulatory role and an unknown direct role in partition. ParA recognizes the par promoter and represses transcription of the pur operon. This fimction of ParA is essential to maintain a controlled level of Par proteins in the ce11 (discussed below). ParA also bas a second, essential bction in partition, which is unknown: even if the requirement for its autoregulatory activity is removed
(i.e. it is transcribed at low levels fiom another promoter), ParA is still required for Pl partition
(Davis et al., 1996). The ParA protein, a 44-kDa polypeptide, possesses a weak ATPase activity that is stirnulated by ParB and by DNA (Davis et a[., 1992). ParA is one of several proteins in a family (including P7 ParA, F SopA, and E. coli MinD) that contain Waiker-type ATP-binding motifs (Wallser, 1982; Motallebi-Veshareh et al., 1990). ParA is also a site-specific DNA- binding protein that binds CO-operativelyto an operator site in the par promoter. This binding
14 presurnably mediates ParA's repressor function in vivo (Friedman and Austin, 1988; Davis et al., 1992). This binduig is stimdated by ATP, (IATP, and especially by ADP and non- hydrolyzable ATP analogs. Al1 these adenine nucleotides also promote ParA dimerization
(Davey and Funnell. 1994). It appears that adenine nucleotide binding and hydrolysis affect
ParA structure and function differentiy, implying that different conformations of ParA have distinct roles in regdation and partition (Davey and Funnell, 1997).
ParA interacts with ParB. ParB stimulates repression by ParA in vivo, but bas no
repressor activity on its own (Friedman and Austin, L 988). ParB dso enhances ParA's par promoter binding and ATPase activities in vitro, providing Merevidence that an interaction occurs between the two proteins (Davis et al., 1992; Davey and Funnell, 1997). Recent genetic evidence suggests that ParA interacts with the ParB-parS partition complex, and possibly
mediates plasmid pairing prior to partition (Youngren and Austin, 1997). Nevertheless, the second role of ParA in partition is still conjecturai-it may aid in the pairing of daughter
plasmids or it may contribute to the movement of daughter plasrnids to the cell-quarter
positions, which would require ATPase activity.
b) The ParB protein and the partition complex. ParB is a 38-kDa protein that exists as a dimer in solution and binds directly to pars by recognizing a set of specific sequences (Figure 3;
Funnell. 1 988a,b; Davis and Austin, 1988; FunneIl, 199 1). Bacterial integration host factor
(IHF) greatly stimulates ParB's affinity for the site by binding to an IHF-binding site inpars and inducing a strong bend in the DNA at this site (Funnell, 1988b; Funnell, 1991). This bend
(enhanced by DNA superhelicity) allows a core of ParB to sirnultaneously interact with its
binding motifs located on each end of the pars site, thus forrning a higher-affinity complex known as the partition complex. parS includes two ParB-binding motifs: the heptamer "BOXA"
sequence (ATITCA(C/A)) and the hexamer "BoxB" sequence (TCGCCA) (Funnell and
15 Gagnier, 1993). There are two Box B repeats, located on each side of the IHF-binding site, and
four Box A repeats, with one located on the left side and the other three on the right side of the
IHF-binding site (Figure 3). In the absence of IHF, ParB binds to the right half ofpars, which
is adequate for partition activity (Martin et al., 1987; Davis et al., 1990; Funnell and Gagnier,
1993). However, IHF and the binding motifs in the lefi subsite are required to form the wild
type partition cornplex, which imparts full incornpatibility and partition activity (Funnell and
Gagnier, 1994).
c) A model of the Pl partition cycle. Figure 4 illustrates my curent working model for P 1
partition. Mer replication, there are two daughter plasrnids in the cell. ParB and IHF bind to
the pars site to form the partition complex, which then allows the plasmids to pair. Pairing
between daughter plasmids has recently been shown to occur in the R1 plasmid using electron
microscopy (K. Gerdes, unpublished results). The plasmids are then positioned at the cell
quarter positions, so that when septum formation occurs, each daughter ce11 has one plasmid.
This localization to the ce11 quarter positions has recently been shown to occur for the F plasmid
using fluorescence in situ hybridization (FISH) (Niki and Hiraga, 1997), and for the F and Pl
plasmids using a green fluorescent protein (GFP)-Lac1 repressor fusion bound to multiple copies
of the lac operator inserted into the plasmids (Gordon et al.. 1997). ParA is also involved in this
cycle, but its precise role is unknown. Also, because the plasmids are precisely positioned in the
ce11 before septum formation, it is believed that host factors are essential to aid in the movement
and/or anchoring of the daughter plasmids. Gordon and coworkers (1 997) demonstrated that
inhibition of sephun formation by the antibiotic cephalexin (which inhibits the product of the fisl gene (Wientjes and Nanninga, 1991)) inhibits the localization of Pl to the ce11 1/4 and 3/4
positions. This observation suggests that a host factor(s) associated with the division septum is essential for proper plasmid positioning, or thatfisl is necessary for both plasmid localization and septum formation.
Involvement of host factors
Partition can be considered as essentially a positioning reaction. Although the Ml functions of ParA and ParB in partition are undetermined, it is highly doubtful that they are able to segregate daughter plasmids to the proper ce11 positions on their own. There mut be host- encoded structures that act as liaisons between the plasmids and the host, so that plasrnids can
"sense" their locations in the cell. Since IHF is an abundant protein in bacteria (Ditto et al.,
1994), and acts as an accessory factor in P 1 partition, it is unlikely to be a direct localization determinant. With the exception of IHF, the number. structure and function of host facton that mediate partition in any active plasmid partition system are unknown, despite extensive investigation.
There are several potential roles for host facton that position daughter plasrnids. These roles would perhaps resemble those aheady descnbed for chromosome partition, such as a tethering component and a fixed cellular attachent site (Figure 5). Many types of screens have been performed in the 1st few years in an attempt to identifi host factors for P 1 and the other unit copy plasmids, and other than IHF, none has been found. For example, Biek and Cohen
(1986) performed a screen for bacterial mutations that destabilized low-copy-nurnber plasmids.
However, they only identified mutations in the recombination gene recD, which increased plasmid concatemerization. Niki and coworkers (1988) also performed a screen for mutations in
E. coli to identiQ chromosornal genes required for F plasmid partition, but that screen only yielded replication and recombination factors. A yeast MO-hybrid screen dso failed to identiS direct interactions between bacterial host proteins and Pl ParA or ParB (J.A. Surtees, M.Sc. thesis, University of Toronto, 1996).
17 It is possible that partition components are essential for the bacterial host and cannot be mutated, thus explaining the failure of these screens to identifj host factors. It is also possible that interactions between the plasmid and host partition factors require more than two proteins, which would account for the nonsuccess of the yeast two-hybrid system. It was therefore necessary to design a strategy for identming host factors that would avoid these potential problems while exploiting what is known about partition proteins.
Previous experiments have show the relative levels of ParA and ParB to be crucial for
Pl partition. Overproduction of ParA alone inhibits P 1 partition, at least in part by shutting down transcription from the par operon, although other interpreîations are possible (Abeles et al., 1985). Excess ParB production also destabilizes P 1, and this effect is even more dramatic than mutations that elirninate par function (Funnell, 1988a). Excess ParB does not lower P 1 copy number and therefore inhibition is due to a segregation defect. It was proposed that excess
ParB sequesters P 1 via the pars site, thus preventing active, or even random, partition (Funnell,
l988a).
Overproduction of the analogous Par proteins in other partition systems has also been reported to interfere with partition. Overproduction of SopB fiom F, or of ParR (ParB analog) from R1 destabilizes their respective plasmids (Ogm and Hiraga, 1983; Kusukawa et al. 1987:
Dam and Gerdes, 1994). In Caulobacter crescentus, hi& expression of either parA or pari3 resuits in rnislocalization of ParB and in ce11 filamentation (Mohl and Gober, 1997).
Overproduction of both ParA and ParB has minimal effect on cell division, but does cause the mislocalization of ParB and Mproper partition of chromosomal DNA (Mohl and Gober, 1997).
Al1 of these observations lead to the conclusion that partition proteins are lirniting in the cell, and that their levels are crucial for proper partition. It would thus seem appropriate to carry out a genetic screen that will depend on the assurnption that the levels of other partition components
18 are also crucial, perhaps even limiting in the cell, and that an excess of any one product will destabilize the entire system, resulting in the loss of Pl. This thesis describes a genetic screen to identify host factors that interfere with Pl partition when they are expressed at high levels. The rationale was that overproduction of key proteins involved in Pl plasmid partition would dismpt the partition process and lead to the bss of Pl.
In sumrnary, using a high-copy-number genomic Iibrary, I identified nine genes that destabilize P 1 when overexpressed. However, insertion mutations in these genes revealed that none of their gene products were directiy required for Pl partition. Subsequent tests also failed to identifi their specific functions in partition, but it remains possible that these gene products exert their effects on partition indirectiy, by affecting another essential component of the partition system. CHAPTER 2
MATERIALS AND METHODS Bacterial Strains and Plasmids
The E. coli K12 strains used for screening the library and al1 subsequent tests were al1 denvatives of DH5 (Table 2). DHS(hprecA) and DHSlacl::Tc(lprecA) contain a Ac1857 prophage carrying the E. coli recAv gene and were used as recipient strains for Pl transductions
(see page 26). JC7623 is a denvative of AB 1 157 (Horii and Clark, 1973) that carries the recBC and sbcB(C) mutant alleles; these mutations inactivate the RecBCD exonuclease that degrades linear DNA, but allow homologous recombination to occur by the RecF pathway (Goldmark and
Linn, 1972; Kushner et al., 197 1). JC7623 was used for transformation by linear DNA hgments,
pST52 is a high-copy-nurnber derivative of RSF1030 that carries a chloramphenicol- resistance gene and is compatible with pBR322 derivatives (Som and Tomizawa, 1982; Figure
6). pBR327 is a hi&-copy-nurnber derivative of pBR322 that carries an ampicillin-resistance gene (Covarrubias et al., 198 1 ; Figure 6). pBEF2 18 is a unit-copy rniniP 1 plasrnid carrying the lach gene and a kon' gene for kanamycin resistance (Figure 7). It is derived fiom pLG49, an equivaient plasrnid carrying Cm' rather than kan' (Funnell and Gagnier, 1995). pNE25 was constructed by insertion of a miniTnl O-Tc' transposon into the knnr gene of pBEF2 18. Plasmids pAJM4, pAJM5, and pAJM6 are miniPl derivatives with a lach gene, but no pur system and a mutation in the incA locus which increases their copy number from one to four (Figure 8). They differ ody in the orientation of the lach and kan' genes. These plasmids are derivatives of pALA3 1 8 (Pal et al., 1 986). pBEF 1 3 1 chesthe P 1 par promoter, the parA gene, and a par&
IacZ fusion gene (E. coli lac2 fwdto the 19" codon ofparB)cloned into the lac fusion vector pMLB 1034 (Silhavy et al., 1984). pBEF 1 30 contains the latter parB-lac2 fusion gene under the control of the îrp promoter, also in pMLB 1034. Barbara Funnell constructed plasmids pBEF2 18, pBEF 130, and pBEF13 1, and plasrnids pAJM4, pAJM5, and pAM6 were constructed by
21 Andrew Momson. pSE418 (a gift from Steve Elledge, Baylor College of Medicine) is a 6.0-kb plasmid carrying ampicillin and spectinomycin resistance genes. pMC9 is a pBR.322 derivative carrying the lach, ampicillin and tetracycline resistance genes (Calos et al., 1983).
Media and Reagents
LB and M9 minimal media were prepared as descnbed (Sambrook et al., 1989). M9 medium was supplemented with 100 pg thiamine-HCl per ml, 0.2% casamino acids (Difco), 50 pg tryptophan per ml, and 2 pg X-gal(5-bromo-4-chloro-3-indolyl PD-galactopyranoside,
Jersey Supply Lab) per ml. LCA agar plates are LB plates with 1% agar and 5 mM CaC&.
Antibiotics were used at the following concentrations: ampiciIlin, 100 pg/d; chloramphenicol,
25 pgM; kanamycin, 25 pg/ml; spectinomycin, 30 pg/ml; and tetracycline, 15 pg/ml.
Adenine (Sigma), used to supplement media for growingpzirB::kan dns,was present at 100
MW-
Restriction endonucleases, T4 DNA ligase, E. coli DNA polymerase 1 Klenow fragment, calf intestine alkaline phosphatase, and T4 DNA polymerase were purchased fiom either New
England Biolabs or Boehringer Mannheim and used as recommended by the suppliers. The radioisotopes ~)'P-~ATP(Mandel) and a3'p-dTTP (Mandel) were used for labeling probes for
Southem analyses, and ~)'s-~ATP(Amersharn) was used for DNA sequencing reactions. ONPG
(2-nitrophenyl-P-D-galactopyranoside,Boehringer Mannheim) was used as a substrate for liquid
P-galactosidase assays.
Preparation of DNA
Plasmid DNA was prepared nom 1 -5 mi of saturated culture by the alkaline lysis
"miniprep" method (Sarnbrook et al., 1989). Total ce11 DNA (chromosomal and plasmid) was prepared as described by Projan et al. (1983). Plasmid DNA used for cloning and sequencing was purified using Wizard mini-prep columns (Promega) and DNA fragments were purified fiom agarose gels using a QIAEX kit (QIAGEN Inc.) according to the manufacturers' directions.
Transformations
Competent cells were prepared by CaClz shock treatment (Sambrook et al., 1989) and left on ice overnight prior to transformations. Cells (0.05 - 0.2 ml) were incubated with 0.5 - 5.0 pl
(approximately 50-300 ng) plasmid DNA for 30 minutes on ice, heat-shocked for 2 minutes at
42"C, cooled to room temperature for 5 minutes, mixed with 0.5 ml LB medium, and incubated in a 37°C shaker for 1 hour. Culture samples (0.05 - 0.3 ml) were then plated on LB plates containing the appropriate antibiotic(s).
Screen for High-Copy-Number Inhibitors of Pl Plasmid Partition
An E. coli genomic library was used to transform DHSlackTc(pBEF218). The library was constnicted by Donghong Xu (M.Sc. thesis, University of Toronto, 1995), and contains
8,000 to 10,000 different genomic clones with an average insert size of 4 kb, in the pST52 vector. The library was created from a partial SaBA digest of DHSAlac genomic DNA and represents a 7- to 9-fold coverage of the E. coZi genome. In addition, complementation tests performed by B. Funnell indicated that the library plasmids adequately represented the E. coli genorne. Approximately 50,000 transformants were pooled, diluted, plated ont0 M9 minimal medium agar plates containing X-gal, and incubated at 37°C for approximately 40 hours. About
34,800 library tramformants were screened, and dl blue colonies were transferred using toothpicks onto LB + Kan + Cm plates. The resulting colonies were then patched with a Bat- ended toothpick ont0 M9 + X-gal plates and incubated at 37°C for approximately 40 houn (as were al1 colonies used in subsequent tests to maintain consistency in blue colour development).
Al1 patches that were bluer than the DHSlacl::Tc@BEF218, pST52) control (which produces 0.1-
0.3% blue colonies as measured by plasrnid stability tests described subsequently) were
23 categorized as positive candidates (Table 3). Plasmid DNA was extracted fiom each positive candidate, and the DNAs were subsequently used to retransform fiesh DHSlackT'(pBEF2 18).
Three or four colonies were then patched onto M9 + X-gai plates (the "Retransformation Testy')), and any library plasmid that dltumed the colonies darker blue than the control were used to transform DH5. Three or four DH5 transfonnants were patched onto M9 + X-gal plates (the
"Lac Expression Test9'), and any library plasmid that tumed these cells blue were discarded. The remahhg library plasmid candidates were used to transform DHSlacl:: Tc containhg either pA.JM4, pAJM5, or pA.Jh46, and four colonies were patched onto M9 + X-gal plates (the
"Replication Test"). Library plasmids that turned any of these cells biue were elimïnated. The rernaining library plasmids were then digested with HincII, EcoRV, BamHI, and Pst1 (separate digests) and their DNA fragments, separated by agarose gel electrophoresis, were compared to create restriction maps. These restriction maps was used to identim identical plasmids.
DNA Sequencing
The chrornosomal DNA at the plasmid DNA/chromosomaI DNA junction was sequenced
(100-1 50 base pairs) using a modification (Tabor and Richardson, 1987) of the dideoxy chain termination method of Sanger et al. (1977) with a T7 Sequencing Kit (Pharmacia) according to the supplier's protocol. The primers used for sequencing were BF 10
(5 ACTCAATCTTGTCAATATTG) and BF 13 (5 'GTAGCTCAGCGAACCTTG) purchased
£kom Vetrogen. Chromosomal sequences were used to search the NCBI database via the BLAST server (Madden et al., 1994-1998) to find the complete DNA sequence and locations of restriction sites for each insert.
Subcloning Light Blue Candidates
Al1 library inserts that turned DHSlackTc(pBEF218) light blue (Category B; only slightly darker than the vector control-see Table 3) were subcloned into pBR327. The 3.7-kb
24 BgnI fragment of pNE6 was cloned between the EcoEU and BmH.sites of pBR327 after blunt ends had been created for each hgment. Subsequent library plasmids were subjected to the same procedure with the following specifications (see Figure 9 for diagrams of al1 library inserts and note that some of the restriction sites are in the pST52 vector as indicated in Figure 6): the
2.7 kb SiyI hgment of pNE7, the 3.0 kb BglII-HincII fiagrnent of pNE11, the 3.5 kb HNicII fhgment of pNE 13, the 2.3 kb hIIfiagrnent of pNE 14, the 2.4 kb Se1 fiagment of pNE 16, the
3.5 kb SfyI-BamHI fiagrnent of pNE 17, the 3 -5 kb StyVBamHI fizigment of pNE 19, the 4.3 kb
Styl hgment of pNE20, the 3.6 kb BamHI-BglII hgment of pNE2 1. and the 3.8 kb Sryl-BamHI fragment of pNE22. pNE 18 and pNE23 were done in 2 parts: pNE 18 was digested with BgtII and Sryi to yield a 2.6 kb fragment and with HincII to yield a 1.5 kb fiagnient, and pNE23 was digested with StyI to yield 2.3 kb and 1.8 kb hgrnents. These hgments were individually cloned into pBR327.
Idenwing Important Genes
The genes causing a medium to dark blue phenotype in DHSlacl::Tc@BEF218) were identified in pE2, pNE3, pNE5, pNE8, pNElO. and pNEl2 using minitransposon mutagenesis.
The minitransposon used was a Tnl O-ATS denvative canying a kanarnycin resistance cassette and was introduced into cells by rneans of a phage, AM13 16. The latter contains mutations to cripple phage replication genes, the 7c repressor gene, and phage integration system genes
(Kleckner et al., 199 1). Minitransposons were preferable to wild-type transposons because they transpose at a much higher fiequency. For exarnple, a 9-kb transposon will transpose at approximately 1% the fiequency of a 2-kb minitransposon (Kleckner ef al., 1991).
Minitransposons are also more convenient that wild-type transposons because they have the transposase gene located outside the transposon itself so that it is left behind on the donor vector.
This ensures that additionai rounds of transposition do not occur and that the insertion is stable.
25 Also, the transposase gene in Tnl O-ATS derivatives contains a mutation that reduces its target site specificity, thus increasing the chance of a particular gene receiving an insertion.
The protocol used was a combination of Procedures 2 and 4, as described by Kleckner et al. (199 1). A one-ml culture of N 1O0 cells containing a library plasmid was incubated overnight in LB + Kan, centrifuged, and resuspended in O. 1 ml LB. The cells were mixed with 0.1 ml of phage stock (muitiplicity of infection of approximately I phage per cell) for 15 minutes at room temperature and 15 minutes at 37OC. To remove unadsorbed phage and allow expression of antibiotic genes, cells were washed with 1 ml LB + 50 mM sodium citrate, resuspended in 1 ml
LB + citrate, and incubated at 39°C for 1 hour. Then 0.3 ml of each culture was plated ont0 LB +
Kan plates, and incubated at 3PC overnight. Approximately 10,000 transposition colonies were pooled for each sample to increase the probability that an insertion for each gene in the library insert would be recovered. Plasmid DNA was extracted, and any plasmid DNA carrying an insertion was selected by transforming fresh DH5 to kanamycin resistance. Plasmid DNA was isolated fiom at least 20 of the transformants, and the location of the minitransposon insertion was identified via restriction map analysis. Library plasmids carrying insertions in predicted genes were then used to transform DHSlac~:Cm@NE25)and these colonies were patched ont0
X-gal plates.
To disrupt purB in pNE l and McC in pNE12, I cloned a Aan' cassette fiom pUC-4K into the BgflI site and the EagI site, respectively.
Construction of Chromosomal Insertion Mutants
Chromosomal insertion mutations were constnicted by the gene replacement technique descnbed by Jasin and Schimmel(1984). Competent E. coli JC7623 were transformed by linearized pNE library plasmids containhg the kanr gene inserted into the genes to be mutated.
Library plasmids were fkt linearized with a restriction endonuclease. The DNA sample was
26 then extracted once with phenol-chloroform and once with chlorofom, precipitated with ethanol and resuspended in 20 pl TE (1OrnM Tris (pH 8.0), 1 mM EDTA). During transformation, a double recombination event between the homologous regions of DNA in the chromosome and
plasmid insert resulted in the insertion of kan' into the chromosomal gene. The correct insertion of the kan' gene Uito the chromosome was confkned by Southem blot analysis of chromosomal
DNA, as described by Sambrook et al- (1989).
The mutant alleles were then transferred to DH5 and DH5lacl::Tc by P 1-mediated
transduction, using a protocol descnbed by Miller (1992). Overnight cultures of mutant strains
in the recBC sbcB(C) background were infected with PIrev6 and plated onto LCA agar plates.
P lrev6 is a derivative of P I vir that exhibits a high fiequency of transduction (Sternberg and
Maurer, 1991). Incubation was carrïed out at 37°C for 4-6 hours until confluent ce11 lysis
appeared. The lysate was then isolated fiom the agar and used to transduce DHS(hprecA) and
DHS(hprecA) to kanamycin resistance. Kanr colonies were then cured of the AprecA prophage
by heat-shocking 2 ml of an early-log-phase culture at 42OC for 4 minutes, diluting the culture
40X into LB + 50mM sodium citrate, and incubating in a 30°C shaker for 1 hou. Samples (0.2
ml) of each culture were then plated onto LB + Kan plates and incubated ovemight at 42°C.
Heat-resistant colonies were re-streaked ont0 LB + Kan plates and grown ovemight at 4-C. UV
sensitivity of the resulting colonies confirmed the Ioss of the recA+ gene.
Microscopy
Cells were prepared for microscopy and stained with the fluorescent nucleoid stain DAPI
(4', 6-diamidino-2-phenylindole)as descnbed by Hiraga et al. (1989). Cells were exarnined in a
Nikon Microphot FX-A microscope (kindly provided by Andrew Spence), using fluorescence to
visualize DAPI-stained chromosomes, and Nomarski optics to visualize gross rnorphology. Plasmid Copy Number Measurernents
Copy numbers of pAJM4, pklM5, and pA.JM6 were measured by Southem analysis. The amounts of plasmid lad and chromosomal lac1 hybridizing to a lac1 probe were quantified and compared, as described by Funnell and Gagnier (1995) and the legend to Figure 1 1.
P-Galactosidase Assays
Expression of lac2 was measured in Iiquid cultures following ce11 permeabilization by chloroform and SDS as described by Miller (1992), using ONPG as a substrate.
Subcloning Spr into Library Plasmids
To test the stability of pLG49 in each of the DH5luck:Tc~geneX:knnstrains in the presence of each of the library plasmids, a Spr gene from pSE418 was cloned into each library vector for selection: pNE's 1,5, 8, 10, and 12 had a BumHI hgment of Spr cloned into the Pst1 site on pST52 (completely replacing the Cm'gene) and pNE's 2 and 3 had the same Spr cassette cloned into the EcoRl site in the Cmr gene.
Plasmid Stabiliîy Assays
Destabilization of miniP 1 was confkmed for each library plasmid that tumed
DHSlacl: :Tc(pBEF2 18) blue on X-gal plates and passed al1 subsequent tests.
DHSlacl::Tc(pBEF218) cells containing a library plasmid or the vector pST52 were grown overnight in LB with chloramphenicol (non-selective for miniPl). The cultures were diluted
10,000-fold in LB, plated ont0 M9 plates supplemented as described previously, and incubated for 40 hours at 37°C. The number of dark blue colonies arising out of a population of white (or lighter blue) colonies was counted to measure miniPl plasmid loss.
The goal of my project was to identifi host factors that are essential for Pl plasmid partition. It has been previously shown that overproduction of ParA or ParB interferes with partition of P 1 and other low-copy plasmids (Abeles et al., 1985; Funnell, 1988a; Ogura and
Hiraga, 1983; Kusukawa et al., 1987; Dam and Gerdes, 1994), and 1 reasoned that overproduction of host factors might similarly interfere with P 1 partition (see Introduction).
Based on this rationale. a screen was designed to identiQ host factors that participate in the positioning of daughter plasmids. 1 screened a hi&-copy-number E. coli genomic library to fïnd gene products that destabilize Pl when they are overproduced. As a "tester strain", 1 used a lacl lad+E. coli strain containing a miniP 1 plasmid, pBEF2 18, which carries the laci" gene
(Materials and Methods). These cells are de-repressed for P-galactosidase expression unless they stably maintain the miniP L plasmid carrying the lac1 repressor gene. When grown in the presence of X-gal, cells in which Pl is stable lead to colourless (white) colonies and cells in which PI is unstable lead to blue colonies. The intensity of the blue colour is dependent on the amount of instability, and this colour screening system is very sensitive to small changes in miniP 1 stability (B. Funnell, personal communication).' 1 was therefore confident that the degree of blueness produced in colonies was representative of the level of P 1 instability caused by the library plasmid.
I then isolated library plasmids that destabilized miniPl. Nine hundred and sixty- four library inserts that destabilized miniPl in the initial test were then categorized as (A), (B),
(C), (D), or (E), according to their degree of blueness (Table 3). Most of the library candidates fell into the (A) category and were discarded, while the remaining 3 16 candidates were Mer
' Experiments with parS mutants have shown that slightly decreasing P 1 stability coincides with a detectable increase in the blue phenotype produced on X-gal plates (T. Sutcliffe and B. FunneII, unpublished results). analyzed (see Figure 10 for summary of dl tests).
1 expected that some colonies would be blue for reasons other than destabilization of P 1 during partition and 1 performed several tests to eliminate false positives. First, 1 confirmed that
P 1 instability was a direct result of the presence of a library plasrnid by transfodg each plasmid into fresh tester strain. This "Retransfomation Test" eliminated candidates that were not reproducibly blue, such as those that experienced only random Pl loss, or those that were blue for superficial reasons, such as ce11 density of the patch. This test eliminated 21 8 candidates.
Second, the remaining candidates were subjected to the "Lac Expression Test" which was designed to eliminate library inserts that were interferhg with the action of the Lac repressor. In this test, 1 observed the effects of the library plasmids on cells which had wild-type
Lac repressor provided by the bacterial chromosome. Library inseris that nimed colonies of these cells blue were assumed to be interferhg with either lacl expression or activity, or just making the cells so sick that they lysed. 1 eliminated 48 library candidates in this test, and by this stage ail library plasmids falling into category (E) had been eliminated.
The remaining candidates were then subjected to the "Replication Test" which was designed to eliminate library inserts that lowered plasmid copy number. To do this, 1 observed the effect of each library plasmid on the stability of a set of miniPl plasmids with no par system and a copy nurnber of four @AMplasmids, Figure 8). Because copy nurnber is four, the rate of random plasrnid loss is small, and these plasmids are relatively stably maintained. Since they have no active partition system, they are sensitive to small changes in copy number that will affect the ability to be distributed stably to daughter cells by domsegregation. Three versions of the plasmid were used since they had varying stability, pAJM4 being the least stable and pAJM6 being the most stable. The library plasmids that destabilized these miniPl s were
3 1 assumed to be decreasing the number of individual segregating units of miniPl and were consequentiy discarded. This test elùninated nine library plasmids, leaving 4 1 final candidates.
The remaidg library plasmids were then analyzed by restriction mapping to identifj equivalent library inserts. Of the 41 final candidates, 23 corresponded to different plasmids,
several of which were represented numerous times (see Figure 9). Finally, each library plasmid was confirmed for destabilization of Pl using plasmid stability assays (Methods and Matenals).
Characterization of Library Inserts
1 sequenced each end of the chromosornal DNA insert of each library plasmid and
subjected them to a BLAST! database search (Altschul et al., 1990) for alignment. Since the
DNA sequence of the entire E. coli chromosome is now known (Blattner, 1997a-d for example)
the complete sequences were identified for ail of the inserts (except one; see below), including
the location of the corresponding region on the E. coli chromosome (see Figure 9 and Table 4
for details). Al1 library plasmids except pm21 and pNE23 contained a single inserted
hgment of the E. coZi chromosome. pNE2 1 had a discontiguous insert (ca. 1 1.7 kb) consisting
of three separate fiagments. The middle -3.0 kb fragment was not easily accessible to
sequencing so its contents are unknown. pNE23 also had a discontiguous insert (ca. 3.5 kb)
made up of 2 separate genomic fiagments.
Each library plasmid contained an insert ranging in size from -2 to -1 2 kb, and most
contained several genes. 1 used transposon mutagenesis to identiQ the gene in each insert that
was responsible for destabilizing Pl due to overproduction of the gene product. The genes that
interfered with partition were subsequently referred to as "interference genes". I mutagenized
each library plasmid with miniTnlO transposons, and restriction mapping (Materials and
Methods; Figure 9) identified the locations of the minitransposon insertions. 1 then tested al1
mutagenized library plasmids for their effects on miniPl stability. Any candidate that no longer
32 destabilized miniPl was assumed to be carr).ing a minitransposon insertion in the interference gene.
The interference gene (or genes) for dl plasmids falling into the (C) and (D) categories, except pNE 1. were identified by a miniTn 1O insertion. For pNE 1,I cloned a kan' cassette directly into the insert (see Materials and Methods). Four of the libwplasrnids contained interference genes that encoded three known proteins. These genes were purB @NE l), cba2
@NE5 and pNE15), and helD (pNE8). purB encodes adenylosuccinate lyase, an enzyme that catalyzes 2 steps in de novo purine nucleotide biosynthesis (He et al., 1992; Neuhard and
Nygard, 1987). cbd4 encodes one of two subunits of cytochrome bd-II oxidase, an energy metabolism protein (Dassa et al., 1991; Atlung et al., 1997). helD encodes helicase IV, which has been implicated in the RecF pathway of recombination (Wood and Matson, 1989;
Mendonca er al., 1993).
The remaining five library plasmids in categories (C) and (D) contained interference genes that encode hypothetical proteins of unknown hinction. There were 3 genes in pNE3 that interfered with P 1 partition: yraM, yraN, and yraO (Figure 9). These genes may be in an operon
(dong with yraP) and encode products of 72.8 kDa 14.8 kDa, and 21.1 ma,respectively
(Blattner, 1997a). The gene in pNE3 and pNE4 that destabilized miniPl was yiiU. which encodes a hypothetical9.6 kDa pro tein (Blamier, 1997c). The interference gene in pNE 1O is yibQ, encoding a hypothetical30.7 kDa protein (Blattner, 1997d). Finaily, pNE I 2 contains yjcC, which encodes a hypothetical60.8 kDa protein (Blattner, 1997b).
Unfortunately, this method for identiQing interference genes proved to be dificult for library plasmids that had a light blue (B) phenotype. I therefore subcloned al1 library inserts falling under category (B) into a higher-copy-number plasmid, pBR327 (copy # = -50) to increase the interference gene dose. In this plasmid, pNE2O failed the Lac Expression Test and
33 pNE2 t failed the Replication Test, so they were discarded. pNETs6,7, 11, 13, 14, 16, 17, 18,
19,22, and 23 did not become darker blue, so they too were discarded.
Examinhg the Roles of the Interference Genes in Pl Partition
Next 1 asked whether any of these interference genes were essential for Pl partition or for E. coli growth. Chromosomal insertion mutants were constnicted by crossing the plasmid
Rad insertion mutation into the E. dichromosome, and were examined for potential phenotypes for Pl partition and E. coli growth (Materials and Methods). First, construction of these null alleles by linear ~ansforxnationwas efficient, and al1 alleles were easily transduced to other strain backgrounds. Therefore none of the gene products appeared to be essential for E. coli growth, although the yj~C::krrn strain was slightly temperature-sensitive at 42°C. 1 then tested the stability of the miniPl plasmid pLG49 in null mutants in the DHSlaciIoct strain background. None of the chromosomal mutations appeared to have a destabilizing effect (Le. al1 colonies were white), indicating that none of the gene products encoded by the library plasmids was directly required for Pl partition.
This conclusion led to the question of why overexpression of these genes was destabilizing miniP 1. I performed some simple tests in an attempt to elucidate the role of these gene products for E. coli andor Pl. 1 considered severai possibilities, such as effects on ce11 division, on Pl replication, and on Par protein expression. Since P 1 partition may be Iinked to septum formation (Gordon et al., 1997), it is possible that a library plasmid that disrupts ce11 division would inhibit Pl partition. 1 also considered that a library plasmid could have a subtle effect on average P 1 copy number that decreased its ability to be equipartitioned to daughter cells. In addition to these possibilities, it was conceivable that a library plasmid affecting expression of the Par proteins nom the par promoter could unbalance the ratios of ParA and
ParB, thus obstructing partition. Effects on E. culi gross morphology
Using light and fluorescence microscopy of DAPI stained cells, I examined the gross morphology of cells containhg either a chromosomal insertion mutation in the interference gene, or a wild type allele of the interference gene plus a library plasmid overexpressing the gene product (see Materials & Methods). Al1 of the strains appeared to have normal ce11 size, shape, division fiequency, and nucleoid distribution. including the slightly temperature-sensitive yjcC::knn strain at 42°C. These results indicate that none of the interference gene products have a mong effect on ce11 division or morphology.
Effects on Pl copy number
Since it was unknown how sensitive the Replication Test was to very smdl changes in
P 1 average copy number, 1 performed precise copy number measurements on each of the
Replication Test strains (i.e. DHSlackTc + pMM4? pAJM5, or pAJM6) in the presence of each of the library plasmids. This was an important test because any library plasmid that decreased the average copy number of these miniPl derivatives would influence their ability to be randornly distributed to daughter cells. Figure 11 summarizes the results of these measurements, which indicated that none of the candidates measurably decreased the average copy number of any of the pAJM plasmids. Surprisingly however, two plasmids (called 10-21 and 17-28 in Figure 11) that had failed the Replication Test also did not show a decrease in average copy number. It is possible that 10-2 1 and 17-28 actually decreased the number of
individual segregating units because daughter plasmid catenanes were not being unlinked
following replication or plasmid dimers were not being resolved into fiee monomers. The latter seems unlikely since the E. coli host was a recA mutant. It is also possible that the copy number distribution, rather than the average copy number, of daughter plasmids was affected. This uneven distribution could easily lead to a rapid loss of miniP 1 in enough subsequent generations
35 to have a noticeable effect on colony coiour phenotype. Finally, it is possible that the
"Replication Test" using the pAJM plasmids is acnüilly a more sensitive test of copy number.
Nevertheless, the pNE plasmids created no changes in copy number that could explain their destabilizing effects on P 1 plasmids.
Effects on Par protein expression
It was possible that the candidates interfered with Pl partition by affecting expression of the par genes fiom the par promoter. Expression of pm genes is regulated by ParA and ParB, so any library gene product that affects the ability of ParA to bind the par promoter, the ability of ParB to assist ParA in repression, or the basic ability of RNA polymerase to recognize the promoter could influence the quantities of Par proteins produced in the cell. 1 used a reporter plasmid that contains the par promoter, complete parA, and a parBnacZ fusion gene (see Figure
12) to test the first and third possibilities. 1 measured effects on the expression of the parB4acZ gene in the presence of each of the library plasmids by performing P-galactosidase assays. The results are summarized in Table 4, and show that none of the library plasmids deviate significantly fiom the pST52 vector control with respect to P-galactosidase activity. Therefore, none of library plasmids affect transcription from the par promoter or ParA's ability to repress transcription.
Interactions of library plasmid gene products
It was feasible that the gene products fiom the different library plasmids may interact with each other and affect each other's ability to interfere with partition. So 1 tested whether the gene products from the library inserts were required for the inhibitory effect on P 1 produced by one of the other gene products fiom a different library insert. To do this, 1 exarnined the phenotypes of cells that contained an interference gene nul1 mutation with each of the library plasmids. None of the combinations yielded cells with stably maintained miniP1, but the strains with yralv--:Kun + pNE3 and yra0::Kan + pNE3 even Merdestabilized miniP 1 than phi3 in the wild type background. CHAPTER 4
DISCUSSION Interference genes
In this snidy, 1 used a high-copy-number genomic library of E. coli to isolate genes that destabilize Pl when these genes are overexpressed. 1 identified nine such genes-purB. yraM yraN. yraO, yiill, cbdA. helD. yibQ, and McC-that were further examined to elucidate their function in P 1 partition.
First, chrornosomal nul1 mutations were created and miniPl stability was tested in these strains. None of the gene products appeared to be essential for the E. coli host or for Pl partition. I also examined the gross morphology of these cells, and they appeared to be normal, indicating that neither overexpression of the interference genes nor nul1 mutations in these genes caused defects in ce11 division. Precise copy-number measurements of the miniP 1 derivatives used in the Replication Test indicated that the library plasrnids had no strong effects on the average copy number of miniPl. Howeve- this test was not able to detect small effects on cecombination or copy number distribution. Also, the library plasmids do not appear to affect
Par protein expression although the reporter plasmid used in this test @BEFI 3 1, see Figure 12) does not express full-length ParB. This test codd not, therefore, show if the library plasrnids were afkting the ability of ParB to enhance repression of the par operon by ParA. Finally, 1 leamed that the destabilizing effects produced by each library plasmid are independent of any of the other interference gene products. In summary, none of these tests gave specific information about the hinctions of the interference gene products with respect to Pl partition.
One of the candidates, pur& encodes adenylosuccinate lyase, which catalyzes two reactions in de novo purine nucleotide biosynthesis (He et al., 1992; Neuhard and Nygard,
1987). The enzyme is required for synthesis of IMP, which is a precursor of both AMP and
GMP. Chromosomal purB nuil mutants require adenine supplementation for normal growth, and overexpression on the library plasmid slightly increases the rate of ce11 growth. It is not
39 clear why overexpression ofpurB would destabilize P 1. Perhaps aitering nucleotide levels in the ce11 affects the ceIl cycle or the level of other critical proteins that in turn affect partition.
Another library plasmid pNE2, contained three important genes that may be in an operon although no putative promoter is indicated in the database sequence (Figure 9; Blattner,
1997a). The genes yaM, yroN, and y~aOencode three hypotheticd proteins of unknown
function. These genes al1 have hornologs in other bacterial species, the closest being fiom
Haemophilus infuenzae. YraM. YraN, and YraO in E. coli have approximately 65% similar and 35-50% identical arnino acid sequence dignrnent with YraM, YraN, and YraO in H. inifuenzae, implying these proteins have functions that have been conserved. Perhaps more importantly, though, YraO shares about 70% homology and 45% identity to phosphoheptose isomerase (gmhA or IpcA gene) in Helicobacterpylori, H. inlfluenzae, and E. coli.
Phosphoheptose isomerase is a cytoplasmic enzyme involved in membrane lipopolysaccharide biosynthesis (Brooke and Valvano, 1996). In gram-negative bacteria, lipopolysaccharide (LPS) is an integral structural component of the outer membrane, and consists of lipid A joined to a core oligosaccharide (Schnaitman and Men% 1993). In E. di,phosphoheptose isomerase is encoded by the lpcA gene located at 5.3 minutes on the genetic map, and exists as a 22.6 Da cytosolic protein. LpcA is required for the isomerization of sedoheptulose 7-phosphate into the
LPS precursor D-glycero-D-mannoheptose 7-phosphate. E. coli strains containing mutations in
&CA have decreased amounts of porin proteins, and cannot grow in media containing detergents, bile salts, or hydrophobie antibiotics (e-g. novobiocin) (Coleman and Leive, 1979;
Tamaki et al., 1971). Most of the genes involved in LPS biosynthesis and assembly are located widiin the rfa ciuster in the 8 1-minute region of E. coli chromosome (Schnaitrnan and Klena,
1993). However, several genes involved in the early synthesis reactions of these compounds are not in this region, and their identities and locations remain unknown. it is, therefore, possible
40 that yrPO (and perhaps the other genes in this region) are involved in LPS synthesis or assembly, and that overproduction affects an essentiai partition component in the membrane. If yraO and lpcA are fûnctionaily redundant, this could also explain why a nul1 mutation iny~rrO has no effect on Pl partition. Aiso, if yraM, yruN, and yraO are organized in an operon and expressed from one promoter upstream ofyuM, then yraO may be the only interference gene.
In this case, insertion mutations into ymM and yrd may be having polar effects on the expression ofyraO. Overexpression of these gene products give a strong blue phenotype on X- gal plates, making them three of the more promising candidates.
The other more promising candidate is yiiU, which also encodes a hypothetical protein of unknown function (Blamier, 1997~).Its gene product also has homologs in other bacteria, dl of which have unknown fûnction. However, when this gene is overexpressed in the tester strain. it too gives a strong blue phenotype on X-Ga1 plates. In addition, this gene was independently isolated in two different library plasmids containhg overlapping clones.
In pNE5 and pNE15, the important gene was identified as cb&. CbdA (a.k.a. appC or cyxA) encodes one of two subunits for cytochrome bd-II oxidase (Dassa et al., 1991). E. coli encodes two other temiinal oxidases, cytochrome O oxidase and cytochrome d oxidase, which are expressed under aerobic growth conditions (reviewed by Poole and Ingledew, 1987). They catalyze the oxidation of ubiquinol-8 and the reduction of oxygen to water as the temiinal step in the aerobic respiration chain. Cytochrome bd-II oxidase is the most recently identified cytochrome, and its expression has been shown to be induced by anaerobiosis, phosphate and carbon starvation, and upon entry into stationary phase (Dassa et al. 1982; Atlung and Bronsted,
1994; Atlung et al., 1997). This enzyme is involved in energy metabolism, which could have far-reaching effects if overproduced. It seems likely that the effect of overexpression of such a protein on plasrnid partition would be indirect. Cytochrome bd-II oxidase is however an integral membrane protein so it cannot be excluded.
The important gene identified on pNE8, helD, encodes helicase IV (Wood and Matson,
1989). Helicase IV has been implicated in the minor RecF pathway of recombhation, which E- coli uses for homologous recombination and recombinauonal DNA repair (Mendonca et al.,
1993). The exact role of helicase IV is unknown, but it does exhibit functional redundancy with two other helicases, helicase II (uvrD) and RecQ helicase, so a nul1 mutation does not have an abnormal phenotype (Mendonca er al., 1993). It is possible that overproduction of helicase IV has a small effect on replication or recombination that is not detected in the Replication test.
The gene yibQ was identified in pNE10, and it encodes a hypothetical3 1 kDa protein of
unknown function (Blattner, 1997d). The gene product shares homology with unknown proteins
in H. influemue (also yibQ; 62% similar amùio acid sequence, 41% identical amino acid
sequence) and other bacterial species. It should be noted that 1 was unable to isolate a rniniTnl0
insertion in yibP, located immediately upstream of yibQ (Figure 9). This gene may affect the
expression of yibQ (which does not have a putative promoter indicated in the database sequence)
andior contribute to miniP 1 instability.
Finally, yjcC on pNE 12 encodes a hypothetical6 1 kDa protein of unknown function
whose closest homolog (40% sirnilar amino acid sequence, 24% identities) is the carboxy- terminal region of NtrC in Arorhizobium caulinodans (Blattner, 1997b). Nitrogen regulatory
protein C (NK) activates transcription of glutamine synthetase and other proteins that transport and degrade nitrogen sources during nitrogen-limited growth (for review see Weiss et al., 1992).
To activate transcription, phosphorytated NtrC dimers bind upstream enhancers and oligomerize on the DNA (Porter et al., 1993; Wyrnan er al., 1997). The NtrC oligomer then contacts the a54-holoenzyme fom of RNA polymerase and brings it to a Ntr regdon promoter, via DNA
looping (Wyman es al., 1997). NtrC oligomers possess enough ATPase activity to then open the
closed promoter region complex ,dlowing polymerase to gain access to the template DNA
strand (Weiss et al.. 1991). The carboxyl-terminus of NtrC, which is the region of greatest
homology to yjcC, contains the dimerization determinants and the DNA-binding domain (Porter
et al., 1993). It is, therefore, possible that the yjcC gene product possesses analogous domains,
but this similarity does not reveai its roIe in plasmid partition.
In conclusion, none of the candidates identified in this screen are directly required for Pl
plasmid partition, and none of the subsequent tests differentiated the gene products with respect
to PI stability. The genes that encode known proteins-purB. cbd4, and helD, do not have any
obvious connection to plasmid partition, and so probably have indirect effects on stable
maintenance of P 1. ïhe roles of genes that encode unknown proteins with characterized
homologs-yra0 and yjcC-are dificult to discern, for it is unknown whether the gene
products have functions similar to these homologs. It is also possible that some or al1 of these
interference gene products decrease the expression of an essential partition component.
Mutating the interference gene in the chromosome would therefore remove this inhibitory effect
on partition, although it should then lead to overexpression of the hypothetical essentiai
component, which based on previous reasoning, would still destabilize P 1.
Essential par components
There is also the remaining question of why this screen did not isolate the essential host
factors that were sought. There are several possibilities. For instance, there is a chance that the
host factor gene was not expressed at sufficiently high levels from the library plasmid. Al1 genes in the library inserts had to rely on expression from their natural promoters, so if the promoter or other DNA sequences required for its transcription or translation were not present, the protein products may not have ken present. I have already mentioned that one of the intederence gene products may be functionally redundant with another E. coli protein, and this may also be the case for the other library genes. It is conceivable that the rationale for the screen was incorrect and that overproduction of host factors does not interfere with partition, even though overproduction of ParA and/or ParB in Pl and several other partition systems does interfere with plasmid maintenance. It is also possible that any level of overproduction of an essential factor would be lethal to the cell and would not be detected due to underrepresentation in the library. Ultimately, when such essential host factors are identified, the genes isolated in this screen can be tested again more specifically for interactions with these factors. Due to the general lack of success of al1 screens perfomed in the past to identifi host factors, it is possible that localizing factors are lirniting in the ce11 and are essential for the host.
Future directions
Severai kinds of experiments may give Merinformation about the candidates identified in this partition interference screen. Fïrst, constnicting similar mini-vectors that contain a lad gene could test the effects of these library plasmids on the stability of F1P7, or other low-copy-nurnber plasmids. Since gene products that interfere with other partition systems could either be shared partition components or components that have global effects on ce11 metabolism and are only indirectiy related to plasmid partition, these results could be difficult to interpret. If the interference genes that 1 identified also afTected partition systems other than P 1. the roles of some of these gene products may become more apparent.
The straightforward tests that 1 perfonned to measure miniP 1 average copy nurnber and effects on Par protein expression could also be expanded and improved in sensitivity. For instance, recombination effects on the Replication Test plasmids could be detected by
44 perfofining hi&-resolution agarose gel electrophoresis on nicked substrates to detect catenanes andor dimers (Zechiedrich et al., 1997). Also, interference by library plasmids on par gene repression by ParB could be investigated using a reporter plasmid that contains ZacZ under the control of the par promoter where both ParA and ParB were provided in tram.
Another interesting possibility would be to examine the effects of the library plasmids on
Pl localization to the cellquarter positions using fluorescence microscopy. These effects could be observed using either FISH (using a protocol similar to that used for F as described by Niki and Hiraga, 1997) or the GFP-lac1 and rniniP 1-lac operator constructs used by Gordon and coworkes (1997, see Introduction). Immunofluorescence techniques could also be utilized to examine the effects of the library plasmids or null mutations on specific proteins, such as FtsZ, that are involved in cellular processes closely related to plasmid partition. To do os, antibodies generated against the protein to be examined would have to be obtained.
Several biochemical assays could be performed on the interference gene products. For example, interactions between candidate proteins and ParA and/or ParB could be investigated using immunoprecipitation or chernical cross-linking. in vitro studies of this nature would require candidate proteins that have been at least partiaily purified. One way this could be accomplished is by constmcting poly-histidine-tagged candidate protehs that cm be purified on nickel resin (Hochuii, 1990).
Finally, suppressoa of the interference genes could be identified by repeating the sarne screen descnbed, but in the presence of the library insert subcloned into a compatible high-copy- number plasmid, such as pBR322.
Obviously, the experiments descnbed above are only some of the possible avenues of
Merinvestigation that could be pursued. The most interesting candidates are the genes that encode unknown proteins and have a relatively strong destabilizing effect on Pl. Therefore, if
45 any of the suggested experiments were be to be performed in the near future, the focus should be on yraM yd,and yraO of pNE2 and yiill of pNE3 and pNE4. Figure 1. Models for active plasmid partition.
In (A), daughter plasmids bind unique, host-encoded recepton at distinct locations of a dividing cell via the partition cornplex, so that each daughter ce11 receives one copy of the plasmid. This mode1 requires specific host receptoa for each plasmid type.
In (B), daughter plasmids pair via the partition complex which requires plasmid-encoded components. The paired plasmids are then separated as septum formation occurs into separate daughter cells, or septum formation itself may aid in separation of the plasrnids to daughter cells. Either of these models require host factors to position the daughter plasmids. \ septum formation
plasmid septum fdan pairins & plaamid separatm
Figure 1.
48 Figure 2. The sopbar famiIy of partition operons for plasmids Pl, P7, and F.
Podenotes the operon promoter and arrows indicate the required trans-acting genes in each system. The genetic organization of the sop/par family of partition genes is very similar in al1 three systems. The tram-acting factors, pmA and par& of P 1 and P7 are closely reiated (57% amino acid identity for parA and 42% identity for parB, Davis et al., 1992), whereas sopA and sopB of F are less similar. The cis-acting sites are specific and are not similar in sequence. The sizes of the genes and cis-acting sites are not drawn to scale. parA par6
parA parB
sopc O 0-
Figure 2. ,...... Drd
T?TCGCCATT CTGTTTTTAA AGTAAATTAC TCT T TTCA TTGG 20 +10 +20 {ri+60 GACAAAAATT TCATTTAATG AG A AAGT AACC B A IHF A A B A
Figure 3. The pars site of Pl.
The nucleotide sequence of the pars site of Pl contains approxirnately 90 base pairs. The blue boxes indicate "Box A" motifs, the red boxes indicate "Box Bu motifs, and the green lines indicate the MF binding site (fiom Funnell and Gagnier, 1993). The Dra1 restriction site is indicated in Figure 2. partition &4 SeP- host faetors(?) fornation 1 ParA(?) host factors(?)
Figure 4: A Model of Pl Plasmid Partition.
ParB and IHF bind pars to form the partition cornplex, allowing the daughta plasmi& to pair.
The paired plasmids are then separated and localized to the cd-quarter positions. AAer septum formation, each daughter cell has one copy ofthe plasmid. Figure 5. Potential roles for host factors in Pl plasmid partition.
These two cartoons illustrate the type of components that might be required to position daughter plasmids pnor to ce11 division. There are several other possibilities; the models presented here are just two examples of simple partition systems.
(A) In this model, a tethering component, anchored to the membrane by a second component, pulls paired daughter plasmids apart to the cell-quarter positions. The plasmids may or may not remained anchored to the membrane at the friture division site during the next round of DNA replication.
(B) In this model, host factors are located in the septum. As the growing septum approaches the paired plasmids at the division site, the host factors pry the plasmids apart and push them to the cell-quarter positions. Figure 5. Figure 6. Vectors.
(A) pST52 is a 7.3 kb plasrnid with a copy number of about 20 (Som and Tomizawa 1982).
The library inserts were cloned into the BglII site.
(B) pBR327 is a 3.3 kb derivative of pBR322 with a copy number of about 50 (Covarrubias et al., 198 1 ). The library inserts were cloned into the EcoRIIBamHI site, replacing a segment of the
Tc! gene. Bgrn (cloning site)
Figure 6.
56 Figure 7. The test plasmid pBEF218. pBEF2 1 8 is 9.9 kb miniP 1 plasmid containing the complete P 1replication and partition regions, a kanarnycin resistance gene, and the lad repressor gene. Figure 8. Replication Test phmids.
5 -3 kb miniP 1 plasmids that contain mutations pAJM5 in the incA locus pennit increase in copy number absence of an active partition Figure 9. Bacterial DNA inserts of final library candidates.
The structure of each insert is drawn to scale. Clone names and number of times this clone was present (in brackets) in the final population is given at the far lefi. Restriction sites were assigned for each insert according to database sequence and BamHI, EcoRV, HineII, and PstI sites were confirmed by restriction mapping. Restriction sites are abbreviated as follows: Barn,
BamHI; BII, BglII; EI. EeoRI; EV, EcoRV; HII, HincII; HIII, HindIII; Kpn, KpnI; Ps& PstI;
PII, PvuII; Sty, SPI. Only the library candidates that were categorized as (C) or (D) (Tables 3 and 4) had their interference gene(s) identified with miniTnl0 or a Kanf cassette. The open circles and square with arrows indicate positions into which a miniTn 1O insertion @y transposition) and Kanr insertion (by cloning) were made, respective1y. Blue circles denote insertions that had no effect on the phenotype produced by the librq plasrnid in
DHSlucl::Tc@NE25), whereas white circles (or square) denote insertions that reversed the phenotype. Red arrows indicate interference genes identified by insertion mutations. pNE3 and pNE4 are overlapping clones, and yiiU was identified as the interference gene in pNE4 by process of elimination. pNE21 and pNE23 contain discontiguous inserts, and the middle
Fragment of pNE2 I was not sequenced so the open reading fiames and restriction sites are unknown. HII Pst Hn
Figure 9.
60 Pst Pst HI1 Pst
Figure 9 cont'd. BII Hm HU Stv EV BII Pst
EI PII
(ssb) yjcB
6'" &(sd
PII HII BI1 EI PII PII m EV
.. - - .. PII. . . - .. - .. - - EV HI1 , pNE19 1 II I l m EV () fn13) f290 f124 holE 2;.0218 (0220)
Figure 9 cont'd. Bam Pst PII Pst HII PII pNE20 rn fi m fi
Figure 9 cont'd. Total nrnnber transformants sc~eeaed:
Totd nimiber of blue-c~10Mespicked: 964 initial canaidates
Figure 10. Characterization of potential partition inhibitors.
This flow sheet summarizes the arialyses of hiplasmids that contained candidate genes for inhibitors of P 1 plasmid partition. Figure 11. Determination of copy numbers of Replication Test plasmids. Cells containhg pAJM4, pAJM5, or pAJM6 + negative control pST52 (lanes 1 and 2), positive control 10-21
(lanes 3 and 4), pNE l (lanes 5 and 6), pNE2 (lanes 7 and 8), pNE3 (lanes 9 and 1O), pNE5
(lanes 1 1 and 12), positive control 1 7-28 (lanes 13 and 14), pNE8 (lanes 15 and 16), pNE 1O
(lanes 17 and 18), and pW12 (lanes 19 and 20) were grown in LB + Cm + Kan until the %, reached 0.2 to 0.4. Cells were then chilled on ice to anest Mergrowth, three %, equivalents were collected by centrifugation, and DNA was collected as described by Fumel1 and Gagnier
(19951. For each sample, the amount of DNA in the even-numbered lanes is twice that in the odd-numbered lanes. Plasmid and chromosomal DNAs were digested with EcoRI and EcoRV to yield 0.85 kb and 1.5 kb bands, respectively, that were separated by agarose gel electrophoresis and quantified by Southern analysis (Materiais and Methods). The lac probe was a 0.8 kb HincII-EcoRI fragment from pMC9. On the autoradiogram, arrows indicate the position of the plasmid band, designated P, and the chromosomal band, designated C, that hybridize to the lac probe. Two DNA samples were collected from each ce11 culture containing either pAJM4, pAJM5, or pAJM6 for analysis by Southem hybridization. The measurements in the table represent the average of the two samples from each culture. pST52 10-21 pNEl pNE2 pM3 pNES 17-28 pNE8 pNE10 pNE12 n n nnnn nnnn
Figure 11.
67 (A) pBEF131
Figure 12. Effect of library plasmids on par gene expression.
(A) Diagram of reporter plasmid used in P-galactosidase assays. Expression ofparA and the parB/IucZ fusion product is under the control of the par promoter.
(B) Results of B-gahctosidase assays. Tests for expression fiom the par promoter were carried out in DHSAiac cells containing the reporter plasmid pBEF 13 1 and the indicated library plasmid or pST52 (Materials & Methods). The above example experiment was done in duplicate and the number of Miller units was averaged for the two measurements. Table 1. List of abbreviations-
Table 2. Bacterial strains-
Table 3. Categorfiation of blue phenotypes produced by übrary plasmids. Table 4. Surnmary of library inserts.
AE000395, AE000396 yruK, yruL, yruM, yraN, yraO, yrd A EOOO467 yiiU, ntenG overlapping clone of pNE3 yiiU, rrrettG, nreuA A EOOO 1 99 hya D, hyuE, IyuF AE000357 mu/S, ygbrl AE000377, AE000378 0180 AE000 198 Ir elD overlapping clone of pNE6 ygbA, murs /hlA, 0218 A EOOO439 yibP, yibQ, y ibDl !du 0514, kbl A E0002 19, AE000220 kdsA, chuA AE000477 yjc B, yjcC ssb, SOXS overlapping clone of pNE 1 1 hemK, orj2, o~I prfA, khA AE000286 JiG Ji F, JliH overlapping clone of pNE5 hycrC: hyD, hj)uE, h)lu F hyuB, cbJA AE000446, AE000447 JI35 j2 70, gyr B A E0002 1 7, A E0002 1 8 j244, 084, 01 46 0241, IreA AE000207 pyrC, dinl, p.(,/3 72 f46,yceB AE000278 J29U,f124, holE, 0218 fII3, a220 overlapping clone of pNE 19 091, /219,$113, j290, f12-1, hu1E 02 113 AE000439, AE000439 (discontiguous) yibP, yibQ, yibD, hofl;, hop, yheH, 05 14, hofl yheK yhc.1, yhd AE000258 071, 0154, 0193, 0192
AE000278, AE00049 1 (discontiguous) ylp, ylyu YI@*
Bi, E. and J. Lutkenhaus (1992): in "Prokaryotic Structure and Function: A New Perspective" (S. Mohan, C. Dow, JA. Cole, eds.), pp. 123- 152. Cambridge Univ. Press, Cambridge.
Bi, E. and J. Lutkenhaus (1993): Ce11 division inhibitors SulA and MinCD prevent formation of the FtsZ ring. J. Bacteriol. 175: 1 11 8- 1125.
Biek, D.P. and S.N. Cohen (1986): Identification and characterization of recD, a gene afEecting plasmid maintenance and recombination in Escherichia coli. J. Bacteriol. 167: 594- 603.
Blakely, G., S. Coiioms, G. May, M. Burke, and D.J. Sherratt (1991): Escherichia coli XerC recombinase is required for chromosome segregation at ce11 division. New Biol. 3: 789- 798.
Blattner, F.R (1997a): Direct submission to GenBank, accession nurnber AE000396.
Blattner, F.R (1997b): Direct submission to GenBank, accession number AE000477.
Blattner, F.R (1997~):Direct submission to GenBank, accession number AE000467.
Blattner, FOR(1 997d): Direct submission to GenBank, accession number AE000439.
Bowler, L.D. and B.G. Spratt (1989): Membrane topology of Penicillin-Binding Protein 3 of Escherichia coli. Mol. Microbiol. 3: 1277-1286.
Brooke, J.S. and M.A. Valvano (1996): Biosynthesis of hercore lipopolysacchmide in enteric bacteria: identification and characterization of a conserved phosphoheptose isomerase. J. Biol. Chem. 271: 3608-3614.
Calos, M.P., J.S. Lebkowski, and M.R Botchan (1983): High mutation frequency in DNA transfected into mammalian cells- Proc. Natl. Acad. Sci. U.S.A. 80: 301 5-301 9.
Chattoraj, D., K. Cordes, and A. Abeles (1984): P 1 plasrnid replication: negative control by repeated DNA sequences. Proc. Natl. Acad. Sci. U.S.A. 81: 6456-6460.
Chattoraj, D.K., K.M. Snyder, and A.L. Abeles (1 985): P 1 plasmid replication: multiple functions of RepA protein at the ongin. Proc. Natl. Acad. Sci. U.S.A. 82: 2588-2592.
Clerget, M. (1991): Recombination promoted by a short DNA segment of plasmid R1 and by a homologous segment in the terminus region of the Escherichia dichromosome. New Biol. 3: 780-788.
Coleman, W.C., Jr. and L. Leive (1979): Two mutations which affect the banier function of the Escherichia coli K- 12 outer membrane. J. Bacteriol. 139: 899-9 10. Covarrubias, L., L. Cervantes, A. Covarrubias, X Soberon, 1. Vichido, A. Blanco, Y.M. Kupersztoch-Portnoy, and F. Boiivar (1 98 1): Construction and characterization of new cloning vehicles V. Mobilization and coding properties of pBR322 and several deletion derivatives including pBR327 and pBR328. Gene 13: 25-35.
Dam, M. and K. Gerdes ( 1994) : Partitionhg of plamiid R 1. Ten direct repeats flanking the parA promoter constitute a centromere-like partition site parc, that expresses incompatibility. J. Mol. Biol. 236: 1289-1298.
Das, A., D. Court, and S. Adhya (1976): Integration-negative mutants of bacteriophage lambda- Proc, Natl. Acad. Sci. U.S.A. 73: 1954-1 963.
Dassa, E., M. Cahu, B. Desjoyaux-Cherel, and P.L. Bouquet (1982): The acid phosphatase with optimum pH of 2.5 of Escherichia Coli: physiological and biochemical çnidy. J. Biol. Chem. 257: 6669-6676.
Dassa, JO,H. Fsihi, C. Marck, M. Dion, M. Kieffer-Bontemps, and P.L. Bouquet (1991): A new oxygen-regulated operon in Escherichia coli comprises the genes for a putative third cytochrome oxidase and for pH 2.5 acid phosphatase (appA). Mol. Gen. Genet. 229: 341-352.
Dassain, M. and JO-P.Bouché (1994): The min locus, which confen topological specificity to ce11 division, is not involved in its coupling with nucleoid separation. J. Bacterïol. 176: 6143- 6145.
Davey, M.J. and B.E. Funne11 (1 994): The P 1 plasmid partition protein ParA. J. Biol. Chem. 269: 29908-299 13.
Davey, M.J. and B.E. Funnell(1997): Modulation of the Pl plasmid partition protein ParA by Aï?, ADP, and Pl ParB. J. Biol. Chem. 272: 15286-15292.
Davis, M.A. and SJ. Austin (1988): Recognition of the Pl plasmid centromere analog involves binding of the ParB protein and is modified by a specific host factor. EMBO J. 7: 1881-1888.
Davis, M.A., K.A. Martin, and S.J. Austin (1 990): Specificity switching of the P 1 plasmid centromere-like site. EMBO J. 9: 99 1-998.
Davis, M.A., K.A. Martin, and S.J. Austin (1992): Biochemical activities of the ParA partition protein of the Pl plasmid. Mol. Microbiol. 6: 1141 -1 147.
Davis, M.A. L. Radnedge, K.A. Martin, F. Hayes, B. Youngren, and S.J. Austin (1996): The P 1 ParA protein and its ATPase activity play a direct role in the segregation of plasmid copies to daughter cells. Mol. Microbiol. 21: 1029-1036.
DeBoer, P., R Crossley, and L. Rothfield (1989): A division inhibitor and a topological specificity factor coded for by the minicell locus determine proper placement of the division septum in Escherichia coli. Ce11 56: 641 -649. DeBoer, P., R Crossley, and L. Rothfield (1992): The essential bacterial cell-division protein FUis a GTPase. Nature (London) 359: 254-256.
Ditto, M.D., D. Roberts, and RA. Weisberg (1991): Growîh phase variation of integration host factor level in Escherichia coli. J. Bacteriol. 176: 3738-3748.
Ezaki, B., T. Opra, H. Niki, and S. Hiraga (199 1): Partitioning of a mini-F plasmid into anucleate cells of the mukB nul1 mutant, J. Bacteriol. 173: 6643-6646.
Friedman, S.A. and S.J. Austin (1988): The P 1 plasmid-partition system synthesizes two essential proteins fiom an autoregulated operon. Plasmid 19: 103-1 12.
Funneil, B.E. (1988a): Mini-P 1 plasmid partitioning: Excess ParB protein destabilizes plasmids containing the centromere parS. I. Bactenol . 170: 954-960.
Funnell, BoE. (1988b): Participation of Escherichia coli integration host factor in the P 1 plasmid partition system. Proc. Nad. Acad Sci. U.S.A. 85: 6657-6661.
Funneii, B.E. (1991): The P 1 partition complex at purs: The influence of Escherichia coli integdon host factor and of substrate topology. J. Biol. Chem. 266: 14328-14337.
Funnell, B.E. and Le Gagnier (1993): The Pl plasmid partition complex at parS. J. Biol. Chem. 268: 3616-3624,
Funneii, B.E. and L. Gagnier (1994): Pl plasmid partition: Binding of P 1 ParB protein and Escherichia coli integration host factor to altered pars sites. Biochimie 76: 924-932.
Funnell, B.E. and L. Gagnier (1 995): Partition of Pl plasmids in Escherichia coli mukB chromosomal partition mutants. J. Bacteriol. 177: 238 1-2386.
Gerdes, K. and S. Molin (1986): Partitioning of plasmid RI-structural and functional analysis of the parA locus. J. Mol. Biol. 190: 269-279.
Gerdes, K., T. Thisted, and J. Martinussen (1 990): Mechanism of post-segregational killing by the hokhok system of plasmid RI: sok antisense RNA regulates formation of a hok rnRNA species correlated with killing of plasmid-fiee cell. Mol. Microbiol. 4: 1807-18 18.
Goldmark, P.J. and S. Linn (1972): Purification and properties of the recBC DNase of Escherichia coli K-12. J. Biol. Chem. 247: 1849- 1860.
Gordon, G.S., D. Sitnikov, C.D. Webb, A. Teleman, A. Straight, R Losick, A.W. Murray, and A. Wright (1997): Chromosome and low copy plasrnid segregation in E. coli: Visual evidence for distinct mechanism. Ce11 90: 11 1 3- 112 1 .
Hale, C.A. and P.AmJODeBoer (1 997): Direct binding of FtsZ to ZipA, an essential component of the septal ring structure that mediates ce11 division in Escherichia coli. Ce11 88: 175-1 85. Hayes, F., L. Radnedge, MA. Davis, and S.J. Austin (1994): The homologous operow for Pl and P7 plasmid partition are autoregulated from dissimilar operator sites. Mol. Microbiol. 11: 249-260.
He, B., J.M. Smith, and H. ZaUcin (1 992): Escherichia coli purB gene: cloning, nucleotide sequence, and regulation by purR. J. Bacteriol. 174: 130- 1 36.
Hiraga, S., A. Jaffe, T. Opra, H. Mori, and H. Takahashi (1986): F plasmid ccd mechanism in Escherichia coli. J. Bacteriol. 166: 100- 104.
Hiraga, S., H. Niki, T. Ogura, C. Ichinose, H. Mon, B. Ezaki, and A. Jaffe (1989): Chromosome partitioning in Escherichia coli: novel mutants producing anucleate cells. J. Bacteriol. 171 : 1496- 1505.
Hirota, Y., A. Ryter, and F. Jacob (1968): Thennosensitive mutants of Escherichiu coli affected in the process of DNA synthesis and cellular division. Cold Spring Harbor Symp. Quant. Biol. 33: 677-693.
Hochuli, E. (1 990): Purification of recombinant proteins with metal chelate adsorbent, in "Genetic Engineering, P~ciplesand Methods" Vol. 12 (J.K.Setlow, ed.), pp. 87-98. Plenum Press, New York.
Horü, Z.I. and A.J. Clark ( 1973): Genetic analysis of the RecF pathway to genetic recombination in Escherichia coli K- 12: isolation and characterization of mutants. J. Mol- BioI. 80: 327-344.
Hu, K.H., E. Liu, K. Dean, M. Gingras, W. DeGmff, and N.J. Tmn (1996): Overproduction of three genes leads to camphor resistance and chromosome condensation in Escherichia coli. Genetics 143: 1521-1 532.
Huang, T., C. Cao, and J. Lutkenhaus (1996): Interaction between FtsZ and inhibitors of ce11 division. J. Bacteriol. 178: 5080-5085.
Ireton, K., N.W. Gunther IV, and A.D. Grossman (1 994): spoOJ is required for normal chromosome segregation as well as the initiation of spodation in Bacillus subtilis. J. Bacteriol. 176: 5230-5329.
Jaffé, A., T. Ogura, and S. Hiraga (1985): Effects of the ccd function of the F plasmid on bacterial growth. J. Bacteriol. 163: 84 1-849.
Jasin, M. and P. Schimmel(1984): Deletion of an essential gene in Escherichia coli by site- specific recombination with linear DNA fragments. J. Bacteriol. 159: 783-786.
Kato, J., H. Suzuki, and H. Ikeda (1992): Purification and characterization of DNA topoisornerase IV in Escherichia coli. J. Biol. Chem. 267: 25676-25684. Kleckner, N., J. Bender, and S. Gottesman (1991): Uses of transposons with emphasis on Tnl O. Methods Enzymol. 204: 139- 180.
Kornberg, A. and T.A. Baker (1992): In, "DNA Replication". W.H. Freeman and Co., New York, N.Y.
Kuernpel, P.L., J.M. Henson, L. Dircks, M. Tecklenburg, and D.F. Lim (1991): dg a recA- independent recombination site in the terminus region of the chromosome of Escherichia di. New Biol. 3: 799-8 1 1.
Kushner, S.R, H. Nagaishi, A. Templin, and A.J. Clark (1971): Genetic recombination in Escherichia coli: the role of Exonuclease 1. Proc. Natl. Acad. Sci. U.S.A. 68: 824-827.
Kusukawa, N., H. Mori, A. Kondo, and S. Hiraga (1987): Partition of the F plasmid: overproduction of an essential protein for partition inhibits plasmid maintenance. Mol. Gen. Genet. 208: 365-372.
Lehnherr, H., E. Maguin, S. Jafri, and M.B. Yarmolinsky (1993): Plasmid addiction genes of bacteriophage Pl : doc, which causes ce11 death on curing of prophage, and phd, which prevents host death when prophage is retained. J. Mol. Biol. 233: 4 14-428.
Leonhardt, H. (1990): Identification of a low-copy-number mutation within the PUB 1IO replicon and its effects on plasmid stability in Bacillus subtilis. Gene 94: 121-1 24.
Lin, D.CrH., P.A. Levin, and A.D. Grossman (1997): Bipolar localization of a chromosome partition protein in Bacillus subtilis. Proc. Natl. Acad. Sci. US.A. 94: 472 1-4726.
Low, B. (1968): Formation of merodiploids in matings with a class of Rec- recipient strains of Escherichia coli K-12. Proc. Natl. Acad- Sci, U.S.A. 60: 160.
Ludtke, D.N., B.G. Eichorn, and S.J. Austin (1989): Plasmid-partition fùnctions of the P7 prophage. J. Mol. Biol. 209: 393-406.
Lutkenhaus, J. (1993): FtsZ ruig in bacterial cytokinesis. Mol. Microbiol. 9: 404-409.
Lutkenhaus, J. and S.G. Addinali (1997): Bacterial ce11 division and the Z Ring. Annu. Rev. Biochem. 66: 93-1 16.
Madden, T., Shavirin, S.B., and J. Epstein (1994- 1998): Basic BLAST. NCBI. National Center for Biotechnology Information. Intemet. http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-bl~t?Jfom=O
Makino, S.-I., C. Sasakawa, and M. Yoshikawa (1988): Genetic relatedness of the basic replicon of the vinilence plasmid in Shigella and enteroinvasive Escherichia coli. Microb. Pathog. 5: 267-274. Martin, KA., S.A. Friedman, and SJ. Austin (1987): The partition site of the Pl plasmid. Proc. Natl. Acad. Sci. U.S.A. 84: 8544-8547.
Mendonca, V.M., K. Kaiser-Rogers, and S.W. Matson (1 993): Double Helicase II (uvrD)- Helicase IV (helD) deletion mutants are defective in the recombination pathways of Escherichia coli. J. Bacteriol. 175: 4325-4334.
Miiier, J.H. (1992): In "A Short Course in Bacterial Genetics". Cold Spring Harbour Laboratory Press, Cold Spring Harbour, New York.
Min, Y., A. Tabuchi, Y. Fan, D.D. Womble, and RH. Rownd (1988): Complementation of mutants of the stability locus of the IncFII plasrnid NRI. Essential functions of the tram-acting stbA and stbB gene products. J. Mol. Biol. 204: 345-356.
Mohl, D.A. and J.W. Gober (1997): Ce11 cycle-dependent polar localization of chromosome partitioning proteins in Cuulobacter crescentus. Cell88: 675-684.
Mori, Hm,A. Kondo, A. Ohshirna, T. Ogura, and S. Hiraga (1986): Structure and fhction of the F plasmid genes essential for partitioning. J. Mol. Biol. 192: 1-15.
Mori, H., Y. Mori, C. Ichinose, H. Niki, T. Ogura, A. Kato, and S. Hiraga (1989): Purification and characterization of SopA and SopB proteins essential for F plasmid partitioning. J. Biol. Chem. 264: 15535-15541.
Motabelli-Veshareh, M., D.A. Rouch, and C.M. Thomas (1990): A family of ATPases involved in active partitioning of diverse bacterial plasmids. Mol. Microbiol. 4: 1455- 1463.
Neuhard, J. and P. Nygaard (1 987): Purines and pyrimidines, in "Escherichia coli and SatmonetZa fyphimurium: Cellular and Molecular Biology" (F.C. Neidhardt, J.L. Ingraham, K.G.Low, B. Magasanik, M. Schaechter, and H.E. Umbarger. eds.), pp. 445-473. American Society for Microbiology Press, Washington, D.C.
Niki, H., C. Ichinose, T. Ogura, H. Mon, M. Morita, M. Hasegawa, N. Kusukawa, and S. Hiraga (1988): Chromosomal genes essential for stable maintenance of the mini-F piasmid in Escherichia coli. J. Bacteriol. 170: 5272-5278.
Niki, H., A. Jaffe, R Imamura, T. Ogura, and S. Hiraga (1 991): The new gene mukB codes for a 177 kDa protein with coiled-coi1 domains involved in chromosome partitioning of E. di. EMBO J. 10: 183-193.
Niki, H., R Imamura, M. Kitaoka, K. Yarnanaka, T. Ogura, and S. Hiraga (1992): E. coli MukB protein involved in chromosome partition forms a homodimer with a rod-and-hinge structure havhg DNA binding and ATP/GTP binding activities. EMBO J. 11: 5 10 1-5 109.
Niki, H. and S. Hiraga (1 997): Subcellular distribution of actively partitioning F plasmid during the cell division cycle in E. coli. Ce11 90: 95 1-957. Novick, RP. (1969): Extrachromosomal inheritance in bacteria Bacteriol. Rev. 33: 210-263.
Ogura, T. and S. Hiraga (1983): Mini-F plasrnid genes that couple host ce11 division to plasmid proliferation. Proc. Natl. Acad. Sci. U.S.A. 80: 47844788.
Pal, S.K., RJ. Mason, and D.K. Chattoraj (1986): Pl plasmid replication: role of initiator titmtion in copy number control. J. Mol. Biol. 192: 275-285.
Poole, RK. and W.J. Ingledew (1987): Pathways of electrons to oxygen, in "Escherichia coli and Salmonella typhirnurium: Cellular and Molecular Biology" (F.C. Neidhardt et ai., eds.), pp. 170-200. Amer. Soc. For Microbiol., Washington, D.C.
Porter, SC,A.K. North, A.B. Wedel, and S. Kustu (1993): Oligomerization of NtrC at the gld enhancer is required for transcriptional activation. Genes Dev. 7: 2258-2273.
Prentki, P., M. Chandler, and L. Caro (1977): Replication of the prophage Pl during the ce11 cycle of Escherichia coli. Mol. Gen. Genet. 152: 71 -76.
Projan, SJ., S. Carleton, and RP. Novick (1983): Determination of plasmid copy number by fluorescence densitornetry. Plasmid 9: 182- 190.
RayChaudhuri, D. and J.T. Park (1992): Escherichia coli ce11 division genefisZ encodes a novel GTP-binding protein. Nature (London) 359: 25 1-254.
Rosner, J.L. (1972): Formation, induction and curing of bacteriophage P 1 lysogens. Virology 48: 679-689.
Rothfield, L.I. (1 994): Bacterial chromosome segregation. Ce11 77: 963-966.
Saleh, A., S. Yamanaka, H. Niki, T. Ogura, M. Yamazoe, and S. Hiraga (1996): Carboxyl terminal region of the MukB protein in Escherichia coli is essential for DNA binding activity. FEMS Microbiol. Lett. 143: 21 1-216.
Sambrook, J., E.F. Fritsch, and T. Maniatis (1989): "Molecular Cloning: a Laboratory Manual". Second Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Sanger, F., S. Nicklen, and A.R Coulson (1977): DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 71: 1342-1346.
Sasakawa, C., K. Kamata, TVSakai, S.Y. Murayama, S. Makino, and M. Yoshikawa (1 986): Molecular alteration of the 140-megadalton plasmid associated with loss of virulence and Congo red binding activity in Shigellaflexneri. Infect. Immun. 51: 470-475.
Schnaitman, C.A. and J.D. Klena (1993): Genetics of lipopolysaccharide biosynthesis in enteric bacteria. Microbiol. Rev. 57: 655-683. Sharpe, M.E. and J. Errington (1996): The BaciZZus subtilis soj-spo0J locus is required for a centromere-like fûnction involved in prespore chromosome partitioning. Mol. Microbiol. 21: 50 1-509.
Silhavy, T.J., MLBerman, and L.W. Enquist (1984): "Experiments with Gene Fusions". Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Som, T. and J. Tomizawa (1982): Ongin of replication of Escherichia coli plasrnid RSF 1030. Mol. Gen. Genet. 187: 375-383.
Spratt, B.G. (1 975): Distinct penicillin-binding proteins involved in the division. elongation and shape of Escherichia coli K-12. Proc. Natl. Acad. Sci. U.S.A. 72: 2999-3003.
Sternberg, N.L. and R Maurer (199 1): Bactenophage-mediated transduction. Methods Enzymol. 204: 19-43.
Summers, D.K. and D.J. Sherratt (1 984): Multimerization of high copy number plasmids causes instability: ColEl encodes a determinant essential for plasmid monomerization and stability. Ce11 36: 1097-1 1 03.
Tabor, S. and C.C. Richardson (1987): DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 84: 4767-4771.
Tabuchi, A., Y. Min, C.K. Kim, Y. Fan, D.D. Womble, and RH. Rownd (1988): Genetic organization and nucleotide sequence of the stability locus of the IncFII plasmid NRI. J. Mol. Biol. 202: 5 1 1-525.
Tamaki, S., T. Sato, and M. Matsuhashi ( 1971): Role of lipopolysaccharides in antibiotic resistance and bactenophage adsorption in Escherichia coli K- 12. J. Bacteriol. 105: 968-975.
Walker, J.E., M. Saraste, M.J. Runswicke, and N.J. Gay (1982): Distantly related sequences in the a-and P-subunits of ATP synthetase, myosin, kinases and other ATP-requinng enzymes and a comrnon nucleotide binding fold. EMBO J. 1: 945-95 1.
Watanabe, E., S. Inamoto, M.-H. Lee, S.U. Kim, T. Ogura, H. Mori, S. Hiraga, M. Yamasaki, and K. Nagai (1989): Purification and characterization of the sopB gene product which is responsible for stable maintenance on mini-F plasmid. Mol. Gen. Genet. 218: 43 1- 436.
Webb, C.D., A. Teteman, S. Gordon, A. Straight, A Belmont, D.C.-H. Lin, A.D. Grossman, A. Wright, and R Losick (1997): Bipolar localization of the replication ongin regions of chromosomes in vegetative and sporulating cells of B. subtilis. Ce11 88: 667-674.
Weiss, D.S., J. Batut, K.E. Klose, J. Keener, and S. Kustu (1991): The phosphorylated form of the enhancer-binding protein NtrC has an ATPase activity that is essential for activation of transcription. Ce11 67: 155-167. Weiss, D.S., LE. Klose, T.R Hoover, A.K. North, S.C. Porter, A.B. Wedel, and S. Kustu (1992): Prokaryotic transcriptional enhancer, in "Transcriptional Regdation" (S.L. McKnight and K.R. Yamamoto, eds.), pp. 667-694. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Wientjes, F. and N. Nanninga (199 1): On the role of the high molecular weight penicillin- binding proteins in the ce11 cycle of Escherichia coli. Res. Microbiol. 142: 333-334.
Wood, E.R and S.W. Matson (1989): The molecular cloning of the gene encoding Escherichia coli 75-Da helicase and the determination of its nucleotide sequence and genetic map position. J. Biol. Chem. 264: 8297-8303.
Wyman, C., 1. Rombel, A.K. North, C. Bustamante, and S. Kustu (1997): Unusual oligomerization required for activity of NtrC, a bacterial enhancer-binding protein. Science 275: 1658-1661-
Yamanaka, K., T. Mitani, T. Ogura, H. Niki, and S. Hiraga (1994): Cloning, sequencing, and characterization of multicopy suppressors of a mukB mutation in Escherichia di. Mol. Microbiol. 13: 301-3 12.
Yamanaka, K., T. Ogura, HeNiki, and S. Hiraga (1996): Identification of two new genes mukE and rnukF, involved in chromosome partitioning in Escherichia coli. Mol. Gen. Genet. 250: 24 1-25 1.
Youngren, B. and S. Austin (1997): Altered ParA partition proteins of plasmid Pl act via the partition site to block plasmid propagation. Mol. Microbiol. 25: 1023- 1030.
Zechiedrich, E.L. and N.R Cozzareili (1995): Roles of topoisornerase IV and DNA gyrase in DNA unlinking during replication in Escherichia coli. Genes Dev. 9: 2859-2869.
Zechiedrich, E.L., Khodursky, A.B., and N.R Cozzareiü (1997): Topoisornerase IV, not gyrase. decatenates products of site-specific recombination in Escherichia coli. Genes Dev. 11: 2580-2592. IMAGE EVALUATION TEST TARGET (QA-3)
APPLIED IMAGE. lnc S 1653 East Main Street