DOCSLIB.ORG

Exploring Monascus Sanguineus As a Potential Natural Source for Pigment Production

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Exploring Monascus Sanguineus As a Potential Natural Source for Pigment Production International Research Journal of Biological Sciences ___________________________________ ISSN 2278-3202 Vol. 2(5), 59-67, May (2013) Int. Res. J. Biological Sci. Exploring Monascus sanguineus as a Potential Natural Source for Pigment Production Dikshit Rashmi and Tallapragada Padmavathi* Department of Microbiology, Centre for PG Studies, Jain University, Bangalore – 560011, Karnataka, INDIA Available online at: www.isca.in Received 27 th February 2013, revised 8th March 2013, accepted 9th April 2013 Abstract Monascus species are known as producers of bio-pigments, which are used for food coloring. For this study, a Monascus sanguineus strain was isolated from pomegranate. Its molecular identification was done by genome sequencing. The effect of different culture media, temperature, and pH on pigment production and mycelial growth was investigated in submerged culture. Production of the red pigment reached its maximum on the 16 th day of incubation (21.9 Color Value Units (CVU)/ml). The optimal temperature for microbial growth and pigment production was 30°C and the maximum pigmentation was observed at pH 6.5 (33.9 CVU/ gram dry substrate (gds). Effect of different solid substrates with varied carbon and nitrogen content on pigment production and optimization was also investigated. Oryza sp. (local polished rice) was found to be the best solid substrate (7.8 CVU/gds) amongst the experimented substrates. The determination of citrinin was carried out by liquid chromatography – mass spectrometry (LC-MS) . Keywords: Monascus , pigment, mycelial growth, genome sequencing, citrinin. Introduction Qualitative analysis for determination of citrinin was also performed. Monascus sp. belongs to the family Monascaceae of the phylum Ascomycecota. Based on the cultural characteristics, 9 Material and Methods Monascus species are internationally acknowledged. These are M. pilosus, M. ruber, M. purpureus, M. floridanus, M. Culture: A wild-type strain of Monascus was isolated from eremophilus, M. pallens, M. sanguineus, M. lunisporas, and M. pomegranate. The strain was maintained on Potato Dextrose argentinensis . However, over 20 species of Monascus have been Agar (PDA) medium and incubated at 28-30°C for 7 days, recorded in the literature since the genus Monascus was preserved at 4°C, and sub-cultured once every 4 weeks. proposed in 1884 1. The Monascus filamentous fungi have been used in Asia for a long time to color and flavor food and Inoculum preparation: Inoculum preparation for solid-state beverages 2,3 . These natural colorants are of practical interest fermentation was performed as described by Babitha et al. 9 with because the red pigments obtained are safe for usage in food some modification. One full loop of sporulated (6 days old) agar industry. Different strains of the genus Monascus are used in slope culture was diluted in distilled water. The spores were pigment production 4,5 . Monascus sp. has been used primarily in scraped off under aseptic conditions to produce a spore Southern China, Japan, and Southeast Asia for making red rice suspension to be used as the inoculum. wine, red soybean cheese and Anka (red rice) 6. Monascus pigments typically comprise six major azaphilone pigments: For morphological investigation, the isolated strain of Monascus Yellow pigments: monascin (C 21 H26 O5) and ankaflavin sp. was grown for 7 days on different growth media such as (C 23 H30 O5 ); Orange pigments: monascorubrin (C 23 H26 O5) and potato dextrose agar (PDA), sabouraud dextrose agar (SDA), rubropunctatin (C 21 H22 O5); and Red pigments: malt glucose peptone agar (MGPA), and malt extract agar 10 monascorubramine (C 23 H27 NO 4) and rubropuntamine (MEA) . 7 (C 21 H2O4) . Monascus sp. was also reported to co-produce the mycotoxin citrinin, as well as other potentially toxic For molecular identification, genomic DNA was isolated from metabolites, such as monascopyridines 8. the culture. The rDNA fragments of ~500 bp were amplified using the universal primers ITS1f (5'- The goal of this study was to isolate a Monascus strain and to CTTGGTCATTTAGAGGAAGTA) and NL4 (5'- GGTCCGTGTTTCAAGACGG), the sequencing PCR was set investigate the general conditions for growth and pigment 1 production on fungal media. Screening was carried out for up with ABI-BigDye® Terminatorv 3.1 Cycle Sequencing Kit . different solid substrates and these substrates with varied carbon Evaluation of the effect of various culture media, and nitrogen content were optimized for pigment yield. temperature, and pH on mycelial growth and pigment production of Monascus sanguineus : Mycelial growth of M. International Science Congress Association 59 International Research Journal of Biological Sciences ________________________________________________ ISSN 2278-3202 Vol. 2(5), 59-67, May (2013) Int. Res. J. Biological Sci. sanguineus in the listed fungal media was evaluated. In each and carbon sources used in the experiments according to the case, 50 ml of the growth medium in 100 ml flask was used. procedure described above 14,15 . The medium pH was adjusted to 5.5. After cooling, these media were inoculated with 0.5 ml of the M. sanguineus culture and Pigment extraction and determination: In the case of incubated for 16 days in static condition. Biomass and pigment cultivation on solid substrate, the culture medium was dried at were assayed on day 4, 8, 12, and 16 after inoculation. The same 50°C for 24 hr. One gram of fermented solid substrate was procedure was adopted to study the effect of temperature and taken for pigment extraction with 10 ml of 95% ethanol on a pH on mycelial growth and pigment production. To investigate shaker at 200 rpm for 24 hr. The extracts were allowed to settle the effect of temperature, the inoculated media were incubated at room temperature and then filtered through Whatman filter at 16, 30, 37, and 50°C. The effect of pH was studied at pH paper. Ethanol extracts of unfermented substrates were used as values of 4.5, 5.5, 6.5, 7.5 and 8.5 and kept for 15 days in static blanks. Analysis of pigment concentration was done using a condition after inoculation 11 . colorimeter at 510 nm. The absorbance values were converted into pigment units using the following formula: Dry cell weight: The mycelia separated from the broth by Color value = O.D. × dilution × volume of extracts/amount of filtration (Whatmann No. 1) were weighed on an analytical sample (g) 13 . scale, vacuum filtered through pre-weighed membrane filters, washed with distilled water, and dried in an oven at 50°C. The Determination of the presence of Citrinin: The instrument results were expressed in grams per liter 12 . used for the determination of citrinin was HPLC Thermo Finnigan Surveyor and MS Thermo LCQ Deca XP MAX. The Pigment content: The pigment content in submerged culture software was Xcalibur. The column used was BDS HYPERSIL was determined using culture filtrate. The filtrate was C18 with a length of 250 mm, i.d. of 4.6 mm and particle size of centrifuged at 10000 g for 15 min. Pigment concentration was 5 µm. The detectors used were HPLC PDA / UV detector (254 determined colorimetrically at 510 nm. The absorbance values nm) and the temperature was ambient with 10 µL as the volume were converted into pigment units using by the following injected. formula: Color value = O.D. × dilution × volume of extracts / amount of MS experimental conditions used were probe/ source voltage of 13 sample (ml) . 4.5 kV, sheath gas flow of 40.00 and auxiliary/sweep gas flow of 26.00. The source type was electro spray ionization (ESI) Substrate selection and solid-state fermentation: For solid- with capillary temperature of 275 °C and capillary voltage of 16 state fermentation four substrates were chosen, viz. Oryza sp. V. The mobilization gas flow was helium at approx. 1 ml/min (local polished rice), Eleusine sp. (finger millet) flour, Ipomoea and the helium in the mass analyzer cavity was maintained at sp. (sweet potato), and Manihot sp. (tapioca). These were 0.1 Pa (10 -3)16 . purchased from a local market of Bangalore, India. The physical form of the substrate was as follows: This analysis describes an approach involving the recognition of pattern of mass spectral analysis lines that are produced as result Eleusine sp. was taken in flour form, Manihot was graded into of LC separated analytes. The pattern recognition provides a minute threads, Lpomoea sp. was cut into small pieces, and method for the prediction of chemical structure and can be Oryza sp. was soaked in water overnight. applied to the sample that has not been examined. The spectral data used were the values of m/z and their related intensities. Initially, 10 g of the substrate was placed in a 250 ml conical flask to which 27.5 ml distilled water was added, pH was Statistical analysis: MS Excel and ANOVA were used for data adjusted to 6.0, and the medium was autoclaved at 121°C for 20 analysis. min. After cooling, the substrate-based medium was inoculated with 10% of the seed culture of M. sanguineus and incubated at Results and Discussion 28 - 30°C for 20 days 9. Moisture content was maintained between 56-60% and was calculated based on the following Isolation and identification of Monascus sp.: The Monascus formula, sp. strain was identified by its capacity for pigment production Moisture content of substrate (%) =100×(wet weight − dry in the medium and pigmented spores. Morphology (the size, weight) / wet weight 7. color, shape, and aerial hyphae) was studied on colonies. This Monascus sp. isolate was able to release the pigment into the Effect of nitrogen and carbon source on pigment media. Microscopic observation of the spores showed that production: Nitrogen sources such as peptone, yeast extract, perithecia were born singly on stalk. Coenocytic mycelium was and monosodium glutamate at 2, 6, and 10% concentration and observed and ascospores were round, smooth, and pigmented.
Load more

Recommended publications
  • 1 Recurrent Loss of Abaa, a Master Regulator of Asexual Development in Filamentous Fungi
    bioRxiv preprint doi: https://doi.org/10.1101/829465; this version posted November 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Recurrent loss of abaA, a master regulator of asexual development in filamentous fungi, 2 correlates with changes in genomic and morphological traits 3 4 Matthew E. Meada,*, Alexander T. Borowskya,b,*, Bastian Joehnkc, Jacob L. Steenwyka, Xing- 5 Xing Shena, Anita Silc, and Antonis Rokasa,# 6 7 aDepartment of Biological Sciences, Vanderbilt University, Nashville, Tennessee, USA 8 bCurrent Address: Department of Botany and Plant Sciences, University of California Riverside, 9 Riverside, California, USA 10 cDepartment of Microbiology and Immunology, University of California San Francisco, San 11 Francisco, California, USA 12 13 Short Title: Recurrent loss of abaA across Eurotiomycetes 14 #Address correspondence to Antonis Rokas, [email protected] 15 16 *These authors contributed equally to this work 17 18 19 Keywords: Fungal asexual development, abaA, evolution, developmental evolution, 20 morphology, binding site, Histoplasma capsulatum, regulatory rewiring, gene regulatory 21 network, evo-devo 22 1 bioRxiv preprint doi: https://doi.org/10.1101/829465; this version posted November 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 23 Abstract 24 Gene regulatory networks (GRNs) drive developmental and cellular differentiation, and variation 25 in their architectures gives rise to morphological diversity.
    [Show full text]
  • Elderberry for Flu • African Herb F~.R B,Ronchitis • Tamanu Oil • Herb Qual~Ty
    Elderberry for Flu • African Herb f~. r B,ronchitis • Tamanu Oil • Herb Qual~ty ' Number63 USA $6.95 CAN $7.95 7 25274 81379 7 If you think all bilberry extracts are alike, there's something you should know. There are almost 450 species of bilberry. But the only extract with clinically proven efficacy, lndena's Mirtoselect®, has always been made There are from a single species: Vaccinium myrtillus L. bilberries and To prove it, we can supply you with the unmistakable HPLC bilberries. fingerprint of its anthocyanin pattern. It may be tempting to save money using cheap imitations - but it's a slip-up your customers would prefer you avoid. To know more, call lndena today. I dlindena science is our nature™ www.indena.com [email protected] Headquarters: lndena S.p.A.- Viale Ortles, 12-20139 Milan -Italy- tel. +39.02.574961 lndena USA, Inc. - 811 First Avenue, Suite 218- Seattle, WA 98104 - USA- tel. + 1.206.340.6140 Yes, I want Membership Levels & Benefits to join the American Pkase add $20 for addmsli oursitk the U.S. Botanical Council! Individual - $50 Professional - $150 Please detach application and mail to: ~ Subscription to our highly­ All Academic membership American Botanical Council , P.O. Box 144345, acclaimed journal benefits, plus: Austin, TX 787 14-4345 or join online at www.herbalgram.org Herbal Gram ~5 0 % discount on first order 0 Individual - $50 ~ Access to members-only of single copies of ABC 0 Academic- $100 information on our website, publications from our Herbal 0 Professional - $150 www.herbalgram.org Education Catalog 0 Organization - $250 (Add $20 postage for imernarional delivery for above levels.) • HerbalGram archives ~ Black Cohosh Educational 0 Corporate and Sponsor levels • Complete German Module including free CE and (Comact Wayne Silverman, PhD, 512/926-4900, ext.
    [Show full text]
  • Phylogeny of Penicillium and the Segregation of Trichocomaceae Into Three Families
    available online at www.studiesinmycology.org StudieS in Mycology 70: 1–51. 2011. doi:10.3114/sim.2011.70.01 Phylogeny of Penicillium and the segregation of Trichocomaceae into three families J. Houbraken1,2 and R.A. Samson1 1CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands; 2Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands. *Correspondence: Jos Houbraken, [email protected] Abstract: Species of Trichocomaceae occur commonly and are important to both industry and medicine. They are associated with food spoilage and mycotoxin production and can occur in the indoor environment, causing health hazards by the formation of β-glucans, mycotoxins and surface proteins. Some species are opportunistic pathogens, while others are exploited in biotechnology for the production of enzymes, antibiotics and other products. Penicillium belongs phylogenetically to Trichocomaceae and more than 250 species are currently accepted in this genus. In this study, we investigated the relationship of Penicillium to other genera of Trichocomaceae and studied in detail the phylogeny of the genus itself. In order to study these relationships, partial RPB1, RPB2 (RNA polymerase II genes), Tsr1 (putative ribosome biogenesis protein) and Cct8 (putative chaperonin complex component TCP-1) gene sequences were obtained. The Trichocomaceae are divided in three separate families: Aspergillaceae, Thermoascaceae and Trichocomaceae. The Aspergillaceae are characterised by the formation flask-shaped or cylindrical phialides, asci produced inside cleistothecia or surrounded by Hülle cells and mainly ascospores with a furrow or slit, while the Trichocomaceae are defined by the formation of lanceolate phialides, asci borne within a tuft or layer of loose hyphae and ascospores lacking a slit.
    [Show full text]
  • Phylogeny of Chrysosporia Infecting Reptiles: Proposal of the New Family Nannizziopsiaceae and Five New Species
    CORE Metadata, citation and similar papers at core.ac.uk Provided byPersoonia Diposit Digital 31, de Documents2013: 86–100 de la UAB www.ingentaconnect.com/content/nhn/pimj RESEARCH ARTICLE http://dx.doi.org/10.3767/003158513X669698 Phylogeny of chrysosporia infecting reptiles: proposal of the new family Nannizziopsiaceae and five new species A.M. Stchigel1, D.A. Sutton2, J.F. Cano-Lira1, F.J. Cabañes3, L. Abarca3, K. Tintelnot4, B.L. Wickes5, D. García1, J. Guarro1 Key words Abstract We have performed a phenotypic and phylogenetic study of a set of fungi, mostly of veterinary origin, morphologically similar to the Chrysosporium asexual morph of Nannizziopsis vriesii (Onygenales, Eurotiomycetidae, animal infections Eurotiomycetes, Ascomycota). The analysis of sequences of the D1-D2 domains of the 28S rDNA, including rep- ascomycetes resentatives of the different families of the Onygenales, revealed that N. vriesii and relatives form a distinct lineage Chrysosporium within that order, which is proposed as the new family Nannizziopsiaceae. The members of this family show the mycoses particular characteristic of causing skin infections in reptiles and producing hyaline, thin- and smooth-walled, small, Nannizziopsiaceae mostly sessile 1-celled conidia and colonies with a pungent skunk-like odour. The phenotypic and multigene study Nannizziopsis results, based on ribosomal ITS region, actin and β-tubulin sequences, demonstrated that some of the fungi included Onygenales in this study were different from the known species of Nannizziopsis and Chrysosporium and are described here as reptiles new. They are N. chlamydospora, N. draconii, N. arthrosporioides, N. pluriseptata and Chrysosporium longisporum. Nannizziopsis chlamydospora is distinguished by producing chlamydospores and by its ability to grow at 5 °C.
    [Show full text]
  • Duke University Dissertation Template
    Systematics, Phylogeography and Ecology of Elaphomycetaceae by Hannah Theresa Reynolds Department of Biology Duke University Date:_______________________ Approved: ___________________________ Rytas Vilgalys, Supervisor ___________________________ Marc Cubeta ___________________________ Katia Koelle ___________________________ François Lutzoni ___________________________ Paul Manos Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biology in the Graduate School of Duke University 2011 iv ABSTRACTU Systematics, Phylogeography and Ecology of Elaphomycetaceae by Hannah Theresa Reynolds Department of Biology Duke University Date:_______________________ Approved: ___________________________ Rytas Vilgalys, Supervisor ___________________________ Marc Cubeta ___________________________ Katia Koelle ___________________________ François Lutzoni ___________________________ Paul Manos An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biology in the Graduate School of Duke University 2011 Copyright by Hannah Theresa Reynolds 2011 Abstract This dissertation is an investigation of the systematics, phylogeography, and ecology of a globally distributed fungal family, the Elaphomycetaceae. In Chapter 1, we assess the literature on fungal phylogeography, reviewing large-scale phylogenetics studies and performing a meta-data analysis of fungal population genetics. In particular, we examined
    [Show full text]
  • Phylogenetic Analysis of Monascus and New Species from Honey, Pollen and Nests of Stingless Bees
    available online at www.studiesinmycology.org STUDIES IN MYCOLOGY 86: 29–51 (2017). Phylogenetic analysis of Monascus and new species from honey, pollen and nests of stingless bees R.N. Barbosa1,2, S.L. Leong3, O. Vinnere-Pettersson3,4, A.J. Chen1,5, C.M. Souza-Motta2, J.C. Frisvad6, R.A. Samson1, N.T. Oliveira2, and J. Houbraken1* 1Westerdijk Fungal Biodiversity Institute, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands; 2Departamento de Micologia Prof. Chaves Batista, Universidade Federal de Pernambuco, Av. Prof. Moraes Rego, s/n, Centro de Bioci^encias, Cidade Universitaria, CEP: 50670-901 Recife, PE, Brazil; 3Swedish University of Agricultural Sciences, Department of Molecular Sciences, Box 7015, SE-750 07 Uppsala, Sweden; 4National Genomics Infrastructure-Sweden, Science for Life Laboratory, Department of Immunology, Genetics and Pathology, Uppsala University, BMC, Box 815, SE-752 37 Uppsala, Sweden; 5Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100193, PR China; 6Department of Biotechnology and Biomedicine, Technical University of Denmark, 2800 Kongens Lyngby, Denmark *Correspondence: J. Houbraken, [email protected] Abstract: The genus Monascus was described by van Tieghem (1884) to accommodate M. ruber and M. mucoroides, two species with non-ostiolate ascomata. Species delimitation in the genus is still mainly based on phenotypic characters, and taxonomic studies that include sequence data are limited. The genus is of economic importance. Species are used in fermented Asian foods as food colourants (e.g. ‘red rice’ (ang-kak, angka)) and found as spoilage organisms, and recently Monascus was found to be essential in the lifecycle of stingless bees.
    [Show full text]
  • Phylogeny of Penicillium and the Segregation of Trichocomaceae Into Three Families
    available online at www.studiesinmycology.org StudieS in Mycology 70: 1–51. 2011. doi:10.3114/sim.2011.70.01 Phylogeny of Penicillium and the segregation of Trichocomaceae into three families J. Houbraken1,2 and R.A. Samson1 1CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands; 2Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands. *Correspondence: Jos Houbraken, [email protected] Abstract: Species of Trichocomaceae occur commonly and are important to both industry and medicine. They are associated with food spoilage and mycotoxin production and can occur in the indoor environment, causing health hazards by the formation of β-glucans, mycotoxins and surface proteins. Some species are opportunistic pathogens, while others are exploited in biotechnology for the production of enzymes, antibiotics and other products. Penicillium belongs phylogenetically to Trichocomaceae and more than 250 species are currently accepted in this genus. In this study, we investigated the relationship of Penicillium to other genera of Trichocomaceae and studied in detail the phylogeny of the genus itself. In order to study these relationships, partial RPB1, RPB2 (RNA polymerase II genes), Tsr1 (putative ribosome biogenesis protein) and Cct8 (putative chaperonin complex component TCP-1) gene sequences were obtained. The Trichocomaceae are divided in three separate families: Aspergillaceae, Thermoascaceae and Trichocomaceae. The Aspergillaceae are characterised by the formation flask-shaped or cylindrical phialides, asci produced inside cleistothecia or surrounded by Hülle cells and mainly ascospores with a furrow or slit, while the Trichocomaceae are defined by the formation of lanceolate phialides, asci borne within a tuft or layer of loose hyphae and ascospores lacking a slit.
    [Show full text]
  • Metagenome Sequence of Elaphomyces Granulatus From
    bs_bs_banner Environmental Microbiology (2015) 17(8), 2952–2968 doi:10.1111/1462-2920.12840 Metagenome sequence of Elaphomyces granulatus from sporocarp tissue reveals Ascomycota ectomycorrhizal fingerprints of genome expansion and a Proteobacteria-rich microbiome C. Alisha Quandt,1*† Annegret Kohler,2 the sequencing of sporocarp tissue, this study has Cedar N. Hesse,3 Thomas J. Sharpton,4,5 provided insights into Elaphomyces phylogenetics, Francis Martin2 and Joseph W. Spatafora1 genomics, metagenomics and the evolution of the Departments of 1Botany and Plant Pathology, ectomycorrhizal association. 4Microbiology and 5Statistics, Oregon State University, Corvallis, OR 97331, USA. Introduction 2Institut National de la Recherché Agronomique, Centre Elaphomyces Nees (Elaphomycetaceae, Eurotiales) is an de Nancy, Champenoux, France. ectomycorrhizal genus of fungi with broad host associa- 3Bioscience Division, Los Alamos National Laboratory, tions that include both angiosperms and gymnosperms Los Alamos, NM, USA. (Trappe, 1979). As the only family to include mycorrhizal taxa within class Eurotiomycetes, Elaphomycetaceae Summary represents one of the few independent origins of the mycorrhizal symbiosis in Ascomycota (Tedersoo et al., Many obligate symbiotic fungi are difficult to maintain 2010). Other ectomycorrhizal Ascomycota include several in culture, and there is a growing need for alternative genera within Pezizomycetes (e.g. Tuber, Otidea, etc.) approaches to obtaining tissue and subsequent and Cenococcum in Dothideomycetes (Tedersoo et al., genomic assemblies from such species. In this 2006; 2010). The only other genome sequence pub- study, the genome of Elaphomyces granulatus was lished from an ectomycorrhizal ascomycete is Tuber sequenced from sporocarp tissue. The genome melanosporum (Pezizales, Pezizomycetes), the black assembly remains on many contigs, but gene space perigord truffle (Martin et al., 2010).
    [Show full text]
  • Monascus Fermented Rice and Its Beneficial Aspects: a New Review
    Asian Journal of Pharmaceutical and Clinical Research Vol. 4, Issue 1, 2011 ISSN - 0974-2441 Review Article MONASCUS FERMENTED RICE AND ITS BENEFICIAL ASPECTS: A NEW REVIEW C. ARUNACHALAM* AND D. NARMADHAPRIYA Research Department of Microbiology, Sri Sankara Arts and Science College, Enathur, Kanchipuram -.India E-mail: [email protected] ABSTRACT Monascus fermented rice has been traditionally used as a natural food colorant and food preservative of meat and fish for centuries. Monascus fermented products gradually regarded as the functional food because the monacolin K (antihypercholesterolemic agents), γ-aminobutyric acid (GABA) (hypotensive agent), and dimerumic acid (antioxidant) were found. This review article describes about the History and traditional use of Monascus fermented rice, Fermentation conditions for pigment production and Pharmacological aspects which include effects in cholesterol lowering, Anti-Diabetic Activity, Anti-Inflammation and prevention of Osteoporosis. Key words: Monascus purpureus, Pigments, Solid State Fermentation, Pharmacological effects, Red Yeast Rice (RYR). INTRODUCTION described in addition to the therapeutic activities, including the betterness of digestion and revitalizing the blood circulation7. Microorganisms are known to produce pigments, among them, the fungi Monascus purpureus is one such agent that produce a variety of Angkak were also found to posses many pharmaceutical aspects. It pigments which posses several beneficial aspects to humans. The was already published during the Ming Dynasty (A.D 1368-1644), pigments produced by Monascus are considered as the most described with the medicinal function of angkak for the treatment important agent, which have been used for centuries as food of indigestion and diarrhea, bruised muscles, hangovers and colic colorant in Eastern countries.
    [Show full text]
  • What Is the Fungal Diversity of Marine Ecosystems in Europe?
    mycologist 20 (2006) 15– 21 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/mycol What is the Fungal Diversity of Marine Ecosystems in Europe? Eleanor T. LANDY*, Gerwyn M. JONES School of Biomedical and Molecular Sciences, University of Surrey, Guildford, Surrey, GU2 7XH, UK abstract Keywords: Diversity In 2001 the European Register of Marine Species 1.0 was published (Costello et al. 2001 and Europe http://erms.biol.soton.ac.uk/, and latterly: http://www.marbef.org/data/stats.php) [Costello Fungi MJ, Emblow C, White R, 2001. European register of marine species: a check list of the marine Marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels 50, 463p.]. The lists of species (from fungi to mammals) were published as part of a European Union Concerted action project (funded by the European Union Marine Science and Technology (MAST) research programme) and the updated version (ERMS 2) is EU- funded through the Marine Biodiversity and Ecosystem Functioning (MARBEF) Framework project 6 Network of Excellence. Among these lists, a list of the fungi isolated and identified from coastal and marine ecosystems in Europe was included (Clipson et al. 2001) [Clipson NJW, Landy ET, Otte ML, 2001. Fungi. In@ Costelloe MJ, Emblow C, White R (eds), European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels 50: 15–19.]. This article deals with the results of compiling a new taxonomically correct and complete list of all fungi that have been reported occurring in European marine waters.
    [Show full text]
  • The Morphology and Structure of Red Pigment Producing Fungus: Monascus Purpureus
    Journal of Microbiology & Experimentation Research Article Open Access The morphology and structure of red pigment producing Fungus: Monascus Purpureus Abstract Volume 5 Issue 1 - 2017 The red pigment producing, ascospore forming fungus Monascus purpureus was obtained Musaalbakri Abdul Manan,1 Rosfarizan by monospore isolation and maintained on potato dextrose agar at 32°C for 7 days. M. 2 2 purpureus produces compact colonies of mycelia and accumulates large quantities of red Mohamad, Arbakariya Ariff 1Biotechnology and Nanotechnology Research Centre, pigment. Here we aimed to describe this newly isolated red pigment producing fungus Malaysian Agricultural Research and Development Institute using biochemical and microscopy technique. A newly isolated red pigment producing (MARDI), Malaysia fungus from local red fermented rice was identified using Microbial Identification 2Department of Bioprocess Technology, Universiti Putra Malaysia System based on fatty acids profiles. The growth, morphology, and structure of M. (UPM), Malaysia purpureus were characterized by Scanning Electron Microscopy (SME). We found that M. purpureus reproduces sexually (by the formation of cleistothecium with ascospores) and Correspondence: Arbakariya Ariff, Department of Bioprocess asexual (by the formation of conidia). In Monascus species, the formation of either asexual Technology, Faculty of Biotechnology and Biomolecular Sciences, or sexual spores appears to be an effective growth strategy. On the basis of biochemical Universiti Putra Malaysia (UPM), 43400
    [Show full text]
  • Thematic Area: Conservation of Fungi Moderator: Dr
    XVI Congress of Euroepan Mycologists, N. Marmaras, Halkidiki, Greece September 18-23, 2011 Abstracts NAGREF-Forest Research Institute, Vassilika, Thessaloniki, Greece. XVI CEM Organizing Committee Dr. Stephanos Diamandis (chairman, Greece) Dr. Charikleia (Haroula) Perlerou (Greece) Dr. David Minter (UK, ex officio, EMA President) Dr. Tetiana Andrianova (Ukraine, ex officio, EMA Secretary) Dr. Zapi Gonou (Greece, ex officio, EMA Treasurer) Dr. Eva Kapsanaki-Gotsi (University of Athens, Greece) Dr. Thomas Papachristou (Greece, ex officio, Director of the FRI) Dr. Nadia Psurtseva (Russia) Mr. Vasilis Christopoulos (Greece) Mr. George Tziros (Greece) Dr. Eleni Topalidou (Greece) XVI CEM Scientific Advisory Committee Professor Dr. Reinhard Agerer (University of Munich, Germany) Dr. Vladimir Antonin (Moravian Museum, Brno, Czech Republic) Dr. Paul Cannon (CABI & Royal Botanic Gardens, Kew, UK) Dr. Anders Dahlberg (Swedish Species Information Centre, Uppsala, Sweden) Dr. Cvetomir Denchev (Institute of Biodiversity and Ecosystem Research , Bulgarian Academy of Sciences, Bulgaria) Dr. Leo van Griensven (Wageningen University & Research, Netherlands) Dr. Eva Kapsanaki-Gotsi (University of Athens, Greece) Professor Olga Marfenina (Moscow State University, Russia) Dr. Claudia Perini (University of Siena, Italy) Dr. Reinhold Poeder (University of Innsbruck, Austria) Governing Committee of the European Mycological Association (2007-2011) Dr. David Minter President, UK Dr. Stephanos Diamandis Vice-President, Greece Dr. Tetiana Andrianova Secretary, Ukraine Dr. Zacharoula Gonou-Zagou Treasurer, Greece Dr. Izabela Kalucka Membership Secretary, Poland Dr. Ivona Kautmanova Meetings Secretary, Slovakia Dr. Machiel Nordeloos Executive Editor, Netherlands Dr. Beatrice Senn-Irlett Conservation officer, Switzerland Only copy-editing and formatting of abstracts have been done, therefore the authors are fully responsible for the scientific content of their abstracts Abstract Book editors Dr.
    [Show full text]