International Research Journal of Biological Sciences ___________________________________ ISSN 2278-3202 Vol. 2(5), 59-67, May (2013) Int. Res. J. Biological Sci. Exploring Monascus sanguineus as a Potential Natural Source for Pigment Production Dikshit Rashmi and Tallapragada Padmavathi* Department of Microbiology, Centre for PG Studies, Jain University, Bangalore – 560011, Karnataka, INDIA Available online at: www.isca.in Received 27 th February 2013, revised 8th March 2013, accepted 9th April 2013 Abstract Monascus species are known as producers of bio-pigments, which are used for food coloring. For this study, a Monascus sanguineus strain was isolated from pomegranate. Its molecular identification was done by genome sequencing. The effect of different culture media, temperature, and pH on pigment production and mycelial growth was investigated in submerged culture. Production of the red pigment reached its maximum on the 16 th day of incubation (21.9 Color Value Units (CVU)/ml). The optimal temperature for microbial growth and pigment production was 30°C and the maximum pigmentation was observed at pH 6.5 (33.9 CVU/ gram dry substrate (gds). Effect of different solid substrates with varied carbon and nitrogen content on pigment production and optimization was also investigated. Oryza sp. (local polished rice) was found to be the best solid substrate (7.8 CVU/gds) amongst the experimented substrates. The determination of citrinin was carried out by liquid chromatography – mass spectrometry (LC-MS) . Keywords: Monascus , pigment, mycelial growth, genome sequencing, citrinin. Introduction Qualitative analysis for determination of citrinin was also performed. Monascus sp. belongs to the family Monascaceae of the phylum Ascomycecota. Based on the cultural characteristics, 9 Material and Methods Monascus species are internationally acknowledged. These are M. pilosus, M. ruber, M. purpureus, M. floridanus, M. Culture: A wild-type strain of Monascus was isolated from eremophilus, M. pallens, M. sanguineus, M. lunisporas, and M. pomegranate. The strain was maintained on Potato Dextrose argentinensis . However, over 20 species of Monascus have been Agar (PDA) medium and incubated at 28-30°C for 7 days, recorded in the literature since the genus Monascus was preserved at 4°C, and sub-cultured once every 4 weeks. proposed in 1884 1. The Monascus filamentous fungi have been used in Asia for a long time to color and flavor food and Inoculum preparation: Inoculum preparation for solid-state beverages 2,3 . These natural colorants are of practical interest fermentation was performed as described by Babitha et al. 9 with because the red pigments obtained are safe for usage in food some modification. One full loop of sporulated (6 days old) agar industry. Different strains of the genus Monascus are used in slope culture was diluted in distilled water. The spores were pigment production 4,5 . Monascus sp. has been used primarily in scraped off under aseptic conditions to produce a spore Southern China, Japan, and Southeast Asia for making red rice suspension to be used as the inoculum. wine, red soybean cheese and Anka (red rice) 6. Monascus pigments typically comprise six major azaphilone pigments: For morphological investigation, the isolated strain of Monascus Yellow pigments: monascin (C 21 H26 O5) and ankaflavin sp. was grown for 7 days on different growth media such as (C 23 H30 O5 ); Orange pigments: monascorubrin (C 23 H26 O5) and potato dextrose agar (PDA), sabouraud dextrose agar (SDA), rubropunctatin (C 21 H22 O5); and Red pigments: malt glucose peptone agar (MGPA), and malt extract agar 10 monascorubramine (C 23 H27 NO 4) and rubropuntamine (MEA) . 7 (C 21 H2O4) . Monascus sp. was also reported to co-produce the mycotoxin citrinin, as well as other potentially toxic For molecular identification, genomic DNA was isolated from metabolites, such as monascopyridines 8. the culture. The rDNA fragments of ~500 bp were amplified using the universal primers ITS1f (5'- The goal of this study was to isolate a Monascus strain and to CTTGGTCATTTAGAGGAAGTA) and NL4 (5'- GGTCCGTGTTTCAAGACGG), the sequencing PCR was set investigate the general conditions for growth and pigment 1 production on fungal media. Screening was carried out for up with ABI-BigDye® Terminatorv 3.1 Cycle Sequencing Kit . different solid substrates and these substrates with varied carbon Evaluation of the effect of various culture media, and nitrogen content were optimized for pigment yield. temperature, and pH on mycelial growth and pigment production of Monascus sanguineus : Mycelial growth of M. International Science Congress Association 59 International Research Journal of Biological Sciences ________________________________________________ ISSN 2278-3202 Vol. 2(5), 59-67, May (2013) Int. Res. J. Biological Sci. sanguineus in the listed fungal media was evaluated. In each and carbon sources used in the experiments according to the case, 50 ml of the growth medium in 100 ml flask was used. procedure described above 14,15 . The medium pH was adjusted to 5.5. After cooling, these media were inoculated with 0.5 ml of the M. sanguineus culture and Pigment extraction and determination: In the case of incubated for 16 days in static condition. Biomass and pigment cultivation on solid substrate, the culture medium was dried at were assayed on day 4, 8, 12, and 16 after inoculation. The same 50°C for 24 hr. One gram of fermented solid substrate was procedure was adopted to study the effect of temperature and taken for pigment extraction with 10 ml of 95% ethanol on a pH on mycelial growth and pigment production. To investigate shaker at 200 rpm for 24 hr. The extracts were allowed to settle the effect of temperature, the inoculated media were incubated at room temperature and then filtered through Whatman filter at 16, 30, 37, and 50°C. The effect of pH was studied at pH paper. Ethanol extracts of unfermented substrates were used as values of 4.5, 5.5, 6.5, 7.5 and 8.5 and kept for 15 days in static blanks. Analysis of pigment concentration was done using a condition after inoculation 11 . colorimeter at 510 nm. The absorbance values were converted into pigment units using the following formula: Dry cell weight: The mycelia separated from the broth by Color value = O.D. × dilution × volume of extracts/amount of filtration (Whatmann No. 1) were weighed on an analytical sample (g) 13 . scale, vacuum filtered through pre-weighed membrane filters, washed with distilled water, and dried in an oven at 50°C. The Determination of the presence of Citrinin: The instrument results were expressed in grams per liter 12 . used for the determination of citrinin was HPLC Thermo Finnigan Surveyor and MS Thermo LCQ Deca XP MAX. The Pigment content: The pigment content in submerged culture software was Xcalibur. The column used was BDS HYPERSIL was determined using culture filtrate. The filtrate was C18 with a length of 250 mm, i.d. of 4.6 mm and particle size of centrifuged at 10000 g for 15 min. Pigment concentration was 5 µm. The detectors used were HPLC PDA / UV detector (254 determined colorimetrically at 510 nm. The absorbance values nm) and the temperature was ambient with 10 µL as the volume were converted into pigment units using by the following injected. formula: Color value = O.D. × dilution × volume of extracts / amount of MS experimental conditions used were probe/ source voltage of 13 sample (ml) . 4.5 kV, sheath gas flow of 40.00 and auxiliary/sweep gas flow of 26.00. The source type was electro spray ionization (ESI) Substrate selection and solid-state fermentation: For solid- with capillary temperature of 275 °C and capillary voltage of 16 state fermentation four substrates were chosen, viz. Oryza sp. V. The mobilization gas flow was helium at approx. 1 ml/min (local polished rice), Eleusine sp. (finger millet) flour, Ipomoea and the helium in the mass analyzer cavity was maintained at sp. (sweet potato), and Manihot sp. (tapioca). These were 0.1 Pa (10 -3)16 . purchased from a local market of Bangalore, India. The physical form of the substrate was as follows: This analysis describes an approach involving the recognition of pattern of mass spectral analysis lines that are produced as result Eleusine sp. was taken in flour form, Manihot was graded into of LC separated analytes. The pattern recognition provides a minute threads, Lpomoea sp. was cut into small pieces, and method for the prediction of chemical structure and can be Oryza sp. was soaked in water overnight. applied to the sample that has not been examined. The spectral data used were the values of m/z and their related intensities. Initially, 10 g of the substrate was placed in a 250 ml conical flask to which 27.5 ml distilled water was added, pH was Statistical analysis: MS Excel and ANOVA were used for data adjusted to 6.0, and the medium was autoclaved at 121°C for 20 analysis. min. After cooling, the substrate-based medium was inoculated with 10% of the seed culture of M. sanguineus and incubated at Results and Discussion 28 - 30°C for 20 days 9. Moisture content was maintained between 56-60% and was calculated based on the following Isolation and identification of Monascus sp.: The Monascus formula, sp. strain was identified by its capacity for pigment production Moisture content of substrate (%) =100×(wet weight − dry in the medium and pigmented spores. Morphology (the size, weight) / wet weight 7. color, shape, and aerial hyphae) was studied on colonies. This Monascus sp. isolate was able to release the pigment into the Effect of nitrogen and carbon source on pigment media. Microscopic observation of the spores showed that production: Nitrogen sources such as peptone, yeast extract, perithecia were born singly on stalk. Coenocytic mycelium was and monosodium glutamate at 2, 6, and 10% concentration and observed and ascospores were round, smooth, and pigmented.