PIAS1 and Huntingtin in Protein Homeostasis

UNIVERSITY OF CALIFORNIA, IRVINE

Finding balance in Huntington's disease: PIAS1 and huntingtin in protein homeostasis

DISSERTATION

submitted in partial satisfaction of the requirements for the degree of

DOCTOR OF PHILOSOPHY

in Biological Sciences

Joseph Ochaba

Dissertation Committee: Professor Leslie Thompson, Chair Assistant Professor Kim Green Professor Peter Kaiser Professor Marcelo Wood

2016

Portions of Chapter 1 © 2014 Proceedings of the National Academy of Sciences of the United States of America Portions of Chapter 2 © 2013 Elsevier Inc. Portions of Chapters 3 © 2016 Elsevier Inc. All other materials © 2016 Joseph Ochaba

DEDICATION

This dissertation is dedicated to my wife, Kelsey whose unyielding love, support, and

encouragement have enriched my soul and inspired me to pursue and complete this

research.

I also dedicate this body of work to my parents, Andrea and David. I hope that this achievement will complete the dream that you had for me all those years ago when you

chose to give me the best education you could.

TABLE OF CONTENTS

Page

LIST OF FIGURES AND TABLES iv

LIST OF ABBREVIATIONS vii

ACKNOWLEDGMENTS viii

CURRICULUM VITAE x

ABSTRACT OF THE DISSERTATION xvi

INTRODUCTION 1 A. Huntington’s disease: From protein to pathogenesis 1 B. Protein clearance pathways in Huntington’s disease 5 C. The role of SUMOylation: A post-translational modification with 8 disease relevance D. PIAS1: An SUMO-HTT E3 ligase and Transcriptional repressor 13 E. Inflammation and Huntington’s disease 16

CHAPTER 1: A potential function for the huntingtin protein as a scaffold 23 for selective autophagy

CHAPTER 2: SUMO-2 and PIAS1 modulate insoluble mutant huntingtin 67 protein accumulation

CHAPTER 3: PIAS1 regulates mutant huntingtin accumulation and 115 Huntington's disease-associated phenotypes in vivo

CHAPTER 4: The role of SUMO-interaction motifs in huntingtin and 169 a -synuclein accumulation and aggregation

DISSERTATION CONCLUDING REMARKS 193

REFERENCES 197

iii

LIST OF FIGURES AND TABLES Page

1 The SUMOylation pathway 9

1.1 Loss of HTT function in Drosophila larvae or conditional knockout 51 of HTT in the mouse CNS inhibits autophagy 1.2 p62, lipofuscin and ubiquitin accumulate in Htt knockout mouse 52 brain 1.3 HTT copurifies with proteins required for regulation of autophagy 53 1.4 Alignment of the N-terminal domain of HTTs with yeast Atg23s 55 1.5 Alignment of the central domain of HTTs with yeast Vac8s 56 1.6 Alignment of the C-terminal domain of HTTs with yeast Atg11s 58 1.7 The C-terminal domain of HTT is toxic in primary cortical neurons 60 1.8 HTT contains a conserved WXXL domain at W3037 61 1.9 xLIRs in human Huntingtin 62 1.10 WXXLs in human Huntingtin 63 1.11 xLIRs and WXXL domains in Saccharomyces cerevisiae Atg11 64 1.12 The C-terminal domain of HTT interacts with GABARAPL1 65 and LC3B 1.13 Theoretical model of HTT as a scaffold protein required for 66 selective autophagy

Table 2.1 qPCR primers 98 2.1 Illustration showing modulation of PIAS1 alters levels of insoluble mHTT 99 accumulation. 2.2 K6 and K9 are primary sites for HTTex1p in vitro SUMOylation 100 2.3 SUMO-1 and SUMO-2 are differentially expressed in HD mice 101 versus control 2.4 mRNA Expression of the SUMO Enzymes 102 2.5 Establishment of SUMOylation Assay 104 2.6 HTT is modified by both SUMO-1 and SUMO-2 106 2.7 PIAS1 is a SUMO E3 ligase for HTT 108

Page

2.8 A 586aa fragment of HTT is SUMO modified downstream of exon 1 109 2.9 SUMO-2 causes mutant HTT to accumulate 111 2.10 SUMO-2 proteins accumulate in HD brain 113

3.1 Silencing efficacy of artificial miRNAs targeting mouse Pias1 148 expression 3.2 PIAS1 levels are modulated in R6/2 mouse model following 149 viral-mediated knockdown or overexpression 3.3 Soluble/Insoluble fractionation represents Cytoplasmic/Nuclear 151 fractions, respectively 3.4 Insoluble/nuclear PIAS1 levels are elevated in R6/2 HD 152 mouse model 3.5 Control miSAFE expression is equivalent to Vehicle injected 153 R6/2 mice and does not influence HTT levels or alter behavioral outcomes 3.6 Real-time PCR of PIAS1 and human HTT transgene expression 154 in R6/2 mice 3.7 Effects of PIAS1 modulation on behavior in R6/2 mice 155 3.8 PIAS1 modulation has no effect on mouse weight 156 3.9 PIAS1 knockdown rescue on Rotarod task disappears at 9 weeks 157 3.10 Effect of PIAS1 modulation on overall survival and physiological 158 assessment of R6/2 mice 3.11 PIAS1 modulates insoluble protein accumulation in R6/2 mice 159 3.12 PIAS1 knockdown reduces mHTT inclusions in HD mouse 160 striatum 3.13 PIAS1 modulation alters levels of synaptophysin in the striatum 161 of R6/2 mice 3.14 miPIAS1.3 expression corresponds to altered levels of 162 synaptophysin in the striatum of R6/2 mice

Page

3.15 Iba1+ microglia numbers are decreased by PIAS1 reduction in 163 the R6/2 striatum 3.16 Insoluble NF-kB (p65) levels are restored to NT levels following 164 PIAS1 reduction in the R6/2 striatum 3.17 Soluble inflammatory cytokines are altered in the R6/2 striatum 165 and restored to NT levels following PIAS1 knockdown 3.18 Temporal profile of pro-inflammatory cytokines in detergent 166 soluble fraction of striatal tissue homogenates 3.19 Conserved domains of PIAS1 167 3.20 The PIAS1 SIM domain regulates accumulation of insoluble 168 mHTT and self-turnover

4.1 GPS-SUMO prediction evaluation of Huntingtin (586aa) 188 and a -synculein 4.2 a -synuclein secondary structure from PELE via 189 Biology WorkBench 4.3 Aggregation ‘hot spot’ prediction using AGGRESCAN prediction 190 software 4.4 SIM mutations in 25Q and 137Q, 586 aa fragment of HTT alters 191 cleavage and insoluble accumulation. 4.5 SIM mutation in A53T a -synuclein abrogates insoluble 192 accumulation and confirmation state

LIST OF ABBREVIATIONS

AAV Adeno-associated virus a -synculein Synuclein, alpha (non A4 component of amyloid precursor) BACHD An HD transgenic mouse line expressing a neuropathogenic, full- length human mutant Huntingtin (fl-mhtt) gene carrying 97 mixed CAA-CAG repeat CNS Central nervous system COS A fibroblast-like cell line derived from monkey kidney tissue GFAP Glial fibrillary acidic protein HD Huntington’s disease HeLa A cell type in an immortal cell line used in scientific research HMW High molecular weight HTT Human huntingtin protein IFN g Interferon gamma IBA1 Ionophore calcium-binding adapter molecule 1 IL Interleukin IL1-b Interleukin-1 beta JAK/STAT Janus kinase/ signal transducer and activator of transcription mHTT mutant human huntingtin protein miRNA microRNA mRNA Messenger RNA MSN Medium Spiny Neurons NFKB Nuclear factor kappa-light-chain-enhancer of activated B cells NT Nontransgenic controls for HD mice pcDNA Plasmid Cytomegalovirus promoter DNA PD Parkinson’s disease PIAS1 Protein inhibitor of activated STAT-1 Poly Q A polyglutamine tract or polyQ tract is a portion of a protein consisting of a sequence of several glutamine units PTM Post-translational Modification R6/2 An HD transgenic mouse line for the 5' end of the human HD gene carrying approximately 120 +/- 5 (CAG) repeat expansions SIM SUMO-interaction motif STAT1 Signal transducer and activator of transcription-1 SUMO-1 Small ubiquitin-related modifier 1 SUMO-2/3 Small ubiquitin-related modifier 2/3 TNF a Tumor necrosis factor alpha UPS Ubiquitin-Proteasome System zQ175 The zQ175 knock-in (zQ175 KI) allele encodes the human HTT exon 1 sequence with a ~190 CAG repeat tract, replacing the mouse Htt exon 1

vii

ACKNOWLEDGMENTS

I am forever grateful for the teachings and support of my mentor, Dr. Leslie Thompson.

Her intelligence is rivaled only by her enthusiasm and dedication to the field of

Huntington’s disease research. Leslie, I have greatly appreciated your encouragement and mentorship over the years, both of which have driven me as an individual and a scientist. It has been a true honor and a pleasure working alongside of you and learning from you.

Your ability to manage and involve yourself in so many different areas of research without missing a step is impressive. I admire your generosity and genuine scientific and personal interest in the HD community. Working in your lab and having access to the resources in the community, has allowed me to grow as an individual and learn as a scientist. The amount I have been able to accomplish in such a short time could only have been done with you as a mentor. Thank you for everything.

I would also like to thank, Dr. Joan Steffan for all of her intellectual input and thoughtful discussions throughout the course of my graduate career, all of which were invaluable.

Joan, I admire your passion, your work ethic, and your dedication to science. You have taught me so much including experimental design, analysis, and technique. I thank you for encouraging me to think independently and yet always being there when I needed your advice. Lastly, thank you for teaching me that it is (in fact) all about autophagy.

I am very fortunate to have had access to two great mentors. Thank you both for always being there for me scientifically and personally and I can only hope that I will make you both proud in the years to come.

viii

I would like to thank my committee members, Dr. Marcelo Wood, Dr. Peter Kaiser, and Dr.

Kim Green, for providing helpful suggestions and critique, all of which have been immensely invaluable to these studies.

Thank you to the entire Thompson lab for their technical assistance and support both intellectually and emotionally throughout the years of my graduate work; particularly Dr.

Jack Reidling, Eva Morozko, Alice Lau, and Sylvia Yeung. I really appreciate the time each of you have spent in helping me complete my dissertation.

Thank you, Dr. Jacqueline O’Rourke for the mentorship you provided when I was a first year rotating graduate student. I don’t think I could have imagined taking on such a challenging project without your motivating guidance and support.

I also thank my family and friends who may or may not understand my research, but who understand my passion and desire to research neurological diseases. Specifically, I would like to thank my parents, Andrea Ochaba and David Paré. Thank you for supporting me and all of my crazy dreams throughout the years. I could not have made it this far without you.

And most importantly, I thank my wife, Kelsey Ochaba. Thank you for being at my side through it all and for being a proud supporter of my research and sharing in the many uncertainties, challenges, and sacrifices that were necessary in completing this dissertation.

This work was supported in parts by NINDS 5RO1NS090390, the Janet Westerfield foundation, and NSF GRFP. I thank Cell Press and PNAS for permission to include copyrighted figures and text as part of my dissertation.

JOSEPH OCHABA

CURRICULUM VITAE

Current Appointment: Postdoctoral Fellow Department of Psychiatry and Human Behavior Biological Sciences 3 Room 3214 University of California, Irvine Irvine, CA 92697-4545 Tel: (949) 824-1910 [email protected] https://www.linkedin.com/pub/joseph-ochaba/77/327/a01

EDUCATION

2007-2011 B.S. in Biological Sciences; Magna cum laude San Diego State University, San Diego, California

2011 – 2016 Ph.D. in Biological Sciences: Neurobiology and Behavior University of California Irvine, Irvine, California

RESEARCH EXPERIENCE

2008-2011 Undergraduate Honors Researcher Emphasis: Ecology/Developmental Biology Project: Investigation of embryological dormancy in the fairy shrimp, Branchinecta lindahli • Developed applied fluorescence microscopy assay on developmentally stalled embryos to demonstrate how variable environmental factors influence the developmental process. Department of Biological Sciences San Diego State University Research advisor: Dr. Andrew Bohonak

2010-2011 Undergraduate Researcher Emphasis: Psychology Project: Differences in the spatiotemporal distribution of brain activity in children with SLI. • Implemented a novel human imaging method, aMEG, for the first time on children with SLI. Department of Speech, Language, and Hearing Sciences San Diego State University Research advisor: Dr. Julia Evans

2010-2011 Research Scientist/Lab Manager Emphasis: Ecology/Developmental Biology Project: Genomic Investigation of Species Diversity and Distribution across California in Vernal Tadpole Shrimp • Multiplex analysis to understand genomic/species diversity of tadpole shrimp in Northern California for land/species conservation Department of Biological Sciences/USGS San Diego State University/USGS Reporting Supervisor: Dr. Andrew Bohonak

2012 Rotating Graduate Student Emphasis: Neurobiology and Behavior/Inflammation Project: In vivo suppression of microglia-mediated neuroinflammation via CSF1R inhibition • In vivo pharmacological compound screen for CSF1R inhibitors and examining effects on microglia Department of Neurobiology and Behavior University of California Irvine Research advisor: Dr. Kim Green

2011-Current Graduate Student/PhD Candidate Emphasis: Neurobiology and Behavior/Biochemistry Project: Understanding Neuroregulatory Mechanisms of PIAS1 and Implications for Huntington's Disease • In vivo validation of PIAS1 as a therapeutic target for HD • Novel SUMO-interaction motif identification • Novel assay development to investigate the impact of HTT SUMOylation on HD • Longitudinal assessment of aggregation/inflammation in HD mouse models Department of Neurobiology and Behavior University of California Irvine Research advisor: Dr. Leslie Thompson

AWARDS & HONORS

2009,10,11 Alvarado Hospital Chaplains Program Grant Recipient 2010 Director’s Volunteer of the Year Award, Alvarado Hospital, San Diego, CA 2011 Undergraduate Excellence Award in Oral Presentation and Research, SDSU 2012 Honorable Mention, NSF Graduate Student Fellowship (GRFP) 2013 Awarded, NSF Graduate Student Fellowship (GRFP)

2014 Award for Most Outstanding Graduate Student Presentation (REMIND Symposium, UCIrvine) 2014 Advancement to PhD candidacy 2014 Renee Harwick Advanced CNLM Graduate Student Award 2015 Dr. William F. Holcomb Scholarship for Research Excellence

PROFESSIONAL SOCIETIES

Society for Neuroscience

COURSEWORK/PROFESSIONAL DEVELOPMENT

2015 Activate to Captivate Public Speaking Certificate Program/Communication Training 2016 PHRMSCI 272: Drug Discovery Computational Techniques

TEACHING EXPERIENCE

2010 Undergraduate Teaching Assistant: Organismal Biology, SDSU 2013 Graduate Student Teaching Assistant: Intro to Neurobiology; N110, UC Irvine 2013 – 2015 Graduate Student Teaching Assistant: Neurobiology Lab; N113L, UC Irvine 2014 - Current Graduate Student Teaching Coordinator: Neurobiology Lab; N113L, UC Irvine

VOLUNTEER EXPERIENCE

2009-2010 Neurology Interest Group Representative: American Medical Student Association 2007-2011 Emergency Room Volunteer Technician: Alvarado Hospital 2007-2011 Outpatient Surgical Unit Volunteer: Alvarado Hospital 2008-2011 Second Vice President of Auxiliary Board: Alvarado Hospital 2008-2011 Neurorehabilition Peer Mentor: ThinkFirst 2012-Current Staff Writer: HDBuzz 2013-Current NSF GRFP Mentor, UC Irvine

UNDERGRADUATE STUDENTS MENTORED

Derek Booth (2014) Chapman University Internship Program Judy Wong (2015) University of California, Irvine Jacob Sim (2015) University of California, Irvine

xii

FUNDING

2011 - Current Janet Westerfield Foundation 2012 – Current NSF Graduate Research Fellowship (NSF 782993-21666)

PUBLICATIONS

Ochaba, J. 2012. Of mice and men: using animal models to study Huntington's disease. (http://en.hdbuzz.net/106 ) HDBuzz.

Ochaba, J. 2013. The 'N17' region of huntingtin protein: an address label in Huntington's disease? ( http://en.hdbuzz.net/116 ) HDBuzz .

O’Rourke, J.G., Gareau, J.R., Pallos, J., Ochaba, J. , Reverter, D., Mee, L., Vashishtha, M., Nicholson, T., Apostol, B.L., Illes, K., Zhu, Y., Yao, T., Dasso, M., Shuai, K., Kazantsev, A.G., Bates, G.P., Difiglia, M., Wanker, E.E., Marsh, J.L., Lima, C.D., Steffan, J.S., Thompson, L.M. 2013. SUMO-2 and PIAS1 modulate insoluble mutant Huntingtin protein accumulation: relevance to Huntington’s disease. Cell Reports. Jul 25;4(2):362-75.

Ochaba, J. 2013. Gene silencing drug safe in ALS patients... bring on Huntington's disease trials. ( http://en.hdbuzz.net/131 ) HDBuzz .

Ochaba, J. , Lukacsovich, T., Lau, A.L., Yeung, S.Y., Wanker, E.E., Humbert, S., Saudou, F., Osmand, A.P., Zeitlin, S.O., Marsh, J.L., Thompson, L.M., and Steffan, J.S. Is Huntingtin an Atg11-like scaffold protein required for selective autophagy? Proc Natl Acad Sci U S A. 2014 Nov 25;111(47):16889-94.

Ochaba, J. 2015. mTORC1 tips the scales in Huntington’s disease mice (http://en.hdbuzz.net/186) HDBuzz .

Ochaba, J., Mas Monteys, A., O’Rourke, J.G., Reidling, J.C., Steffan, J.S., Davidson, B., and Thompson, L.M. 2016. PIAS1 Regulates Mutant Huntingtin Accumulation and Huntington’s Disease-Associated Phenotypes In vivo . Neuron 90, 1–14.

xiii

CONFERENCES

TALK ABSTRACTS

Ochaba, J. and Bohonak, A.J. 2011. Embryological correlates of dormancy in the fairy shrimp Branchinecta lindahli . Selected talk abstract for San Diego State University Student Research Symposium.

Ochaba, J. Hunting Down the Causes of Huntington’s Disease. 2013. Educational Discussion/Presentation, UHS.

Ochaba, J. 2013. SUMOylation regulates the formation of insoluble mutant huntingtin: Relevance to HD pathogenesis. Neuroblitz Seminar Series. UC Irvine. Ochaba, J. , O’Rourke, J.G., Gareau, J.R., Bates, G.P., Difiglia, M., Wanker, E.E., Marsh, J.L., Steffan, J.S., Thompson, L.M. 2013. SUMO modification in Huntington’s disease. Selected talk abstract for CAG Triplet Repeat Disorders Gordon Conference.

Ochaba, J. 2014. Targeting PIAS1 as a Therapeutic for Huntington’s Disease. Selected talk abstract for REMIND Emerging Scientist Symposium.

Ochaba, J. 2014. Targeting PIAS1 as a Therapeutic for Huntington’s Disease. Neuroblitz Seminar Series. UC Irvine.

Ochaba, J. , O’Rourke, J.G., Mas Monteys, A., Lee, J.H., Steffan, J.S., Davidson, B., and Thompson, L.M. 2014. Targeting PIAS1 as a Therapeutic for Huntington’s Disease. Selected talk for International SUMO, Ubiquitin, UBL Proteins: Implications for Human Diseases conference . Shanghai, China.

Ochaba, J. 2014. Targeting PIAS1 as a potential therapeutic for Huntington's disease. Neuroblitz Seminar Series. UC Irvine.

Ochaba, J. 2015. Targeting PIAS1 as a potential therapeutic hub for Huntington's disease. Neuroblitz Seminar Series. UC Irvine.

POSTER ABSTRACTS

Ochaba, J. , O’Rourke, J.G., Mas Monteys, A., Lee, J.H., Steffan, J.S., Davidson, B., and Thompson, L.M. 2012. SUMO-2/3 and PIAS1 modulate accumulation of insoluble mutant Htt. Abstract for poster presentation, HD2012: "The Milton Wexler Celebration of Life" Conference.

Steffan, J. S., Ochaba, J. , Lukacsovich, T., Lau, A.L., Marsh, J. L., and Thompson, L.M. 2012. Is Huntingtin a mammalian Atg11? Abstract for Keystone Meeting on “Autophagy, Inflammation and Immunity (B4).”

xiv

O’Rourke, J.G., Gareau, J.R., Ochaba, J. , Pallos, J., Reverter, D., Mee, L., Vashishtha, M., Nicholson, T., Apostol, B.L., Illes, K., Zhu, Y., Yao, T., Dasso, M., Shuai, K., Kazantsev, A.G., Bates, G.P., Difiglia, M., Wanker, E.E., Marsh, J.L., Lima, C.D., Steffan, J.S., Thompson, L.M . 2013. SUMO-2 and PIAS1 regulate formation of insoluble mutant Huntingtin: relevance to HD . Poster abstract for CHDI's 8th Annual HD Therapeutics Conference.

Ochaba, J. , Lukacsovich, T., Lau, A.L., Yeung, S.Y., Wanker, E.E., Humbert, S., Saudou, F., Osmand, A.P., Zeitlin, S.O., Marsh, J.L., Thompson, L.M., and Steffan, J.S., 2013. Is Huntingtin an Atg11-like scaffold protein required for selective autophagy? Poster abstract for CAG Triplet Repeat Disorders Gordon Conference.

Ochaba, J. , O’Rourke, J.G., Mas Monteys, A., Lee, J.H., Steffan, J.S., Davidson, B., and Thompson, L.M. 2014. Targeting PIAS1 as a Therapeutic for Huntington’s Disease. Selected poster abstract for International SUMO, Ubiquitin, UBL Proteins: Implications for Human Diseases conference . Shanghai, China.

Ochaba, J., O’Rourke, J.G., Mas Monteys, A., Lee, J.H., Steffan, J.S., Thompson, L.M. 2015. Targeting PIAS1 as a Therapeutic for Huntington’s Disease. Poster abstract for Cold Spring Harbor Laboratory: THE UBIQUITIN FAMILY meeting.

ABSTRACT OF THE DISSERTATION

Finding balance in Huntington's disease: PIAS1 and huntingtin in protein homeostasis

Joseph Ochaba

Doctor of Philosophy in Biological Sciences

University of California, Irvine, 2016

Professor Leslie Thompson, Chair

The disruption of protein quality control networks that ensure proper folding and degradation of cellular proteins is likely central to pathology in Alzheimer’s disease (AD),

Parkinson’s disease (PD), Huntington’s disease (HD), and other “protein misfolding” diseases (La Spada and Taylor, 2010; Wilkinson et al., 2010). A detailed understanding of the proteostasis network components and their contributions to pathology are therefore crucial to developing improved therapeutic interventions. HD is caused by the abnormal expansion of a CAG repeat within the HD gene resulting in an expanded stretch of polyglutamines in the Huntingtin (HTT) protein (Group, 1993a). A key pathological feature is the accumulation of mutant HTT protein (mHTT) (Cisbani and Cicchetti, 2012; Zhao et al., 2016). Post-translational modifications of HTT, including SUMOylation and phosphorylation (Ehrnhoefer et al., 2011; Pennuto et al., 2009), appear to contribute to mechanisms underlying mHTT function, clearance, and accumulation (O'Rourke et al.,

2013; Ochaba et al., 2016; Zhao et al., 2016).

The work presented here represents an innovative conceptual shift to address questions fundamental to HD and other diseases where protein homeostasis is affected. This approach may therefore provide insight into a broad spectrum of protein misfolding

xvi disorders.. My dissertation utilized gain-of and loss-of-function approaches to query the importance of HTT function, modulation of PIAS1-regulatory networks, and SUMO- interaction motifs in the context of cell culture and in vivo mouse model systems to assess the impact on critical disease regulatory networks and HD pathogenesis. The precise mechanisms involved in the aforementioned have not yet been elucidated, nor has the

PIAS and SUMO pathways been tested in vivo for its relevance to the following: the accumulation of neurodegenerative disease-causing proteins, neuroinflammation, protein clearance networks, or overall impact on disease phenotypes. My dissertation suggests that PIAS1 may link protein homeostasis and neuroinflammation in HD through a combination of modulating accumulation of toxic HMW species of HTT and compensating for dysfunctional inflammatory signaling cascades between neurons and microglia, potentially allowing improved flux through protein clearance pathways, of which HTT itself is likely involved in regulating.

xvii

INTRODUCTION

Huntington’s disease: from protein to pathogenesis

Huntington's disease (HD) can be regarded as a paradigm for a range of neurodegenerative disorders. It is monogenic, fully penetrant, and—similar to other neurodegenerative diseases—a disorder of protein misfolding and aggregation.

Huntingtin (HTT ) was the first disease-associated gene to be molecularly mapped to a human chromosome (Gusella et al., 1983). Ten years later, scientists as part of an ongoing Huntington's Disease Collaborative Research Project, identified the DNA sequence and determined the precise nature of the HD-associated mutation in HTT

(1993). This was the result of an extensive study focusing on the populations of two isolated Venezuelan villages within the Lake Maracaibo region, Barranquitas and

Lagunetas, where there was an unusually high prevalence of the disease. Extensive analysis revealed that the mutation was an expansion in the number of CAG repeats within the HTT gene and the increase in the number of CAG repeats above a threshold determined whether or not an individual would have HD. During protein synthesis, the expanded CAG repeats are translated into a series of uninterrupted glutamine residues forming what is known as a polyglutamine tract (polyQ). Individuals with six to 35 CAG repeats will be unaffected; individuals with 36-39 repeats will be at increased risk for

HD; and individuals with 40 or more CAG repeats will manifest disease phenotypes

(Ross et al., 2014). A more recent study reported an individual presenting late onset HD symptoms with a 29 triplet expansion suggesting that individuals with lower repeat ranges (27-35) may also be susceptible to inheriting the disorder (Garcia-Ruiz et al.,

2016). The disease was found to be inherited in an autosomal dominant manner with

age-dependent penetrance, and repeat CAG lengths of 40 or more are associated with nearly full penetrance by age 65 years and longer CAG repeats are predictive of earlier onset, accounting for up to 50–70% of variance in age of onset, with the remainder likely to be due to modifying genes and the environment (Wexler et al., 2004). The gene itself encodes a 350-kDa protein, named huntingtin (HTT), that may function as a giant scaffold for organizing signaling complexes (Desmond et al., 2013) and possibly for selective autophagy (Ochaba et al., 2014; Steffan, 2010), among other potential functions. These functions are likely perturbed upon polyQ expansion associated with

HD.

Global prevalence of HD is approximately 4–10 per 100,000 in the western world, although these numbers are likely a significant underestimate, with many more potentially at risk of the disease. The mean age of disease/clinical onset is 40 years, with death occurring 15–20 years from onset (Bates, 2005). HD is characterized by clinical features including progressive motor dysfunction, cognitive decline, and psychiatric disturbances, due to a marked loss of medium spiny neurons (MSNs) in the striatum in addition to shrinkage of the cortex (Bates, 2005); both of these clinical characteristics are associated with neuronal dysfunction and neuronal cell death.

Formal diagnosis of Huntington's disease is made on the basis of characteristic motor signs of chorea, dystonia, bradykinesia, or incoordination (UCDRS scale). Although chorea is usually prominent early in the stages of the disease, later progressive bradykinesia, incoordination, and rigidity (so-called motor impairment) are more disabling functionally. Most patients have substantial cognitive or behavioral disturbances before onset of diagnostic motor signs which progress with disease.

Currently the specific mechanisms which trigger the onset of HD are not clear, nor are there any effective, disease modifying treatments for this devastating disease.

A major pathological indicator of HD pathogenesis is HTT accumulation and the process of aggregation in regions of the brain and in peripheral tissues, which has been shown to interfere in several ways with normal cell metabolism and function (Kim and Kim,

2014; Sassone et al., 2009; Weydt et al., 2006). Especially affected in HD are cells of the brain cortex and striatum. However, it is important to note that the presence of inclusions does not necessarily correlate with huntingtin-induced death (Lee et al.,

2013a). Rather, it may be the formation of an insoluble high molecular weight (HMW)

HTT species that most closely tracks with HD pathogenesis and disease progression

(O'Rourke et al., 2013; Shibata et al., 2006). Although the precise mechanisms by which the expanded poly-Q contributes to HTT-induced toxicity remain unknown, the formation of nuclear inclusions of HTT in the brain of HD patients is an invariant feature.

Inclusions appear to be comprised largely of mutant HTT fragments and proteolysis of full length HTT may play an important role in the pathogenesis of HD. Indeed, extensive work suggests that N-terminal HTT fragments may constitute a toxic form of

HTT by virtue of the ability to aggregate rapidly, nucleate, and accelerate the aggregation process (Cha et al., 1998; Mangiarini et al., 1996b). By investigating these various forms and dynamic states of HTT implicated in disease pathogenesis, we can use different models of HD to study disease pathogenesis and evaluate potential therapeutic interventions through their modulation. One of the goals of my dissertation is to gain an understanding of the processes that impact these various HTT species and their contribution to disease.

The formation of nuclear inclusions of HTT in the brain of HD patients and animal models is an invariant feature and aggregate serves as a surrogate marker of potential gain-of-function and partial loss of normal function that is linked to the polyQ-mediated neurotoxicity (Schulte and Littleton, 2011). The inverse correlation between the length of the polyQ and the age at onset and severity suggests that the polyQ expansion is the primary determinant of HTT aggregation and toxicity and a direct relationship between the length and the aggregation propensity of polyQ repeats in peptides in cultured cells and animal models is observed. The dominant toxicity of polyQ expansions is supported by the identification of other polyQ-containing proteins as causative factors in other neurodegenerative diseases (e.g. SBMA and the SCAs). The accumulation of expanded poly-Q-containing proteins is a hallmark of HD as well as other poly-Q expansion diseases such as Spinal and Bulbar Muscular Atropha, Spinocerebellar ataxia, and

Dentatorubral-pallidoluysian atrophy (Jochum et al., 2012; Michalik and Van

Broeckhoven, 2003; Ross, 2002). However, more recent lines of evidence suggest that

HTT oligomerization, inclusion formation, and toxicity are also strongly influenced by sequences outside of the polyQ domain (Wang and Lashuel, 2013). Several findings indicate that extensive cross-talk and interactions between the different domains in HTT may be critical: 1) Mutations, deletions, or post-translational modifications (PTMs) within the flanking sequences of the polyQ repeats region in Httex1 strongly influence the aggregation, cellular behavior, and toxicity of mutant HTT; 2) N-Terminal HTT fragments of different lengths (e.g., 120, 171, and 586) containing similar numbers of polyQ repeats exhibit different aggregation and toxicity properties in cellular and animal models of HD (Wang and Lashuel, 2013). Further, longer N-Terminal HTT fragments

can demonstrate enhanced aggregation propensity (e.g. Htt1–117) and/or toxicity (Htt1–

20813) compared with the shorter exon1 fragments (Wang and Lashuel, 2013), and additional aggregation motifs have been identified within these longer fragments.

Accumulated-cleaved/truncated forms of HTT containing the N-terminal expanded poly-

Q are most easily recognized as neuronal inclusions.

As a whole, my dissertation seeks to understand the roles that HTT and a specific modifier of HTT play in protein and disease homeostasis. Previous studies have shown that treatment with Congo Red and trehalose, compounds which reduce the accumulation of over-expressed expanded poly-Q-positive proteins by enhancing the rate of their degradation and clearance/turnover, alleviated neuropathological marks and neurological symptoms in various HD transgenic mouse models (Frid et al., 2007;

Tanaka et al., 2004), suggesting that approaches to modulate mHTT accumulation may be important. However, these studies have not translated well to clinical application and by focusing on visible inclusions, may not be targeting key pathogenic species.

The results presented here underscore the importance of studying the underlying mechanisms that regulate aberrant homeostasis of proteins with expanded poly-Q.

Protein clearance pathways in HD

The age-related decline in protein homeostasis challenges the capacity of neurons to counteract the accumulation of misfolded proteins such as mHTT. This may explain in part the late onset of HD and other protein conformation diseases (Balch et al., 2008).

While a invariant feature of polyQ diseases, the role of inclusions in HD has been controversial and some forms of inclusions/aggregates are even thought to be

protective, serving as possible clearance intermediates (Arrasate and Finkbeiner, 2012;

Arrasate et al., 2004). Interestingly, neuronal HTT aggregates found in human postmortem brain material are positive for ubiquitin in addition to autophagy cargo, indicating a role of the ubiquitin-proteasome and autophagy related protein quality control systems (DiFiglia, 1997; Gutekunst et al., 1999; Ochaba et al., 2014; Sapp et al.,

1997; Sieradzan et al., 1999). Previous studies showed that wildtype and mutant HTT are cleared by the proteasomal and autophagosomal pathways (Juenemann et al.,

2013; Thompson et al., 2009; Waelter et al., 2001; Wyttenbach et al., 2000).

Furthermore, HTT can be ubiquitinated and SUMOylated at its N-terminal region, suggesting specific ubiquitin-mediated degradation by cellular clearance mechanisms

(Bhat et al., 2014; Juenemann et al., 2013; Lu et al., 2013; O'Rourke et al., 2013;

Steffan et al., 2004). The specific role of the proteasome and clearance networks involving HTT is controversial and it is not clear modulating it is key to regulating mHTT clearance Poly-Q-expanded HTT inhibits the UPS before its progression into large aggregates (Bennett et al., 2007; Bett et al., 2009; Schipper-Krom et al., 2012).

However, there is pharmacological evidence to suggest the role of autophagy, a large- scale catabolic mechanism, in regulating the degradation of the N-terminal part of HTT.

Autophagy is an intracellular mechanism that mediates the degradation of large protein complexes and damaged organelles in a lysosome-dependent manner (Boya et al.,

2013). The hallmark of autophagy is the formation of a double-membrane cytosolic vesicle, the autophagosome, which sequesters cytoplasm and delivers it to the lysosomes for degradation. Interestingly, our group and others have suggested that

HTT itself may act as a mammalian ATG11 - a scaffold involved in mitophagy (a form of

mitochondrial autophagy) (Ochaba et al., 2014; Steffan, 2010). Indeed, Dr. Steffan at

UCI was the first to hypothesize that HTT could be involved in its own clearance.

Several studies have specifically targeted autophagy in HD; specifically, Rapamycin, an inducer of autophagy, has been shown to reduce the aggregation of expanded poly-Q polypeptides in transfected cells, HD fly and mouse models, and also improve performance on behavioral tests (Sarkar et al., 2009). It is important to note the complex nature of this clearance network in that that there are many forms of autophagy being regulated by many different processes. Experimental evidence is building that suggests

HTT is not simply a passive passenger in autophagy but that it may also be an important regulator of autophagy acting as a scaffold for autophagosome transport and biogenesis. What makes this so compelling is the fact that mutations in several motor proteins and autophagy regulators also lead to neurodegenerative disease with HD-like phenotypes. For example, neural-specific deletion of another Atg11 protein, FIP200, led to cerebellar degeneration caused by increased neuronal death, axon degeneration, and accumulation of ubiquitinated protein aggregates (Liang et al., 2010). Additionally, similarly to HTT, dynein is involved in autophagy, ER structure, mitotic spindle orientation, and retrograde transport. Loss of dynein results in death and specific mutations in dynein lead to a toxic gain of function that promotes mild but similar phenotypes to HD (Hinckelmann et al., 2013). This study and others suggest a pivotal role in autophagy proteins in contributing to regulation of neuronal homeostasis through autophagic functions.

HD is typically described as a toxic gain of function by mHTT, but a loss-of-function mechanism of WT HTT that involves autophagy may also contribute significantly to the disease.

These results support the possible role of autophagy in regulating the clearance and turnover of expanded poly-Q proteins. While various genetic studies have identified the genes and defined pathways that regulate autophagy in yeast (He and Klionsky, 2009), we still do not understand, the molecular mechanisms that mediate the turnover of poly-

Q expanded proteins or whether a mechanistic defect might contribute to the age- dependent accumulation of HTT species. Further, it is important to note that these identified relationships are relatively novel and there are many forms of autophagy that are being investigated to further elucidate the role of HTT in autophagy and protein homeostasis.

The role of SUMOylation: A post-translational modification with disease relevance

The disruption of protein quality control networks that ensure proper folding and degradation of cellular proteins is central to pathology of a number of neurodegenerative diseases including AD, PD and HD (Gestwicki and Garza, 2012).

Therefore, understanding the contribution of such networks to pathology is crucial to devise strategies to improve therapeutic interventions, especially since no therapeutic is presently available that changes the course of any neurodegenerative disease. In HD a key pathological feature is the accumulation of mHTT protein (Waelter et al., 2001;

Zhao et al., 2016). mHTT can be modified by multiple post-translational modifications

(PTMs), including SUMOylation. Covalent modification by SUMO polypeptides, or

SUMOylation, is an important regulator of the functional properties of many proteins.

This PTM causes de-aggregation of inclusions, releasing the soluble mHTT monomers, increasing neurotoxicity, and accumulation of PTM-HTT inhibits protein clearance machinery (Juenemann et al., 2013; Steffan et al., 2004). PTMs of HTT, including

SUMOylation and phosphorylation (Ehrnhoefer et al., 2011; Pennuto et al., 2009), appear to contribute to mechanisms underlying mHTT clearance and accumulation

(O'Rourke et al., 2013; Thompson et al., 2009) and influence in vivo pathogenesis (Gu et al., 2005). Additionally, SUMO modification itself can function as a secondary signal affecting ubiquitin-dependent degradation by the proteasome (UPS) (Praefcke et al.,

2012).

Figure 1 The SUMOylation pathway. SUMO is expressed as a precursor protein and processed by SUMO specific proteases (SENPs) to expose a C terminal diglycine motif (-GG). Enzymatic reactions are similar to ubiquitination and include a single SUMO E1-activating enzyme (SAE1/UBA2), a single SUMO E2- conjugating enzyme (Ubc9) and transfer of SUMO to target lysines (eg HTTex1) with or without the assistance of the SUMO E3-ligating enzymes. Multiple SENPs both cleave and process SUMO itself. SUMOylation is the covalent attachment of SUMO to target proteins that regulates subcellular localization, protein stability, transcriptional regulation, and interaction properties of SUMO-modified proteins with their cellular targets (Cubenas-Potts and

Matunis, 2013; Gareau and Lima, 2010). Four different forms exist in the mammalian system, SUMO-1-4; SUMO-2 and SUMO-3 are nearly identical and are often referred to as one protein (SUMO-2/3) (Geoffroy and Hay, 2009). The SUMOylation pathway involves a cascade of enzymes, with a single E1-activating enzyme (SAE1/UBA2), a single E2-conjugating enzyme (UBC9), multiple E3-ligating enzymes (Protein Inhibitors of Activated STAT [PIAS], PC2, MMS21, and RanBP2), which provide substrate

specificity, and multiple proteases (SENPs) that both cleave and process the SUMO moiety from target proteins (Figure 1). SUMO modification occurs at the same lysine residue that is used for ubiquitination, and ubiquitnation and SUMOylation have extensive crosstalk in regulating clearance of cellular proteins. SUMO1-3 conjugation has been shown to play a major role in many cellular networks including embryogenesis. A report showed embryos deficient in the SUMO-conjugating enzyme

Ubc9 die at the early post-implantation stage and that SUMO1-deficient mice are viable, as SUMO2/3 can compensate for most SUMO1 functions (Zhang et al., 2008). In a separate study, SUMO-2, specifically, was found to be the predominantly expressed isoform and that expression levels and not functional differences between SUMO-2 and

SUMO-3 are critical for normal embryogenesis (Wang et al., 2014a). The involvement of

SUMO modification has further been demonstrated for a growing number of neurodegenerative diseases including AD, PD, polyglutamine repeat diseases, and even in settings of transient cerebral ischemia (Datwyler et al., 2011; Krumova and

Weishaupt, 2013; McMillan et al., 2011).

In HD, SUMO-1/2 modified proteins accumulate in an insoluble protein fraction from HD postmortem striatum, and SUMO isoforms can regulate the formation and accumulation of insoluble HTT species in cells (O'Rourke et al., 2013). We previously reported that

HTT can be modified by SUMO-1 in cell culture, and that SUMO-1 co-localizes with expanded HTTex1p at the nuclear periphery and in inclusions within immortalized striatal neurons (Steffan et al., 2004). Further, mutation of the lysine residues 6 and 9 within the exon 1 fragment significantly reduced or eliminated HTTex1p modification by

His-SUMO-1. Of relevance, transgenic flies expressing either HTTex1p-97QP or

HTTex1p-97QP K6, 9, 15R under the same conditions displayed strikingly different phenotypes where expression of the HTTex1p-97QP transgene produces visible neurodegeneration, while K6, 9, 15R mutant transgene display almost no detectable phenotype (Steffan et al., 2004). These studies were taken further and show that HTT is SUMO-1 and 2 modified within the amino terminus and at downstream sites in the full-length wild type and mutant proteins (O'Rourke et al., 2013; Steffan et al., 2004).

The SUMO modification network may further impact other cellular processes relevant to

HD, including NF- B inflammatory signaling through IKK-α SUMOylation (Huang et al.,

2013). Since chronic expression of the causative proteins in neurodegenerative diseases such as mHTT cause cellular stress, including oxidative stress (Turner and

Schapira, 2010) and inflammation (Bjorkqvist et al., 2008), cellular processes such as

SUMOylation that respond to stress likely contribute to disease. These studies support hypotheses to be tested in the thesis that SUMO regulates accumulation of mHTT and that modulation of this network in vivo will impact disease.

SUMO and ubiquitin modification have also been shown to be a relevant modification that can differentially regulate mHTT clearance by autophagy (Martin et al., 2015).

Specifically, ubiquitination at residues K6, K9, and K15 in particular is associated with

HTT degradation, and SUMOylation of these lysines competes with ubiquitination, leading to increased toxicity in the presence of the HD mutation. WT HTT is preferentially ubiquitinated through K48 linkage, which is considered the ‘classical’ signal for proteasomal degradation. Conversely, mHTT, and in particular mHTT fragments, show preferential ubiquitination through K63 of ubiquitin, and this is correlated with increased stability and aggregation (Bhat et al., 2014).

Other modification may also act in concert with SUMOyation to regulate mHTT flux. For example, the switch between HTT SUMOylation and ubiquitination at K6, K9, and K15 is regulated through phosphorylation at S13 and S16, and it has been shown that these phosphorylation events are crucial determinants of mHTT toxicity and degradation (Gu et al., 2009; Thompson et al., 2009).

In addition to HTT (both truncated and fragments derived from full length HTT) several other polyglutamine repeat disease proteins are SUMO modified (Chua et al., 2015;

Craig and Henley, 2015; Poukka et al., 2000; Riley et al., 2005). Further, an increase in

SUMOylated proteins is observed in brain tissue of SCA1 patients and in transgenic mice (Kang and Hong, 2010). In Parkinson’s models, overexpression of SUMO has been shown to reduce the accumulation of protein aggregates that typify PD (Krumova et al., 2011) suggesting SUMO may act via different pathways depending on disease networks. In Drosophila models of polyQ disease, overexpression of a mutant form of the SUMO E1 activating enzyme, UBC9, enhances neurodegeneration, implicating the

SUMO conjugation pathway in polyglutamine pathogenesis (Chan et al., 2002). These studies and others suggest that SUMOylation may be a significant modifier of neurodegenerative disease.

PIAS1: An SUMO-HTT E3 ligase and Transcriptional repressor

The diversity of SUMO substrates is governed by a relatively small number of SUMO E3 ligases. The PIAS family of SUMO E3 ligases contains homologs in both vertebrates and invertebrates. Mammals contain five major PIAS isoforms: PIAS1, PIAS2α/Xα and

2β/Xβ, PIAS3, and PIAS4/y. At the protein level, PIAS1 is expressed in close to 90% of

tissues throughout the body including various brain regions with strong nuclear localization (The Human Protein Atlas). These proteins are characterized by the presence of five conserved and functional domains that dictate functions such as DNA binding, substrate interactions, SUMO ligase activity and potentially SUMO paralog selection (Shuai and Liu, 2005). Given the relationship of the SUMO network to HD pathogenesis and other neurodegenerative diseases, a key means to modulate this network in vivo is either through SUMO itself, which would be anticipated to have an overly broad impact and potentially deleterious effects, or through more selective means through regulation of a putative SUMO E3 ligase, in this case PIAS1. We previously demonstrated that PIAS1 is an E3 SUMO ligase for both HTT SUMO-1 and SUMO-2 modification and that genetic reduction of the single dPIAS in a mHTT expressing

Drosophila is protective. PIAS proteins can act as adaptor proteins that bridge the

SUMO-conjugated E2 enzyme and the substrate in the SUMOylation cascade as well as act as E3 SUMO ligases.

In addition to functioning as E3-ligases, PIAS proteins regulate transcription, immune responses and cytokine signaling (Liu and Shuai, 2008; Rytinki et al., 2009).

PIAS1, in particular, is involved in the regulation of several key inflammatory signaling nodes (Shuai, 2006; Shuai and Liu, 2005) such as NFK-B and interferon-inducible genes. Of clinical relevance, PIAS1-associated complexes are implicated in multiple sclerosis and IFN-b non-responsive treatment outcome (O'Doherty et al., 2009). PIAS1 is an important negative regulator of NF-κB transcription factors that are activated by proinflammatory cytokines, growth factors, bacterial lipopolysaccharides, viruses, and stress signals, and NF-κB is altered in expression in HD systems (Marcora and

Kennedy, 2010). The binding of PIAS1 to the p65 subunit of NF-κB inhibits cytokine- induced NF-κB-dependent gene activation and induction of proinflammatory cytokine transcription. Further, PIAS1 null mice displayed elevated proinflammatory cytokine IL-

1β and TNF-α levels relative to their wild type littermates, increased resistance to viral and bacterial LPS infection, and partial perinatal lethality with no major later developmental abnormalities (Shuai, 2006), suggesting that some redundancy among

PIAS proteins may exist, which would suggest that targeting PIAS1 for HD is likely to be safe. PIAS1 is also implicated in negative regulation of interferon-inducible genes

(Choleris et al., 2001). When interferon pathways are activated, clearance of accumulated misfolded proteins is induced and cytotoxicity in both HD (Lu et al., 2013) and Spinocerebellar Ataxia (Chort et al., 2013) models is reduced. As these networks are regulated by PIAS and are highly relevant to HD, PIAS1 may play a fundamental role in HD pathogenesis through a combined impact on SUMO modification pathways and transcription. Recent studies have also indicated that proinflammatory stimuli, such as TNF a and LPS, can activate PIAS1 through a SUMO-dependent, IKK a -mediated phosphorylation event. Activated PIAS1 is then recruited to inflammatory gene promoters to repress transcription. Further, SUMOylation can regulate inflammation through the direct modulation of the activity of key transcription factors involved in inflammatory responses (Lu et al., 2013). For example, the SUMOylation of members of the nuclear-receptor family, such as the peroxisome proliferator-activated receptor γ, regulates the activity to transrepress inflammatory gene activation (Liu and Shuai,

2008). More specifically and of relevance to these studies, PIAS1, while functioning as a

SUMO E3 ligase, is also a transcriptional repressor of NF-κB and STAT1. PIAS1

functions by blocking the DNA-binding activity of NF-κB and STAT1 on gene promoters

(Shuai, 2006) to regulate inflammation.

These findings support a hypothesis that therapies targeting the PIAS1 SUMO

E3-ligase pathway might be developed to modulate inflammatory signaling pathways

(Liu and Shuai, 2008). To date, few studies have investigated ways to modulate neuroinflammatory pathways in HD and none have investigated the interrelationship between mHTT accumulation and neuroinflammation.

Inflammation and Huntington’s Disease

Neuroinflammation is implicated in the pathogenesis of several neurodegenerative diseases including HD. The process of inflammation is initiated in response to tissue damage and infectious agents. These responses must be regulated properly, and unrestricted inflammation can lead to inflammatory disorders and cancers. The transcriptional induction of genes involved in inflammatory responses is controlled by various transcription factors, including NF-κB, STAT1, and activator protein-1 (AP-1).

Interestingly, these pathways are altered in HD and have been suggested to contribute to disease progression (Trager et al., 2013). Post-mortem human HD tissue has a distinct profile of inflammatory mediators such as increased IL-1b and TNF-a in the striatum (Silvestroni et al., 2009), although the role of neuroinflammation is not clear.

Additionally, microglial activation is observed in HD human tissue and R6/2 mice

(Simmons et al., 2007). Studies in AD have suggested a beneficial role for neuroinflammation in the recruitment of macrophages in clearing intracerebral A b deposits, mobilizing astrocytes for trophic support and blood brain barrier integrity, and

in production of neurotrophic factors (Simard et al., 2006; Wee Yong, 2010). Of further relevance, following impairment of the UPS, an alternative clearance network associated with immunoproteasome activity may be activated. Additionally, autophagy can regulate inflammation through directing interactions with innate immune signaling pathways, by removing endogenous inflammasome agonists and through effects on the secretion of immune mediators (Guo et al., 2015). Moreover, autophagy contributes to antigen presentation and to T-cell homeostasis, and it affects T-cell repertoires and polarization (Arroyo et al., 2014). The proposed roles of autophagy in regulating inflammatory networks, bridge both the innate and adaptive immune systems and autophagic dysfunction associated with inflammation, infection, and neurodegeneration.

These and another studies have implicated the innate and adaptive immune systems in

HD. Particularly, studies have shown innate immune activation of microglia with expression of proinflammatory cytokines, impaired migration of macrophages, and deposition of complement factors in the striatum (Ellrichmann et al., 2013). A large body of evidence exists for a pivotal role of neuroinflammation in the development of several neurodegenerative diseases including HD. Yet, the exact underlying inflammatory pathomechanisms and the definite impact of the innate and adaptive immune system in HD pathology are still not fully understood. It is unclear if changes in the immune system are the cause or the consequence of HD pathology. However, immune system activation during HD is clear given the elevated expression of cytokines such as IL-6 in mouse models and symptomatic as well as presymptomatic patients.

Furthermore, activation of CNS innate immune cells in HD, such as microglia and astrocytes, is one of the universal components of neuroinflammation. Therefore, the

contribution of inflammation to neurodegeneration in HD is strongly suggested but not definitely demonstrated.

Although mHTT is ubiquitously expressed, an emerging concept is how it impacts non- neuronal tissues. An important factor that influences HD neuropathology is cell-cell interactions. Of particular relevance to neuroinflammation, it is known that in the brain over 90% of cells are glial cells that support the survival of neuronal cells (Colon-Ramos and Shen, 2008). Glial pathology has been found in many HD mouse models (Bradford et al., 2010) and in postmortem brains of HD patients (Myers et al., 1991). Glial cells also play a crucial role in neuronal function and cell-cell communication. Further, mHTT is also expressed in glial cells and affects neuronal pathology in HD (Lin et al., 2001).

HTT inclusions, however, are much more common in neurons than in glia in HD model mouse brains, suggesting that glial cells have mechanisms that prevent the accumulation and deposition of HTT aggregates in glia (Bradford et al., 2010). At the same time, mHTT stimulates microglia and leads to microglia activation. Migrating microglia secrete proinflammatory cytokines (e.g., TNFα) and nitric oxide, both of which contribute to neurotoxicity. However, phagocytic microglia may also produce neuroprotective factors. Additionally, glial cells also protect against excitotoxicity by clearing excess excitatory neurotransmitters from the extracellular space (Maragakis and Rothstein, 2001, 2004). This protective function may be particularly relevant to the selective degeneration of MSNs in the striatum in HD and glia are believed to play a prominent role in excitotoxicity induced HD pathogenesis (Coyle and Schwarcz, 1976).

Glia conditioned medium appeared to provide neuroprotective effects in cell models and an R6/1 mouse model of HD in addition to other models of neurodegenerative diseases

(Ruiz et al., 2012) . Of relevance to this thesis, PIAS1 is involved in the negative regulation of several key inflammatory signaling nodes (Liu and Shuai, 2008; Shuai and

Liu, 2005) such as NF-κB and interferon-inducible genes.

While the primary pathology associated with HD is thought to arise from neuronal dysfunction and death, as previously stated, HTT expression has been found in every tissue studied and is also expressed in immune cells and both central and peripheral innate immune cells have been shown to be abnormal in HD patients (Trager et al.,

2013). Further, there is peripheral immune system dysfunction in in HD patient plasma in the form of changes in levels of innate immune proteins such as complement factors and cytokines. Elevated cytokine and chemokine levels have been identified in HD patients, which correlates with disease progression and can be detected about 16 years before disease onset (Trager et al., 2013). A particular mechanism behind this dysfunction is mHTT’s interaction with the key kinase of the NF-κB pathway – IKK – which has been shown as one cause of increased cytokine production in primary human

HD immune cells, by leading to increased activation of the NF-κB signaling cascade upon stimulation with LPS (Khoshnan and Patterson, 2011). Intracellular signaling pathways leading to the activation of the transcription factor NF-κB are important regulators of cytokine production and play a key role in inflammation and immune dysfunction in HD. Events such as the activation of Toll-like receptors (TLRs) leads to the phosphorylation and activation of IKK. This kinase phosphorylates IkB, which is then ubiquitinated and degraded by the proteasome, whereby it dissociates from the NF-κB transcription factor subunits (RelA, RelB, cRel, NFkB1, NFkB2) that it sequesters in an inactive state in the cytoplasm. The free NFkB molecules can then translocate into the

nucleus and activate gene transcription (Hayden and Ghosh, 2012). Interestingly,

PIAS1 has been strongly implicated in transcriptional silencing of this particular pathway. Striatal extracts and isolated astrocytes from HD modeled R6/2 mice reveal that overexpression of mHTT exon 1 can stimulate the NF-κB pathway by directly interacting with IKK a suggesting the NF-κB pathway is implicated in HD (Hsiao et al.,

2013).

Another immune signaling pathway shown to play a role in HD dysfunction is the

JAK/STAT signaling pathway which plays a critical role in the communication between immune cells and is mainly activated through cytokine receptors. The binding of cytokines to their receptors leads to the activation and cross-phosphorylation of JAK tyrosine kinases, which are bound to the intracellular domain of the cytokine receptor.

Activation of these kinases leads to subsequent phosphorylation of tyrosine residues in the intracellular domain of the receptor. STAT signaling molecules may then bind these phosphotyrosine residues and are subsequently phosphorylated by JAKs, allowing the

STATs to dimerize and then translocate into the nucleus to act as transcription factors and induce transcription of cytokine genes. It is important to note that there are many different STAT family members (STAT1-6), each of which is activated by different receptors and different JAKs. This inevitably leads to the expression of specific sets of genes, depending on which STAT has been activated. For instance, STAT1 is activated by IFNγ, while STAT3 is activated by IL-6 and IL-10 signaling, and STAT5 is activated by IL-2. Both STAT3 and STAT1 are activated in monocytes stimulated by IL-6, while

STAT5 has been linked to monocyte production of IL-6. Given that different STATs have different roles within these signaling cascades, understanding how these are regulated

by factors such as PIAS1 and affected in HD may provide critical information regarding pathogenesis and progression.

SUMMARY

The misfolding and aggregation of disease proteins is characteristic of numerous neurodegenerative diseases. Particular neuronal populations are more vulnerable to proteotoxicity while others are more apt to tolerate the misfolding and aggregation of disease proteins. Thus, the cellular environment must play a significant role in determining whether disease proteins are converted into toxic or benign forms. There is immense molecular complexity in the cellular processes which regulate this conversion or ‘flux’ of pathways such as inflammatory responses and protein clearance networks, particularly in HD. For example, interacting partners and medications can modulate the conformation and localization of disease proteins and thereby influence proteotoxicity.

Thus, interplay between these protein homeostasis network components can modulate the self-association of disease proteins and determine whether they elicit a toxic or benign outcome. My dissertation work suggests that PIAS1 may act as a regulator in this interplay by linking protein homeostasis and neuroinflammation in HD through a combination of modulating accumulation of toxic HMW species of HTT and modulating or compensating for dysfunctional inflammatory signaling cascades between neurons and microglia. These effects on mHTT itself as well as PIAS1 specific effects potentially allow improved flux through protein clearance pathways, of which HTT itself is likely involved in. Given that PIAS proteins regulate several critical cellular processes such as transcription, immune responses, and cytokine signaling (Liu and Shuai, 2008; Rytinki

et al., 2009), and the likelihood that these processes play critical roles in different stages of disease and development, PIAS1 may serve as an “opportunistic” target. The fundamental properties identified in this dissertation suggest that regulating HTT’s function or regulating PIAS1 and other E3 SUMO ligases may be key to tipping the balance between normal protein homeostasis and disease processes that ultimately contribute to neurodegeneration in HD, concepts that may broadly impact other neurodegenerative diseases.

CHAPTER 1

A potential function for the huntingtin protein as a scaffold for selective

Autophagy

SUMMARY OF CHAPTER 1

Since the Huntington’s Disease Collaborative Research Group first identified the mutation responsible for HD in 1993 (Group, 1993a), investigators have sought to understand how this defective gene causes the drastic neurodegeneration seen in individuals with HD (Gil and Rego, 2008; Lee et al., 2013b; Lee and Kim, 2006).

Expansion of CAG repeats in the HTT gene results in a misfolded protein product referred to as mHTT. Most of these studies have focused on the role of mHTT in the initiation and progression of HD, with experimental evidence suggesting that chronic expression and accumulation of this abnormal protein is toxic to multiple cell types in the brain (Zhao et al., 2016). Despite the importance of understanding how mHTT causes neurodegeneration, there is also a great deal of scientific interest in studying the function of the “normal” un-mutated version of the protein. Although loss of function does not appear to “cause” HD, given results from genetic mouse knockout models, there may be more subtle impairments that significantly contribute to disease.

Therefore understanding normal HTT protein function may provide a better understanding of pathogenic mechanisms related to impairment of these normal functions and alternative or additional therapeutic approaches.

This portion of my dissertation examines a potential normal function of the HTT protein and gives possible insights into how HTT itself may contribute to its own homeostasis.

For many years, the normal function of HTT was “unknown”; however, there are

emerging activities of HTT in transcription, as a protein scaffold and more recently in autophagy (Martin et al., 2015). Our group, working with collaborators, has recently defined a novel role for HTT in selective autophagy that is required in Drosophila and mouse CNS. This work was based a hypothesis developed by Dr. Joan Steffan, where she described similarities in structure between human HTT and yeast autophagy proteins. My contribution to this work was to evaluate binding activity between the C- terminal domain of HTT and the yeast autophagy scaffold protein Atg11, suggesting that

HTT may normally function as a scaffold for various types of selective autophagy. In this work, we show that mice expressing an expanded repeat form of HTT produce deficits in protein clearance and dysregulation of autophagy in Drosophila . Because autophagy is critical for clearance of cellular proteins, including mutant HTT, the impairment of normal HTT function by the polyQ expansion could suppress activity of the autophagy machinery. These results may have important implications when evaluating therapeutic strategies for HD. Further, research into HTT function is valuable not only because it can provide a better picture of what is disrupted in the mutant version of the protein, but may even offer clues for developing future treatments and cures based on boosting normal HTT function.

Chapter from:

Ochaba, J ., Lukacsovich, T., Csikos, G., Zheng, S., Margulis, J., Salazar, L., Mao, K.,

Lau, A.L., Yeung, S.Y., Humbert, S., Saudou, F., Klionsky, D., Finkbeiner, S.,

Zeitlin, S.O., Marsh, J.L., Housman, D.E., Thompson, L.M., and Steffan, J.S.

(2014). A potential novel function for the Huntingtin protein as a scaffold for

selective autophagy. Proceedings of the National Academy of Sciences, USA ,

111: 16889-94.

INTRODUCTION

Although the HTT gene was described in 1993, potential normal functions of HTT have only recently been suggested or described (Zheng and Joinnides, 2009). Although the exact function of this protein is unknown, it appears to play an important role in neurons and is essential for normal development before birth. Identifying the normal biological function of the HTT protein is important in the effort to design and implement effective therapeutic interventions for HD, but has proved challenging.

In the mouse, loss of HTT leads to lethality during gastrulation at embryonic day seven

(Duyao et al., 1995; Nasir et al., 1995; Zeitlin et al., 1995). Conditional inactivation of

HTT in mouse forebrain at postnatal or late embryonic stages causes a progressive neurodegenerative phenotype associated with neuronal degeneration, motor phenotypes and early mortality (Dragatsis et al., 2000). Loss of HTT in mouse cells reduces primary cilia formation, and deletion of HTT in ependymal cells leads to alteration of the cilia layer, suggesting a role for HTT in ciliogenesis (Keryer et al.,

2011). Mutant HTT expression and HTT knockdown have also been found to impair axonal trafficking of vesicles, mitochondria and autophagosomes in neurons in vitro and in vivo (Gauthier et al., 2004; Trushina et al., 2004; Wong and Holzbaur, 2014). A clear molecular mechanism to relate these findings to the function of the HTT protein, however, has not yet emerged.

In contrast to the embryonic lethality observed in the mouse, Drosophila lacking the endogenous Htt gene develop normally. However, adult Drosophila HTT loss-of-function

(LOF) flies show an accelerated neurodegenerative phenotype in a Drosophila model of

HD expressing human mutant exon 1 HTT protein (Zhang et al., 2009). Loss of HTT function leads to defects in mobility and ultimately survival as the adult flies age, and to a mitotic spindle misorientation which is also observed in the conditional mouse neuronal HTT knockout. Drosophila HTT expression in mouse cells treated with mouse

HTT si-RNA can compensate for the loss of mouse HTT demonstrating functional conservation of the mitotic spindle and axonal transport roles of HTT from these widely divergent species (Godin et al., 2010; Zala et al., 2013). In zebrafish, depletion of HTT produces symptoms of cellular iron deficiency, demonstrating a requirement for HTT in cellular iron utilization (Lumsden et al., 2007) while knockout of HTT in Dictyostelium discoideum demonstrates it is needed for survival when nutrients are limiting (Myre et al., 2011).

In contrast to the sequence conservation among vertebrate and invertebrate HTT proteins, finding clear homologs of metazoan HTT in yeast has proved challenging.

Bioinformatic studies suggest that the HTT protein shares a sequence relationship with three different components of the yeast autophagy system, Atg11, Atg23 and Vac8

(Steffan, 2010), leading us to propose that HTT carries out cellular functions analogous to those carried out by these yeast proteins. To test this hypothesis, we conducted functional studies showing that Drosophila and mouse knockouts for HTT have impaired autophagic processes. Molecular association studies utilizing co-immunoprecipitation reveal that HTT has high affinity for mammalian components of the autophagy system

that are known to interact with the relevant yeast autophagy proteins. These observations support the hypothesis that a normal function of the HTT protein is in the execution of autophagy pathways and that ablation of HTT function leads to defects in autophagy which may be important to consider in evaluating therapeutic options in HD.

RESULTS

HTT LOF in Drosophila inhibits autophagy

Given the similarities in amino acid sequence between human HTT and yeast Atg11,

Atg23 and Vac8 (Steffan, 2010), we asked whether normal Drosophila HTT plays a role in autophagy by assessing the ability of HTT LOF flies to mount a stress-activated autophagic response. Feeding larvae were immersed in 20% sucrose for 3 hours to induce a starvation response. Autophagy was monitored with both LysoTracker Red and by immunostaining with anti-p62/SQSTM1, a receptor protein for selective autophagy that is called Ref(2)P in Drosophila (Nezis et al., 2008). In normal larvae, this starvation regimen induces the rapid appearance of many acidic LysoTracker Red positive vesicles (Figure 1.1A). In HTT LOF larvae, the appearance of acidic vesicles

(primary lysosomes and autolysosomes) induced by starvation stress is dramatically suppressed. Consistent with a disruption of autophagy, accumulation of Ref(2)P increased markedly in the fat bodies of HTT LOF larvae (Figure 1.1B). The data from

Figure.1.1A,B was quantitated and found to be highly significant (p<0.01). These observations indicate that HTT-deficient Drosophila are unable to mount a stress- induced autophagic response. This phenotype is similar to that reported for LOF mutants of Drosophila RB1CC1/FIP200 and Atg7, proteins that are also essential for

autophagy (Juhasz et al., 2007; Kim et al., 2013; Nagy et al., 2014). In addition, we observe a climbing deficit in HTT LOF larvae, a behavioral defect typical of impaired autophagy. Late in the 3 rd larval stage (L3) a hormone signal prompts the initiation of a wandering behavior when larvae leave the food and climb the walls of the vial searching for an appropriate place to pupariate. HTT LOF larvae wander to pupriation sites significantly lower (approximately half) than controls (Figure 1.1C). This behavior is similar to the motor deficit reported for RB1CC1/FIP200 and Atg7 LOF mutants (Juhasz et al., 2007; Kim et al., 2013). These data demonstrate that loss of HTT in Drosophila results in an almost complete loss of starvation-induced autophagy.

Conditional knockout of HTT in the mouse CNS supports a role for HTT in autophagy

Because complete loss of function of HTT in the mouse causes early embryonic lethality, we utilized the conditional inactivation of HTT in mouse forebrain to assess the impact of HTT LOF. HTT LOF at early postnatal or late embryonic stages causes a progressive neurodegenerative phenotype and early mortality (Dragatsis et al., 2000), reminiscent of the phenotypes caused by loss of autophagy proteins such as Atg5, Atg7 and RB1CC1/FIP200 in the CNS of mice. These conditional knockouts cause abnormal accumulation of ubiquitinated protein aggregates accompanied by increased apoptosis and neurodegeneration (Hara et al., 2006; Komatsu et al., 2006; Liang et al., 2010). We analyzed HTT conditional knockout mice ( Htt flox/-;nestin-cre-tg ) for similar biochemical correlates and observed statistically significant increases in p62 in the pellet fraction from dissected striata by 6 months of age compared to controls (Figure 1.1D). This dysregulation is progressive as by 14 months, accumulation of p62 in these fractions is

even more pronounced (Figure 1.2A). Dysregulation of autophagy is also suggested by a pronounced accumulation of lipofuscin and ubiquitin in thalamus from 7 month old conditional knockout mice (Figure 1.2B), a brain region that shows relatively early lipofuscin accumulation in aging rodents and for which dysfunction is implicated in HD

(Kassubek et al., 2005; Nakano et al., 1995). Lipofuscin and ubiquitin accumulation is similarly pronounced in striata from CAG140 HD mice (Zheng et al., 2010; Zheng et al.,

2012). Although most Htt-/- mutants die before 15 months of age because of hydrocephalus, in one surviving 2-year-old mutant mouse with milder hydrocephalus, ubiquitin and p62 puncta and lipofuscin accumulation were also prevalent in the striatum, similar to what we observed in 2 year old 140Q/+ mouse striatum (Figure

1.2C). Taken together, these data are consistent with HTT playing a necessary essential role in autophagy that is impaired upon HTT knockout or mutation.

The C-terminal domain of HTT is similar to yeast Atg11

The in vivo data above support the hypothesis that HTT normally functions as a component of the autophagy system. Sequence analysis of HTT orthologs from mammals and invertebrates suggest that several regions of the HTT protein share similarity with Saccharomyces cerevisiae autophagic proteins (Figures 1.3A,1.4-1.6)

(Steffan, 2010). The amino-terminal (N-terminal) domain of mammalian HTTs (human

HTT amino acids [aa] 1-586) is similar to yeast Atg23 (Figure 1.4) the central region of

HTT (aa 745-1710) is similar to yeast Vac8 (Figure 1.5), while the carboxy-terminal (C- terminal) region of HTT (aa 1815-3144) is similar to yeast Atg11 (Figure 1.6). This suggests the hypothesis that HTT is a protein in which the functionality of these three yeast proteins is combined into a single large polypeptide chain.

To evaluate whether the C-terminal region of HTT was functionally related to Atg11 in yeast, we asked whether it would co-immunoprecipitate with human orthologs of known yeast Atg11-interacting proteins. In yeast, the Atg1/ULK1 kinase complex is a key regulator of autophagic activation and inhibition and is comprised of several Atg proteins including Atg1, Atg11, Atg13 and Vac8 (Mao et al., 2013; Yorimitsu and Klionsky, 2005).

In mammalian cells this complex includes ULK1, RB1CC1/FIP200 and Atg13 (Figure

1.3A). To test for interaction with members of this complex, a minimal fragment of the

C-terminal domain of HTT (aa 2416-3144) that contains the Atg11 CC3- and CC4-like domains involved in interactions with autophagy proteins (Aoki et al., 2011; Yorimitsu and Klionsky, 2005), was fused in frame to an N-terminal Venus tag (Figure 1.3B).

When epitope-tagged and overexpressed in HEK293T cells, we found that these three mammalian proteins co-immunoprecipitate with the C-terminal HTT fragment. In addition, this fragment also co-purified with autophagic receptor protein p62/SQSTM1, an ortholog of yeast Atg19 that is known to interact with Atg11 (Kraft et al., 2010; Mao et al., 2013) (Figure 1.3C).

The mammalian homolog of Atg6, BECN1/Beclin-1 is part of the phosphatidylinositol 3- kinase complex required for induction of autophagy and is phosphorylated and activated by ULK1 (Russell et al., 2013). As Atg6 has a genetic interaction with Vac8 (Hoppins et al., 2011), we investigated the potential interaction between BECN1 and HTT, since the central domain of HTT resembles Vac8 (Figure 1.5) (Steffan, 2010). BECN1 co- immunoprecipitated with full-length wild type (WT; 23Q) and mutant (100Q) HTT in cells

(Figure 1.3D). These data are consistent with HTT functioning like Atg11 and Vac8 in metazoans.

The N- and C-terminal domains of HTT interact

In yeast, Atg23 and Atg11 work together to regulate autophagosome formation and

Atg9 trafficking (Steffan, 2010). In HTT, the N-terminal domain resembles the yeast

Atg23 protein (Figure 1.4), while the C-terminal domain is similar to Atg11 (Figure 1.6).

If these structural similarities are functionally relevant, one would predict that the N- and

C-terminal domains of HTT might interact with each other. Consistent with this hypothesis, the N-terminal 586 amino acid-HTT fragment co-immunoprecipitates with the C-terminal region tested above (2416-3144) and expansion of the polyQ repeat did not affect the interaction (Figure 1.3E). The HTT fragment encoded by 90 amino acid exon 1 was not sufficient for this interaction, suggesting that HTT residues within the 91-

586 amino acid domain are required.

HTT may play a role in mitophagy

In yeast, selective autophagic clearance of mitochondria, mitophagy, requires an interaction between Atg11 and the protein Atg32, a receptor protein anchored to the outer mitochondrial membrane (Suzuki, 2013). The mammalian counterparts of Atg32 are the integral membrane receptors BNIP3 and BNIP3L/NIX (Hanna et al., 2012;

Parzych and Klionsky, 2014). Immunoprecipitation of MYC-tagged BNIP3 or

BNIP3L/NIX after co-tranfection with Venus-tagged HTT (2416-3144) followed by

Western blotting (Figure 3 C) resulted in robust staining with anti-Venus antibody but not with anti-actin, demonstrating that the C-terminal HTT (2416-3144) interacts with the mammalian counterparts of yeast Atg32 that bind Atg11 during mitophagy.

BNIP3 and BNIP3L/NIX were both originally isolated as proteins that, when overexpressed in cultured mammalian cells (e.g. MCF-7, HeLa and Rat fibroblasts), cause apoptotic cell death, suggesting that destabilizing mitophagic balance may have severe consequences for the cell (Zhang and Ney, 2009). Furthermore, overexpression of Atg11 from a multi-copy plasmid in yeast results in cell death (Geng et al., 2008).

Consistent with a disruption in cellular homeostasis, transiently transfecting C-terminal

HTT fragments into rat primary cortical neurons (Figure 1.7) caused cell death, both when expressing either the minimal CC3 and CC4-like region (aa 2416-3144) or a longer fragment that comprises the full Atg11-like protein (aa 1651-3144).

HTT and Atg11 have WXXL domains

Atg8-family proteins are evolutionarily conserved proteins that are components of the core autophagic machinery and play a crucial role in the formation of autophagosomes.

Yeast Atg8 is highly similar to the mammalian Atg8 family, which is comprised of at least three MAP1 light chain 3 proteins (LC3A, LC3B, LC3C), and four gamma- aminobutyrate receptor-associated protein (GABARAP) and GABARAP-like proteins

(GABARAPL1/Atg8L/GEC-1, GABARAPL2/Gate-16 and GABARAPL3) (Kalvari et al.,

2014). Atg8s are ubiquitin-like modifiers that become conjugated to phosphatidylethanolamine by a process similar to ubiquitination. Lipidated Atg8s localize to phagophores (autophagosome precursors) and autophagosomes and are involved in the recruitment of the selective cargo to the forming autophagosome. Atg11 has recently been shown to directly interact with Atg8 (Li et al., 2014). To examine whether the C-terminal domain of HTT interacts with the Atg8-family of proteins in cells,

the two different C-terminal HTT fragments were tested in co-immunoprecipitation experiments with mammalian Atg8 homologs LC3B and GABARAPL1.

Proteins that dock onto Atg8s have a “WXXL” interaction surface with a consensus sequence W/F/Y-X-X-L/I/V/F. In mammals, this domain is also be referred to as a “LIR” for LC3-interacting region (Farre et al., 2013; Kalvari et al., 2014) and is found in many proteins including p62, OPTN/optineurin and BNIP3L/NIX, which are also Atg8 family- interacting proteins (Figure 1.8A). The C-terminal domains of both Atg11 and HTT contain a highly conserved region (Figure 1.6, 1.8B) with a consensus LIR, coinciding with tryptophan (W) 3037 in human HTT. Using a web resource for prediction of Atg8- family interacting proteins, iLIR (Kalvari et al., 2014), we find that human full-length HTT has 9 such xLIR motifs (LIR motifs containing flanking residues common to other Atg8 family-interacting proteins) including the phylogenetically conserved motif at W3037 which has the highest position-specific scoring matrix (PSSM) score (Figure 1.8C, 1.9).

An additional 45 WXXL motifs were also identified within full-length HTT (Figure 1.10), again similar to yeast Atg11, which has 4 xLIRs and 23 WXXL domains predicted by the iLIR web resource (Figure 1.11).

The p62 and OPTN proteins each contain only one predicted xLIR, and mutation of the p62 xLIR at W338A or the OPTN xLIR at F178A blocks their interaction with LC3 (Noda et al., 2008; Wild et al., 2011). We found that Venus-HTT (2416-3144) and Venus-

HTT(1651-3144) specifically co-immunoprecipitated with both MYC-LC3B and MYC-

GABARAPL1. To test whether the interaction of HTT with either GABARAPL1 or LC3B was dependent on the presence of the conserved W3037 motif, a W to A mutation was introduced (W3037A) into both C-terminal HTT polypeptides. This mutation did not

affect the interaction with the longer construct (Figure 1.8D), but significantly reduced the interaction of GABARAPL1 with the shorter amino acid 2416-3144 HTT fragment

(Figure 1.12). The interaction with LC3B was not affected by the presence of the

W3037A mutation. These data suggest that the higher number of combined xLIRS and

WXXL domains within the longer HTT fragment (26 vs. 11) may compensate for the mutation, but that this highly conserved motif at HTT W3037 is likely a functional LIR, as evidenced by reduced binding to GABARAPL1. The domain of mammalian Atg8s that interacts directly with WXXL domains, as shown by crystal structure, is negatively charged for GABARAPL1 but positively charged for LC3B (Noda et al., 2008).

Therefore it is possible that the positively charged HTT residue R3035 adjacent to the

WXXL at W3037 may directly interact with GABARAPL1 E7 and D8 negatively-charged residues, but not with LC3B R10 and R11 positively-charged residues. There may therefore be a structural basis for the loss of GABARAPL1 interaction with HTT

W3037A; this will be evaluated in future studies.

DISCUSSION

Autophagy is an evolutionarily-conserved lysosomal degradation pathway . Here we show that the HTT protein in Drosophila and mice is essential for normal selective autophagy and we propose that the HTT proteins of metazoans encapsulate the function of autophagy proteins Atg11, Atg23 and Vac8 in yeast. Specifically, the protein

Atg11 is known to regulate selective autophagy and act as a scaffold/adaptor protein that brings the autophagic core machinery into contact with targets for degradation.

Vac8 is part of the Atg1 complex and plays a role in nucleophagy in the formation of nucleus/vacuole junctions, while Atg23 and Atg11 work together to regulate

autophagosome formation and Atg9 trafficking in yeast (Steffan, 2010). We find that the

C-terminal domain of HTT, similar in structure to yeast Atg11, can interact with the

Atg1/ULK1 kinase complex, receptor proteins and the Atg8 family of proteins, suggesting that HTT may have activity as a scaffold for selective forms of macroautophagy and microautophagy, in essence functioning as a mammalian Atg11.

The loss of HTT function in a number of different organisms and tissue types has led to a plethora of phenotypic consequences (Zuccato et al., 2010). The possibility that HTT plays a role as an autophagic scaffold has the potential to unite a diverse set of observations regarding HTT function and has relevance to therapeutic interventions in

HD. In Figure 1.13, we outline a range of cellular processes which have been shown to involve selective autophagy and to require the specific functional components we suggest are attributable to HTT; many of these have been reported to be disrupted in

HTT knockouts. For example, in zebrafish loss of HTT function is associated with a defect in iron metabolism which at present is mechanistically unclear. A defect in selective autophagic clearance of the iron-binding protein ferritin (ferritinophagy) with loss of HTT function in HD patients and mice may therefore reflect an impairment in ferritinophagy (Lumsden et al., 2007; Mancias et al., 2014; Simmons et al., 2007). Both mutant HTT expression and HTT knockdown are found to impair axonal trafficking of vesicles, mitochondria and autophagosomes in neurons in vitro and in vivo (Gauthier et al., 2004; Trushina et al., 2004; Wong and Holzbaur, 2014; Zala et al., 2013), consistent with a loss of Atg11/Atg23-like membrane trafficking .

Autophagy proteins can regulate cell cycle progression, mitosis and selective midbody ring autophagic clearance (Dotiwala et al., 2013; Maskey et al., 2013; Pohl and Jentsch,

2009), therefore HTT activity at the mitotic spindle may reflect its function as part of the autophagic machinery. We also find that HTT knockout in the mouse CNS causes accumulation of p62- and ubiquitin-containing aggregates, which may reflect a loss of aggrephagy, the selective autophagic disposal of protein oligomers and aggregates

(Lamark and Johansen, 2012). Atg11 is a scaffold protein required for selective targeting of oligomers to the yeast vacuole in the Cvt pathway. Two Atg11-interacting proteins required for the Cvt pathway, Atg20 and Atg24, are similar in amino acid sequence to HTT-interacting proteins OPTN and HAP1 respectively (Steffan, 2010), further supporting the similarity in aggrephagy function between HTT and Atg11.

Loss of HTT function in mouse cells reduces cilia formation, and ciliogenesis is altered in HD. The association of HTT with OPTN directly links it to the RAB8 protein, important for ciliogenesis (Hattula and Peranen, 2000; Keryer et al., 2011; Nachury et al., 2007; Wild et al., 2011). These data support a role for HTT in ciliogenesis/ciliophagy

(Wrighton, 2013). A loss of WT HTT function may similarly cause dysregulation of RNA- mediated gene silencing as HTT associates with Argonaute and P bodies/stress granules, both shown to be cleared by selective autophagy/granulophagy (Buchan et al., 2013; Gibbings et al., 2012; Savas et al., 2008). These associations suggest that many of the phenotypic consequences caused by loss of HTT function can be understood in terms of disrupted selective autophagy.

HD is a progressive neurodegenerative disease associated with protein accumulation and dysfunction and a growing number of studies suggest that fundamental defects in autophagy may underlie pathogenesis of this disease. In HD, autophagosomes form normally and are eliminated by lysosomes, but fail to efficiently trap cytosolic cargo in

their lumen. The number of lipid droplets increases in HD cells, paralleling their reduced association with autophagosomes which may reflect a loss of selective autophagic degradation of fats and lipids, lipophagy. Indeed, the accumulation of lipofuscin, which represents reduced lipid degradation and is a hallmark of aging and neurodegeneration, is observed in postmortem HD brain (Cortes and La Spada, 2014; Martinez-Vicente et al., 2010). Relevant to the proposal that HTT is a critical component of the autophagy machinery, when autophagy core proteins are reduced through knockdown (Dragatsis et al., 2000; Trushina et al., 2004), neurodegeneration is observed that is similar to that observed in HD models containing an expanded polyglutamine repeat within HTT. In

Drosophila, HTT LOF animals are viable with no obvious developmental defects, however, removing endogenous Drosophila HTT leads to accelerated neurodegeneration in flies challenged with expanded human HTT exon 1 (Q93) and to loss of autophagy in starvation-stressed larvae (Figure 1.1). The loss of stress-induced autophagy can account for the accelerated degeneration when challenged with mutant

HTT, consistent with a role for wild type HTT in autophagy in flies.

Inactivation of HTT in mouse brain results in progressive neurodegeneration and in an accumulation of aggregates (Figure 1.1D) (Dragatsis et al., 2000). Conditional neuronal knockdown of autophagy core proteins Atg5 and Atg7 has previously been shown to cause neurodegeneration with corresponding accumulation of aggregates (Hara et al.,

2006; Komatsu et al., 2006). Knockdown of the ULK1 kinase complex protein

RB1CC1/FIP200, a protein with sequence similar to yeast Atg11 (Li et al., 2014) and the

C-terminal domain of HTT, causes cerebellar neurodegeneration and aggregate accumulation (Liang et al., 2010), while knockdown of HTT results in striatal cell loss

(Ross and Tabrizi, 2011), although at a much slower rate of progression possibly due to redundancy in Atg11-like protein function. Thus, differential expression and use of mammalian Atg11-like proteins in brain may contribute to the selective neuronal cell death observed in neurodegenerative diseases. BECN1 can regulate autophagic clearance of full-length and fragmented mutant HTT in cell culture and co-localizes with mutant HTT in inclusions in transgenic R6/2 HD mouse brain (Shibata et al., 2006) raising the possibility that sequestration of BECN1 in mutant HTT aggregates can contribute to disease by disrupting autophagy. Here we find that BECN1 associates with full-length WT and mutant HTT. Together, these findings have significance for therapeutics that involve reduction of normal HTT function if HTT is indeed a critical scaffold protein involved in selective autophagy.

The central domain of HTT shares similarity with Vac8 (Figure 1.5), a protein that functions together with Atg11 in yeast nucleophagy, suggesting that the central and C- terminal domains of HTT may play a role in mammalian nucleophagy (Steffan, 2010).

Impairment of nucleophagic transcription factor clearance caused by a loss in WT HTT function may contribute to HD pathogenesis, as transcriptional dysregulation has been demonstrated in HD and autophagic clearance of transcription factors has been recently shown to be progressively dysregulated with aging and neurodegeneration (Lu et al.,

2014; Zuccato et al., 2010). In addition, we observe that the C-terminal domain of HTT co-immunoprecipitates with mitophagy receptor proteins p62, BNIP3 and BNIP3L/NIX.

A loss of mitophagic function may contribute to the known abnormalities in mitochondrial function and bioenergetics that occur in HD (Rosenstock et al., 2010).

We find that the HTT N-terminal Atg23-like domain interacts with its Atg11-like C- terminal domain. We postulate that posttranslational modifications within the N-terminal domain of HTT which regulate WT and mutant HTT abundance and mutant HTT- mediated toxicity may serve as potential modulators of this intramolecular interaction and hence regulation of autophagy. These modifications include phosphorylation of serines 13, 16, and 421 and acetylation of lysines 9 and 444 (Steffan, 2010; Thompson et al., 2009). Phosphorylation of HTT serines 13 and 16 may change the conformation of a flexible hinge in the N-terminal domain of HTT to reduce the ability of HTT to fold back on itself (Caron et al., 2013), thereby potentially allowing the autophagy activity of the Atg11 C-terminal domain to be activated. Indeed, mimicking this modification reduces mutant HTT-mediated toxicity in vivo (Gu et al., 2009), consistent with a central role for this phosphorylation event.

We propose here that HTT may function as a scaffold for selective autophagy, based on structural similarities with Atg11, Atg23 and Vac8, interactions with Atg11 partners, the presence of a motif that can regulate at least one of these interactions, and findings that loss of HTT function recapitulates phenotypes in common with loss of core autophagy proteins. A loss of neuronal selective autophagy with age may contribute to the accumulation of protein aggregates, disruption of mitochondrial function and inflammation that are hallmarks of HD and other polyQ diseases, as well as diseases such as Alzheimer’s and Parkinson’s diseases, FTD and ALS. Given that autophagy has been implicated in many of these diseases, targeting HTT itself may provide an attractive therapeutic target for intervention in these disorders, suggesting that these findings may have broad relevance.

EXPERIMENTAL PROCEDURES

Cell culture and transfection, Immunoprecipitation and Western blot

ST14A and HEK293T cells were cultured, lysed and sonicated. For immunoprecipitation, 500 m g of HEK293T cell lysate was incubated with anti-HA, anti-

MYC or anti-Living Colors antibody and Dynabeads (Invitrogen) and incubated on a rotator overnight at 4°C. Immunoprecipitates were washed three times and analyzed by

Western blot and statistics as described in below .

Nestin-cre conditional Htt knockout mouse

For conditional knockout of Htt expression in neuronal progenitors, we used a nestin-cre transgenic line. Htt flox/-;nestin-cre-tg mice were obtained from crosses between Htt +/-; nestin-cre-tg males and Htt flox/flox females. Brains were frozen and subjected to analysis as described below. p62/SQSTM1 was detected by Western analysis in the striatal insoluble pellet fraction and quantitated as previously described (Zheng et al., 2010).

Drosophila HTT LOF experiments

Autophagy was analyzed in HTT LOF Drosophila larvae (Zhang et al., 2009) as described in below. Briefly, early third instar larvae synchronized at 88 hours after egg laying (AEL) were starved through flotation in sucrose for 3 hours at room temperature.

Fat bodies were dissected and processed with LysoTracker Red or fixed and subjected to immunohistochemistry with anti-p62/Ref(2)p. Climbing behavior was analyzed by averaging the distance from the food surface of the 5 highest pupae in each of 10 vials.

Plasmids pARIS-httpcDNA3.2-N[His-mCherry]Q23-C[HA-TC] (pARIS-mCherry-httQ23), pARIS- httpcDNA3.2-N[His-mCherry]Q100-C[HA-TC] (pARIS-mCherry-httQ100), pcDNA25QP-

H4 exon 1, pcDNA97QP-H4 exon 1, pcDNA25Q-586aa and pcDNA137Q-586aa are previously described(O'Rourke et al., 2013; Pardo et al., 2010; Thompson et al., 2009).

The following plasmids were obtained from Origene: myc-DDK-GABARAPL1 DNA

(RC206762), myc-DDK-BNIP3L (NIX) DNA (RC203315), myc-DDK-MAP1LC3B DNA

(RC207356). HA-ULK1, myc-mAtg13, myc-FIP200 and myc-p62 have been published(Jung et al., 2009; Wooten et al., 2008). W3037A mutants were made in the full length HTT gene in pARIS by site directed in vitro mutagenesis. Venus-HTT(2416-

3144) and Venus-(1651-3144) were generated fusing Venus in the vector pGW1 in frame with the C-terminal 728 aa of HTT using the pARIS SpeI site, and with the C- terminal 1493aa of HTT using the pARIS SalI site. We inserted a short synthetic oligonucleotide into the BglII-EcoRI site of pGW1 just downstream of the Venus coding sequence:5'GATCTGTCGACATTCTAGATATAGAATTCTGA3'

3'ACAGCTGTAAGATCTATATCTTAAGACTTTAA5'. These oligonucleotides provided the SalI and the XbaI (that has a complementary 5’ overhang with SpeI) restriction sites in frame with the Venus coding sequence for the insertion of HTT gene fragments and also added a stop codon to terminate the fusion proteins at the 3' end of the HTT gene.

We inserted both the SalI-EcoRI and the SpeI-EcoRI fragments of pARIS-HTT plasmids into pGW1. Using this technique we generated 4 constructs: Venus-HTT(2416-3144) wt,

Venus-HTT(2416-3144) W3037A, Venus-HTT(1651-3144) wt, and Venus-HTT(1651-

3144) W3037A.

Antibodies

The following antibodies were used: Anti-HTT-5492 (Millipore); Anti-HA11 Clone 16B12 monoclonal (Covance); Anti-MYC 9E10 (Millipore); Anti-actin A2066 (Sigma-

Aldrich) Anti-β-actin (MP Biomedicals), Anti-alpha-Tubulin (Sigma-Aldrich), Anti- p62/SQSTM1 (American Research Products, Inc.), Anti-Living Colors® (to detect EGFP and Venus) 632592 polyclonal or 632381 monoclonal (Clontech), anti-rabbit-FITC and anti-guinea pig-Cy3 (Jackson Immunologicals). Primary antibodies used for mouse immunohistochemistry were: p62/SQSTM1 (American Research Products, Inc.) and ubiquitin (Novus). Anti-Ref(2)P was kindly provided by Dr. Gabor Juhasz. (Eötvös

Loránd University; Budapest, Hungary).

Cell culture and transfection

ST14A and HEK293T cells were cultured at 33°C and 37°C, respectively at 5% CO2 in

Dulbeco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum. Both cell lines were transfected using Lipofectamine 2000 reagent (Invitrogen).

293T cells were harvested for Western analysis 48 h after transfection. For fluorescence analysis, 293T cells were plated on poly-L-Lysine coated cover slips and transfected. 48h later, 293T cells were fixed in 4% paraformaldehyde, permeabilized with 0.2% Triton X-100 in PBS, and nuclei were stained with 4′,6-diamidino-2- phenylindole. For St14A live cell fluorescence experiments, cells were seeded in 35mm glass bottom culture dishes (MatTek). Mitochondrial staining was performed with 50 nM

MitoTracker Red (Molecular Probes) for 20 min at 33°C 24 hours after transfection and nuclear staining with Hoechst (10g/ ml) was done simultaneously. Fluorescent microscopy was performed using Zeiss AxioObserver.Z1 microscope and images were captured with Axiovision 4.7 software.

Immunoprecipitation

293T cells were lysed in buffer containing: 20 mM Tris-HCl, pH 7.5, 10% glycerol, 137 mM NaCl, 0.5 mM EDTA, 1% NP-40, supplemented with 20 mM N-ethylmaleimide, 1 mM PMSF, phosphatase inhibitors 2 and 3 (Sigma-Aldrich), complete mini protease inhibitor pellet (Roche), 10 ng/ml aprotenin, 10 ng/ml leupeptin, 5 mM nicotinamide and

5 mM butyrate. Briefly, transfected cells were harvested, lysed, and sonicated on ice.

500g of lysate was incubated with lysis buffer (- 10% glycerol) + phosphatase inhibitors 2 & 3 and added to Dynabeads (Invitrogen) coupled to anti-HA, anti-myc, or anti-living colors antibodies and incubated on a rotator overnight at 4°C.

Immunoprecipitates were washed three times and analyzed by Western blot.

Western blot

Equal amounts of protein were subjected to SDS-PAGE on 4-12% bis-tris or 3-8% tris- acetate mini gels (Invitrogen) and transferred onto 0.45m nitrocellulose membranes

(Bio-Rad). Membranes were incubated with Starting Block – TBS blocking buffer

(Thermo Scientific) for 1 hour, then with primary antibodies overnight. Blots were washed three times with TBS-0.1% Tween-20 for 8 min and incubated with secondary

IgG-HRP antibodies for 45 minutes, washed three more times and detected with

SuperSignal West Pico Chemiluminescent Substrate or SuperSignal West Dura

Extended Duration Substrate (Thermo Scientific) according to the instructions of the supplier. Membranes were exposed to BioMax XAR (Kodak) films and developed. The signal intensities were analyzed and quantitated using ScionImage. Experiments were performed in triplicate or greater with representative images shown.

Statistical Analysis

All statistical analyses were performed using GraphPad Prism 5.04 software. All data are expressed as mean ± SE of measure. p < 0.05 was considered to be statistically significant in all cases. Statistical comparisons of results were performed by performing one-way ANOVA analysis followed by Bonferroni’s multiple comparison tests.

Primary cortical neuron survival assay

Cell culture and transfection: Cortical neurons were dissected from embryonic day 20-

21 rat pups and cultured at 0.6x10 6 cells/ml for 4 days in vitro , as described (Saudou et al., 1998). For survival analyses, cells were plated at a density of 0.1x10 6 cells per well of a 96-well plate. Euthanasia for these experiments was entirely consistent with the recommendations of the Guidelines on Euthanasia of the American Veterinary Medical

Association. Transfection of primary neurons was accomplished using Lipofectamine

2000 (Invitrogen). All transfections involved 0.02-0.7 µg DNA (total) and 0.5 µl

Lipofectamine 2000 per well. Cells were incubated with Lipofectamine/DNA complexes for 60 min at 37°C before rinsing. The remainder of the transfection protocol was per the manufacturer’s suggestions, resulting in an overall transfection efficiency of < 1%.

Longitudinal fluorescence microscopy: Experiments involving neuronal survival analysis utilized an automated microscopy platform described previously (Arrasate et al., 2004;

Barmada et al., 2010). Briefly, images were obtained at 24 h intervals with an inverted microscope (Nikon Ti-E) equipped with the PerfectFocus system, a high-numerical aperture 20x objective lens and a 16-bit Andor 888 back-thinned EMCCD digital camera with a cooled charge-coupled device. Illumination was provided by a Lambda XL lamp

(Sutter) with a liquid light guide. The MS-2500 XY stage (Applied Scientific) was controlled by rotary encoders in all three planes of movement. All components were

encased in a custom-designed, climate-controlled environmental chamber ( In vivo

Scientific). The illumination, filter wheels, focusing, stage movements, and image acquisitions were fully automated and coordinated with a mix of proprietary

(GreenButtonGo + scheduler + Liconic Incubator) and publicly available (ImageJ,

µManager) software.

Image analysis

Relevant data were extracted from the raw, digital images in a sequential process using an original script developed in Accelrys® PipelinePilot (San Diego, CA). Briefly, the median background fluorescence from a portion of all images was calculated and subtracted from individual image. The images were then assembled into montages representing each well at each time point. The montages were sequenced and aligned automatically, and neuron cell bodies segmented based on intensity and morphology.

Among the variables recorded for each neuron were the fluorescence intensity and the time of death, marked by the loss of cellular fluorescence, rounding or dissolution of the cell body. Statistical analyses and the generation of cumulative hazard plots were accomplished using custom-designed algorithms and the survival package within R, while bar graphs were created using Prism.(Arrasate et al., 2004; Barmada et al., 2010;

Saudou et al., 1998)

Survival analysis

For longitudinal survival analysis, the survival time of a neuron was defined as the time point at which a cell was last seen alive. Survival functions were fitted to Kaplan-Meier curves and used to derive cumulative hazard (or risk-of-death) curves that describe the instantaneous risk-of-death for individual neurons in the cohort being tracked. We used

Cox proportional hazards regression analysis (Cox analysis) to generate hazard ratios that quantified the relative risk-of-death between cohorts of neurons expressing different constructs. Hazard ratios and their respective p values were generated using the coxph function in the survival package for R statistical software. The date of the experiment was included as a stratification variable and expression of each construct at the first time point was included as a covariate. All Cox models were analyzed for violations of proportional hazards using the cox.zph function in R.

Nestin-cre conditional Htt knockout mouse

For conditional knockout of Htt expression in neuronal progenitors, we used a nestin-cre transgenic line (Tronche et al., 1999). Htt flox/-;nestin-cre-tg mice were obtained from crosses between Htt +/-; nestin-cre-tg males and Htt flox/flox females. Cre-mediated recombination begins ~E9.5, and HTT expression is eliminated in neuronal progenitors and their differentiated progeny (neurons and glia). Brains from Htt flox/-;nestin-cre-tg and

Httf lox/+ ;nestin-cre-tg controls were rapidly frozen in isopentane chilled on dry ice, and then 14 m fresh frozen sections through the striatum were obtained using a cryostat

(Bright Instrument Co.). Sections were washed briefly in PBS, fixed for 10 min in 4% paraformaldehyde for 10 min, followed by a rinse in PBS and then a second fixation step in 100% methanol for 15 min on ice. Sections were then washed again in PBS before blocking with 5% donkey serum, 0.1% Triton X100 in PBS for 1 h at RT, and then incubated o/n at 4˚C with primary antibody diluted in 5% donkey serum, 0.1%

Triton X100 in PBS. Primary antibodies used were: p62/SQSTM1 (1:100 guinea pig polyclonal from American Research Products, Inc.) and ubiquitin (1:100 rabbit polyclonal from Novus). Following the primary antibody incubation, sections were

washed in PBS three times and incubated with secondary antibodies (anti-rabbit-FITC and anti-guinea pig-Cy3, Jackson Immunologicals), together with the fluorescent DNA stain To-Pro-3 iodide (1:10,000, Invitrogen) for 1 h at RT. Lipofuscin autofluorescence was suppressed by washing with PBS, and then incubating sections sequentially in 75% ethanol for 5 min, lipofuscin eliminator reagent (Millipore) for 5 min, and 5 min in 75% ethanol. Sections were then mounted with Vectashield (Vector Laboratory, and examined using either an Olympus BX51 microscope equipped with a MagnaFire CCD camera or a Nikon C1-confocal microscope. p62/SQSTM1 was detected by Western analysis in the striatal pellet fraction and quantitated as previously described (Zheng et al., 2010).

Lipofuscin imaging

Lipofuscin analysis was performed using 14 m m fresh frozen brain sections. Sections were fixed for 15 min on ice in 100% methanol, washed in PBS, and then incubated with

To-Pro-3 iodide (1:10,000 dilution in PBS) for 1h at RT. Sections were then washed in

PBS and mounted using Vectashield. Lipofuscin autofluorescence was imaged in the green and red channels (lipofuscin has a broad emission spectrum from 500 nm to 650 nm).

Drosophila HTT loss-of-function experiments

Drosophila stocks: Stocks were maintained on a standard cornmeal/sugar/agar medium at 25°C and 50% humidity on a 12h light/12h dark cycle. To obtain a large amount of synchronized larvae, first the well-fed adults were transferred into new vials and allowed to lay their eggs for one hour. After this pre-laying period, the flies were transferred

again into new vials for egg laying for 3h. This second collection contained fertilized eggs which gave larvae with relatively synchronized stages with regard to development.

Starvation treatments: Early third instar larvae synchronized at 88 hours after egg laying

(AEL) were floated in 20% sucrose for 3h at room temperature (RT)(Neufeld, 2008).

LysoTracker Red staining: Treated (starved) and non-treated larvae were dissected in

100 μl PBS (phosphate-buffered saline) and stained in 100 μM LTR (Invitrogen, L7528) diluted in PBS for 3 min. After washing the tissues were mounted in 50% glycerol/PBS completed with 1 μg/μl DAPI (4’,6 diamidino- 2-phenylindole, Sigma, D9542). p62 immunostaining

A polyclonal affinity-purified p62/Ref(2)P antibody (raised in rabbit) was used in this experiment (kindly provided by Gabor Juhasz). Fat bodies from synchronous 88h AEL starved third instar larvae were dissected and fixed with 3.6% formaldehyde in PBS for

60 min at RT. Samples were washed 2 x 5min in PBS then were incubated for 20 min in

PBS + 0.1% Triton X-100. Following 3 x 5 min wash with PBS, nonspecific binding sites were blocked by incubation with 3% milk powder dissolved in PBS for 1h. Incubations with primary and secondary antibodies were performed overnight at 4°C and for 1h at

RT respectively in the blocking buffer diluted 1.1 with PBS. Primary antibodies were used at a dilution of 1:2000. Anti-rabbit-Alexa488 (Invitrogen) secondary antibody was used at a dilution of 1:1400.

Microscopy

Images were obtained on a fluorescent microscope (Carl Zeiss, Axioimager 2.1) equipped with a grid confocal unit (Carl Zeiss, Apotome) using Plan-NeoFluar 40× 0.75

NA air objective (Carl Zeiss), Axiocam Mrm camera (Carl Zeiss) and Axiovision software

(Carl Zeiss).

Climbing assay

Just after onset of pupariation the distance between the surface of food and the middle point of five puparium located furthest from the food were measured. The average was considered as the representative highest distance for that given culture. Ten vials of control and Htt loss-of-function lines were measured and the average values were presented in mm on the diagram. Both synchronous and non-synchronous Drosophila cultures were kept under similar conditions.

Chapter 1

Figures

Figure 1.1. Loss of HTT function in Drosophila larvae or conditional knockout of HTT in the mouse CNS inhibits autophagy. (A) Loss of Drosophila HTT function results in an inhibition of autophagy in starved larvae as shown by significant reduction in numbers of acidic vesicles monitored by LysoTracker Red in fat body cells. (Scale bars, 30 μm.) ( B) Drosophila p62/SQSTM1, Ref(2)P, significantly accumulates in the cytoplasm of fat body cells with HTT LOF in starved larvae. (Scale bars, 30 μm.) ( C) Just before pupariation, the locomotion of the HTT LOF larvae exhibit a statistically significant climbing deficit. ( D) Htt flox/−;nestin-cre-tg CNS conditional Htt knockout mice significantly accumulate p62/SQSTM1 in the striatal insoluble fraction with aging. n = 3 for each genotype.

Figure 1.2. p62, lipofuscin and ubiquitin accumulate in Htt knockout mouse brain. (A) Httflox/−;nestin-cre-tg CNS conditional Htt knockout mice (Htt−/−) significantly accumulate p62/SQSTM1 in the striatal insoluble fraction with aging, as shown by Western blot. (B) Lipofuscin and ubiquitin accumulate in Httflox/−;nestin-cre-tg CNS conditional Htt knockout mouse thalamus at 7 mo. Confocal images of the thalamus of Httflox/+;nestin-cre (Htt+/− controls) and Httflox/−;nestin-cre (Htt−/−) conditional knockout mice. Increased lipofuscin autofluorescence in the green and red channels (yellow) and ubiquitin puncta (red) are evident in the mutant thalamus. (Scale bar, 159.13 μm.) (C) Two-year old Httflox/−;nestin-cre-tg CNS conditional Htt knockout mice and heterozygous CAG140 HD knockin mice accumulate lipofuscin and neuropil protein aggregates that can contain ubiquitin or p62/SQSTM1 in the striatum. (Scale bar, 25 μm).

Figure 1.3. HTT copurifies with proteins required for regulation of autophagy. (A) HTT shares similarity with yeast proteins Atg23, Vac8, and Atg11; its C-terminal Atg11-like domain may interact with mammalian homologs of yeast Atg11-binding proteins. A flexible hinge within the N-terminal domain of HTT may be modulated by HTT phosphorylation by IKK, AKT, and CDK5, activating the C-terminal Atg11- like domain of HTT to function in selective autophagy. ( B) HTT constructs used in this study: Venus- HTT(2146–3144) (red) and Venus-HTT(1651–3144) (green). ( C) Components of the Atg1 kinase complex and receptor proteins p62, BNIP3, and BNIP3L/NIX coimmunoprecipitate with HTT(2416–3144). HEK293T cells were cotransfected with Venus-HTT(2416–3144) and plasmids expressing HA-ULK1, MYC-RB1CC1/FIP200, MYC-ATG13, MYC-p62, MYC-BNIP3, and MYC-BNIP3L/NIX. Cell lysates were subjected to immunoprecipitation with (+) and without (−) antibodies against HA and MYC. ( D) BECN-1 co-immunoprecipitation with full length HTT. HEK293T cells were cotransfected with pARIS-HTT (23Q or 100Q) and BECN1-GFP. Cell lysates were subjected to immunoprecipitation using antibodies against GFP. ( E) 25QP and 97QP N-terminal HTT exon 1 fragments do not coimmunoprecipitate with Venus- HTT(2416–3144), but 586 amino acid HTT fragments do copurify. HEK293T cells were cotransfected with Venus-HTT(2416–3144) and with exon1 and 586 HTT fragment constructs. Cell lysates were subjected to immunoprecipitation using antibodies against Venus.

Figure 1.4. Alignment of the N-terminal domain of HTTs with yeast Atg23s. The alignment was done using EMBL-EBI MUltiple Sequence Comparison by Log-Expectation (MUSCLE, www.ebi.ac.uk/Tools/msa/muscle) (1, 2) and Jalview Java Alignment Editor (3, 4). 1. Edgar RC (2004) MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5:113. 2. Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32(5):1792–1797. 3. Clamp M, Cuff J, Searle SM, Barton GJ (2004) The Jalview Java alignment editor. Bioinformatics 20(3):426–427. 4. Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ (2009) Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 25(9):1189–1191.

Figure 1.5. Alignment of the central domain of HTTs with yeast Vac8s. The alignment was done using EMBL-EBI MUltiple Sequence Comparison by Log-Expectation (MUSCLE, www.ebi.ac.uk/Tools/msa/muscle) (1, 2) and Jalview Java Alignment Editor (3, 4). 1. Edgar RC (2004) MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5:113. 2. Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32(5):1792–1797. 3. Clamp M, Cuff J, Searle SM, Barton GJ (2004) The Jalview Java alignment editor. Bioinformatics 20(3):426–427. 4. Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ (2009) Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 25(9):1189–1191.

Figure 1.6. Alignment of the C-terminal domain of HTTs with yeast Atg11s. The alignment was done using EMBL-EBI MUltiple Sequence Comparison by Log-Expectation (MUSCLE, www.ebi.ac.uk/Tools/msa/muscle) (1, 2) and Jalview Java Alignment Editor (3, 4). 1. Edgar RC (2004) MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5:113. 2. Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32(5):1792–1797. 3. Clamp M, Cuff J, Searle SM, Barton GJ (2004) The Jalview Java alignment editor. Bioinformatics 20(3):426–427. 4. Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ (2009) Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 25(9):1189–1191.

Figure 1.7. The C-terminal domain of HTT is toxic in primary cortical neurons. Venus-HTT(1651– 3144) and Venus-HTT(2416–3144) expression reduces survival of rat primary cortical neurons. Kaplan– Meier plots are shown for survival analysis performed on primary rat cortical neurons. The table shows the results of a Cox proportional hazards analysis performed to compare survival across groups expressing different Venus constructs. Initial expression level of each construct was included as a covariate to account for differences in expression level between Venus constructs. CI, Confidence interval; HR, hazard ratio; n, number of neurons.

Figure 1.8. HTT contains a conserved WXXL domain at W3037. (A) Published WXXL domains shown to interact with the Atg8 family of proteins. (B) WXXL domain conserved between HTT and Atg11 families, aligned with W3037 of human HTT. (C) xLIRs defined in human HTT using iLIR web resource(1). (D) Venus-HTT(1651-3144) fusion protein coimmunoprecipitates with mammalian Atg8s. HEK293T cells were cotransfected with Venus-HTT(1651–3144) and MYC-LC3B or MYCGABARAPL1. Cell lysates were subjected to immunoprecipitation (using anti-MYC). The resulting precipitates were examined by immunoblot analysis with the indicated antibodies. W3037A mutation does not reduce binding of the longer HTT C terminal fragment, Venus-HTT(1651–3144) to MYC-GABARAPL1 or MYC-LC3B. 1. Kalvari I, et al. (2014) iLIR: A web resource for prediction of Atg8-family interacting proteins. Autophagy 10(5):913–925.

Figure 1.9. xLIRs in human Huntingtin.

Figure 1.10. WXXLs in human Huntingtin.

Figure 1.11. xLIRs and WXXL domains in Saccharomyces cerevisiae Atg11. PSSM, position-specific scoring matrix.

Figure 1.12. The C-terminal domain of HTT interacts with GABARAPL1 and LC3B. Venus- HTT(2416–3144) coimmunoprecipitates with mammalian Atg8s. HEK293T cells were cotransfected with Venus-HTT(2416–3144) and MYC-LC3B or MYC-GABARAPL1. Cell lysates were subjected to immunoprecipitation (IP) using anti-MYC. The resulting precipitates were examined by immunoblot analysis with the indicated antibodies. W3037A mutation significantly reduces the coimmunoprecipitation of Venus-HTT(2416–3144) with MYC-GABARAPL1 but not with MYC-LC3B.

Figure 1.13. Theoretical model of HTT as a scaffold protein required for selective autophagy. Functioning as a mammalian Atg11, HTT interacts with receptor proteins (e.g., p62, BNIP3, BNIP3L/NIX) and with ATG8s (e.g., LC3B, GABARAPL1) to enable various forms of selective autophagy.

CHAPTER 2

SUMO-2 and PIAS1 modulate insoluble mutant huntingtin protein accumulation

SUMMARY OF CHAPTER 2

A key feature in HD is the accumulation of the mHTT protein, which may be regulated by posttranslational modifications. Of specific relevance to this dissertation,

SUMOylation appears to contribute to HD pathology. In 2004, our group showed that

HTT could be SUMO modified and that that SUMOylation decreased aggregation of soluble toxic mHTT, masks a signal for HTT to stay in the cytoplasm (nuclear retention signal), and promotes the dysregulation of gene transcription in the nucleus of the cell.

As the next step, our lab defined the primary sites of SUMO modification in the amino- terminal domain of HTT, showed modification downstream of this domain, and demonstrated that HTT is modified by the stress-inducible SUMO-2. Prior to my joining the lab, a systematic study of E3 SUMO ligases was performed and demonstrated that

PIAS1 is an E3 SUMO ligase for both HTT SUMO-1 and SUMO-2 modification and that reduction of dPIAS in a mutant HTT Drosophila model is protective. Further, the accumulation of SUMO-2-modified proteins in the insoluble fraction of HD postmortem striata implicated SUMO-2 modification in the age-related pathogenic accumulation of mutant HTT and other cellular proteins that occurs during HD progression (Figure 2.1).

My contribution to this published work helped reveal that SUMO-2 modification regulates accumulation of insoluble HTT in HeLa cells in a manner that mimics proteasome inhibition and can be modulated by overexpression and acute knockdown of PIAS1. This work for the first time suggested that targeting the SUMOylation network

involving HTT could result in a significant alteration of disease networks, particularly in the accumulation and proteostasis of mHTT.

Chapter from:

O’Rourke, JG, Gareau, JR, Ochaba, J , Song, W, Rasko, T, Reverter, D, Lee, J, Mas

Monteys, A, Pallos, J, Mee, L, Vashishtha, M, Apostol, BL, Nicholson, TP, Illes, K, Zhu,

Y-Z, Dasso, M, Bates, GP, Difiglia, M, Davidson, D, Wanker, EE, Marsh, JL, Lima, C,

Steffan, JS, Thompson, LM (2013). SUMO-2 and PIAS1 Modulate Insoluble Mutant

Huntingtin Protein Accumulation. Cell Reports 4, 1–14.

INTRODUCTION

Huntington’s disease (HD) is caused by the expansion of a CAG repeat within the HD gene and the corresponding polyglutamine track within the Huntingtin (HTT) protein

(Group, 1993a). Symptoms include movement abnormalities, psychiatric symptoms and cognitive deficits with accompanying degeneration of medium spiny neurons in striatum and loss of cortical volume (Ross and Tabrizi, 2011). Post-translational modifications modulate protein function and HTT is subject to multiple such functionally relevant modifications including SUMOylation, ubiquitination, acetylation, palmitoylation, and phosphorylation (for review, (Ehrnhoefer et al., 2011; Pennuto et al., 2009). We previously demonstrated that a fragment of mutant HTT is modified by SUMO-1 and genetic reduction of SUMO in Drosophila expressing mutant HTT exon 1 is protective

(Steffan et al., 2004). SUMO-1 modification of mutant HTT in cells was also associated with increased toxicity and decreased aggregation by the striatal enriched small guanine nucleotide-binding protein Rhes (Subramaniam et al., 2009). SUMO modification is also

implicated in Alzheimer’s disease (AD), Parkinson’s disease (PD), and Amyotrophic

Lateral Sclerosis (ALS), as well as other CAG repeat diseases (SBMA, DRPLA, SCA1, and SCA7) (for review, (La Spada and Taylor, 2010; Wilkinson et al., 2010)). Although this modification is linked to pathogenesis, the precise mechanisms involved have not yet been elucidated.

SUMO modification is the covalent attachment of SUMO (Small Ubiquitin-like

MOdifier) to specific lysine residues within a target protein and regulates key processes involved in normal cellular function, including subcellular localization, protein stability, transcriptional regulation and interaction properties of SUMO-modified proteins with their cellular targets (Cubenas-Potts and Matunis, 2013; Gareau and Lima, 2010).

While highly transient, the effects of this modification are long lasting (Johnson, 2004).

Four different forms, SUMO-1-4, exist in mammals. SUMO-2 and SUMO-3 are nearly identical (97% identity) and often referred to as one protein (SUMO-2/3) (Gareau and

Lima, 2010; Johnson, 2004) and SUMO-4 is found only in a precursor form (Bohren et al., 2004). The SUMOylation pathway involves a cascade of enzymes, similar to ubiquitination, with a single E1-activating enzyme (SAE1/UBA2), a single E2- conjugating enzyme (UBC9), multiple E3-ligating enzymes (PIAS, PC2, MMS21, and

RanBP2), which provide substrate specificity, and multiple proteases (SENPs) that both cleave the SUMO moiety from target proteins and process SUMO itself (Figure 1A).

Given that SUMOylation is implicated in HD and other neurodegenerative diseases, identification of the E3s responsible for HTT modification may provide insight into mechanisms underlying HD and provide novel therapeutic targets.

Here we systematically evaluated the enzymatic machinery involved in HTT SUMO modification and report for the first time that HTT is modified by SUMO-2 and that

PIAS1 functions as a HTT SUMO E3 ligase. This modification may serve more than one function since longer HTT polypeptides, both wild-type and mutant, are SUMO modified downstream of exon 1. SUMO-2 overexpression causes mutant HTT to accumulate in cells. In HD postmortem striatum, SUMO-2 modified proteins accumulate in the insoluble fraction, suggesting this modification is relevant in vivo to HD. Further validating the potential in vivo relevance for SUMO modification pathways in HD, genetic reduction of dPIAS in Drosophila expressing expanded repeat HTT is neuroprotective. Taken together, these results provide a rationale for targeting SUMO-

2 and PIAS1 as novel therapeutic targets for HD.

RESULTS

HTTex1p Lys 6 and Lys 9 are the primary sites of SUMO modification

We previously showed that truncated HTT (Httex1p) is SUMO-1 modified in cells and that Lys 6 (K6) and Lys 9 (K9) may represent primary sites for modification based on the absence of SUMO modification upon mutagenesis of target lysines (Steffan et al.,

2004). From these studies it was not clear which lysines are preferentially SUMO modified. Based on SUMO prediction software, the lysines in HTTex1p (Figure 2.2A) do not fall within a classic SUMO consensus sequence, but rather are low probability

SUMO sites or not predicted (Figure 2.6A). However, classic SUMO consensus sequences are neither necessary nor sufficient for determining SUMO modification of a protein. To directly determine which of the three N-terminal lysines (K6, K9, or K15) are

preferentially SUMO modified, HTTex1p and lysine mutants, mutated singly and in combination, were purified and analyzed using an in vitro SUMO modification system followed by mass spectrometry analysis. SUMO-1 (T05R) was used based on ease of detection of mono-SUMO modification and to minimize the confounding effect of aggregation, unexpanded HTTex1p (25Q) constructs were used. When K6 and K9 were mutated singly to arginine (K6R, K9R), SUMO modification is reduced compared to wild-type, but when K6 and K9 (K6,9R) are mutated together SUMO modification is greatly reduced, similar to the three lysine mutant (Figure 1B) suggesting that K6 and

K9 are the major target sites. Mass spectrometry analysis confirmed that K6 and K9 are indeed the primary sites of SUMO modification (Data not shown).

HTTex1p is subject to other post-translational modifications such as ubiquitination and phosphorylation (Ehrnhoefer et al., 2011; Zheng and Diamond, 2012). Since phosphorylation a) modulates SUMO modification of cellular proteins, b) mimicking phosphorylation of serines S13 and S16 in expanded repeat HTTex1p (97QP) regulates

SUMO-1 modification in cells (Thompson et al., 2009) and c) this modification is relevant in vivo (Gu et al., 2009), we evaluated SUMO modification of wild-type

HTTex1p (25Q) in the context of a HTT phosphomimic S13,16D in vitro . SUMO modification of the phosphomimetic HTT (25Q) SUMO modification was equal to or more rapid than for WT HTT control (Figure 2.2B); mass spectrometry analysis revealed that SUMO modification of the S13,16D phosphomimic is restricted to K6 (Data not shown). These results suggest that both in vitro and in cells, other post-translational modifications, including phosphorylation, may influence SUMO modification of HTT.

PIAS and SUMO modification proteins are highly expressed in mouse brain

Since SUMO E3 ligases provide specificity in targeting proteins where a modified lysine does not fall within a consensus site (Gareau and Lima, 2010), such as HTT, identifying the E3 ligase(s) that promote HTT SUMOylation may be key to identifying therapeutic targets that regulate this modification. Based on the fact that PIASy was identified as a

HTT-interacting protein in a yeast two-hybrid screen (Goehler et al., 2004), we evaluated whether PIAS proteins could function as HTT E3 ligases. In humans, the

PIAS family consists of 4 members, PIAS1, PIASx (xα and xβ), PIAS3 and PIASy.

Originally identified as Protein Inhibitors of Activated STAT (PIAS) (Shuai and Liu,

2005), the PIAS proteins are involved in regulation of transcription, immune responses, cytokine signaling, and E3 ligase activity (Liu and Shuai, 2008; Rytinki et al., 2009). As

E3 ligases, they enhance SUMOylation of a number of different proteins and multiple

PIAS proteins can sometimes act as E3 ligases for the same substrate (Schmidt and

Muller, 2002).

To first establish that SUMO modification enzymes are present in brain regions relevant to HD, expression of SUMO related proteins was quantified in mouse striatum and cortex using qRT-PCR. SUMO-1, SUMO-2, PIAS and SENP mRNAs are all expressed in wild-type cortex and striatum. Within each region, PIASx is most highly expressed, followed by PIAS1 , with PIAS3 and PIASy having similar expression profiles (Figure

2.3A). This suggests that any PIAS could potentially serve as a HTT E3 SUMO ligase based its expression in vivo . The SENP proteins are also expressed in brain with

SENP6 most highly expressed followed by SENP2 and SENP3 , and finally SENP1

(Figure 2.3A). SUMO-1 and SUMO-2 are expressed in mouse brain at relatively high

levels. These data demonstrate that the SUMO machinery is present in relevant brain regions.

To determine if these SUMO related genes show expanded repeat HTT-dependent alterations in expression patterns, each was quantified in wild-type and R6/2 mouse cortex and striatum at 4, 8 and 12 weeks. R6/2 mice express a truncated HTT fragment

( exon 1 with ~150Qs) and shows very rapid HD-like disease progression with onset by approximately 6 weeks, highly penetrant phenotypes at 8 weeks and end-stage disease by 12 weeks (Mangiarini et al., 1996a). At 4 weeks and 8 weeks, some dysregulation begins to occur (Figure 2.4A, B), and by 12 weeks there are statistically significant increases of SENP1 , SENP3 , and SUMO-1 in R6/2 cortex and of SENP1 , SENP6 ,

PIAS3 , SUMO-1 and SUMO-2 in R6/2 striatum (Figures 2.3B, C), suggesting that in vivo SUMO modifying pathways may be perturbed in HD. The increases in SUMO-1 and SUMO-2 specifically in striatum, the region of greatest vulnerability to neurodegeneration, were particularly noteworthy. A similar pattern of increased SUMO-

2 in R6/2 striatum but not cortex was also observed at the protein level (Figure 2.3D,E), suggesting a SUMO-2 selective response in striatum. RNA was also isolated from dissected brain regions of BACHD mice (Gray et al., 2008) that express full length human HTT as a BAC transgene with 97Qs and shows progressive disease over a longer time course. SUMO-1 and -2 expression were similarly increased in BACHD striatal samples at 14 months (Figure 2.4C), a time when disease phenotypes are evident, and SUMO-2 is increased in N171 mouse striatum at 12 weeks compared to 6 weeks (Jia et al., 2012). The progressive nature of these changes, with the most robust observed at late disease stages, is consistent with the concept of early changes in

protein homeostasis systems (Schipper-Krom et al., 2012) with later profound disruption of the SUMO network at the gene expression and protein level. Taken together, the most consistent changes in HD fragment and full length HTT mouse models is upregulation of SUMO, suggesting that this pathway may be dysregulated in vivo .

HTTex1p is modified by both SUMO-1 and SUMO-2

Modification by SUMO-2 is unique in its capacity to be induced by cellular stress (Saitoh and Hinchey, 2000). Based on our previous data that the stress-inducible kinase IKK can activate phosphorylation of HTT S13 and S16 and increase polySUMOylation of

97QP HTTex1p (Thompson et al., 2009), and given that oxidative stress and other cellular stressors are implicated in HD (Browne and Beal, 2006), we investigated whether SUMO-2 can modify HTT. A cell-based SUMOylation assay was optimized to visualize and quantify SUMO modification (Figure 2.5A), which for endogenous proteins is a highly dynamic process and only low levels of modification are typically observed for an individual protein at any given time (Johnson, 2004). Expanded repeat HTTex1p

(46QP) with a C-terminal epitope tag (46QP-H4) was co-transfected with SUMO-1

(GFP-SUMO-1) or SUMO-2 (GFP-SUMO-2) and then purified under denaturing conditions using magnetic nickel beads (Ni-NTA). SUMO-1 and SUMO-2 can both modify HTTex1p and when the lysines (K6, K9, and K15) are mutated to arginine (3R),

SUMO modification cannot be detected (Figure 2.6A). An unusual laddering below control HTT in the presence of SUMO-2, but not in the presence of lysine mutants, is observed for this construct, however, the laddering is not detected by anti-GFP and its significance is not clear.

PIAS1 is a candidate SUMO E3 ligase for HTT

Each of the PIAS proteins were evaluated for their ability to enhance SUMO modification of HTT and the ratio of SUMO modified HTT versus purified HTT was quantified using a Western blot imaging system (Odyssey Imager, LI-COR). Since the

PIAS proteins are regulators of transcription, like SUMO, and can act as co-activators and co-repressors in addition to their E3 ligase activity (Rytinki et al., 2009), 1/10 myc- actin under a CMV-based promoter was co-transfected to account for transcriptional effects ((Thompson et al., 2009) and Figure 2.5A). To control for differences in protein loading due to denaturing conditions precluding protein assays, each membrane was stained with a reversible protein stain (MEMCode). Finally, to control for differential

HTT expression, 10% of each sample was trichloracetic acid (TCA) precipitated and subjected to Western analysis. To demonstrate that the modified form of HTT does indeed represent SUMO modified HTT, SUMO-1 was co-expressed in its mature, processed form (SUMO-1-GG) together with each of the SUMO isopeptidases SENP

(SENP1, SENP2, SENP3, SENP5, and SENP6) to show elimination by isopeptidases.

SENP1, SENP2, and SENP6 each catalyzed removal of SUMO-1 from HTT while

SENP3 and SENP5 had no effect (Figure 2.6B), providing validation that the shift in protein mobility represents SUMO modified HTT and suggesting selectivity of isopeptidase action.

To evaluate each PIAS protein for the ability to enhance HTT SUMO modification,

46QP-H4 was co-expressed with SUMO-1 (GFP-SUMO-1) and each of the PIAS proteins (PIAS1, PIASxα, PIASxβ, PIAS3, and PIASy). HTT is readily modified by

SUMO-1 (Steffan et al., 2004) and (Figure 2.6A) at saturating levels of SUMO-1. In order to detect enhancement of SUMO-1 modification, a titration was performed to

determine the SUMO-1 concentration at which modification of HTT was barely detectable (Figure 2.6C) and the addition of a relevant E3 ligase could increase HTT

SUMO modification (Stankovic-Valentin et al., 2007). PIAS1 repeatedly enhanced

SUMO-1 modification of HTTex1p (Figure 2.7A, representative figure), as did Rhes as previously reported (Figure 2.6B).

We next investigated whether SUMO-2 modification of HTT is also sensitive to the addition of an E3 ligase. Because this modification is more difficult to visualize under basal conditions, limiting SUMO-2 levels was not necessary. SUMO-2 was cotransfected with individual PIAS cDNAs and PIAS1 was also most effective at enhancing SUMO-2 modification of HTT (Figure 2.7B, representative figure). In this assay, Rhes did not enhance the formation of a SUMO2-HTT species (Supplemental

Figure 3C).

Consistent with its role as an E3 SUMO ligase and the underlying rationale that direct interactions between E3 ligases and targets can promote SUMO modification, PIAS1 was evaluated for its ability to bind to HTT fragments in vitro . Using GST pull-down assays with HTT exon 1 encoding polypeptides, both normal range (20QP) and expanded repeat HTTex1p(51QP) interact strongly with PIAS1 (7.75% and 7% respectively) (Figure 2.7C). As controls, protein lacking the protein-interacting proline rich domain of Htt (20Q and 51Q) or expressing the proline rich region alone showed greatly reduced interactions. These results suggest that a direct interaction between

PIAS1 and HTTex1p may facilitate SUMO modification.

Longer HTT fragments are SUMOylated

A potentially critical and initiating cleavage event occurs at a caspase-6 cleavage site of

HTT (Graham et al., 2006), creating a polypeptide of 586 amino acids (HTT 586 aa).

Using bioinformatics tools (SUMOplot, Abgent), 5 additional lysines downstream of

HTTex1p are predicted to be SUMO modification sites of high (2 lysines) or lower (3 lysines) probability (Figure 2.8A). Of interest, further analysis of the 586 aa fragment

(Tatham et al., 2008) reveals up to 13 potential overlapping SUMO-interacting motifs

(SIMs) within this region depending upon consensus sequence designation (Figure

2.8A). SIMs are non-covalent SUMO interacting motifs that may enhance SUMOylation of the SIM-containing proteins themselves (Blomster et al., 2010). Therefore, the SUMO and SIM motifs in HTT may work together to regulate HTT SUMOylation.

To determine if longer HTT fragments are SUMOylated independently of the lysines within the first 17 amino acids, HTT 586 aa containing either an unexpanded (25Q-

586aa) or expanded polyQ repeat (137Q-586aa) was co-expressed with SUMO-1

(Figure 2.8B), as this modification should be detected under basal conditions. As a control, HTT 586 aa constructs with K6,9,15R mutations that diminish SUMO modification within the 1 st 17 aas were tested. Immunoprecipitated HTTex1p (46QP-

H4) is monoSUMOylated by SUMO-1 (Figure 2.8B), but the 3R mutant form is not modified as expected. However, other lysines downstream of this amino terminal domain can also be SUMOylated as SUMO-1 modification is observed even in the presence of the K6,9,15R mutation in either its expanded or unexpanded forms.

PIAS1 increases SUMO-2 modification of HTT 586aa

SUMO-2 modification of HTT 586 aa is not detected in the absence of external stimuli

(Figure 2.8E), therefore longer HTT fragments were evaluated for SUMO-2 modification

in the presence of an E3-SUMO ligase. Potential interactions between longer HTT fragments and E3 SUMO ligases were first investigated using a large scale yeast two hybrid screen. Here the 586 aa fragment of HTT was used as bait and PIAS1 emerged as the single E3 SUMO ligase interaction partner (Figure 2.8C), supporting its relevance even for longer HTT polypeptides. Previously identified interactors were also tested in this system and confirmed, including HIP2 and GIT2 (Goehler et al., 2004). To further validate this interaction in vitro , co-immunoprecipitation of HTT from cell lysates transfected with HTT (25Q-586) and PIAS1 with or without co-transfected SUMO-1 was tested. PIAS1 binds both transfected HTT (586aa) and full length endogenous HTT based on PIAS1 detection even in the absence of exogenous HTT 586 overexpression

(Figure 2.8D). SUMO-2 modification of longer HTT polypeptides was therefore tested in the presence of PIAS1. Based on in vitro results (Figure 2.2B) and because SUMO-2 is stress inducible similar to the signal transduction cascades that modulate HTT phosphorylation, S13, 16D phosphomimic polypeptides were also tested. Expanded repeat HTT 586 aa fragments are SUMO-2 modified in the presence of PIAS1 and that this modification is enhanced by mimicking phosphorylation (S13, 16D-586aa) for both expanded and unexpanded HTT 586 aa (Figure 2.8E,F).

SUMO-2 promotes accumulation of insoluble mutant HTT

Emerging data suggests that SUMOylation may influence aggregation and accumulation of aggregation-prone neurodegenerative disease proteins (Kim et al.,

2011; Tatham et al., 2011). To address the functional consequences of SUMO modification of mutant HTT on disease, the involvement of SUMO-1 and SUMO-2 modification on the formation of insoluble HTT species was evaluated in HeLa cells,

where SUMO modification systems are highly active. Our previous studies evaluated visible inclusion formation and levels of soluble mutant HTT and showed that fusion of

SUMO to the HTTex1p N-terminus promoted stabilization of HTTex1p (Steffan et al.,

2004). However, we and others have since identified the HTTex1p N-terminus as an important mediator of aggregation, localization and protein stability (Atwal and Truant,

2008; Rockabrand et al., 2007; Sivanandam et al., 2011; Thompson et al., 2009; Zheng et al., 2013), which may have been masked by the presence of the SUMO moiety.

SUMO-1 also decreased mutant HTT aggregation in the presence of Rhes and increased toxicity in cells (Subramaniam et al., 2009). In each case, only SUMO-1 was evaluated.

For HD, the process of aggregation and specific aggregation intermediates are likely to be critical to pathogenesis. Using a centrifugation protocol published for α-synuclein

(Kim et al., 2011), lysates were separated into detergent-soluble and detergent- insoluble fractions. The detergent-soluble fraction contains monomeric HTT, which includes overexpressed mutant HTTex1p (97Q) and endogenous full length HTT

(indicated by arrows, Figure 2.9A, soluble fraction). In contrast, the detergent-insoluble fraction contains only high molecular weight (HMW) HTT in the samples containing

97Q-HTTex1p (Figure 2.9A, insoluble fraction), which are likely multimers or potentially oligomers of soluble HTT.

MG132 is a proteasomal inhibitor that causes the accumulation of mutant HTT in cells

(Lee and Goldberg, 1998). To investigate the relationship between proteasomal degradation and SUMO modification and to analyze levels of soluble and insoluble HTT species in the presence of SUMO-1 and SUMO-2, HeLa cells were transiently

transfected with 97Q-HTTex1p and treated with MG132 (5µM). Treatment with MG132 causes a robust increase in high molecular weight (HMW) mutant HTT in the insoluble fraction (Figure 2.9A), with accumulation of ubiquitin-modified cellular proteins (data not shown). In contrast, soluble, monomeric HTT levels are maintained or slightly decreased (Figure 2.9A), supporting the concept that impairment of proteasomal function increases levels of aggregating HTT. Immunoprecipation was performed to increase HTT detection. Addition of SUMO-1 had little to no additional effect on soluble

HTT or insoluble HMW HTT levels (Figure 2.9B and 2.9C). However, the addition of

SUMO-2 caused an increase in insoluble HTT (Figure 2.9B and 2.9C) that was comparable to proteasome inhibition. This effect is not augmented by combined SUMO-

2 expression and proteasome inhibition, suggesting that SUMO-2 modulates accumulation and aggregation of mutant HTT in a manner that mimics proteasome inhibition. This regulation of insoluble HTT levels by SUMO-2 is dose-dependent. When cells were treated with increasing amounts of SUMO-2, verified by increasing levels of mono-SUMO-2 by western analysis (Figure 2.9D, boxed in panel 1), increasing levels of high molecular weight (HMW) HTT were observed, while monomeric levels showed a corresponding decrease in the insoluble fraction, potentially reflecting insoluble monomeric HTT levels.

Since SUMO-2 modulates HMW HTT species and SUMO-2 modification of HTT appears to require the presence of a SUMO E3 ligase, we tested whether PIAS1 alone can modulate mutant HTT accumulation. When PIAS1 was overexpressed in the presence of expanded repeat HTT with 97Qs, the detergent-insoluble HTT HMW

“oligomeric” species increased while soluble HTT appeared to be unaffected (Figure

2.10A), whereas a reduction of the HMW oligomeric HTT species is observed following

PIAS1 acute knockdown (Figure 2.10B). Taken together, these data demonstrate that

PIAS1 can regulate the accumulation of insoluble HMW HTT polypeptide species, suggesting that modulation of PIAS1 may influence pathogenesis in HD.

Genetic reduction of (Su-var) 2-10 (dPIAS) is neuroprotective in mutant HTTex1p- expressing Drosophila

To validate the potential involvement of PIAS proteins in HD pathogenesis in vivo , the single Drosophila PIAS protein, Su(-var)2-10 ( dPIAS ) (Hari et al., 2001), was evaluated for its effect on HD-like phenotypes in a fly model (Steffan et al., 2001). When expressed in all neurons from embryogenesis on, expanded repeat HTTex1p (93Q) causes a progressive loss of visible rhabdomeres (photoreceptor neurons in the eye)

(Marsh and Thompson, 2006) and a decrease in the number of flies that eclose from the pupal case as adult flies (Figure 2.10C). When expressed in a background of heterozygous genetic reduction of dPIAS , the number of visible photoreceptor neurons and survival (eclosion) are both increased (Figure 2.10C). The observed neuroprotection is not simply a consequence of decreased transgene expression based on analysis of HTT RNA by qPCR (data not shown). These results are consistent with our previous observations showing that reduction of Drosophila SUMO ( smt3 ) was protective in this same model (Steffan et al., 2004).

Insoluble SUMO-2 modified proteins are increased in human HD brain

To investigate whether SUMO-modified proteins accumulate in HD patient brain tissue compared to control subjects and whether SUMO-1 or SUMO-2 have selective effects, post-mortem striata from 3 control and 3 HD brains were evaluated. Each of the HD

subjects displayed a remarkable accumulation of SUMO-2 modified protein compared to controls in insoluble fractions (Figure 2.10D). To a lesser extent, accumulation of

SUMO-1 is also observed. Differences in levels of SUMO-2 modified protein do not correlate with ubiquitin reactivity in control and HD brain fractions, but rather appear to be specific for SUMO. While we cannot conclude from these data that the increased

SUMO-2 reactivity represents an increase in mutant HTT SUMO-2 modification per s e, a HTT antibody raised against amino acids 115-129 shows a similar pattern of increased HMW HTT species in HD samples compared to controls (Figure 2.10D), suggesting that HTT is included in the proteins that accumulate in HD striata. Taken together, these results support SUMO-2 relevance in HD pathology and that SUMO modifying enzymes may be valid therapeutic targets.

DISCUSSION

SUMO modification contributes to an impressive array of regulatory mechanisms that have critical biological functions (Bruderer et al., 2011). In turn, dysregulation of this cellular process is implicated in diseases ranging from cancer to neurological disease

(Gareau and Lima, 2010). While SUMO modification is transient, downstream consequences are long lasting and impact processes such as protein folding, subcellular localization, stability, transcriptional regulation and protein activity (Geiss-

Friedlander and Melchior, 2007), all of which are affected in HD (Zheng and Diamond,

2012). Implicating a role in neurodegenerative diseases, a growing number of causative neurodegenerative disease proteins either co-localize with SUMO molecules or are target proteins for SUMO modification (for review (Krumova and Weishaupt,

2012; Wilkinson et al., 2010)). To date, the primary mechanisms involve altered solubility of or visible inclusion formation by these disease proteins, with ensuing protective (SBMA), deleterious (SCA7), or mixed effects (α-synuclein) (Kim et al., 2011;

Oh et al., 2011), depending on the protein context and form of SUMO tested. Enzymes involved in these processes, such as Rhes, are beginning to emerge (Subramaniam et al., 2009).

Here we demonstrate that SUMO-2 modification of HTT, a stress-responsive modification pathway not previously investigated for HTT, regulates the accumulation of insoluble mutant HTT. This SUMO form is consistently upregulated in striata from several HD mouse models, at a stage of disease anticipated to display significant dysregulation of protein homeostasis network components. Further, PIAS1, which selectively enhances HTT SUMO-1 and -2 modification and is expressed in brain, is integral to this accumulation. The functional relevance of these findings is further validated by 1) the neuroprotection observed upon reduction of the single Drosophila

PIAS ( dPIAS), which is most similar to PIAS1 (Hari et al., 2001), in flies expressing a mutant fragment of HTT, and 2) the profound accumulation of SUMO-2 modified HMW protein in human HD brain. The finding that the stress-responsive SUMO-2 is likely most relevant to HD pathogenesis over basal SUMO-1 modification by regulating the accumulation of high MW and likely poly-SUMOylated protein, is consistent with the prevailing literature that chronic expression of mutant HTT causes cellular stress, including oxidative stress (Turner and Schapira, 2010). This cellular stress, which is likely progressive and could therefore promote stress responses, including SUMO-2 modification, could then contribute to disease. Validation of SUMO-2 involvement in

response to neuronal stressors has recently emerged in several systems, including APP overexpression in AD mice (McMillan et al., 2011), transient cerebral ischemia in brains of ground squirrels (Lee et al., 2012) and transient ischemia in cells (Yang et al., 2012), in some cases promoting a neuroprotective response to ischemic stress (Datwyler et al.,

2011).

We previously reported that mimicking phosphorylation of S13 and S16 reduces monoSUMOylation and increases polySUMOylation of mHTTex1p with a highly expanded 97Q repeat (Thompson et al., 2009). Here we confirm that K6 and K9 within the first 17 amino acid domain are indeed SUMO-1 modification sites even though these lysines do not lie within classic SUMO consensus sequences. Intriguingly, SUMO-1 is conjugated to K6 and K9 equivalently in the absence of other modifications, whereas phosphomimetic substitutions of S13 and S16 appear to block SUMO modification on

K9 or promote SUMO-1 modification on K6, which may be significant to regulation of other HTT modifications, such as K9 acetylation. In cells, mimicking phosphorylation at these sites enhances SUMO-2 modification in the presence of a relevant E3 SUMO ligase. Given that phosphorylation of HTT is responsive to inflammatory cues

(Thompson et al., 2009), that PIAS1 is involved in immune function, and that inflammation is increased in HD (Bjorkqvist et al., 2009; Khoshnan et al., 2004), it is likely that SUMO-2 modification is also responsive to inflammatory cues which appear early in HD.

A key feature in HD is the accumulation of mutant HTT fragments containing the polyQ expansion (Landles et al., 2010). Wild-type and mutant HTT can be cleaved by caspases, calpains, and aspartyl proteases to form N-terminal fragments (Warby et al.,

2008), which become toxic when in the context of the expanded polyglutamine repeat.

Studies in mice expressing a caspase 6 resistant form of mutant HTT suggest that HTT proteolysis specifically at 586 may be critical to HD pathogenesis (Graham et al., 2006;

(Warby et al., 2009) and overexpression of transgenic expanded repeat HTT 586 supports potential toxicity of this fragment (Waldron-Roby et al., 2012). Analysis of longer polyQ polypeptides revealed that unexpanded and expanded HTT 586 fragments are SUMOylated downstream of HTTex1p. The caspase 6 cleavage fragment of HTT

(586aa) has 5 predicted SUMOylation sites C-terminal to exon 1, with potentially greater than 13 overlapping SIMs within this region, depending on SIM motif evaluated. SIMs are non-covalent SUMO interacting motifs that have recently emerged as having critical regulatory properties (Gareau and Lima, 2010). For example, the ubiquitin ligase RNF4 has multiple SIMs that recognize polySUMO-2 chains and ubiquitinate them for degradation by the proteasome (Geoffroy and Hay, 2009; Tatham et al., 2008). Indeed these SIMs may be important signal transduction inducers downstream of polySUMOylation events (Sun and Hunter, 2012). SIMs within target proteins can also enhance their SUMO modification and are found within several E3-SUMO ligases, including PIAS1 (Gareau and Lima, 2010). The implications of these multiple SIMs in

HTT is not yet clear, however, we are actively pursuing this area of investigation.

The interplay between SUMO2 and proteasome inhibition is consistent with recent proteomic analysis of extracts from HeLa cells treated with MG132 to identify SUMO-2 modified proteins (Tatham et al., 2011). In these studies, all SUMO paralogs accumulated upon treatment with MG132, however the greatest response exhibited was by SUMO-2, suggesting that SUMO modification of cellular proteins is not only involved

in regulating proteostasis of unfolded and misfolded proteins within a cell, but may in fact represent a response to the presence of misfolded or oligomerized proteins, such as mutant HTT, and be involved in protein clearance mechanisms. This hypothesis is supported by studies showing that the presence of mutant HTT polypeptide alone in C. elegans can cause the misfolding and inactivation of temperature sensitive mutant proteins to a similar degree as heat shock (Gidalevitz et al., 2006). These findings suggested that mutant HTT protein expression is sufficient to impact the protein homeostatic network, and relevant to the work described here, accumulation of SUMO-

2-modified cellular proteins. Further, when the production of misfolded proteins exceeds the capacity of the chaperone and UPS systems, mimicked here by proteasome/cathepsin inhibition by MG132, then these proteins may be targeted for degradation by autophagy, which also becomes impaired late in disease. As protein clearance mechanisms become impaired upon aging, modified proteins normally targeted for degradation by post-translational modification, such as phosphorylation and acetylation, may accumulate and take on toxic functions. Supporting this concept, proteasome inhibition promoted formation of aggregates containing SUMO-modified α- synuclein (Kim et al., 2011).

In summary, the work presented here supports a general mechanism in HD whereby the chronic expression of expanded repeat HTT promotes general protein misfolding and initiation of stress response pathways that promote SUMO-2 modification of HTT, progressively resulting in accumulation of insoluble and high MW species that may be a reflection of ongoing pathogenesis. In addition, loss of normal HTT functions may also contribute to the accumulation of SUMOylated proteins (Steffan, 2010). Initially, SUMO-

2 modification and polySUMOylation is likely to facilitate normal cellular clearance mechanisms with integration between SUMOylation and ubiquitination and serve in a neuroprotective capacity, however these are likely to become toxic as pathways become impaired and these species accumulate and cause further disruption of overall cellular protein homeostasis, reflected here by increased expression and level of

SUMO-2 and other SUMO modification cellular components. This is demonstrated by the accumulation of SUMO-2 protein in a high MW insoluble fraction from human HD striatum, the region most profoundly affected in HD. We further identify a HTT E3-

SUMO ligase, PIAS1, which is expressed in relevant brain regions and appears to have a pivotal role in the regulation of SUMO-2 modified HTT, providing a novel and selective therapeutic target.

EXPERIMENTAL PROCEDURES siRNA siRNA against PIAS1 and a non-targeting control were purchased from Dharmacon

(Thermo Scientific) and include PIAS1-ON-TARGETplus SMARTpool (L-008167-00-

0005), Human PIAS1, NM_016166 and ON-TARGETplus Non-targeting siRNA #1 D-

001810-01-20.

Primary Antibodies

Anti-HTT (Enzo) antibody was generated in collaboration with England Enzo Life

Sciences UK (Palatine House, Matford Court, Exeter EX2 8NL, United Kingdom). The following antibodies were also used: anti-HTT (MAB5490), anti-HA.11 Clone 16B12 monoclonal (Covance); anti-Myc 9E10 (Millipore); anti-EGFP detected by Living

Colors® Full-length Monoclonal Antibody (Clontech, Living Colors® A.v. Monoclonal

Antibody (JL-8), anti-mPIAS1 (Invitrogen), anti-SUMO-1 (Enzo Life Sciences), anti-

SUMO-2 (MBL International), and anti-ubiquitin (Santa Cruz Biotechnology).

GST Pull-Down Assays

Performed as previously described (Steffan et al., 2000).

In vitro SUMO modification

The expression and purification of human E1 (SAE1/UBA2ΔCT), E2 (UBC9), IR1*

(RanBP2, aa 2631-2695) and mature SUMO-1 have been previously described

(Bernier-Villamor et al., 2002; Lois and Lima, 2005; Olsen et al., 2010; Reverter and

Lima, 2005).

Mass spectrometry

SUMO-1 T95R was generated by PCR mutagenesis (Quikchange; Stratagene) to introduce a trypsin cleavage site near the SUMO C-terminus and purified as described for SUMO-1. Reactions containing 200 μM SUMO-1 T95R, 200 μM HTT (WT or

S13,16D), 200 nM E1, 200 nM E2 and 2 μM IR1* in reaction buffer (20 mM HEPES, pH

7.5, 50 mM NaCl, 5 mM MgCl¬2, 1 mM DTT, 1 mM ATP and 0.01% Tween-20) were incubated at 37°C and aliquots were removed at 0 and 60 minutes. Samples were enriched by incubation with Ni-NTA beads (QIAGEN) and eluted with loading buffer containing 100 mM EDTA. Samples were resolved by SDS-PAGE and stained with

Coomassie blue. Bands corresponding to HTT and SUMO-modified HTT were submitted for analysis by mass spectrometry.

Cell Culture

HeLa cells were plated on 10 cm plates and cultured in DMEM plus 10% FBS. For cDNA only, cells were plated on Day 1 and transiently transfected with 6 µg of total DNA and 8 µl Lipofectamine 2000 (Invitrogen) on Day 2, media was changed on Day 3, and cells were collected on Day 4. For siRNA only, transient transfections were carried out as described above, except that 720 pmol siRNA and 36 µl of RNAi Max were used.

For combined siRNA and cDNA experiments, cells were transfected with siRNA, media replaced Day 2 and cDNA transfected 12 hours after siRNA. Day 3 and 4 are as described above. Cells were transfected at ~70% confluency for DNA and ~30-50% confluency for siRNA.

Western blot analysis

8% bis-acrylamide gels and Invitrogen 4-12% bis-tris mini gels were used for SDS-

PAGE and proteins were transferred to nitrocellulose membrane and nonspecific proteins were blocked with SuperBlock blocking buffer (Thermo Scientific). Two types of detection were used: Chemiluminescence/film or Odyssey Imager/LI-COR

(Supplemental Methods). Experiments were performed in triplicate with representative images shown.

Nickel purifications

His-tagged HTT proteins were purified using magnetic Ni-NTA nickel beads

(QIAGEN). For in vitro SUMOylation assays, ST14.A cells were transfected with the

25QP-HBH constructs into ~25 10 cm plates per construct and purified under native conditions using the recommended buffers from QIAGEN (lysis buffer- 50 mM

NaH 2PO 4, 300 mM NaCl, 10 mMimidazole, 0.05% Tween 20, pH8; Wash buffer- 50 mM

NaH 2PO 4, 300 mM NaCl, 20 mM imidazole, 0.05% Tween 20, pH8). For denaturing

SUMO cell culture assay, HeLa cells were transfected and purified under denaturing conditions recommended buffer from QIAGEN (lysis buffer- 6M Guanidine HCl, 0.1M

NaH 2PO 4, 10mM Tris-Cl, pH 8, Wash Buffer #1- 8M urea, 100mM NaH 2PO 4, 10mM

Tris-Cl, pH 8, and Wash buffer #2- 8M urea, 100mM NaH 2PO 4, 10mM Tris-Cl, pH 6.3).

Ten percent of each lysate was subjected to TCA precipitation. For the nickel purification, 50 μl of magnetic bead slurry was added to each sample and incubated at room temperature for 3 hours. Beads were collected on the magnetic rack, washed two times with Wash buffer #1 (8M urea, pH 8), one time with Wash buffer #2 (8M urea, pH

6.3), and one final time with 1X PBS. Washed beads were submerged in 2x Laemmli sample buffer, boiled for 10 min, analyzed using Western analysis. Each experiment was performed in triplicate and a representative figure is represented.

Immunoprecipitations

HeLa cells were lysed in buffer containing 50 mM Tris-HCl, pH 8, 150 mM NaCl, 1%

NP40 alternative, a mini protease inhibitor pellet (Roche), 2 mM DTT, and 25 mM N-

Ethylmaleiamide (NEM) (Ulrich, 2009). HTT protein was either precipitated using protein

G plus from Santa Cruz or hydrazide-link beads from Bioclone

Soluble/Insoluble fractionation

HeLa cells were collected in lysis buffer containing10mM Tris (pH 7.4), 1% Triton X-100,

150 mM NaCl, 10% Glycerol, and 0.2 mM PMSF, Roche complete protease mini and phosphoSTOP pellets. Cells collected were lysed on ice for 60 min before centrifugation at 15,000xg for 20’ at 4°C. Supernatant was collected as the detergent- soluble fraction. The pellet was washed 3x with lysis buffer and centrifuged at 15,000xg for 5’ each at 4°C. The pellet was resuspended in lysis buffer supplemented with 4%

SDS, sonicated 3x, and boiled for 30 min. and collected as the detergent-insoluble fraction. Protein concentration was quantitated using Lowry Protein Assay (Bio-Rad)

Soluble/insoluble fractionation protocol was previously described (Kim et al., 2011).

Filter retardation assay

30ug of detergent-soluble and detergent-insoluble protein in 200 μl of 2% SDS was boiled for 5’ and vacuumed through a dot blot apparatus onto a cellulose acetate membrane. Membrane was then washed 3x with 0.1% SDS and then blocked in 5% milk and subject to western blot analysis (previously described (Sontag et al., 2012a;

Wanker et al., 1999)).

RNA isolation and Real-time quantitative PCR (RT-PCR)

Cortex and striatum were dissected from 4, 8, and 12 week old female wild-type and

R6/2 mice. At King’s College London, hemizygous R6/2 mice were bred by backcrossing R6/2 males to (CBA x C57BL/6) F1 females (B6CBAF1/OlaHsd, Harlan

Olac, Bicester, UK) and maintained as previously described (Labbadia et al., 2011). The

CAG repeat was 204.7 ± 5.8. Brain tissues were homogenized in Trizol (Invitrogen) and total RNA was isolated using RNEasy Mini kit (QIAGEN). DNase treatment was incorporated into RNEasy procedure in order to remove residual DNA. Reverse transcription was performed using oligo (dT) primers and 1 µg of total RNA using

Superscript III First Strand Synthesis system (Invitrogen). Quantitative PCR (qPCR) was performed (Supplemental information).

Automated Y2H Screening

GATEWAY technology (Invitrogen) was used to subcloning of 25Q-586aa and 73Q-

586aa cDNAs encoding human HTT fragments into Y2H expression plasmids.

“Gateway compatible” cDNAs encoding selected proteins were generated by PCR amplification. Amplified DNA products were isolated from agarose gels and combined with the pDONR221 plasmid (Invitrogen), creating the desired entry DNA plasmids. The identity of all PCR products was verified by DNA sequencing. Subsequently utilizing LR recombination, pBTM116_D9 plasmids (for the production of LexA DNA binding domain fusions) were generated encoding HTT bait proteins for automated Y2H interaction mating. The identity of the plasmids was verified by BsrGI restriction digestion. Bait plasmids were transformed into the L40ccua MATa yeast strain and yeast clones individually mated against a matrix of MATα yeast clones encoding 16,888 prey proteins

(with Gal4 activation domain fusions) using pipetting and spotting robots. The automated Y2H screenings were repeated 3 times. Interaction mating experiments and imaging were performed as described previously (Stelzl et al., 2005).

Drosophila crosses

Flies were reared on standard cornmeal molasses medium at 25°C. To compare phenotypes of HTT expressing animals in a normal vs. a Su(var)2-10 (dPIAS) reduced background, w/w; +/+; UAS>HTTex1p-Q93/UAS>HTTex1p-Q93 females were crossed to elav-GAL4/Y; Su(var)2-10[zimp-2]/Sp males. Eclosion data from ≥1500 segregants was calculated as percent of elav -GAL4 /+; Su(var)2-10 /+ HTT /+ or elav -GAL4 /+; +/ Sp ;

HTT /+ flies vs . HTT non-expressing male siblings. Pseudopupil analysis was carried out on 7 day old flies as described (Steffan et al., 2001).

Human postmortem brain

Human autopsy brain tissue, from the striatum of control and HD patients, was flash frozen with postmortem intervals ranging from 13 to 22 h and were obtained from

individuals with ages at autopsy from 72 to 93 years of age and Grades 3-4. Frozen human brain tissue was homogenized on ice using T-PER Tissue Protein Extraction

Reagent (Thermo) containing a complete mini pellet (Roche), phosphotase inhibitor #1

(Sigma), phosphotase inhibitor #2 (Sigma), and 25 mM NEM. Lysates were ultracentrifuged at 45,000 rpm at 4°C for 60 min, and the pellet was homogenized on ice in 70% formic acid, ultracentrifuged at 45,000 rpm at 4°C for 60 min, and the supernatant collected as the “insoluble fraction”.

Plasmids

HTTex1p cDNA containing 25, 46, and 97 CAG/CAA repeats in pcDNA3.1 (Invitrogen) were used as previously described (Aiken et al., 2009; Steffan et al., 2004). The unexpanded 25Q construct contains a C-terminal HBH tag (Aiken et al., 2009) and was a generous gift from Peter Kaiser and Christian Tagwerker. The expanded HTTex1p with 46Q has a C-terminal His tag H4 (His-HA-HA-His) (Thompson et al., 2009) and

HTTex1p with 97Q is untagged (Steffan et al., 2004). HTT constructs containing 586aa unexpanded (25Q-586aa) and expanded (137-586aa) are described (Apostol et al.,

2003). Mutations in HTTex1p were created using double-stranded oligonucleotides as previously described (Thompson et al., 2009) for the following plasmids: 25QP-HBH,

25QP-K6R-HBH, 25QP-K9R-HBH, 25QP-K6,9R-HBH, 25QP-K6,9,15R-HBH, 25QP-

S13,16D-HBH, and 46QP-K6,9,15R-H4 (3R). Site directed mutagenesis was used to make the Lys to Arg (25Q-3R-586aa and 137Q-3R-586aa) and the Ser to Asp (25Q-

S13,16E-586aa and 137Q-S13,16D-586aa) mutants for the unexpanded and expanded

586aa constructs. Human PIAS constructs (PIAS1, PIASxα, PIASxβ, and PIASy) constructs were kind gifts from Ke Shuai (UCLA). PIAS3 cDNA was purchased from

(Invitrogen). The myc-actin plasmid was a kind gift from H. Rommelaere at Ghent

University, Ghent, Belgium. All human PIAS proteins were PCR amplified using double- stranded oligonucleotides and subcloned into the pGWIZ vector with no tag. The following plasmids were provided from the following laboratories: pCS2-EGFP-SUMO-1 and pCS2-EGFP-SUMO-2 (PR Potts and H Yu, The University of Texas Southwestern

Medical Center, Dallas, TX); pMyc-Actin (H. Rommelaere, Ghent University, Ghent,

Belgium), GFP-SENP1, GFP-SENP2, GFP-SENP3, GFP-SENP5, GFP-SUSP1

(SENP6) and GFP-SENP7 (M. Dasso, NIH), and His-SUMO-1 and SUMO-2 (gift from

Ron Hay, University of Dundee, Dundee, UK). *Note: here we refer to SUMO-2 as accession number NM_006937.3.

Protein Identification-Nano-LC-MS/MS

Wild-type (WT) and mutant (S13, 16D) Huntington (HTT) preparations are in-gel digested and generated peptides subjected to a micro-clean-up procedure (Erdjument-

Bromage et al., 1998) on 2 ml bed-volume of Poros 50 R2 (Applied Biosystems – ‘AB’) reversed-phase beads, packed in an Eppendorf gel-loading tip, and the eluant diluted with 0.1% formic acid (FA) to yield a final concentration of 6% acetonitrile (MeCN).

Analysis of the resulting peptides is done using a QSTAR-Elite hybrid quadrupole time- of-flight mass spectrometer (AB/MDS Sciex) equipped with a NanoSpray ion source

(AB/MDS Sciex). Peptide mixtures (in 20 microL) are loaded onto a trapping guard column (0.3x5-mm PepMap C18 100 cartridge from LC Packings) using a Tempo nano

MDLC system (Applied Biosystems) at a flow rate of 20 microL/min. The mass analyzer is operated in automatic, data-dependent MS/MS acquisition mode; the collision energy is automatically adjusted in accordance with the m/z value of the precursor ions

selected for MS/MS. Initial protein identifications from LC-MS/MS data is done using the

Mascot search engine (Matrix Science, version 2.3.02; http://www.matrixscience.com) and the NCBI (National Library of Medicine, NIH) databases. Up to two missed tryptic cleavage sites are allowed, precursor ion mass tolerance = 0.4 Da, fragment ion mass tolerance = 0.4 Da; protein modifications are allowed for Metoxide, Cys-acrylamide, N- terminal acetylation and GlyGly modification (adduct) on internal Lysine after tryptic digestion. MudPit scoring is typically applied with ‘require bold red’ activated, and using significance threshold score p < 0.05.

Drosophila transgene analysis

To quantify expression of the Htt transgene, Heads of elav-GAL4/+; Su(var)2-10[zimp-

2]/+; UAS>Httex1pQ93/ + and elav-GAL4/+; +/Sp; UAS>Httex1pQ93/+ female flies were homogenized in TRIzol reagent (Invitrogen) and RNA was prepared according to the manufacturers recommendations. First strand cDNA was prepared from 1 µg of total

RNA with Maxima Universal First Strand cDNA Synthesis Kit (Thermo Scientific) using random hexamer primers. The resulting cDNA was diluted 1:10 and quantitated in qPCR reactions in an MJ Research Opticon thermal cycler using SYBR Green PCR

Master Mix (Applied Biosystems). Transgene expression levels were determined compared to a template calibration curve and normalized to the levels of the rp49 housekeeping gene.

Cell-Based SUMO Assay

Overexpression of a moderately expanded form of HTTex1p with 46 polyglutamines

(46QP-H4) fused in frame with a C-terminal multi-epitope tag without any confounding lysines, 6xHis-HA-HA-6xHis (H4, (Thompson et al., 2009)), allows purification of

HTTex1p under denaturing conditions (Ni-NTA) (Herbst and Tansey, 2000). By co- transfecting SUMO-1 or SUMO-2, SUMOylation of HTTex1p can be selectively visualized using the triple lysine mutant (3R) as a negative control. Human HeLa cells were chosen based upon previous studies analyzing global SUMO modification

(Bruderer et al., 2011). qPCR primers

Primer sequences are listed in Table 2.1.

Chapter 2

Figures

Sumo1-F GTGAATCCACGTCACCATGTC

Sumo1-R GTATCTCACTGCTATCCTGTC

Sumo2-F GTCAATGAGGCAGATCAGATTC

Sumo2-R CACATCAATCGTATCTTCATCC

Pias1-F GTCTCCTACGTCACCACTAAG

Pias1-R GCATAGGCGTCATGTGGAAG

Pias2-F CCGTGCAGTGACTTGTACAC

Pias2-R CTCATCCACATCAGAACAGTC

Pias3-F GGTGAGGCAATTGACTGCAG

Pias3-R GTAGTAGCCACTTCACTGTCG

Pias4-F GACGCTAGTGGCCAAGATGG

Pias4-R GTCACCAGTTCGTGCTTCAG mActin-F AGGTATCCTGACCCTGAAG mActin-R GCTCATTGTAGAAGGTGTGG

Table 2.1. qPCR Primers

Figure 2.1. Illustration showing modulation of PIAS1 alters levels of insoluble mHTT accumulation.

Figure 2.2. K6 and K9 are primary sites for HTTex1p in vitro SUMOylation. (A) Schematic illustration of the SUMOylation pathway. SUMO is expressed as a precursor protein (SUMO-X) that is processed by SUMO specific proteases (SENPs) to expose a C terminal diglycine motif (-GG). Enzymatic reactions are similar to ubiquitination and include activation by the SUMO E1-activating enzyme (SAE1/UBA2), to the SUMO E2-conjugating enzyme (Ubc9) and transfer of SUMO to target lysines with or without the assistance of the SUMO E3-ligating enzymes. (B) Time course of SUMO-1 modification of His tagged HTTex1p (25Q) purified proteins (WT, K6R, K9R, K6,9R, K6,9,15R, and S13,16D) was performed in vitro . SUMOylation was visualized using anti-His antibody. Wild-type HTTex1p (WT) is SUMOylated within 16 min, K6R or K9R mutations delays SUMOylation and combined mutations (K6,9R or K6,9,15R) greatly reduce SUMOylation, Mutations that mimic phosphorylation (S13,16D) alter kinetics of SUMO-1 modification with SUMO modification observed beginning by 4 minutes.

100

Figure 2.3. SUMO-1 and SUMO-2 are differentially expressed in HD mice versus control. (A) QRT-PCR analysis of SUMO modifying proteins and enzymes in cortex and striata of WT mice at 12 weeks. Relative expression for all the SUMO enzymes is normalized to mouse β-actin. (B and C) qRT- PCR of SUMO mRNAs from 12 week old WT and R6/2 mouse cortex (B) and striatum (C). SUMO enzyme mRNAs are differentially expressed in R6/2 versus control with statistically significant increases in SENP1 (p=0.01), SENP3 (p= 0.02), and SUMO-1 (p= 0.003) in cortex and SENP1 (p=0.02), SENP6 (p=0.04), PIAS3 (p=0.007), SUMO-1 (p=0.02), and SUMO-2 (p=0.02) in striatum. Samples were analyzed in quadruplicate and normalized to mouse β-actin. Data are shown as R6/2 expression relative to WT levels set at 1 for each enzyme with +/- S.D., n=4, *, p<0.05.

101

102

Figure 2.4. mRNA Expression of the SUMO Enzymes. qRT-PCR data showing relative mRNA expression levels of the SUMO enzymes in cortex and striata of 4 and 8 weeks in R6/2 and age matched controls. (A) At 4 weeks, SUMO-1 is upregulated in cortex (p = 0.0004) and SENP2 (p = 0.05), SENP5 (p = 0.025), and SUMO-1 (p = 0.04) are upregulated in R6/2 versus control striata. (B) At 8 weeks, in cortex SENP3 (p = 0.015) and PIAS3 (p = 0.003) are upregulated in R6/2 versus control. In striata, none of the SUMO enzymes are statistically significantly different between R6/2 and control. Note: all data shown as relative expression to WT levels set at 1 for each enzyme with +/_ S.E.M., n = 4, *p < 0.05. (C) qRT-PCR of RNA isolated from 14 month old WT and BACHD striatum showing relative mRNA expression levels of the SUMO-1, SUMO-2, and PIAS enzymes. Both SUMO-1 (p = 0.03) and SUMO-2 (p = 0.02) expression levels are significantly elevated in BACHD versus control. Samples were analyzed in triplicate and normalized to mouse b-actin. Note:WT and BACHD mice were treated with control microRNA for another study. Note: all data shown as relative expression to WT levels set at 1 for each enzyme with +/_ S.E.M., n = 6, *p < 0.05.

103

104

Figure 2.5. Establishment of SUMOylation Assay. (A) HeLa cells overexpressing SUMO (GFP-SUMO- 1 or GFP-SUMO-2) and Httex1 (46QP-His-HA-HA-His or 46QP-H4) were lysed under denaturing conditions 48 hr after transient transfection. Htt was purified using magnetic nickel beads (NiNTA) and subjected to Western analysis using the Odyssey Infrared detection system from LI-COR. The Odyssey is a quantitative Western blot detector that has the ability to detect two proteins in separate fluorescent channels, even if the bands co-migrate. The Odyssey scanner detects fluorescent secondary antibodies using an infrared laser; for rabbit polyclonal antibodies a goat-anti-Rabbit secondary (IRDye 800CW, LI- COR) was used, which fluoresces red, and for mouse monoclonal antibodies goat-anti-Mouse IgG secondary (IRDye 680LT, LICOR), which fluoresces green, was used. Since, the GFP tag on the SUMO protein can bind non-specifically to the magnetic nickel beads, the NiNTA blots were probed with anti-Htt antibodies (anti-Htt (Enzo) or anti-HA) and the three lysine mutant (3R) served as a negative SUMO-Htt control. Due to the denaturing conditions each Western blot was subjected to a reversible protein stain (Memcode) to account for any unequal protein loading and NiNTA. Western blots are presented in the gray scale. (B) Bar graph representing the amount of Htt SUMO modified. Using the Odyssey software, the amount of Htt SUMOylated (Htt-SUMO) is divided by the total amount of Htt purified and then multiplied by 100. This ratio allows us to compare across lanes when analyzing the SUMO E3 ligases and the SUMO isopeptidases (SENPs). (C) Trichloroacetic Acid precipitation (TCA) performed on 10 percent of the whole cell lysates allows for an approximation of protein expression levels and is referred to as WC TCA. Once again, the reversible protein stain (MemCode) helps determine equal loading of protein, myc- actin (1/10) serves as a transfection control for possible CMV promoter effects caused by the overexpression of transcriptional regulators and is detected with the anti-myc antibody (Millipore). Relative expression level of Htt in whole cells is detected with either the polyclonal antibody anti-Htt (Enzo) or the monoclonal antibody anti-HA.

105

106

Figure 2.6. HTT is modified by both SUMO-1 and SUMO-2. (A) HeLa cells transfected with His tagged HTTex1p (46Q) or 46QP-K6,9,15R (3R) along with GFP-SUMO-1 or GFP-SUMO-2, lysed under denaturing conditions, and nickel purified (Ni-NTA). Unmodified HTT-46Q is indicated by the arrow and SUMO modified HTT the boxed region. The lysine mutant (3R) serves as a negative control. Ni-NTA represents nickel purified His-tagged HTT and WC TCA represents 10% of the whole cell lysate expression of HTT and myc-actin (transfection control). HTT is modified by SUMO-1 (left) and SUMO-2 (right). (B) SUMO isopeptidases (SENP1, SENP2, SENP3, SENP5, and SENP6) modulate SUMO modified HTT when overexpressed together with HTT (46QP-H4 or 3R) and SUMO-1 (GFP-SUMO-1). SENP1, SENP2, and SENP6 decrease HTT SUMOylation. Graph depicts quantitation of western blot using the Odyssey ® Infrared Imaging System (LI-COR ®) to calculate the ratio of HTT purified versus the HTT modified by SUMO multiplied by 100. (C) Titration of SUMO-1. Denaturing nickel purification of HTTex1p (46QP-H4) following transfection with decreasing amounts of SUMO-1 reduces the amount of SUMO modified HTT to undetectable levels. The Ni-NTA blot displayed in the grey scale shows purified HTTex1 and SUMO-modified HTTex1 using HTT antibody. *Note: 0.5µg of SUMO-1 (1/4) was used for identifying the SUMO-1 E3 ligase for HTTex1p. Graph depicts quantitation of western blot using the Odyssey ® Infrared Imaging System (LI-COR ®) to calculate the ratio of HTT purified versus the HTT modified by SUMO multiplied by 100. *Note: all experiments were performed in triplicate and a representative figure is shown. Western blot analysis of SUMO-2 in 14 week R6/2 cortex (D) and striatum (E) versus aged matched controls. SUMO-2 is upregulated in R6/2 striatum versus control (p=0.026, n=4). Protein is normalized to alpha-tubulin and quantitated using imageJ.

107

Figure 2.7. PIAS1 is a SUMO E3 ligase for HTT. (A) Under limiting SUMO conditions (¼ SUMO-1, lanes 3-10), PIAS1 increases HTT-SUMO modification above ¼ SUMO alone. Purified HTT (arrow) and SUMO-HTT (boxed region) were detected using anti-HTT. Graph depicts quantitation of the Ni-NTA Western blot using the Odyssey ® Infrared Imaging Software (LI-COR ®) to calculate the ratio of HTT purified versus the HTT modified by SUMO multiplied by 100. (B) Western analysis of overexpression of HTTex1 (46QP-H4 or 3R), SUMO-2 (GFP-SUMO-2), and all the PIAS proteins (PIAS1, PIASxα, PIASxβ, PIAS3, and PIASy). Under non-limiting SUMO-2 conditions, PIAS1 enhances SUMO modification of HTT. WC TCA shows overall myc-actin (transfection control) and HTT levels. Graph quantitating the ratio of HTT purified versus the HTT modified using the Odyssey ® (LICOR). (C) Top: autoradiography results of GST pull-down assay showing that radiolabeled human PIAS1interacts with HTTex1p. Bottom: phosphorimager analysis of GST pull-downs, performed in triplicate, showing the percent of 35 S-labeled PIAS protein that bound the GST proteins; GST alone, unexpanded HTT with and without the proline-rich region (20QP and 20Q), expanded HTT with and without the proline-rich region (51QP and 51Q), and the proline-rich region alone (Pro). *Note: all experiments were performed in triplicate; representative figures are shown.

108

109

Figure 2.8. A 586aa fragment of HTT is SUMO modified downstream of exon 1. (A) SUMOplot (Abgent) predicts HTT is SUMOylated downstream of HTTex1p lysines. Abgent SUMOplot analysis predicts two high probability SUMO sites (red) and three low probability SUMO sites (blue) identified downstream of HTT exon 1. Greater than 13 overlapping non-covalent SUMO interacting motifs (SIMs) are observed within this fragment (yellow). (B) Longer HTT polypeptides are modified by SUMO-1. Western blot overexpressing HTTex1p (46QP-H4 or 3R), unexpanded HTT-586 fragment (25Q-586aa or 25Q-3R-586aa), and expanded HTT-586 fragment (137Q-586aa or 137Q-3R-586aa) with SUMO-1 (GFP- SUMO-1). Cell lysates were subjected to HTT immunoprecipitation (IP) using HTT antibody. Western analysis performed with the Odyssey ® (LI-COR) allows detection of HTT (not shown) and SUMO simultaneously, and shows all forms of HTT are SUMO-1 modified using the anti-GFP antibody. HTTex1p is covalently SUMO-1 modified (lane 3) and the modification disappears when Lys are mutated to Arg (3R) (lane 4). Both unexpanded (lane 4 and 5) and expanded HTT-586 fragments (lane 6 and 7) are covalently SUMO-1 modified in both the presence and absence of the 3 Lys in the N-terminal region of HTT (3R). Free SUMO-1 is indicated with the arrow and SUMO modified HTT indicated by the boxes. Inset on the right, from a replicate experiment, shows co-migration of expanded HTT (anti-HTT) and SUMO-1 (anti-GFP) displayed in the grey scale, and in color when the two antibodies are merged (HTT in red and SUMO-1 in green and yellow when co-localizing). (C) Bait plasmids (HTT-586aa-25Q or HTT- 586aa-73Q) were transformed into the L40ccua MATa yeast strain. Yeast clones encoding bait proteins were individually mated against a matrix of MATα yeast clones encoding 16,888 prey proteins (with Gal4 activation domain fusions) using pipetting and spotting robots. Diploid yeasts were spotted onto SDIV (- Leu-Trp-Ura-His) agar plates for selection of PPIs as well as nylon membranes placed on SDIV agar plates for β-galactosidase assays. After 5–6 days of incubation at 30°C, digitized images of the agar plates and nylon membranes were assessed for growth and β-galactosidase activity using the software Visual Grid (GPC Biotech). (D) Overexpression of PIAS1 alone, with unexpanded HTT constructs (25Q- 586aa) plus SUMO-1 (GFP-SUMO-1) shows PIAS1 binds both full length HTT and HTT-586 fragment (25Q-586aa). Wild-type HTT was used in these experiments to preclude confounding aggregation effects. Western analysis detection was performed using Odyssey (LI-COR) and displayed in the grey scale, but shown in color on the merge (HTT is Red and PIAS1 is Green). (E) HeLa cells overexpressing either expanded 586aa-HTT or the phosphomemetic (S13,16D= DD) with SUMO-2 plus and minus PIAS1. HTT was purified by IP using hydrazide beads (Bioclone) cross-linked to HTT (Enzo, UK) antibody and subjected to western analysis using anti-HTT (MAB5490). (F) IP of HTT with hydrazide linked beads shows both unexpanded and expanded HTT 586aa phosphomimetics (S13, 16D-586aa) are modified by SUMO-2. *asterisks indicated SUMO conjugated HTT. *Note: all experiments including the yeast two hybrid assay were done in triplicate; representative experiments are shown.

110

111

Figure 2.9. SUMO-2 causes mutant HTT to accumulate. (A) Western analysis of whole cell lysates from HeLa cells transfected with His-SUMO-1 or -2 and/or 97Q-HTT exon-1 and treated with 5μM MG132 for 18 h. Lysates were separated using differential centrifugation into a detergent-soluble fraction (SOLUBLE) with 1% triton-x 100 and a detergent-insoluble fraction (INSOLUBLE) with 4% SDS. Western blot probed with anti-HTT shows full length endogenous HTT in the SOLUBLE fraction, upper arrow, and 97Q-HTTex1, lower arrow (Left panel). In the INSOLUBLE fraction: HTT HMW)species are indicated by the bracket and asterisks (Right panel). (B) MG132 and SUMO-2 cause mutant HTT to accumulate as HMW species (bracket and asterisk). Western blot showing immunoprecipitation (IP) with HTT antibody cross-linked beads from the detergent-insoluble fraction probed with the anti-HTT antibody. (C) Mutant HTT (97Q-Httex1) fibrils are detected with anti-HTT in the insoluble fraction with treatment of MG132 or addition of exogenous SUMO-2. (D) Western blot with increasing concentrations of SUMO-2 detected with anti-His antibody - left panel. Middle panel- same western blot probed with anti-HTT showing soluble forms of HTT. Right panel- western blot from detergent-insoluble fraction with monomeric HTT (97Q) at 55 kDa and * indicating the HMW species. *Note: all experiments were performed in triplicate, representative figures are shown.

112

113

Figure 2.10. SUMO-2 proteins accumulate in HD brain. (A) Western blot analysis of HeLa cells overexpressing exogenous PIAS1 in the presence of mutant HTT (97Q) when separated into detergent- soluble and detergent-insolube fractions. No difference detected in monomeric HTT (Top panel, Soluble), but high molecular weight HTT levels increases with PIAS1 overexpression. Anti-PIAS1 antibody (Invitrogen). (B) Acute knockdown of PIAS1 decreases HMW HTT species in the detergent-insoluble fraction. PIAS1 knockdown is detected in detergent-soluble and insoluble fractions using anti-PIAS1 antibody (Invitrogen). (C). Drosophila melanogaster expressing mutant HTTex1p (93Q) in a reduced Su(var)2-10/dPIAS genetic background exhibit statistically significantly reduced photoreceptor neuron (rhabdomere) degeneration (left panel, P=0.033 when comparing dPIAS /+ to +/+ flies) and increased overall survival (right panel, P=0.047 when comparing dPIAS 1/+ to +/+ flies). Significance was measured by Student’s t-test. (D) High molecular weight (HMW) SUMO-2 accumulates in postmortem HD striata. Western blot analysis of the insoluble fraction from three control and three HD patient postmortem striata as described (methods).

114

CHAPTER 3

PIAS1 regulates mutant huntingtin accumulation and Huntington's disease-associated

phenotypes in vivo

SUMMARY OF CHAPTER 3

In the previous chapter, we reported the discovery that the SUMO E3 ligase, PIAS1 regulates mHTT accumulation and SUMO of HTT in cells. As reported in Chapters 1-2,

HTT plays a major in protein quality control networks and the disruption of protein quality control networks is central to pathology in HD and many other neurodegenerative disorders. Specifically, the aberrant accumulation of insoluble high- molecular-weight protein complexes containing the HTT protein and SUMOylated proteins corresponds to disease manifestation. My dissertation work is focused on mechanisms associated with disease pathology; specifically, the disruption of these protein quality control networks that ensure proper folding and degradation of cellular proteins is likely central to pathology in “protein misfolding” diseases. The results from the study presented in this chapter and in the corresponding recent publication (Ochaba et al., 2016) confirm the association between aberrant accumulation of expanded polyglutamine-dependent insoluble protein species and pathogenesis, and provide a link between phenotypic benefit to reduction of these species through PIAS1 modulation. At the end of the chapter, I describe unpublished studies to begin to evaluate structure-function relationships of PIAS1 and HTT.

In this work, I performed all experiments to investigate whether PIAS1 modulation in neurons alters HD-associated phenotypes in vivo . This work was in collaboration with the Davidson lab, who provided the miRNA used to perform in vivo knockdown.

115

Instrastriatal injection of a PIAS1-directed miRNA significantly improved behavioral phenotypes in rapidly progressing mHTT fragment R6/2 mice. PIAS1 reduction prevented the accumulation of mHTT and SUMO- and ubiquitin-modified proteins, increased synaptophysin levels, and normalized key inflammatory markers. In contrast,

PIAS1 overexpression exacerbated mHTT-associated phenotypes and aberrant protein accumulation. These results confirm the association between aberrant accumulation of expanded polyglutamine-dependent insoluble protein species and pathogenesis, and they link phenotypic benefit to reduction of these species through PIAS1 modulation.

These findings suggest a novel role for PIAS1 in HD as a novel therapeutic target which may act as an important regulatory switch. A detailed understanding of the proteostasis network components and their contributions to pathology are therefore crucial to improved therapeutic interventions.

A Portion of Chapter from published studies:

Ochaba, J., Mas Monteys, Al., O’Rourke, J.G., Reidling, J., Steffan, J.S., Davidson,

B.L., and Thompson, L.M. (2016). PIAS1 regulates mutant Huntingtin

accumulation and Huntington’s disease-associated phenotypes in vivo . Neuron

90:507-520 .

INTRODUCTION

Huntington’s disease (HD) is caused by an expansion of a CAG repeat within the HD gene, encoding an expanded stretch of polyglutamines in the Huntingtin (HTT) protein

(Group, 1993b). Symptoms include movement abnormalities, psychiatric symptoms and cognitive deficits with accompanying cortical atrophy and degeneration of medium spiny

116

neurons in the striatum (Ross and Tabrizi, 2011). A key pathological feature is the aberrant accumulation of mutant HTT (mHTT) protein (Waelter et al., 2001), potentially through the disruption of protein quality control networks that ensure proper folding and degradation of cellular proteins (La Spada and Taylor, 2010; Wilkinson et al., 2010).

Post-translational modifications (PTMs) of HTT, including SUMOylation and phosphorylation (Ehrnhoefer et al., 2011; Pennuto et al., 2009), may contribute to mechanisms underlying mHTT accumulation (O'Rourke et al., 2013; Thompson et al.,

2009) and influence in vivo pathogenesis (Gu et al., 2005). Additionally, SUMO modification itself can function as a secondary signal affecting ubiquitin-dependent degradation by the proteasome (UPS) (Praefcke et al., 2012).

SUMOylation is the covalent attachment of a Small Ubiquitin MOdifier Protein (SUMO) to target proteins. Although a transient modification, SUMOylation has long-lasting effects, including the regulation of subcellular localization, protein stability and clearance, chromatin remodeling, and interaction properties of modified proteins

(Cubenas-Potts and Matunis, 2013; Gareau and Lima, 2010). Four different forms,

SUMO 1-4, exist. The SUMOylation pathway involves a cascade of enzymes, with an

E1-activating enzyme (SAE1/UBA2), an E2-conjugating enzyme (UBC9), and multiple

E3-ligating enzymes (Protein Inhibitors of Activated STAT [PIAS], PC2, MMS21, and

RanBP2) which provide substrate specificity. The diversity of SUMO substrates is governed by a relatively small number of SUMO E3 ligases. SUMO modification can occur on the same lysine residue as ubiquitination with extensive crosstalk in regulating cellular protein clearance. More recently, the importance of the SUMO modification system in brain has emerged, given the number of neurotransmitters and receptors that

117

are regulated by SUMOylation (Sen and Snyder, 2010). Further, SUMO proteins are implicated in a growing number of neurodegenerative diseases including Alzheimer’s disease, Parkinson’s disease, Amyotrophic lateral sclerosis (Hickey et al., 2008), polyglutamine repeat diseases, and transient cerebral ischemia, as well as HD

(Datwyler et al., 2011; Krumova and Weishaupt, 2013) , typically through an association with dysregulated disease protein aggregation and abundance.

We previously showed that SUMO-1/-2 modified proteins accumulate in an insoluble protein fraction from human HD postmortem striatum, and that SUMO isoforms can regulate the formation and accumulation of this insoluble HTT species in cells

(O'Rourke et al., 2013). Both wild type and mHTT are SUMO-1 and 2 modified within the amino terminal 17 amino acids and at downstream sites within the full-length protein

(O'Rourke et al., 2013; Steffan et al., 2004). Modulation of the SUMO network in vivo to investigate functional consequences in HD related systems can either be through

SUMO itself, which would be anticipated to have an overly broad impact and potentially deleterious effects, or through more selective means such as regulation of a relevant

SUMO E3 ligase.

Five major PIAS isoforms are expressed in mammals and can act as adaptor proteins that bridge the SUMO-conjugated E2 enzyme and the substrate in the SUMOylation cascade as well as act as ligases. The PIAS proteins themselves were originally characterized by their ability to regulate transcription, immune responses, and cytokine signaling (Liu and Shuai, 2008; Rytinki et al., 2009), although roles in protein clearance pathways are emerging (Lee et al., 2009; Liu and Shuai, 2009). We previously demonstrated that PIAS1 can selectively enhance HTT modification by both SUMO-1

118

and SUMO-2 and regulate the formation of insoluble high molecular weight (HMW) HTT species, suggesting that PIAS1 might influence pathogenesis in HD. Further, genetic reduction of the single dPIAS in mHTT-expressing Drosophila is protective (O'Rourke et al., 2013).

Given the ability of PIAS1 to enhance SUMO modification of HTT and regulate mHTT accumulation in cell models, we hypothesized that reduction of PIAS1 in HD striata might confer neuroprotection. Using viral delivery of a mouse PIAS1-targeting artificial microRNA (miRNA) to the HD modeled R6/2 mouse striatum, which shows progressive accumulation of HMW mHTT protein, PIAS1 reduction significantly prevented HD- associated phenotypes and accumulation of insoluble mHTT. Strikingly, PIAS1 ameliorated disease-associated increases in apparent microglial activation and dysregulation of relevant proinflammatory cytokines. Conversely PIAS1 overexpression exacerbated disease phenotypes and the accumulation/aggregation profile. These results suggest that PIAS1 may link protein homeostasis, neuroinflammation and disease symptomatology by modulating formation of toxic forms of accumulated mHTT.

RESULTS

Targeted modulation of PIAS1 in the striatum of mHTT expressing R6/2 mice

To investigate the relationship between mHTT accumulation and functional outcomes and determine whether PIAS1 contributes to this network in vivo , we used acute instrastriatal knockdown or overexpression of PIAS1 in a mHTT expressing mouse model. PIAS1 protein is expressed in most tissues including brain therefore we confined knockdown to the brain. Our studies utilized R6/2 transgenic mice, based on their

119

relatively rapid progression, the formation of detergent-insoluble aggregated species of

HTT which increase with disease progression, and inflammatory responses that are reminiscent of symptomatic human HD (Chang et al., 2015; Hsiao et al., 2013). These mice express the first exon of human HTT (CAG repeat of ~125), and show reproducible and rapidly progressing motor and metabolic symptoms at 6 weeks of age and eventually develop tremors, lack of coordination, excessive weight loss, and early death (~12 weeks) (Mangiarini et al., 1996a).

Adeno-associated viruses, which transduce striatal neurons (AAV2/1 or 2/2) (Harper et al., 2005; McBride et al., 2008), were engineered to express PIAS1-targeting artificial miRNAs for acute knockdown of PIAS1 in vivo . A series of mouse PIAS1-directed artificial miRNAs were tested and miPIAS1.3 selected based on optimal knockdown in

NIH3T3 cells (Figure 3.1A-B). Striata of mice were bilaterally injected with rAAV2/1miPIAS1.3-CMVeGFP (miPIAS1.3) or rAAV2/1-mU6miSAFE-CMVeGFP

(miSAFE) (mismatch control) for knockdown studies and rAAV2/2-CMVPIAS1 (PIAS1) or rAAV2/2-CMVeGFP (eGFP) (viral control) for overexpression studies at 5 weeks of age. For knockdown studies, mice were sacrificed at 10 weeks. PIAS1 overexpression mice were sacrificed at 9 weeks due to declining health of mice. Consistent with other studies (Aschauer et al., 2013; Harper et al., 2005; McBride et al., 2008), AAV2/1 and

2/2 viral transduction was exclusively neuronal as demonstrated by βIII-tubulin/eGFP co-localization and lack of GFP expression in microglia or astrocytes as measured by

Iba1 or GFAP co-staining (Figures 3.2A-B).

PIAS1 protein levels were evaluated to determine whether modulation was achieved in treated mice following viral injections. We previously showed that PIAS1 is primarily in

120

the detergent-insoluble fraction, similar to HMW HTT and modified proteins (O'Rourke et al., 2013), therefore isolated detergent-soluble and detergent-insoluble proteins. The detergent-soluble fraction contains mainly cytoplasmic proteins such as GAPDH, monomeric forms of HTT (including the R6/2 mHTT fragment encoding human transgene), endogenous mouse full-length HTT, and soluble oligomeric species of HTT which do not fully resolve on standard PAGE gels (O'Rourke et al., 2013; Sontag et al.,

2012b) (Figure 3.3). In contrast, the detergent-insoluble fraction contains primarily nuclear proteins including Histone H3 (Figure 3.3), HMW HTT species (likely multimers or potentially insoluble oligomers and fibrils), and accumulated forms of SUMO- and ubiquitin-modified proteins. Levels of PIAS1, primarily a nuclear protein, were monitored in striatal tissues from 10 week old R6/2 and non-transgenic (NT) mice. In the soluble fraction, PIAS1 levels are slightly higher in NT animals by Western analysis (Figure

3.4A), however PIAS1 protein levels were significantly elevated in the insoluble, nuclear fraction from R6/2 mice (Figure 3.4A). In miPIAS1.3 treated R6/2 mice, insoluble PIAS1 levels in the striatum were markedly reduced, as indicated by decreased protein expression at 5 weeks post-injection relative to miSAFE treated R6/2 mice (Figure

3.5A). While there was a significant decrease in levels of soluble PIAS1 in NT mice with miPIAS1.3 injection, there was little to no impact on soluble PIAS1 levels in R6/2 mice

(Figure 3.4B). Given the already high levels of PIAS1 in R6/2 mice, miPIAS1.3 miRNA produced a relatively greater apparent degree of knockdown compared to NT mice. As a control for off-target viral effects, we found that apart from eGFP expression, vehicle treated (Formulation Buffer 18) mice did not differ biochemically nor behaviorally from miSAFE treated mice (Figure 3.5A-C). Given the relatively low levels of insoluble PIAS1

121

in NT mice, miPIAS1.3 miRNA produced a relatively smaller apparent degree of knockdown compared to R6/2 mice, therefore no statistically significant decrease in

PIAS1 levels was detected following miPIAS1.3 treatment in NT mice (Figure 3.4B).

However, knockdown was observed in RNA from both R6/2 and NT mouse striata

(Figure 3.6). For overexpression studies, virus expressing PIAS1 bilaterally injected into

R6/2 mouse striata resulted in a significant increase in insoluble PIAS1 levels 4 weeks post-injection (Figure 3.2D), a significant reduction in soluble PIAS1 levels was found in

NT mice, but not R6/2 mice (Figure 3.4B).

Modulation of PIAS1 alters behavioral phenotypes in the R6/2 mouse model of HD

R6/2 mice show progressive weight loss, abnormal hind limb posture/splayed limbs when held by the tail (clasping) (Mangiarini et al., 1996a), loss of motor coordination and balance measured using a Rotarod test (Carter et al., 1999), a decrease in sensorimotor performance when climbing down a vertical pole (Hickey et al., 2008) and diminished forelimb grip strength (Woodman et al., 2007). To determine whether altering PIAS1 levels in vivo had an effect on these R6/2 phenotypes, we injected rAAV virus that either knocks down or overexpresses PIAS1 into the striatum of 5 week old mice and then monitored their body weight and ability to perform on a series of behavioral tasks (Figure 3.7A).

R6/2 mice begin losing weight and show a decline in behavioral tests at 6 weeks

(Mangiarini et al., 1996a) and our results are consistent with those findings. No treatment effect on weight was observed for either PIAS1 knockdown or overexpression

(Figure 3.8A-B). Reduction of endogenous levels of PIAS1 in R6/2 mice caused a significant improvement on Rotarod performance compared to miSAFE injected mice at

122

7 weeks (Figure 3.7B), but deficits reappeared at 9 weeks (Figure 3.9). In the pole test task there was no effect observed with miPIAS treated R6/2 mice at 6 weeks, however, by 8 weeks of age they exhibited a complete rescue in deficits observed compared to miSAFE treated R6/2 mice that was comparable to NT mice (Figure 3.7C). When grip strength was measured, R6/2 mice injected with miPIAS1.3 had no treatment effect at

6.5 weeks, but had a significant and almost complete rescue effect by 8 weeks compared to miSAFE treated R6/2 mice (Figure 3.7D). Finally, miPIAS1.3 delayed the onset of clasping in R6/2 mice relative to miSAFE treated R6/2 mice (Figure 3.7E), which persisted up to the 9 week end point. CAG repeat length variability did not account for the behavioral improvement as repeat lengths assessed in a subset of animals (tail and striatal tissue) are within a tight range of 122-132 CAGs across animals with variation between individual animal tail samples and striatal tissue within 1-

2 CAG repeats.

Next, we injected the striatum of NT and R6/2 mice with AAV virus expressing either eGFP (as the control) or PIAS1 and performed complementary behavioral analyses as above. At 7 weeks, R6/2 mice overexpressing PIAS1 were not significantly different in

Rotarod performance when compared to eGFP injected R6/2 controls (Figure 3.7F).

R6/2 mice overexpressing PIAS1 demonstrated significantly impaired pole test descending times compared with eGFP treated R6/2 mice as early as 6 weeks of age

(Figure 3.7G), with deficits disappearing at 8 weeks. For grip strength, R6/2 mice overexpressing PIAS1 were significantly weaker than eGFP injected mice at 8 weeks for grip strength task (Figure 2H). PIAS1 exacerbated the onset of clasping in R6/2 mice relative to eGFP treated mice (Figure 3.7I).

123

To determine whether PIAS1 modulation altered longevity in R6/2, we evaluated survival in a small cohort (n=5 for each condition) and found that PIAS1 knockdown significantly increased survival when compared to control, whereas PIAS1 overexpression HD mice had no significant effect (Figure 3.10A).

Observational screens were performed weekly to rapidly assess general health, body weight, posture, appearance of the fur, neurological reflexes, home cage activity levels, and reactions to handling as designated by a multi-component Irwin Assessment Scale

(Irwin, 1968). Of these parameters, modulation of PIAS1 appeared to show an effect on

3 physiological assessments: spontaneous activity, piloerection, and gait. Specifically,

PIAS1 knockdown delayed the onset of abnormal spontaneous activity (Figure 3.10B), piloerection (Figure 3.10C), and gait impairments (Figure 3.10D), relative to miSAFE and PIAS1 overexpression treated R6/2 mice. PIAS1 overexpression mice also exhibited earlier onset of abnormal physiological characteristics such as abnormal piloerection and gait impairments (Figure 3.10B-C).

Taken together, these results demonstrate that PIAS1 knockdown significantly improves neurological phenotypes of R6/2 mice and that this effect is selective, given exacerbation of some phenotypes following PIAS1 overexpression. Interestingly, there were no significant differences across the battery of behavior assessments when comparing treatment effects on NT mice for either PIAS1 miRNA or cDNA delivery, supporting a selective role for PIAS1 in the disease setting.

PIAS1 knockdown decreases pathogenic accumulation of mHTT, SUMOylated, and Ubiquitinated proteins

124

Given that HMW mHTT species and SUMO-1 and 2/3 modified proteins accumulate in

HD brain and that PIAS1 regulates accumulation of mHTT and SUMO-modified proteins in cells (O'Rourke et al., 2013), we investigated the impact of PIAS1 modulation on insoluble mHTT accumulation and protein homeostasis in vivo . The detergent insoluble fraction of R6/2 striatum plus and minus PIAS1 knockdown (mPIAS1.3 treatment) was analyzed for the presence of insoluble accumulated mHTT. Similar to our previous findings in cells, PIAS1 knockdown decreased insoluble HTT accumulation by ~60% in

R6/2 mouse striatum (Figure 3.11A-B) compared to R6/2 treated with control virus

(miSAFE). Further, this reduction in mHTT accumulation was due to PIAS1 knockdown and not to a decrease in mHTT transgene expression, as no differences in soluble mHTT transgene expression or HTT mRNA expression by RT-PCR between miPIAS1.3 treated mice compared to miSAFE were observed (Figure 3.6).

We previously showed PIAS1 could modulate levels of SUMO-modified proteins in cells

(O'Rourke et al., 2013) and here reduction of PIAS1 also significantly reduced levels of insoluble SUMO-1 (Figure 3.11A and 3.11C), SUMO-2 (Figure 3.11A and 3.11D), and ubiquitin-modified proteins (Figure 3.11A and 3.11E) in R6/2 striatum, suggesting that

PIAS1 may be critical in generation of these modified and potentially pathogenic protein species. These fractions represent SUMO- and ubiquitin-modified cellular proteins including HTT as there are currently no antibodies that exclusively detect SUMO- or ubiquitin-modified HTT.

As observed for behavioral outcomes, overexpression of PIAS1 had the opposite effect compared to reduced PIAS1 and promoted aberrant protein accumulation and aggregation. Insoluble HTT accumulation was significantly increased in mouse striatum

125

by week 9 (Figure 3.11F and 3.11H). Insoluble SUMO-1 (Figure 3.11F and 3.11H),

SUMO-2 (Figure 3.11F and 3.11I), and ubiquitin-modified proteins (Figure 3.11F and

3.11J) were also significantly increased in 9 week old R6/2 striatum following PIAS1 overexpression.

Finally, aberrant accumulation of mHTT is reflected in the formation of large visible aggregates, therefore we also evaluated the formation of inclusions in tissue sections from treated R6/2 mice. HTT-containing aggregates within the striatum were significantly reduced in striata of R6/2 mice injected with miPIAS1.3 compared to the miSAFE treated control group (Figure 3.12A). As expected, no inclusions were observed in NT mice (data not shown). Conversely, a 2-fold increase in inclusion bodies was observed in R6/2 mice treated with PIAS1 overexpressing vectors (Figure 3.12B).

Reduction of PIAS1 increases synaptophysin levels

A decrease in synaptic markers is associated with impaired synaptic activity and behavioral output in HD mice (Cepeda et al., 2003), whereas restoration of key synaptic marker levels prevented synapse degeneration, ameliorated motor and cognitive decline, and reduced striatal atrophy and neuronal loss in various mouse models of HD

(Wang et al., 2014b). Further, one of the many neural SUMOylation targets includes transporters and neurotransmitter receptors; factors critical to the health of a synapse

(Sen and Snyder, 2010). Synaptophysin is a presynaptic marker that is significantly decreased in the striatum of HD patients and animal models (Goto and Hirano, 1990); this decrease may be related to the accumulation of synaptotoxic mHTT species.

Therefore we next investigated whether PIAS1 knockdown or overexpression

126

modulates synaptophysin expression in R6/2 mice compared to controls, which may be an indication of overall synaptic health/function.

Immunohistochemical analysis of synaptophysin was performed on the striatum for both

NT and R6/2 mice at 10 weeks for PIAS1 knockdown and 9 weeks for PIAS1 overexpression. Expression was quantified and significantly increased in striatal areas expressing miPIAS1.3 when compared to miSAFE in both HD and NT injected mice

(Figure 3.13A; Figure 3.14). In contrast, overexpression of PIAS1 resulted in a decrease of synaptophysin when compared to eGFP treated HD mice (Figure 3.13B), consistent with the increased HTT accumulation and worsening of behavioral readouts. There was no significant difference in synaptophysin levels in NT mice treated with either PIAS1 overexpression or eGFP control (Figure 3.13B).

Reduced PIAS1 selectively normalizes key dysregulated inflammatory markers in

R6/2 mice

The PIAS1-SUMO ligase pathway plays a critical role in innate immune signaling and in inflammatory responses (Liu and Shuai, 2008; Liu et al., 2005). Importantly, these pathways are dysfunctional in HD (Shuai, 2006; Shuai and Liu, 2005). Chronic expression of mHTT results in sustained neuroinflammation which can cause elevated microglia activation and dysfunctional proinflammatory signaling, potentially contributing to neurotoxicity in HD. We evaluated whether altering PIAS1 levels in R6/2 striatum results in modulation of disease-associated neuroinflammation by investigating levels of key inflammatory proteins such as those expressed by activated microglia, inflammatory factors, and proinflammatory cytokines.

127

As microglia are intimately involved in regulation of inflammation, levels of anti-ionized calcium binding adaptor molecule 1 (Iba1), a marker for microglia in mouse tissue, was evaluated. Upon activation of microglia due to inflammation, expression of Iba1 is upregulated allowing the discrimination between surveying and activated microglia

(Jeong et al., 2013). As expected, HD mice were found to have elevated steady-state levels of Iba1, consistent with increased neuroinflammation in the context of mHTT expression (Figures 3.15A and 3.15B). Treatment with miPIAS1.3 significantly reduced

Iba1+ microglia (Figure 3.15A) within the virus-expressing regions, suggesting that mHTT accumulation and PIAS1 signaling may be essential for this neuroinflammatory effect. When PIAS1 was overexpressed, a significant increase in Iba1 protein staining was observed in HD mice (Figure 3.15B). Modulation of PIAS1 in NT mice did not yield a significant change in Iba1 levels compared to control treated mice (Figures 3.15A and

3.15B), suggesting that the presence of mHTT is an essential component of altered neuroinflammatory responses upon modulation of PIAS1.

Cytokines constitute a significant portion of the immuno- and neuromodulatory messengers that can be released by activated microglia. Additionally, PIAS1 regulates several downstream activators of pro-inflammatory cytokine signaling pathways including NF-k B (Shuai, 2006). We therefore examined NF-k B (p65) following modulation of PIAS1 in the insoluble striatal protein fraction which as shown above contains primarily nuclear and accumulated proteins. Consistent with previous studies

(Camandola and Mattson, 2007), p65 levels were significantly decreased in the insoluble/nuclear fraction in R6/2, suggesting defective activation and localization of p65 to the nucleus (Figures 3.16A and 3.16B). Following PIAS1 knockdown in R6/2 mice,

128

insoluble/nuclear p65 levels were increased and restored to NT levels (Figure 3.16A). In contrast, overexpression of PIAS1 did not alter p65 levels (Figure 3.16B).

Given Iba1 and NF-k B’s role in inflammation, we next determined if changes in these markers corresponded to alterations in proinflammatory cytokines. We used a sensitive immunoassay panel to measure levels of IL1-β, IL-12p70, IFNγ, IL-6, IL-4, IL-5, IL-6, IL-

2, KC/GRO, IL-10, and TNFα in striatal tissue. Several of these cytokines are altered in

HD mouse models and human post-mortem tissue, including TNFα, IL1-β, IL-6, IL-10, and IFNγ (Ellrichmann et al., 2013; Silvestroni et al., 2009). Because detergent- insoluble samples contained high levels of SDS and can disrupt ELISA detection and that cytokines are soluble in nature, only soluble protein fractions were analyzed.

Strikingly, PIAS1 reduction restored levels of several dysregulated proinflammatory cytokines back to NT levels. For instance, IFN g , IL-6, and KC/GRO were significantly increased in HD mice relative to NT animals (Figure 3.17A-D). However, this inflammatory effect was restored to NT levels in the presence of miPIAS1.3 (Figure

3.17A-C). In the case of IL1-β, HD mice have relatively high levels at baseline; PIAS1 knockdown increased its levels in controls and HD mice (Figure 3.17D). Further, there were no genotype or treatment effects for the other 7 cytokines on the panel (3.18A), indicating selectivity in this PIAS1-mediated response for genes known to be dysregulated in HD systems and regulated by PIAS1 (Shuai, 2006) . In contrast to

PIAS1 reduction, PIAS1 overexpression did not elicit any changes to these same cytokines (e.g. IFN g , IL-6, KC/GRO, IL1-β) in R6/2 mice (Figure 3.17E-H), possibly because PIAS1 levels are already high, or in NT controls. No treatment effects were

129

observed for striatal expression of the cytokines IL-12p70, IL-4, IL-5, IL-2, or IL-10 in NT or R6/2 animals, as with miPIAS1.3 (Figure 3.18B).

These results suggest that PIAS1 knockdown results in the selective restoration of several inflammatory markers that are dysregulated in R6/2 mice and HD patients.

DISCUSSION

Approaches to reduce the causal entity in HD by targeting the production or accumulation of the mHTT protein itself are each likely to ameliorate HD pathogenesis.

Here we describe a selective approach to reduce the accumulation of an insoluble,

HMW and modified form of HTT in vivo in R6/2 mice through acute knockdown of the

E3 SUMO ligase PIAS1, thereby reducing HD related phenotypes, significantly normalizing aberrant neuroinflammatory responses and potentially improving synaptic health in these mice. Outcomes were specific to preventing formation of this HTT species and to decreasing PIAS1 whereas overexpression of PIAS1 significantly exacerbated HD phenotypes and dysregulated protein homeostasis as measured by accumulation of pathogenic insoluble mHTT, SUMOylated, and ubiquitinated proteins.

PIAS1 and protein homeostasis

There is growing awareness that the SUMO network is important in a number of critical cellular processes, including pathways responsible for maintaining proteostasis through quality control, regulation of the turnover of cellular components, and stress responses.

Age- and disease-related decline in protein homeostasis challenges the ability of neurons to counteract the accumulation of misfolded proteins. Their apparent critical role in regulating clearance of toxic mHTT clearance intermediates make SUMO and

130

selective regulatory E3 ligases enticing targets for developing therapeutics for HD. Our findings indicate that PIAS1 may be a central feature in modulating the formation of accumulated/aggregated mHTT, either as a component of clearance mechanisms or through a contribution to the formation of toxic, modified clearance intermediates to be degraded. Our previous studies suggested that levels of PIAS1 can influence pathogenesis, given that reduced PIAS1 prevented aberrant accumulation of insoluble mHTT in cells (O'Rourke et al., 2013) and repressed PIAS1 was associated with improved behavior outcomes following AV.caRheb treatment in N171-82Q mice and WT control littermates (Lee et al., 2015). Importantly, PIAS1 appears to function at the protein homeostasis level versus acting to modulate HTT gene expression.

Post-translational modification of proteins such as tau, a -synuclein, and HTT has been linked to regulating their abundance in cells, potentially in association with cellular clearance networks (Pennuto et al., 2009; Popova et al., 2015). As protein clearance mechanisms become impaired upon aging, modified proteins which normally would be targeted for degradation may ultimately create accumulated clearance intermediates that take on toxic properties (Orr and Zoghbi, 2007; Shao and Diamond, 2007). The outcome is likely tied to the overall functional state of protein clearance pathways in the cell at a given time. For instance, SUMOylation of disease proteins can positively or negatively regulate aggregation potential and cellular homeostasis (Sarge and Park-

Sarge, 2009). SUMOylated proteins, as well as other post-translationally modified proteins, can act as clearance intermediates, effectively targeting them for degradation by either the UPS or by autophagy. However, when these pathways become blocked or impaired, proteins begin to accumulate and aggregate and further modification by

131

ligases such as PIAS1 may generate more SUMOylated proteins than the system is able to effectively clear. It is possible that by reducing PIAS1 levels in our study, the formation of toxic HMW mHTT clearance intermediates is being significantly reduced, lightening the burden on the cell and shifting cellular homeostasis into a protective state.

PIAS1 and Neuroinflammation

In non-disease settings, inflammation acts as a homeostatic adaptive biological response to pathogen infection and tissue injury to activate the immune system and tissue repair mechanisms. However, when pathological processes result in a sustained inflammatory response, this chronic response may promote pathogenesis in several neurodegenerative diseases including HD and contribute to maladaptive responses that cause impaired neural plasticity and regeneration (Pekny and Pekna, 2014). Post- mortem human HD tissue has a distinct profile of inflammatory mediators such as increased gene expression of IL1-b , IL-8 ( KC/GRO in mice ), IL-6, and TNF a in the cortex and cerebellum (Silvestroni et al., 2009), decreased IL1-b , IL-8, TNF a and increased IL-6 mRNA levels in both human HD and R6/2 mouse striatum (Laprairie et al., 2014). How these mediators contribute to disease is unclear.

We investigated the expression of key inflammatory mediators in the presence of PIAS1 modulation and observe selective restoration of inflammatory signaling. First, although

TNFα levels are higher in the plasma and brain tissues of mice and patients with HD

(Bjorkqvist et al., 2008), PIAS1 modulation did not appear to impact TNF a levels, suggesting that PIAS1’s effects on cytokine and inflammatory state may be downstream of TNF a regulation, potentially at the level of NF-κB. HTT can interact with p65 and mHTT expression impairs transport of NF-k B from the synapse to the nucleus, a

132

process which appears to be critical to cell survival, synaptic plasticity, and neuroprotection (Marcora and Kennedy, 2010). Inappropriate regulation of NF-κB is involved in a wide range of neurodegenerative disorders including HD (Camandola and

Mattson, 2007) and p65 activation normalizes the expression of several cytokine genes in HD models (Laprairie et al., 2014). PIAS1 is an important negative regulator of NF-κB transcription factors that are activated by proinflammatory cytokines, growth factors, bacterial lipopolysaccharides, viruses, and stress signals (Liu et al., 2005). The binding of PIAS1 to p65 inhibits cytokine-induced NF-κB-dependent gene activation and induction of proinflammatory cytokine transcription, predicting that decreasing PIAS1 could restore NF-κB activity. Indeed, reduction of PIAS1 restored insoluble/nuclear p65 to NT levels (Figure 3.16). An intriguing connection between protein accumulation and these inflammatory responses is that IκB kinase β can regulate p65 clearance; this kinase also phosphorylates HTT S13 (Khoshnan and Patterson, 2011; Oeckinghaus and Ghosh, 2009; Thompson et al., 2009), which both facilitates SUMO modification of

HTT and clearance of mHTT. It is conceivable that PIAS1 is involved in this regulatory loop.

Levels of microglia are also decreased following PIAS1 knockdown in R6/2 mice (Figure

3.15). Microglial activation is observed in R6/2 mice and HD human tissue (Simmons et al., 2007) and expression of mHTT in microglia is sufficient to activate microglia and induce inflammatory responses via the myeloid lineage-determining factors PU.1 and

C/EBPs (Crotti et al., 2014). Remarkably, PIAS1 serves as a SUMO E3 ligase to regulate C/EBPβ activity (Liu et al., 2013) suggesting PIAS1 may be critical to this pathway which is dysfunctional in HD. Given that cellular debris from degenerating

133

neurons, including aggregates, can stimulate inflammatory cascades by microglia (Eyo and Wu, 2013; Suzumura, 2013), the prevention of mHTT accumulation may directly influence microglial activation. Indeed, we find that specific modulation of PIAS1 in neurons may alter cell-to-cell communication with neighboring glial cells to alter inflammatory homeostasis. One powerful aspect of this study comes from comparing the behavioral and neuropathological changes to mHTT proteostasis and inflammatory markers, which allows predictions as to the relevance of each that can be formally tested in future studies. A potential association between effects on HTT proteostasis is that microglial neuronal toxicity may account for loss of synaptophysin (Rasmussen et al., 2007), therefore by reducing levels of Iba1, and possibly activated microglia, PIAS1 knockdown may indirectly restore levels of synaptophysin in response to reduced neuronal toxicity. The significant reduction of accumulated insoluble mHTT and modified proteins in cells may restore positive cell-to-cell signaling between transduced neurons and neighboring/recruited microglia to limit the progression of a disease inflammatory state. PIAS1 knockdown, however, also appears to elicit selective effects beyond reducing mHTT accumulation. For instance, synaptophysin levels were increased in both NT and HD lines at 10 weeks following PIAS1 knockdown, suggesting that synaptotoxicity could be reversed both as a consequence of reduced mHTT accumulation but also at least in part, directly as a consequence of PIAS1 activity.

PIAS1 is critically involved in the regulation of several key inflammatory signaling nodes

(Liu et al., 2007; Shuai, 2006; Shuai and Liu, 2005) including STAT1, NF-κB as mentioned, and interferon-inducible genes and PIAS1 can negatively regulate interferon-inducible genes (Shuai, 2006). When interferon pathways are activated,

134

clearance of accumulated misfolded proteins is induced and cytotoxicity reduced in HD

(Lu et al., 2013), SCA (Chort et al., 2013) and ALS (Hadano et al., 2010) models. IFN-g levels are increased following PIAS1 knockdown in R6/2, consistent with PIAS1’s role as a negative regulator for IFN-g mediated innate immune responses (Liu et al., 2004).

As many of these highly relevant networks are transcriptionally regulated by PIAS,

PIAS1 may therefore play a fundamental role in HD pathogenesis through a combined impact on SUMO modification pathways and transcriptional networks. Consistent with our findings, PIAS1-homozygous null mice have elevated proinflammatory cytokine IL1-

β levels relative to their wild type littermates (Liu et al., 2007).

R6/2 mouse model and next steps

Based on findings presented here using a rapidly progressing mouse model, R6/2, that expresses an amino terminal fragment of the full length mHTT protein (Mangiarini et al.,

1996a), PIAS1 knockdown would be predicted to be neuroprotective and potentially effective when treatment is initiated symptomatically or early in disease. However, this likely depends on model and/or disease stage. Pathogenesis in R6/2 mice represents aspects of manifest HD, showing demonstrable protein accumulation, nuclear HTT localization, neuroinflammation, and dysregulated transcriptional signatures similar to striatal tissues from both symptomatic full length knock-in mouse models of disease and to human HD brain (Chang et al., 2015; Ciamei et al., 2015; Simmons et al., 2007). It will be essential to evaluate the effects of PIAS1 modulation in full length models of HD at various stages of the disease and perhaps in human patient-derived induced pluripotent stem cell neuronal subtypes in future studies in order to fully understand the contribution of PIAS1 to disease and its potential as a clinical target. Further, our

135

findings elucidate effects on neuronal dysfunction versus neurodegenerative aspects of disease, given the limited neuronal loss that is observed in mouse models of HD relative to human HD.

Summary

There is immense molecular complexity of inflammatory responses in HD . The data suggests that PIAS1 may link protein homeostasis and neuroinflammation in HD through a combination of modulating or compensating for dysfunctional inflammatory signaling cascades between neurons and microglia, and modulating accumulation of toxic HMW species of HTT, potentially allowing improved flux through protein clearance pathways. Given that PIAS proteins regulate several critical cellular processes, such as transcription, immune responses, and cytokine signaling (Liu and Shuai, 2008; Rytinki et al., 2009), and the likelihood that these processes play critical roles in different stages of disease and development, PIAS1 may thus serve as an “opportunistic” target. As a therapeutic target, homozygous animals display partial perinatal lethality (Shuai, 2006), suggesting a requirement for sufficient PIAS1 during development, however heterozygous null mice do not display any perinatal lethality and are clinically normal. Of significance, no deleterious effects were observed in NT animals following partial reduction of PIAS1, suggesting that a therapeutic reduction of PIAS1 could be safe through knockdown or small molecule inhibitors. PIAS1 protein levels were not significantly altered in these NT mice, despite expression of AAVs and decreased mRNA levels (Figure 3.2C). It is conceivable that other PIAS proteins and/or overall cellular homeostasis mechanisms may normally maintain PIAS1 levels under strict control by either clearing out excess or maintaining levels of PIAS1 when

136

overexpressed or knocked down. Supporting this concept is the presence of a C- terminal domain responsible for targeting for PIAS1 for proteolysis/clearance (Reindle et al., 2006). These cellular processes may be less functional in the expanded polyglutamine repeat context, as highlighted by the accumulation of PIAS1 in HD mice and impact on this accumulation through exogenous targeting of expression. The fundamental properties identified here may also broadly impact other neurodegeneration diseases, suggesting that PIAS1 and other E3 SUMO ligases may be key to tipping the balance between normal protein homeostasis and disease processes that cause neurodegeneration.

B. UNPUBLISHED DATA

Ongoing Studies: Targeting PIAS1 functional domains to achieve specificity

Structurally, PIAS1 contains five functional domains, including the SUMO-interaction motif (SIM) functional domain; these domains regulate cell processes by altering subcellular localization and formation of protein complexes through non-covalent interaction with SUMOylated proteins and binding various transcriptional activators/complexes to either repress or enhance activation of specific pathways. While

PIAS1 is associated with proteostasis mechanisms, including HTT from our work, the

SIM-mediated interactions remain largely unknown. Further, the role of the PIAS1-SIM- interactome in the context of HD has not been evaluated thus far, yet preliminary data show increased mHTT accumulation in the absence of the PIAS1 SIM. Interestingly,

RNF4, another E3-SUMO ligase, also contains several SIMs that are required for recruitment and clearance of nuclear SUMOylated protein aggregates (Kung et al.,

137

2014). Therefore, it is plausible that PIAS1 may also function as a scaffold for stress- induced protein clearance complexes in the CNS through its SIM domain.

Preliminary data: The PIAS1 SIM domain may regulate mHTT accumulation

The PIAS protein family contains several highly conserved regions including the E3

SUMO ligase domain and SIM (Palvimo, 2007; Yunus and Lima, 2009) that regulate

PIAS functions (Figure 3.19 ). Given the multiple functions of PIAS1, it may be therapeutically relevant to targets individual functional domains of the protein rather than modulating its levels as a whole as demonstrated thus far in these studies. Of particular interest is a highly acidic region within the PIAS protein containing a putative

SUMO1 and polySUMO ‘VIDLT’ interaction motif (SIM) which favors a β-strand confirmation as predicted by PELE, a collection of secondary structure prediction algorithms hosted on Biology Workbench ( workbench.sdsc.edu ). PIAS1-mediated recruitment of proteins following cell stress is dependent upon the SUMO-interacting motif (SIM) in various proteins (Azuma et al., 2005) and all three major SUMO paralogues (SUMO1–3) can bind SIMs (Hecker et al., 2006; Kerscher, 2007). Though important for ligase function, it is important to note that the PIAS1 SIM is not required for the E3 SUMO ligase activity (Kotaja et al., 2002; Sachdev et al., 2001). Given the involvement of SUMO molecules and modifications in HD, this SIM domain is likely regulatory and may modulate mHTT protein homeostasis.

To investigate the importance of this domain in PIAS1’s function in HD protein homeostasis, we generated PIAS1 mutant constructs with the VIDLT SIM domain swapped with AAAAA stretch in order to conserve tertiary structure, and transiently cotransfected with 25Q/97Q-HTTex1p or 25Q/137Q-586HTT into HeLa cells. Treatment

138

with PIAS1 causes a robust increase in HMW mutant HTT in the insoluble fraction as previously reported (O’Rourke et al., 2013). When co-expressed with expanded mHTT,

PIAS1 lacking its SIM domain caused an even larger increase in HMW insoluble mHTT

(Figure 3.20). Additionally, PIAS1 levels were significantly increased when the SIM was mutated (Figure 3.20).

These preliminary findings suggest that the SIM domain within PIAS1 may represent a functional domain to target protein homeostasis mechanisms affecting mHTT accumulation.

SUMMARY AND NEXT STEPS

The role of PIAS1 in protein clearance in the CNS remains elusive. Future studies will identify PIAS1 SIM-mediated interacting proteins that may participate in proteostasis through mass spectrometry approaches. PIAS1 has a clear modulatory effect on mHTT homeostasis both in vitro and in vivo ; therefore identifying the mechanisms whereby

PIAS1 exerts this effect and the potential role of the SIM will provide valuable mechanistic insights. Future studies will also examine whether defined domains can act in concert with other conserved and functionally relevant regions of PIAS through generation of combinatorial PIAS1 domain mutants. Future studies regarding the role of the SIM and other PIAS1 domains in protein homeostasis, in addition to others, will inform next stage development of PIAS1 as a therapeutic target.

139

EXPERIMENTAL PROCEDURES

Animals

Experiments were carried out in strict accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and an approved animal research protocol by the Institutional Animal Care and Use Committee (IACUC) at the

University of California, Irvine, an AAALAC accredited institution. All efforts were made to minimize animal suffering. R6/2 mice were obtained from Jackson Laboratories (Bar

Harbor, ME) (RRID:IMSR_JAX:006494) and housed under 12 h light/dark cycle in groups of up to 5 animals/cage with food and water ad libitum. CAG repeat sizing of tails and a subset of striatal tissue was performed (Laragen, Los Angeles, CA). To justify group and trial sizes in the animal experiments, we used G Power

(http://www.psycho.uni-duesseldorf.de/abteilungen/aap/gpower3/). Assessment of differences in outcome were based upon our previous experience and published results

(Carter et al., 1999; Hickey et al., 2005; Hockly et al., 2003; Stack et al., 2005)use models and applying the power analysis to analysis of variance model under these conditions and assumptions we arrived at an n=10 per experiment for behavior and n=4 for biochemical analysis.

Injections

Bilateral intrastriatal injections were performed using a stereotaxic apparatus

(coordinates 0.01mm caudal to bregma, 0.2mm right/left of midline, 0.345 pocket to

0.325mm ventral to pial surface). Mice were anesthetized with isofluorane, placed in the stereotax and 5μl (~3e12vg/ml) of either vector were dispensed in each hemisphere’s striatum with a Hamilton syringe (Hamilton, Reno, NV). Animals were injected with ~

140

3e12vg/ml of either rAAV2/1mU6miSAFECMVeGFP (n=10), rAAV2/1mU6miPIAS1.3CMVeGFP (n=10), rAAV2/2CMVeGFP (n=10), or rAV2/2CMVPIAS1 (n=10) at a rate of 0.5μl/min and the needle was left in place for 2 min after each injection. Once completed, the incision was sutured.

Behavior and Tissue Collection for Biochemical Processing

Behavioral studies were performed one week following surgeries and analyzed blinded using Rotarod, pole test, grip strength, and Irwin assessment (Supplemental

Experimental Procedures). Mice were sacrificed by Euthasol and transcardial perfusion.

For biochemical assessment, cortex, striatum, and cerebellum was microdissected from flash-frozen half brains and stored at -80C until processing; 40μm sections of post-fixed half brains were processed for immunohistochemistry and imaged via confocal microscopy. All animals were assigned to treatment groups with randomly generated identification codes to keep the researcher blind throughout testing and analysis.

Immunohistochemistry and Quantitation

The following primary antibodies were used: anti-Iba1 (Wako Cat# 27030

RRID:AB_2314667), anti-GFAP (Abcam Cat# ab7260 RRID:AB_305808), anti-HTT

(X.J. Li, Emory University School of Medicine; Georgia; USA Cat# mEM48

RRID:AB_2307353), anti-Synaptophysin (Sigma-Aldrich Cat# S5768

RRID:AB_477523), and anti-b III Tubulin (Covance Research Products Inc Cat# PRB-

435P-100 RRID:AB_10063850). Alexa fluorescent conjugated secondary antibodies were used (Innovative Research Cat# A21103 RRID:AB_1500591, Thermo Fisher

Scientific Cat# A21050 RRID:AB_10562369, Thermo Fisher Scientific Cat# A21070

RRID:AB_10562894, Thermo Fisher Scientific Cat# A21428 RRID:AB_10561552,

141

Thermo Fisher Scientific Cat# A21422 RRID:AB_10561696). Stained tissue was mounted on slides and cover slipped with Fluoromount-G (SouthernBiotech). Images were acquired on a LeicaDM2500 confocal microscope. For each brain, five representative sections were chosen and eGFP localized 10x, 20x, and 63x z-stack images obtained for each treatment using confocal microscopy at comparable sections in each animal. Stacked images were obtained for each section containing viral expression as reported by eGFP expression, followed by automatic analyses using

Imaris Bitplane 5.0.

Western Blot Analysis

Whole mouse striatum tissue was processed for either soluble/insoluble fractionation as previously described (O'Rourke et al., 2013) (Supplemental Experimental Procedures) or with TPER buffer with protease inhibitors (Complete Mini, Roche Applied Science,

Mannheim) and phosphatase inhibitors (PhosSTOP Phosphatase Inhibitor Cocktail,

Roche Applied Science, Mannheim). Protein concentration was determined by BCA assay (Pierce, Rockford), and 30 m g of protein was reduced, loaded on 3-8% bis- acrylamide gels/4%–12% bis-tris mini gels (Life Technologies) for SDS-PAGE, transferred to nitrocellulose membrane, and nonspecific proteins were blocked with

SuperBlock Blocking Buffer (Thermo Scientific). Primary antibodies used were: Anti-

HTT (Millipore Cat# MAB5492 RRID:AB_347723); Anti-HTT (VIVA Bioscience Cat#

VB3130, RRID:AB_2566818); Living Colors Full-Length Antibody (Clontech

Laboratories, Inc. Cat# 632381 RRID:AB_2313808); anti-mPIAS1 (Thermo Fisher

Scientific Cat# 396600 RRID:AB_10151462); anti-SUMO-1 (Enzo Life Sciences Cat#

BML-PW9460 RRID:AB_10542961), anti-SUMO-2 (MBL International Cat# M114-A48

142

RRID:AB_1953063); anti-Ubiquitin (Santa Cruz Biotechnology Cat# sc-8017

RRID:AB_628423); anti-NF k B p65 (Santa Cruz Biotechnology Cat# sc-8008

RRID:AB_628017), anti-Histone H3 (Millipore Cat# 06-755 RRID:AB_2118461), anti-

GAPDH (IMGENEX Cat# IMG-5019A-1 RRID:AB_316884), and anti-a -tubulin (Sigma-

Aldrich Cat# T6074 RRID:AB_477582). Blots were developed using Pico/Dura Western

Blotting Detection System (Pierce) and exposed to film for images. Protein quantification was performed using Scion Image analysis software. Band densities were normalized to a -tubulin.

RNA Isolation and Real-Time Quantitative PCR

Brain tissues were homogenized in TRIzol (Invitrogen), and total RNA was isolated using RNEasy Mini kit (QIAGEN). DNase treatment was incorporated into the RNEasy procedure in order to remove residual DNA. RIN values were >9 for each sample

(Agilent Bioanalyzer). Reverse transcription was performed using oligo dT primers and

1μg of total RNA using SuperScript III First-Strand Synthesis System (Invitrogen).

Quantitative PCR was performed as previously described (Vashishtha et al., 2013) and ddCT values were quantitated and analyzed against RPLPO.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 5.04 software. All data are expressed as mean ± SEM, and a value of p<0.05 was considered to be statistically significant. Statistical comparisons of densitometry results were performed by one-way

ANOVA followed by Bonferroni's multiple comparison tests. Student's t tests were used for aggregate size and number comparisons from the EM48 immuno-labeling study.

One-way ANOVA followed by Bonferroni's multiple comparison tests was used to

143

establish significance of the body weight analysis from the R6/2 mouse study.

Significance in the clasping assay was determined by Fisher's exact probability test.

The Rotarod and pole test data were analyzed by one-way ANOVA followed by

Bonferroni's multiple comparisons tests.

Supplemental Experimental Procedures

Production of AAV vectors

To reduce mouse Pias1 mRNA levels, artificial miRNA sequences (miSafe, and miPias1 variants) were generated by polymerase extension of overlapping DNA oligonucleotides

(IDT, Coralville). Polymerase-extended products were purified using Qiaquick PCR purification kit, digested with XhoI-SpeI and cloned into a XhoI-XbaI site on a Pol-III expression cassette containing the mouse U6 promoter, a multiple cloning site and the

Pol-III-terminator (6T’s) (Monteys et al., 2014).

For in vivo studies, the miRNA expression cassettes were moved into an AAV shuttle plasmid containing a eGFP gene under the control of the human cytomegalovirus immediate-early gene enhancer/promoter region (CMV promoter) and upstream of a

SV40 poly (A) signal. These transcriptional units are flanked at each end by AAV serotype 2 145-bp inverted terminal repeat sequences. Recombinant AAV vectors were produced by standard calcium phosphate transfection method in HEK293 cells by using the AdHelper, AAV1 transpackaging and AAV shuttle plasmids (Sandalon et al., 2004).

Vector titers were determined by realtime PCR and were between 3e10 – 2.16e13 vg/ml.

Recombinant virus was purified by precipitation with PEG 8000, followed by iodixanol gradient ultracentrifugation with a final titer of 3e12 genome copies/mL. Three hours

144

before surgery, all viral vector preps were dialyzed against Formulation Buffer 18

(Hyclone) to remove salts (three total hours of dialysis).

Cognitive and Motor Behavioral Timeline & Assessment

Body weights were obtained daily at 6–10 weeks of age at the same time each day. For clasping assessment, mice were suspended by the tail for 30 s daily at 6–10 weeks of age as described previously (Mangiarini et al., 1996). The presence or absence of hindlimb clasping was noted. Rotarod evaluations were performed using an accelerating apparatus (Dual Species Economex Rota-Rod; 0207-003M; Columbus Instruments) at 7 and 9 weeks of age. The latency to fall from the rod was recorded. The three trials were averaged and analyzed for significance. Mice were also examined for performance on a vertical pole (1 cm in diameter, 60 cm high) at 6 and at 8 weeks of age. The mice were tested with a modification of this protocol by placing them facing down on the vertical pole and total time to descend measured. Mice were habituated to the task 1 d before testing. This task was performed four times with a 30 second rest between trials. The total time to descend from the starting point of placement on the pole was measured.

The four trials were averaged and analyzed for significance. To measure forelimb grip strength, a mouse was held by the tail and lowered towards a specially designed pull bar with a force gauge in such a manner as to retain the peak force applied on a digital display grip strength meter. This assay senses the peak amount of force an animal applies in grasping (Ugo Basile, Italy). Mice were gently pulled back until they released their grip from the handle. Each session consisted of five consecutive trials, with the four strongest pulls being averaged and analyzed for significance. The equipment automatically measures the grams of force required to pry the mouse from the handle.

145

During the 14-week survival study, we monitored neurological signs with a modified

Irwin test every 3 days beginning at 6 weeks and scored animals according to a pre- defined scoring criteria.

Soluble/Insoluble Fractionation

Striatal tissue was homogenized in lysis buffer containing 10 mM Tris (pH 7.4), 1%

Triton X-100, 150 mM NaCl, 10% glycerol, and 0.2 mM PMSF. Tissue was lysed on ice for 60 min before centrifugation at 15,000 × g for 20 min at 4°C. Supernatant was collected as the detergent-soluble fraction. The pellet was washed 3× with lysis buffer and centrifuged at 15,000 × g for 5 min each at 4°C. The pellet was resuspended in lysis buffer supplemented with 4% SDS, sonicated 3×, boiled for 30 min, and collected as the detergent-insoluble fraction. Protein concentration was quantitated using Lowry

Protein Assay (Bio-Rad) Soluble/Insoluble fractionation protocol was previously described and optimized for HTT visualization (O'Rourke et al., 2013).

Primers: oIMR1594: 5’-CCCCTCAGGTTCTGCTTTTA-3’, oIMR1596: 5’-

TGGAAGGACTTGAGGGACTC-3’; PIAS1 Forward: 5’-TTAAGGAGGATGGCACTTGG-

3’, PIAS1 Reverse: 5’-AGCTCAAGCATCCATCGACT-3’; RPLPO Forward: 5’-

TGGTCATCCAGCAGGTGTTCGA-3’, RPLPO Reverse: 5’-

ACAGACACTGGCAACATTGCGG-3’.

146

Chapter 3

Figures

147

Figure 3.1. Silencing efficacy of artificial miRNAs targeting mouse Pias1 expression. (A) Quantitative analysis of Pias1 mRNA levels in NIH3T3 cells electroporated with U6/miCtl, U6/miPias1.3 and U6miPias1.8 expression cassettes. Total RNA was collected 36h post-electroporation and Pias1 transcripts were determined by RT- qPCR. All samples were normalized to ß-actin and results are the mean ± SEM relative to cells transfected with miCtl (n= 4 wells) (B) miCtl and miPias1.3 expression cassettes were transfected into mouse NIH3T3 cells, and endogenous Pias1 protein levels were determined 48 h after transfection. miCtl was used as a no silencing control and Beta-Catenin serves as a loading control. miPias1.3 expression resulted in a significant reduction in levels of Pias1 vs miCtl (p<0.05), whereas miPias1.8 expression did not result in a significant reduction in levels of PIAS1 vs miCtl. * P < 0.05; values represent means ± SEM. Statistical comparisons of results were performed by performing a Krustal-Wallis test; n=4/treatment.

148

149

Figure 3.2. PIAS1 levels are modulated in R6/2 mouse model following viral-mediated knockdown or overexpression. (A-B) miPIAS1.3 viral expression is limited to neurons. Confocal images of R6/2 striatum (63x) with miPIAS1.3. (A) Red: immunohistochemical label for b III-Tubulin, a neuronal marker; green: GFP expression of viral vector. (B) Red: immunohistochemical label for Iba1, a microglia marker; blue: GFAP, an astrocyte marker; green: GFP expression of viral vector. Scale bar = 75 m m. (C) Immunoblotting of PIAS1 from 10-week-old R6/2 and NT mouse striatal lysates following viral mediated miSAFE or miPIAS1.3 treatment. Insoluble PIAS1 levels are significantly reduced following miPIAS1.3 treatment in R6/2, but not NT mice compared to eGFP treatment. All data are expressed as western quantitation and relative expression to NT + miSAFE treated mice. Protein expression was validated for protein loading prior to antibody incubation using reversible protein stain and each samples’ corresponding soluble a -tubulin expression. (D) Immunoblotting of PIAS1 from 9-week-old R6/2 and NT mouse striatal lysates following viral mediated eGFP or PIAS1 treatment. Insoluble PIAS1 levels are significantly increased following PIAS1 treatment in R6/2, but not NT mice compared to eGFP treatment. All data are expressed as western quantitation and relative expression to NT + eGFP treated mice. Protein expression was validated for protein loading prior to antibody incubation using reversible protein stain and each samples’ corresponding soluble a-tubulin expression. Densitometry analyses for (C) and (D) revealed increased levels of PIAS1 compared to age- and sex-matched NT littermates. Data represent mean ± SEM. *p<0.05; ** p<0.01; *** p<0.001, **** p<0.0001; One-way ANOVA followed by Bonferroni post-testing testing was applied. n=4/treatment.

150

Figure 3.3. Soluble/Insoluble fractionation represents Cytoplasmic/Nuclear fractions, respectively. Western blot analysis of 9-week old NT and R6/2 mouse striatal lysates separated into detergent-soluble and detergent-insoluble fractions. Cytoplasmic marker, GAPDH, was exclusively detected in the soluble striatal protein fraction in addition to monomeric transgene mHTT (5492) and soluble oligomeric/multimers of mHTT. Nuclear marker, Histone H3, was exclusively detected in the detergent insoluble striatal protein fraction in addition to an insoluble high molecular weight accumulated species of mHTT (5492).

151

Figure 3.4. Insoluble/nuclear PIAS1 levels are elevated in R6/2 HD mouse model. (A) Immunoblotting of PIAS1 showed significantly elevated levels of insoluble PIAS1 in the striatum of 10 week old R6/2 mice compared to NT controls (N=3). (B) Knockdown of PIAS1 resulted in a significant reduction in levels of soluble PIAS1 levels in NT striatum only and not in R6/2 mice at 10 weeks. Data represent mean ± SEM. *p < 0.05; ** p < 0.01; One-way ANOVA followed by Bonferroni post-testing testing was applied. n=3/treatment.

152

Figure 3.5. Control miSAFE expression is equivalent to Vehicle injected R6/2 mice and does not influence HTT levels or alter behavioral outcomes. (A-B) Western blot analysis of 10-week old R6/2 mouse striatal lysates separated into detergent-soluble and detergent-insoluble fractions. (A) No significant differences were observed in insoluble PIAS1 or soluble mHTT transgene for either Vehicle or miSAFE injected mice. Both miSAFE and miPIAS1.3 confirmed eGFP expression driven by viral vector (eGFP). (B) No significant differences were observed in insoluble accumulated mHTT for vehicle and miSAFE injected mice. (C) No significant differences were detected (apart from genotype) in NT and R6/2 mice treated with miSAFE or vehicle on Rotarod (7 week), Pole Test (8 week), and Grip Strength (8 week) behavior tasks. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001 values represent means ± SEM. Statistical significance was determined by one-way ANOVA with Bonferroni post-testing for all behavioral analysis. n=10/group for all behavioral analysis.

153

Figure 3.6. Real-time PCR of PIAS1 and human HTT transgene expression in R6/2 mice. RPLPO (Large Ribosomal Protein) endogenous control was used to normalize gene expression differences in cDNA samples. Significance was determined by one-way ANOVA with Bonferroni post-testing; p<0.05; **, p<0.01. n=4/treatment.

154

Figure 3.7. Effects of PIAS1 modulation on behavior in R6/2 mice. (A) Timeline of the study shows age of mice at treatment and timing of behavioral testing ( n=10 per group) assessed through clasping, Rotarod, pole test, and grip strength. (B-E) PIAS knockdown: 7-week (Rotarod) and 8-week (pole test and grip strength) old mice are shown. R6/2 mice treated with miSAFE performed significantly worse on all tasks compared to NT + miSAFE/miPIAS1.3. R6/2 mice injected with miPIAS1.3 virus demonstrated improvements in clasping over time. Behavioral deficits were significantly improved in HD + miPIAS1.3 compared to HD + miSAFE on Rotarod time, descent time, and forelimb grip strength. (F-I) PIAS overexpression: 7-week (Rotarod), 6-week (pole test), and 8-week (grip strength) old mice are shown. R6/2 mice treated with eGFP performed significantly worse on all tasks compared to NT + eGFP/PIAS1. R6/2 mice injected with +PIAS1 virus demonstrated exacerbated deficits in clasping over time. Behavioral deficits were significantly worsened in R6/2 + PIAS1 compared to R6/2 + eGFP in descending time and forelimb grip strength. No significant treatment effect was detected for eGFP v. PIAS1 overexpression in R6/2 mice for Rotarod latency to fall time. * P<0.05, ** P<0.01, *** P< 0.001, **** P< 0.0001 values represent means ± SEM. Statistical significance was determined by one-way ANOVA with Bonferroni post-testing for all behavioral analysis.

155

Figure 3.8. PIAS1 modulation has no effect on mouse weight. A significant reduction in body weight compared with NT mice was detected from 8 weeks of age in R6/2 mice. Significance was determined by one-way ANOVA with Bonferroni post-testing; *** P < 0.001, **** P < 0.0001. n=10/treatment.

156

Figure 3.9. PIAS1 knockdown rescue on Rotarod task disappears at 9 weeks. No significant differences were detected (apart from genotype) in NT and R6/2 mice treated with miPIAS1.3 when compared to miSAFE on Rotarod (9 week) behavior task. Significance was determined by one-way ANOVA with Bonferroni post-testing; **** P < 0.0001; values represent means ± SEM. n=10/group for all behavioral analysis.

157

Figure 3.10. Effect of PIAS1 modulation on overall survival and physiological assessment of R6/2 mice. (A) Survival of mice after striatal stereotaxic viral injections was determined using 15 R6/2 mice (3 groups, 5 mice each). One group received eGFP control; the remaining two groups were injected with either miPIAS1.3 (KD) or PIAS1 (OXP). PIAS1 knockdown significantly increased longevity of R6/2 mice, whereas PIAS1 overexpression had no significant effect when compared to eGFP injected mice. (B-D) Quick observational screens were performed weekly to rapidly assess spontaneous activity, piloerection, and gait and scored as designated by a multi-component Irwin Assessment Scale. PIAS1 knockdown delayed the onset of (B) abnormal spontaneous activity, (C) piloerection, and (D) gait impairments, relative to miSAFE and PIAS1 overexpression treated R6/2 mice. PIAS1 overexpression mice also exhibited earlier onset of abnormal physiological characteristics such as abnormal piloerection and gait impairments. n=5/treatment.

158

Figure 3.11. PIAS1 modulates insoluble protein accumulation in R6/2 mice. Western blot analysis of mouse striatal lysates separated into detergent-soluble and detergent-insoluble fractions. (A) PIAS knockdown: R6/2 mouse striatum is enriched in insoluble accumulated mHTT and SUMO-1, SUMO-2, and ubiquitin conjugated proteins compared to NT mice at 10 weeks. PIAS1 knockdown in R6/2 mice results in a significant reduction of insoluble (B) HMW accumulated HTT, (C) SUMO-1 and (D) SUMO-2 insoluble conjugated proteins, and a decrease in (E) ubiquitin-modified insoluble conjugated proteins compared to R6/2 miSAFE treated mice. Quantitation of the relative protein expression for mHTT, SUMO- 1, SUMO-2 and Ubiquitin is shown directly below.(F) PIAS1 overexpression in R6/2 mice results in a significant increase of insoluble (G) HMW accumulated mHTT, (H) SUMO-1 and (I) SUMO-2 insoluble conjugated proteins, and an increase in (J) ubiquitin-modified insoluble conjugated proteins compared to eGFP treated R6/2 mice. Quantitation of the relative protein expression for mHTT, SUMO-1, SUMO-2 and Ubiquitin is shown directly below.* P<0.05, ** P<0.01, *** P< 0.001 values represent means ± SEM. Statistical significance for relative insoluble accumulated mHTT expression was determined with a two- tailed Student’s t test. One-way ANOVA followed by Bonferroni post-testing testing was applied for SUMO-1, SUMO-2, and ubiquitin accumulated proteins groups. n=4/treatment.

159

Figure 3.12. PIAS1 knockdown reduces mHTT inclusions in HD mouse striatum. Consecutive coronal brain sections containing striatum were immunostained against mHTT containing aggregates; anti-huntingtin (red) and viral reporter GFP expression (green). (A) Images (20x) show that animals with behavioral rescue associated with PIAS1 knockdown also showed a significant reduction in levels of EM48+ aggregates – red) in the striatum in comparison with miSAFE injected mice (n=3 mice) where virus was expressed (GFP - green) (shown below representative images). (B) R6/2 mice with PIAS1 overexpression showed a significant increase in levels of EM48+ aggregates – red) in the striatum in comparison with eGFP injected R6/2 mice (shown below representative images). ** P<0.01, *** P< 0.001 values represent means ± SEM. Statistical significance for number of EM48+ aggregates was determined with a two-tailed Student’s t test. Bars = 250 m m; n=4/treatment.

160

Figure 3.13. PIAS1 modulation alters levels of synaptophysin in the striatum of R6/2 mice. Confocal laser scanning microscopy images (63x) of immunofluorescence for synaptophysin in striatum of NT and R6/2 mice treated with miSAFE/miPIAS1.3 at 10 weeks of age (A) and NT and R6/2 mice treated with eGFP/PIAS1 at 9 weeks of age (B). Consecutive coronal brain sections containing striatum were stained against synaptophysin. Histograms describe the optical intensity levels of synaptophysin in neurons of the NT and R6/2 mice treated with miSAFE/miPIAS1.3 and NT and R6/2 mice treated with eGFP/PIAS1, respectively. There is a higher density of immunoreactivity in the NT mice relative to the R6/2 samples. Following treatment with miPIAS1.3, synaptophysin levels are significantly increased in both NT and R6/2 mouse striatum (representative images). PIAS1 overexpression significantly reduced synaptophysin levels in the striatum of R6/2 mice compared to eGFP treated mice (shown below representative images). *P<0.05, ** P<0.01, *** P< 0.001, **** P< 0.0001 values represent means ± SEM. One-way ANOVA followed by Bonferroni post-testing testing was applied for all immunofluorescence analysis. Bars = 75 m m; n=4/treatment.

161

Figure 3.14. miPIAS1.3 expression corresponds to altered levels of synaptophysin in the striatum of R6/2 mice. Representative low magnification (5x) confocal laser scanning microscopy images of immunofluorescence for synaptophysin in striatum of R6/2 mice treated with miSAFE/miPIAS1.3 at 10 weeks of age. Consecutive coronal brain sections containing striatum were stained against synaptophysin. Expression of miPIAS1.3 and not miSAFE virus results in increased levels of synaptophysin. Bars = 1000 m m.

162

Figure 3.15. Iba1+ microglia numbers are decreased by PIAS1 reduction in the R6/2 striatum. Consecutive coronal brain sections containing striatum were stained against Iba1, a microglia marker. (A) Images (20x) show that R6/2 mice with behavioral rescue associated with PIAS1 knockdown also showed a significant reduction in levels of microglia (Iba1+ cells; red) in the striatum in comparison with miSAFE injected R6/2 mice (shown below representative images). (B) R6/2 mice with PIAS1 overexpression showed a significant increase in levels of microglia (Iba1+ cells; red) in the striatum in comparison with eGFP injected R6/2 mice (shown below representative images). * P<0.05, ** P<0.01, *** P< 0.001 values represent means ± SEM. Statistical comparisons of results were performed by performing one-way ANOVA analysis followed by Bonferroni’s multiple comparison tests; Bars = 250 µm; n=4/treatment.

163

Figure 3.16. Insoluble NF-kk kk B (p65) levels are restored to NT levels following PIAS1 reduction in the R6/2 striatum. (A-B) Western blot analysis of whole tissue mouse striatal lysates from R6/2 and NT mice. In both knockdown and overexpression studies, R6/2 mice exhibited significantly reduced levels of insoluble p65 compared to NT mice. (A) Striatal injections of miPIAS1.3 resulted in a significant knockdown of PIAS1 levels in both NT and R6/2 mice. PIAS1 knockdown in NT mice resulted in no significant alteration in levels of insoluble p65, whereas PIAS1 knockdown in R6/2 mice resulted in a significant increase. (B) PIAS1 overexpression in NT and R6/2 mice resulted in no significant alteration in levels of insoluble NF-k B p65. All data are expressed as western quantitation and relative expression to NT + miSAFE/eGFP treated mice. Protein expression was validated for protein loading prior to antibody incubation using reversible protein stain and each samples’ corresponding soluble a -tubulin expression. *P<0.05, ** P<0.01, values represent means ± SEM. Statistical comparisons of results were performed by performing one-way ANOVA analysis followed by Bonferroni’s multiple comparison tests; n=4/treatment.

164

Figure 3.17. Soluble inflammatory cytokines are altered in the R6/2 striatum and restored to NT levels following PIAS1 knockdown. (A-H) Temporal profile of pro-inflammatory cytokines in detergent soluble fraction of striatal tissue homogenates. R6/2 mice contained significantly higher levels of IL-6 and KC/GRO, significantly reduced levels of IFN g , and no change in IL1-b compared to NT mice. (A-D) PIAS1 knockdown resulted in significant decreases in (A) IFN g , (B) IL-6, and (C) KC/GRO concentrations (pg/ml) in R6/2 compared to miSAFE treated animals. PIAS1 knockdown significantly increased (D) IL1-b levels in both R6/2 and NT mice relative to miSAFE treated mice. (F) PIAS1 overexpression resulted in no significant alteration in (E) IFN g (F) IL-6 (G) KC/GRO, and (H) IL1-b concentrations (pg/ml) in either R6/2 or NT mice compared to eGFP treated animals. * P<0.05, ** P<0.01, *** P< 0.001 values represent means ± SEM. Statistical comparisons of results were performed by performing one-way ANOVA analysis followed by Bonferroni’s multiple comparison tests; n=4/treatment.

165

Figure 3.18. Temporal profile of pro-inflammatory cytokines in detergent soluble fraction of striatal tissue homogenates. (A) R6/2 mice contained no alteration in levels of IL-4 or IL-10 for either miPIAS1.3 treatment or HD genotype. (B) R6/2 mice contained no alteration in levels of IL-4 or IL-10 for either PIAS1 treatment or HD genotype. Values represent means ± SEM. Statistical significance was determined by one-way ANOVA with Bonferroni post-testing for all behavioral analysis. n=4/treatment.

166

Figure 3.19. Conserved domains of protein inhibitor of activated STAT 1(signal transducer and activator of transcription protein) protein (PIAS1). Most PIAS proteins have five conserved domains or motifs: the SAP domain (scaffold-attachment factor A (SAFA) and SAFB, apoptotic chromatin- condensation inducer in the nucleus (ACINUS) and PIAS domain), which contains a conserved LXXLL amino-acid motif (where X denotes any amino acid); the PINIT amino-acid motif; the RLD (RING-finger- like zinc-binding domain); the SIM (highly acidic domain), which contains a SUMO1 (small ubiquitin-like modifier 1)-interaction motif that is found in all PIAS proteins except PIASy and PIASyE6 -; and the S/T region (serine- and threonine-rich region).

167

Figure 3.20. The PIAS1 SIM domain regulates accumulation of insoluble mHTT and self-turnover. Levels of insoluble HMW accumulated mHTT increased as a result of PIAS1 overexpression with and without SIM mutant in HeLa cells transfected with either 25QP or 97QP HTT exon1 fragments as shown by immunoblotting/western analysis. Overexpression of PIAS1 SIM mutant results in significant increases in PIAS1 levels.

168

CHAPTER 4

SUMO-interaction motifs in huntingtin and a -synuclein modulate

accumulation and aggregation propensity

SUMMARY OF CHAPTER 4

The misfolding and aggregation of disease proteins plays a pivotal role in altering cellular networks. However, this event is not completely exclusive to misfolding and aggregation. Additional cellular factors which may intervene and modulate misfolding events also play a critical role in regulating disease protein stability. Building off of the work established in the previous three chapters of this dissertation, interacting protein complexes and SUMOylation both play a major role altering function, protein homeostasis, and accumulation of mHTT. Therefore, it is plausible that regulatory sequences such as SUMO binding domains and SIM motifs in HTT and other interacting proteins may work together to regulate HTT SUMOylation and subsequent downstream events. As described in Chapter 3, SIMs are non-covalent SUMO interacting motifs that have recently emerged as having critical regulatory properties

(Gareau and Lima, 2010) and that may enhance SUMOylation of the SIM-containing proteins themselves (Blomster et al., 2010). For example, the ubiquitin ligase RNF4 has multiple SIMs that recognize polySUMO-2 chains and ubiquitinate them for degradation by the proteasome (Geoffroy and Hay, 2009; Tatham et al., 2011). Indeed these SIMs may be important signal transduction inducers downstream of polySUMOylation events

(Sun and Hunter, 2012). SIMs within target proteins can also enhance their SUMO modification and are found within several E3-SUMO ligases, including PIAS1 (Gareau and Lima, 2010). The implications of multiple SIMs in disease proteins and PIAS1

169

(Chapter 3) are not yet clear. In this chapter, I examined several bioinformatic and biochemical approaches to identify and examine the significance of the SIM landscape within the disease proteins HTT and a -synuclein in order to understand the roles these domains play in mediating protein homeostasis networks in disease settings.

INTRODUCTION

SUMO conjugation and binding to target proteins regulate a wide variety of cellular pathways, including those involved in maintaining protein homeostasis.. The functional aspects of SUMOylation include changes in protein-protein interactions, intracellular trafficking as well as protein aggregation and degradation. Additionally, SUMO has been linked to specialized cellular pathways such as neuronal development and synaptic transmission. It is clear from our work (preceding chapters in this dissertation) and others that SUMOylation is associated with neurological diseases associated with abnormal protein accumulations. For example, SUMOylation of the amyloid and tau proteins involved in AD and other tauopathies may contribute to changes in protein solubility and proteolytic processing. Similar events have been reported for α-synuclein aggregates found in PD, polyglutamine disorders such as HD, as well as protein aggregates found in ALS.

Our understanding of SUMO biology and function has been significantly advanced by the recent discovery of proteins and protein domains that contain SUMO-interacting motifs (SIMs), which interact non-covalently with SUMO and SUMO-modified proteins.

Unlike the motifs and domains that mediate ubiquitin binding, the diversity of SIMs seems much more limited. Nevertheless, the identification and characterization of SIMs has already increased ourunderstanding of how SUMO affects DNA repair,

170

transcriptional activation, nuclear body formation, and of relevance to this body of work, protein turnover and homeostasis. SIMs are distinct from SUMO modification sites, that have critical regulatory properties (Gareau and Lima, 2010). SUMOylation mediates protein-protein interactions through binding of conjugated SUMO moieties to SIMs that are defined as four amino acids strings containing three hydrophobic residues (VVXV or

VXVV where V=V/I) (Hunter and Sun, 2008). Structurally, SIMs display an extended β- sheet structure, forming an extra intermolecular β-strand with β-strand 2 of SUMO and inserted in a hydrophobic groove created between β-strand 2 and the α-helix of SUMO

(Kerscher, 2007). SIM consensus regions are highly hydrophobic and thus, likely aggregation-prone. SIMs are also reported to enhance protein SUMOylation (Kerscher,

2007). Hydrophobic amino acid substitution in this motif is open to interpretation and many in the field define V as V/I/L (Hunter and Sun, 2008). For example, interactions between SUMO-modified proteins can impact numerous biological processes by creating new binding surfaces and inducing conformational changes, thus altering the activity, subcellular localization and degradation of target proteins, signaling cascades and transcription, and DNA damage cell responses. The ubiquitin ligase RNF4 has multiple SIMs, one of which recognizes polySUMO-2 chains and ubiquitinates them for degradation by the proteasome (Geoffroy and Hay, 2009; Sun and Hunter, 2012;

Tatham et al., 2008), thus creating a molecular link between the SUMO and ubiquitin/proteasome systems. Further, SIMS may induce signal transduction downstream of polySUMOylation events (Sun and Hunter, 2012). SIMS within target proteins can also enhance the intramolecular SUMO modification at target SUMO modifiable-lysines within the same protein. SIMs are found within several E3-SUMO

171

ligases, including PIAS1 (Gareau and Lima, 2010) and of relevance to HD, we find

Rhes, which can also enhance SUMO-1 modification of HTT, has 1 predicted SUMO modification site and 5 predicted SIMs, one of which is a polySUMO-2 chain SIM.

Notably α-synuclein has 3 predicted SUMO modification sites and 1 high probability SIM

(Figure 4.1B), suggesting potential broad relevance of this network to other neurodegenerative diseases.

As discussed in the discussion of Chapter 2, further analysis of the 586 aa HTT fragment (Tatham et al., 2008) reveals up to 13-17 potential overlapping SIMs within this region depending upon consensus sequence designation (Figure 4.1A). Further, in

Chapter 3, we evaluated a potential role of the polySUMO SIM within the PIAS1 protein and found that mutating this domain increased mHTT accumulation. Interestingly, in a separate study, RNF4, another ligase, also contains several SIMs that are required for recruitment and clearance of nuclear SUMOylated protein aggregates (Kung et al.,

2014). It is plausible that the SUMO-modified proteins and SIM motifs in proteins like

PIAS1 and HTT may work together to regulate the accumulation or misfolding of aggregation-prone proteins including HTT. A common biochemical feature of many sporadic forms of neurodegenerative disease is decreased solubility of specific disease- associated proteins resulting in the enhanced pathological propensity to form aggregates. The identification of specific motifs or sequences such as point mutations, deletions, or trinucleotide extensions in aggregation prone proteins causing hereditary forms of neurodegenerative diseases further supports a critical role for the aggregation process in disease. One question that remains is the contribution of these various forms

172

of misfolded disease proteins and how each state inevitably contributes to aspects of the disease process.

Data from other studies and also presented in the previous Chapters show that a 586 aa N-terminal fragment (Graham et al., 2006), and full length HTT can be SUMO modified downstream of the sites originally identified within the shorter N-terminal fragments (O'Rourke et al., 2013; Steffan et al., 2004; Subramaniam et al., 2009).

Within the first 586 amino acids of HTT, this disease relevant fragment contains 2 high probability SIM motifs which are conserved across vertebrate species (Figure 4.1A).

The implications of the multiple SIMs is unclear, however they may be integral to HTT and other proteins for function and degradation. SUMO modification or interactions of/with HTT could mediate protein interactions with other SIM containing proteins implicated in disease pathogenesis, such as CoREST, HDAC1 and HDAC4, and in turn,

SIMs may promote protein interactions with these and other SUMO modified proteins. It is evident that SUMOylation and ubiquitination pathways integrate to degrade proteins via proteasomal and autophagic degradation pathways and that SUMO modification and recognition of polySUMO modified proteins provide signals for these pathways.

The results in this chapter examine the prevalence and conservation of SIMs in relevant disease proteins, unique structural properties, and potential roles in directing/modulating aggregation/accumulation dynamics. Additionally, these findings provide a rationale for identifying and targeting SIM domains to alter protein accumulation and homeostasis with respect to misfolded pathogenic proteins such as a -synuclein and HTT and further suggest a novel potential role of SIM domains in protein misfolding disorders such as

PD and HD.

173

RESULTS

HTT SIM domain identification, conservation, and structural properties

To identify putative SIMs within HTT, we used in silico prediction of SUMOylation sites and SIMs in proteins using GPS-SUMO prediction software to greatly narrow down the number of candidate sites present in a 586 aa fragment of HTT based on its potential relevance to disease and propensity to aggregate (Zhao et al., 2014)(Fig. 4.1A). There are a total of 17 possible SIMs in the HTT586 fragment based on predictive searches

(GPS-SUMO) and previously identified amino acid sequence. We increased selection thresholds within the software to narrow putative list resulting in putative SIMs within the

586 fragment: SIM1: aa131-135 and SIM2: aa421-425. To eliminate false-positive SIMs, we performed a secondary structure prediction to identify β-strand overlap over putative

SIMs based on local 3-dimentional structure. Both SIMs favored a β-strand confirmation as predicted by PELE, a collection of secondary structure prediction algorithms hosted on Biology Workbench ( http://workench.sdsc.edu ) (Madadkar-Sobhani and Guallar,

2013) (Figure 4.2A). The structures analyzed include the α-helix, β-strand, β-turn, and random coil. Interestingly, of the two SIMs identified, all were evolutionarily conserved down from humans to rodents. Based on the sequence conservation and structure analysis and properties identified, we next used other structural prediction algorithms to determine if SIMs would be predicted to facilitate aggregation propensity.

SIM domain motifs are structurally similar to aggregation domains

As mentioned, SIM domains contain a secondary structure consisting of a beta strand.

These beta strands are stabilized by hydrophobic contacts and backbone hydrogen bonding. Multiple beta strands can form into a sheet, which is stabilized by long-range

174

contacts. That being said, structurally, a sheet is slightly inferior in terms of stability compared to other structures. Further, mutations or misfolding in certain proteins such as HTT could result in exposure of hydrophobic residues. In this case, proteins aggregate to prevent hydrophobic exposure/avoid entropic penalty. Because both ordered and disordered aggregates show a high/higher beta strand/sheet content, we investigated whether SIM domains were located in particular amino acid stretches that were prone to aggregation.

The AGGRESCAN and PASTA algorithms (Conchillo-Sole et al., 2007; de Groot et al.,

2012; Walsh et al., 2014) were used to identify if sequences within HTT that display aggregation-prone regions that might act as specific nucleating centers in self- assembling reactions. The sequence was processed through a software allowing for the Prediction of Amyloid STructural Aggregation (PASTA) domains within proteins with enhanced functionality and sequence based properties. It predicts the most aggregation-prone portions and the corresponding β-strand inter-molecular pairing for multiple input sequences. In addition, it predicts intrinsic protein disorder and secondary structure efficiently allowing analyses of complementary sequence properties within aggregation prone regions of the HTT protein. A secondary software, AGGRESCAN, was used to further confirm any identified aggregation-prone segments in the protein sequence. AGGRESCAN is a web-based software for the prediction of aggregation- prone segments in protein sequences, the analysis of the effect of mutations on protein aggregation propensities and the comparison of the aggregation properties of different proteins or protein sets.

175

When analyzed by both PASTA and AGGRESCAN, HTT yielded X predicted aggregation “hot spots” (Figure 4.3A). Of particular relevance, tertiary properties analyzed by both tools identified a predicted hot spot sequence which encompasses both highly conserved SIM domain producing the highest normalized hot spot area values within the sequence of 5.441 and 2.322, respectively. Based on these assessments and high predicted scores, we next sought to characterize SIM-null forms of HTT-586 in cell culture.

SIM deletion affects insoluble accumulation of mHTT

Based on the bioinformatics assessments, we next sought to evaluate the putative SIMs found within HTT-586 biochemically. To do this, V/I/Ls were mutated to Ala as previously described (Sun and Hunter, 2012) in order to maintain structural sequences properties in both 25Q and 137Q fragments of HTT.

HeLa cells were transfected with HTT-586 (25Q and 137Q) with and without SIM1,

SIM2, SIM1&2 mutations present. 48 hours following transfection, lysates were sequentially extracted with 1% Triton X-100 (soluble) and 4% SDS (insoluble) and subjected to Western blotting with an anti-HTT antibody.

When SIM1 was mutated in HTT-586 (25Q), there was no observable differences in ether soluble or insoluble forms of HTT (Figure 4.4A). However, when SIM2 was mutated, there was an increase in soluble fragmentation of HTT and insoluble accumulation, suggesting that the SIM2 domain somehow facilitates propensity to cleave and accumulate (Figure 4.4A; SOLUBLE and INSOLUBLE). Interestingly, when both SIM1 and 2 were mutated together, the increase in accumulation as seen with

SIM2 mutation was abrogated.

176

We next evaluated HTT expression using a HTT-586 (137Q) fragment to evaluate the role of these two domains in expanded mHTT. Similar to HTT-586 (25Q), SIM1 mutation produced no effect in insoluble mHTT accumulation. However, when SIM2 was mutated, we found an observable increase in mHTT accumulation (Figure 4.4A;

INSOLUBLE). Further, when both SIM1 and 2 were mutated together, there was an observable decrease in insoluble mHTT accumulation even below that of non-mutated fragments. Mutations in either SIM 1, 2, or 1 and 2, produced no changes in soluble

HTT levels when HTT-586 (137Q) was overexpressed (Figure 4.4A).

Because mHTT forms multiple clearance intermediates/forms, we wanted to investigate whether SIM mutation shifted preference from one species to another. Using a filter retardation assay, we analyzed insoluble samples to selectively capture an insoluble fibrillary species of mHTT (Figure 4.4C). As expected, 25Q fragments produced no insoluble fibrils regardless of SIM mutation, whereas 137Q fragments produced insoluble fibrils (Figure 4.4C). Both SIM1 and SIM2 mutations increased insoluble mHTT aggregation relative to non-mutated fragments. Interestingly, though insoluble accumulated levels were decreased (Figure 4.4B) with combinatorial mutations of both motifs, these same mutations increased insoluble fibrillary levels (Figure 4.4C).

These preliminary results suggest that putative SIMs within HTT may serve different functions in maintaining protein structure and self-assembly/accumulation. The above data suggests that SIM2 may act to stabilize the protein, whereas SIM1 may be dispensable when mutated by itself. However, interpretation becomes complicated when both SIMs 1 and 2 are mutated in concert. Because HTT contains multiple SIMs which may or may not act in concert or opposition to one another, further studies will be

177

needed to elucidate their individual contribution to HTT SUMOylation and protein homeostasis. With this is mind, we decided to next evaluate another aggregation-prone disease protein as a prototype for these studies, α-synuclein. aa aa -synuclein: A prototype for SIM assessment

α-synuclein is a prototypic aggregation-prone protein that can be recombinantly expressed at high levels and that plays a pivotal role in the pathogenesis of a class of neurodegenerative diseases collectively called synucleinopathies . α-synuclein is a natively unfolded neuronal protein that is enriched in presynaptic terminals (Iwai, 2000) and to date, has no known defined function. However, a central role in the pathology of

Parkinson’s disease, as well as Lewy body disease, has been attributed to α-synuclein aggregation and accumulation (Stefanis, 2012; Vekrellis and Stefanis, 2012). Specific missense mutations and increased gene dosage of α-synuclein have been shown to cause autosomal-dominant PD (Kruger et al., 1998; Polymeropoulos et al., 1997;

Singleton et al., 2003; Zarranz et al., 2004). The three familial mutations, namely, A30P,

E46K and A53T cause PD. Hydrophobic regions in α-synuclein acquire β-sheet configuration, and have a propensity to fibrillize and form amyloids that cause cytotoxicity and neurodegeneration (Vilar et al., 2008).

To evaluate the significance of SIMs in disease proteins further, we investigated an

A53T a -synuclein mutant as a simplified prototype for this system with the goal of evaluating the role of SIM domains in protein misfolding and homeostasis in initial proof- of-concept studies. a -synuclein contains 1 high probability SIM based on GPS-SUMO scoring (Figure 4.1B), containing a corresponding b -strand confirmation prediction

(Figure 4.2B). Additionally, this peptide is conserved from humans through lower

178

organisms. Given sequence conservation and prediction score, we selected the SIM domain (aa 37-40) to investigate further.

Following selective and conservation alignment of SIM (aa 37-40) within a -synuclein, the sequence was processed through PASTA to evaluate domains within proteins with enhanced functionality and sequence based properties to predict intrinsic protein disorder and secondary structure. This was followed with secondary software,

AGGRESCAN, to further confirm any identified aggregation-prone segments in the protein sequence.

When analyzed by both PASTA and AGGRESCAN, a -synuclein yielded 6 predicted aggregation “hot spots” (Figure 4.3B). Of particular relevance, tertiary properties analyzed by both tools identified a predicted hot spot sequence which encompasses the highly conserved SIM domain producing the highest normalized hot spot area value within the sequence of 0.380. Based on these assessments and high predicted scores, we generated a SIM-null form a -synuclein to evaluate biochemically.

SIM deletion affects insoluble accumulation of A53T aa aa -synuclein

Based on the computational assessments, the putative SIM found within the a -synuclein was evaluated biochemically in order to determine its pathological relevance. V/I/Ls were mutated to Ala to maintain structural protein properties in both WT and A53T mutant a -synculein.

To establish an assay for accumulation of a -synculein, we analyzed soluble α-synuclein levels and insoluble α-synuclein aggregates in the presence or absence of of proteasome inhibition. COS-1 cells were transfected with α-synuclein (WT and A53T) with and without SIM mutations present and treated with MG-132 for 18 hours to

179

stimulate accumulation/aggregation of proteins. 48 hours following transfection, lysates were sequentially extracted with 1% Triton X-100 (soluble) and 4% SDS (insoluble) and subjected to Western blotting with an anti-α-synuclein antibody. Consistent with previous findings, A53T α-synuclein showed increased levels of insoluble aggregates both with and without proteasomal inhibiton (Ostrerova-Golts et al., 2000). Interestingly, proteasomal inhibition decreased the accumulation of HMW α-synuclein aggregates in the detergent-insoluble fraction possibly suggesting a role of autophagic/lysosomal compensation or flux when UPS is inhibited. When α-synuclein variants were mutated to eliminate the SIM domain, HMW insoluble α-synuclein aggregates were significantly reduced (Figure 4.5). Further, levels of an α-synuclein tetramer, which has been suggested to correspond to an “aggregation resistant” form (Bartels et al., 2011;

Dettmer et al., 2015), was significantly increased when the SIM was mutated compared to control (Figure 4.5).

These preliminary findings suggest that the α-synuclein SIM may function either structurally to promote insoluble aggregation or may form complexes with SUMOylated proteins which ultimately promote HMW α-synuclein in the detergent-insoluble fraction.

Though we identified putative SIMs in both a -synuclein and HTT using computational algorithm screens, we proceeded with a -synuclein as a surrogate for further biochemical analysis to determine the role of these domains in protein misfolding and homeostasis as initial proof-of-concept studies. These findings underscore the potential relationship between SUMO modification, interactions with other cellular proteins through SIMs, and the altered aggregation propensity that occurs in the various protein aggregation-based diseases.

180

DISCUSSION

SIMs have been described as “gate keepers” for aggregation and misfolding of proteins containing these domains and our bioinformatics data suggests that these motifs are fundamental sequence motifs in cellular proteins which have not been evaluated in the context of neurodegeneration. Herein, we describe for the first time the discovery of a novel function for SIMs in relation to aggregation domains within a -synuclein.

Given these preliminary findings in a -synuclein and HTT, it is possible that these SIMs may contribute to disease pathogenesis, given their relationship to the SUMO-2 network and overlapping comparisons with previously identified aggregation domains (Wang and

Lashuel, 2013).

Interestingly, we found that both SIM1 and SIM2 in HTT-586 overlapped with recently described aggregation-prone or amyloideogenic stretches important in protein folding and protein-protein interactions, which can shift to fibrillary structures when conformational stability is compromised (Sabate et al., 2012). Further, separate studies have identified novel aggregation domains within the HTT protein sequence in an amyloidogenic domain (aa105–138). Mutating this domain resulted in decreased aggregation and inclusion formation compared non-mutated peptides. This amyloidogenic domain encompasses a putative high probability SIM. It is possible that these domains are regulatory and modulate protein homeostatic networks, but once fragments such as exon 1 are released by proteolytic cleavage or through aberrant synthesis (Landles et al., 2010), these regulatory domains are either no longer present or no longer exposed for interact with SUMOylated proteins and exon1 and other small fragments may exert dominant effects. It is also possible that these domains may simply

181

act as potential spots for aggregation and when exposed through cleavage, associate with self/other complexes to aggregate. Proteomics and structural imaging studies and collaborations are in process to further elucidate the role of these domains for both a - synuclein and HTT.

Based on the striking effect observed through modulating a -synuclein and HTT insoluble accumulation propensity, the proposed SIMs will likely be functional and may represent a proposed adhesive surface for SUMO interaction; however SIMs could also be integral to SUMO-2 responses or could provide an independent modulation of pathology. It is known that SUMOylated proteins are targeted to protein clearance machinery and processing (Hunter and Sun, 2008; Sarge and Park-Sarge, 2009;

Wilkinson et al., 2010). Proteins such as septins which are required for mammalian phagosome formation are indeed SUMOylated and may require SIMs to form larger structural and functional complexes.

Additionally, because it appears that these domains may exert differential effects when mutated such as the case for HTT, it is possible that there is cross-talk either structurally or between interacting complexes which act in concert or opposition to one another. Further studies will be needed to elucidate their individual contribution to HTT

SUMOylation, interacting partners/complexes, and protein homeostasis.

Taken together, these findings are consistent with increasing evidence indicating that although the expanded polyQ region in HTT and point mutations in a -synuclein play a central role in the pathogenesis of HD and certain forms of PD, respectively, these features are not the sole determinant of protein aggregation and toxicity. Likely, several other domains which may work in concert with other regions within a fragment will

182

influence the protein’s structure, aggregation, subcellular localization, and toxicity. It is unclear whether these domains function simply as structural motifs or whether they facilitate complex formation with other SUMOylated proteins which may regulate protein homeostasis and ultimately levels of aggregated proteins. Future proteomics studies will aim to address these questions in order to investigate complex partners which may be regulated by these domains. Additionally, we will aim to identify the cross-talk between the novel aggregation motifs identified in this work and the polyQ repeat region and elucidate their potential roles in regulating the physiological and pathogenic properties of the full-length protein and disease-associated N-terminal fragments in cell culture and animal models of HD. Specifically, future studies will also examine the role of these domains in full length HTT, which has 11 additional SUMO motifs, 26 potential

SIMs that favor a β-strand confirmation, and 25 that overlap with aggregation-prone regions. Finally, it is possible that binding through SIMs is cooperative (more than one site required for strong interaction), that SIMs are compensatory, or that additional sequence motifs are involved in binding. This will be highly informative for the field in either case. SIMs may regulate pathogenic threshold to readily aggregate and form fibrils either through structural function as aggregation domains or regulation of complex formation involving SUMOylated proteins and/or SUMO moieties themselves. These findings contribute a novel role in defined motifs within disease-causing proteins and aid in determining the role of structure and the role of PTMs in regulating the functions of these proteins in health and disease.

183

These and future planned experiments will provide critical information to separate the role of SIMs independent of other disease modifiers and domains, in order to better understand their contribution to protein structure and flux.

EXPERIMENTAL PROCEDURES

Bioinformatics analysis

All of the putative SUMOylation sites and SUMO-interaction motifs (SIMs) of the proteins were identified with SUMOsp 2.0 (The CUCKOO Workgroup, USTC). The identified proteins were divided into functional groups based on a literature search.

Confirmation of SIM secondary structure was performed using the program PELE on

BIOLOGY WORKBENCH using eight different programs and aligning their results

(Biology Workbench - http://workench.sdsc.edu ). The aggregation domains of the a- synuclein and HTT peptides were experimentally determined using PASTA 2.0

(prediction of amyloid structure aggregation) as previously described (Walsh et al.,

2014). As a secondary measure, the amyloidogenic propensities of peptides were also predicted with the program Aggrescan as described (Conchillo-Sole et al., 2007).

Chemical and antibodies

MG-132 was purchased from EMD Chemicals (Gibbstown, NJ, USA). The mouse monoclonal anti-α-synuclein (Syn-1) antibody was purchased from BD Biosciences (San

Jose, CA, USA). Anti-HTT (VB3130 – Viva Bioscience) and anti-Myc 9E10 (Millipore) were used.

Plasmid constructs

184

The mammalian plasmid vector expressing human α-synuclein (WT and A53T) was obtained from and previously described in (Kim et al., 2011). HTT constructs containing

586aa unexpanded (25Q-586aa) and expanded (137-586aa) are described (Apostol et al., 2003). Site directed mutagenesis was used to mutate SIM motif to Ala string of amino acids in all above constructs.

Cell culture and DNA transfection

COS-1 and HeLa cells cells were maintained in DMEM supplemented with 10% FBS.

Cells were transfected using Lipofectamine 2000 (Life Technologies), according to the supplier’s instructions. Cells were plated on 10 cm plates and cultured in DMEM plus

10% FBS. For cDNA, cells were plated on Day 1 and transiently transfected with 6 µg of total DNA and 8 µl Lipofectamine 2000 (Invitrogen) on Day 2, media was changed on

Day 3, and cells were collected on Day 4. Cells were transfected at ~70% confluency for DNA.

Insoluble/Soluble Fractionation

The presence and accumulation of insoluble, HMW HTT species will be evaluated as previously described (O'Rourke et al., 2013). Cell and tissue were collected in lysis buffer containing 10 mM Tris (pH 7.4), 1% Triton X-100, 150 mM NaCl, 10% glycerol, and 0.2 mM PMSF (Roche Complete Protease Mini and PhosphoStop pellets). Cells collected were lysed on ice for 60 min before centrifugation at 15,000 × g for 20 min at

4ºC. Supernatant was collected as the detergent-soluble fraction. The pellet was washed 3× with lysis buffer and centrifuged at 15,000 × g for 5 min each at 4ºC. The pellet was resuspended in lysis buffer supplemented with 4% SDS, sonicated 3×, boiled

185

for 30 min, and collected as the detergent-insoluble fraction. Protein concentration was quantitated using Lowry Protein Assay (Bio-Rad).

Filter retardation assay

Wanker et al., 1999)).

186

Chapter 4

Figures

187

Figure 4.1. GPS-SUMO prediction evaluation of Huntingtin (586aa) and aa aa -synculein. (A) The performance evaluation for the prediction of SUMO interaction motifs for caspase 6 cleaved HTT 586 fragment. (B) The performance evaluation for the prediction of SUMO interaction motifs for a -synuclein comparison.

188

Figure 4.2. Secondary structure prediction from PELE via Biology WorkBench. Predictions show beta strand overlap for (A) HTT-586 fragment and (B) a -synuclein. Legend: H = alpha helix, E = beta sheet, T = beta turn, C = random coil.

189

Figure 4.3. Aggregation ‘hot spot’ prediction using AGGRESCAN prediction software. Predictions show aggregation hot spot overlap for SIMs in (A) HTT-586 fragment and (B) a -synuclein.

190

Figure 4.4. SIM mutations in 25Q and 137Q, 586 aa fragment of HTT alters cleavage and insoluble accumulation. (A-B) Western analysis of whole-cell lysates from HeLa cells transfected with 25Q or 137Q, 586-HTT (with and without SIM mutations: 1, 2, or 1/2) and myc-Actin as a transfection control. Lysates were separated using differential centrifugation into a detergent-soluble fraction (SOLUBLE) with 1% Triton X-100 and a detergent-insoluble fraction (INSOLUBLE) with 4% SDS. (A) Western blot probed with anti-HTT shows that SIM2 mutation increases cleavage of SOLUBLE fragments and INSOLUBLE accumulation of 25Q HTT-586. Mutation of both SIMs 1 and 2, restored levels to non-mutated expression. (B) Western blot probed with anti-HTT shows that SIM2 mutation increases INSOLUBLE accumulation of 137Q HTT-586. Mutation of both SIMs 1 and 2, restored levels to non-mutated expression. Note that all experiments were performed in triplicate and loading was standardized to transfected myc-Actin; representative figures are shown. (C) Mutant HTT (137Q-586) fibrils are detected with anti-HTT in the insoluble fraction using filter retardation assay. Various combinations of SIM domain mutations alters insoluble fibril aggregation in 137Q-586 HTT fragment expression.

191

Figure 4.5. SIM mutation in A53T aa aa -synuclein abrogates insoluble accumulation and confirmation state. Western analysis of whole-cell lysates from Cos-1 cells transfected with a -synuclein or a -synuclein A53T (with and without SIM mutation) and treated with 5 μM MG132 for 18 hr. Lysates were separated using differential centrifugation into a detergent-soluble fraction (SOLUBLE) with 1% Triton X-100 and a detergent-insoluble fraction (INSOLUBLE) with 4% SDS. Western blot probed with anti-a -synuclein shows a HMW accumulated alpha-synuclein species, tetramer, dimer, and monomer in the SOLUBLE fraction. MG132 cause a -synuclein A53T to accumulate as HMW species. a -synuclein A53T SIM mutants resulted in elimination of accumulated HMW species. Note that all experiments were performed in triplicate; representative figures are shown.

192

DISSERTATION CONCLUDING REMARKS

Collectively, the body of work presented in this dissertation provides key insights into the interplay between protein homeostasis networks, protein aggregation, and inflammation in HD. Specifically, we investigated how the HTT protein’s function as well as functional domains such as SIMs may contribute to pathogenesis; additionally, how altering the levels of a single SUMO modification enhancer, PIAS1, alters disease course and pathways in an in vivo model of the disease. My findings support the idea that altering cellular homeostasis as assayed through altered inflammatory state and mHTT flux may be a valid screening process to not only assess the role that PIAS1 plays in the disease, but also to better understand how changes in cellular environment dynamics may contribute to altered mechanisms within the cell. This body of work contributes significantly to the field because, to date, few studies have investigated ways to modulate both protein accumulation and neuroinflammatory pathways in HD.

This data suggests that PIAS1 may link protein homeostasis and neuroinflammation in

HD.

Because many of these networks may be opportunistic from a therapeutic standpoint, I am in the process of investigating more longitudinal approaches in assessing the effects of PIAS1 modulation and mHTT accumulation/aggregation dynamics in various mouse models of the disease. The cellular environment plays a significant role in determining whether disease proteins are converted into toxic or benign forms. Further, there is little evidence or correlation between specific protein aggregation states and proteotoxicity in

HD. Given studies that aim to reduce mHTT levels or aggregation as a therapeutic approach (Liang et al., 2011; Margulis and Finkbeiner, 2014), a better understanding of

193

each form’s contribution to disease state would greatly improve therapeutic target assessments in addition to the basic biological mechanism of protein homeostasis. HTT itself may provide a scaffold for degradation of HTT and other cellular proteins (Ochaba et al., 2014; Rui et al., 2015; Steffan, 2010). However, upon repeat expansion, clearance is likely impaired and the proteins aggregate inappropriately. Current studies are in progress to understand the longitudinal flux of mHTT clearance intermediates and the overall cellular environment in the R6/2 mouse model.

There is growing awareness that the SUMO network is important in a variety of cellular processes such as protein homeostasis, clearance, chromatin remodeling, cellular stress responses, neurotransmitter release, and inflammation linked to neurodegeneration. Its critical role in regulating clearance of mHTT makes SUMO and selective regulatory E3 ligases such as PIAS1 enticing targets for developing therapeutics to treat HD. The research is highly significant to the field as it addresses a fundamental biological property in a context not previously studied.

Based on findings presented here using a rapidly progressing mouse model, R6/2,

PIAS1 knockdown would be predicted to be neuroprotective and potentially effective when treatment is initiated symptomatically or early in disease. However, this likely depends on model and/or disease stage. Pathogenesis in R6/2 mice represents aspects of manifest HD, showing demonstrable protein accumulation, nuclear HTT localization, neuroinflammation, and dysregulated transcriptional signatures similar to striatal tissues from both symptomatic full length knock-in mouse models of disease and to human HD brain (Chang et al., 2015; Ciamei et al., 2015; Simmons et al., 2007). Moving forward, we have begun to evaluate the effects of PIAS1 modulation in a zQ175 full-length model

194

of HD at various stages of the disease (Peng et al., 2016) in addition to human patient- derived induced pluripotent stem cell neuronal subtypes in order to fully understand the contribution of PIAS1 to disease and its potential as a clinical target. Further, our findings elucidate effects on neuronal dysfunction versus neurodegenerative aspects of disease, given the limited neuronal loss that is observed in mouse models of HD relative to human HD.

Finally, the structural analysis of SIM domains in disease-associated proteins may provide insights into the possible molecular basis underlying the differences in aggregation, toxicity and neurologic phenotypes observed for the expanded N-terminal fragments spanning exons1–3 of HTT in HD model systems. Given the number of SIMs present in the full length protein and the flux of free-SUMO pools and accumulation of

SUMOylated proteins, it is possible that these domains may influence the clearance/accumulation of misfolded mHTT and other aggregation prone proteins like a - synuclein. Interacting partners have been shown to modulate the confirmation and localization of disease proteins and thereby influence proteotoxicity. SIMs may act as platforms or domains which regulate accumulation, complex formation, and subsequently protein homeostasis. Further studies are required to investigate potential cross-talk between SIMs and their interaction with SUMOylated proteins in order to elucidate their potential roles in regulating the physiological and pathogenic properties of the disease proteins and cellular homeostasis. We propose that these domains may regulate interactions with SUMO and SUMO-modified proteins which normally promote degradation by the proteasome and lysosome. Additionally, SIMs may act to facilitate aggregation propensity within given proteins as well.

195

Together, the fundamental properties identified here may also broadly impact other neurodegeneration diseases, suggesting that regulating E3 SUMO ligases may be one key to tipping the balance between normal protein homeostasis and disease processes that cause neurodegeneration.

196

REFERENCES (1993). A novel gene containing a trinucleotide repeat that is expanded and unstable on

Huntington's disease chromosomes. The Huntington's Disease Collaborative Research

Group. Cell 72 , 971-983.

Aiken, C.T., Steffan, J.S., Guerrero, C.M., Khashwji, H., Lukacsovich, T., Simmons, D.,

Purcell, J.M., Menhaji, K., Zhu, Y.Z., Green, K. , et al. (2009). Phosphorylation of threonine 3: implications for Huntingtin aggregation and neurotoxicity. The Journal of biological chemistry 284 , 29427-29436.

Aoki, Y., Kanki, T., Hirota, Y., Kurihara, Y., Saigusa, T., Uchiumi, T., and Kang, D.

(2011). Phosphorylation of Serine 114 on Atg32 mediates mitophagy. Molecular biology of the cell 22 , 3206-3217.

Apostol, B.L., Kazantsev, A., Raffioni, S., Illes, K., Pallos, J., Bodai, L., Slepko, N., Bear,

J.E., Gertler, F.B., Hersch, S. , et al. (2003). A cell-based assay for aggregation inhibitors as therapeutics of polyglutamine-repeat disease and validation in Drosophila.

Proc Natl Acad Sci U S A 100 , 5950-5955.

Arrasate, M., and Finkbeiner, S. (2012). Protein aggregates in Huntington's disease.

Exp Neurol 238 , 1-11.

Arrasate, M., Mitra, S., Schweitzer, E.S., Segal, M.R., and Finkbeiner, S. (2004).

Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death. Nature 431 , 805-810.

Arroyo, D.S., Gaviglio, E.A., Peralta Ramos, J.M., Bussi, C., Rodriguez-Galan, M.C., and Iribarren, P. (2014). Autophagy in inflammation, infection, neurodegeneration and cancer. Int Immunopharmacol 18 , 55-65.

197

Aschauer, D.F., Kreuz, S., and Rumpel, S. (2013). Analysis of transduction efficiency, tropism and axonal transport of AAV serotypes 1, 2, 5, 6, 8 and 9 in the mouse brain.

PloS one 8, e76310.

Atwal, R.S., and Truant, R. (2008). A stress sensitive ER membrane-association domain in Huntingtin protein defines a potential role for Huntingtin in the regulation of autophagy. Autophagy 4, 91-93.

Azuma, Y., Arnaoutov, A., Anan, T., and Dasso, M. (2005). PIASy mediates SUMO-2 conjugation of Topoisomerase-II on mitotic chromosomes. The EMBO journal 24 , 2172-

2182.

Balch, W.E., Morimoto, R.I., Dillin, A., and Kelly, J.W. (2008). Adapting proteostasis for disease intervention. Science 319 , 916-919.

Barmada, S.J., Skibinski, G., Korb, E., Rao, E.J., Wu, J.Y., and Finkbeiner, S. (2010).

Cytoplasmic mislocalization of TDP-43 is toxic to neurons and enhanced by a mutation associated with familial amyotrophic lateral sclerosis. The Journal of neuroscience : the official journal of the Society for Neuroscience 30 , 639-649.

Bartels, T., Choi, J.G., and Selkoe, D.J. (2011). alpha-Synuclein occurs physiologically as a helically folded tetramer that resists aggregation. Nature 477 , 107-110.

Bates, G.P. (2005). History of genetic disease: the molecular genetics of Huntington disease - a history. Nature reviews Genetics 6, 766-773.

Bennett, E.J., Shaler, T.A., Woodman, B., Ryu, K.Y., Zaitseva, T.S., Becker, C.H.,

Bates, G.P., Schulman, H., and Kopito, R.R. (2007). Global changes to the ubiquitin system in Huntington's disease. Nature 448 , 704-708.

198

Bernier-Villamor, V., Sampson, D.A., Matunis, M.J., and Lima, C.D. (2002). Structural basis for E2-mediated SUMO conjugation revealed by a complex between ubiquitin- conjugating enzyme Ubc9 and RanGAP1. Cell 108 , 345-356.

Bett, J.S., Benn, C.L., Ryu, K.Y., Kopito, R.R., and Bates, G.P. (2009). The polyubiquitin

Ubc gene modulates histone H2A monoubiquitylation in the R6/2 mouse model of

Huntington's disease. J Cell Mol Med 13 , 2645-2657.

Bhat, K.P., Yan, S., Wang, C.E., Li, S., and Li, X.J. (2014). Differential ubiquitination and degradation of huntingtin fragments modulated by ubiquitin-protein ligase E3A.

Proc Natl Acad Sci U S A 111 , 5706-5711.

Bjorkqvist, M., Wild, E.J., and Tabrizi, S.J. (2009). Harnessing immune alterations in neurodegenerative diseases. Neuron 64 , 21-24.

Bjorkqvist, M., Wild, E.J., Thiele, J., Silvestroni, A., Andre, R., Lahiri, N., Raibon, E.,

Lee, R.V., Benn, C.L., Soulet, D. , et al. (2008). A novel pathogenic pathway of immune activation detectable before clinical onset in Huntington's disease. The Journal of experimental medicine 205 , 1869-1877.

Blomster, H.A., Imanishi, S.Y., Siimes, J., Kastu, J., Morrice, N.A., Eriksson, J.E., and

Sistonen, L. (2010). In vivo identification of sumoylation sites by a signature tag and cysteine-targeted affinity purification. J Biol Chem 285 , 19324-19329.

Bohren, K.M., Nadkarni, V., Song, J.H., Gabbay, K.H., and Owerbach, D. (2004). A

M55V polymorphism in a novel SUMO gene (SUMO-4) differentially activates heat shock transcription factors and is associated with susceptibility to type I diabetes mellitus. The Journal of biological chemistry 279 , 27233-27238.

199

Boya, P., Reggiori, F., and Codogno, P. (2013). Emerging regulation and functions of autophagy. Nature cell biology 15 , 713-720.

Bradford, J., Shin, J.Y., Roberts, M., Wang, C.E., Sheng, G., Li, S., and Li, X.J. (2010).

Mutant huntingtin in glial cells exacerbates neurological symptoms of Huntington disease mice. The Journal of biological chemistry 285 , 10653-10661.

Browne, S.E., and Beal, M.F. (2006). Oxidative damage in Huntington's disease pathogenesis. Antioxidants & redox signaling 8, 2061-2073.

Bruderer, R., Tatham, M.H., Plechanovova, A., Matic, I., Garg, A.K., and Hay, R.T.

(2011). Purification and identification of endogenous polySUMO conjugates. EMBO reports 12 , 142-148.

Buchan, J.R., Kolaitis, R.M., Taylor, J.P., and Parker, R. (2013). Eukaryotic Stress

Granules Are Cleared by Autophagy and Cdc48/VCP Function. Cell 153 , 1461-1474.

Camandola, S., and Mattson, M.P. (2007). NF-kappa B as a therapeutic target in neurodegenerative diseases. Expert Opin Ther Targets 11 , 123-132.

Caron, N.S., Desmond, C.R., Xia, J., and Truant, R. (2013). Polyglutamine domain flexibility mediates the proximity between flanking sequences in huntingtin. Proc Natl

Acad Sci U S A 110 , 14610-14615.

Carter, R.J., Lione, L.A., Humby, T., Mangiarini, L., Mahal, A., Bates, G.P., Dunnett,

S.B., and Morton, A.J. (1999). Characterization of progressive motor deficits in mice transgenic for the human Huntington's disease mutation. The Journal of neuroscience : the official journal of the Society for Neuroscience 19 , 3248-3257.

Cepeda, C., Hurst, R.S., Calvert, C.R., Hernandez-Echeagaray, E., Nguyen, O.K.,

Jocoy, E., Christian, L.J., Ariano, M.A., and Levine, M.S. (2003). Transient and

200

progressive electrophysiological alterations in the corticostriatal pathway in a mouse model of Huntington's disease. The Journal of neuroscience : the official journal of the

Society for Neuroscience 23 , 961-969.

Cha, J.H., Kosinski, C.M., Kerner, J.A., Alsdorf, S.A., Mangiarini, L., Davies, S.W.,

Penney, J.B., Bates, G.P., and Young, A.B. (1998). Altered brain neurotransmitter receptors in transgenic mice expressing a portion of an abnormal human huntington disease gene. Proc Natl Acad Sci U S A 95 , 6480-6485.

Chan, H.Y., Warrick, J.M., Andriola, I., Merry, D., and Bonini, N.M. (2002). Genetic modulation of polyglutamine toxicity by protein conjugation pathways in Drosophila.

Hum Mol Genet 11 , 2895-2904.

Chang, K.H., Wu, Y.R., Chen, Y.C., and Chen, C.M. (2015). Plasma inflammatory biomarkers for Huntington's disease patients and mouse model. Brain Behav Immun 44 ,

121-127.

Choleris, E., Thomas, A.W., Kavaliers, M., and Prato, F.S. (2001). A detailed ethological analysis of the mouse open field test: effects of diazepam, chlordiazepoxide and an extremely low frequency pulsed magnetic field. Neuroscience and biobehavioral reviews

25 , 235-260.

Chort, A., Alves, S., Marinello, M., Dufresnois, B., Dornbierer, J.G., Tesson, C.,

Latouche, M., Baker, D.P., Barkats, M., El Hachimi, K.H. , et al. (2013). Interferon beta induces clearance of mutant ataxin 7 and improves locomotion in SCA7 knock-in mice.

Brain : a journal of neurology 136 , 1732-1745.

Chua, J.P., Reddy, S.L., Yu, Z., Giorgetti, E., Montie, H.L., Mukherjee, S., Higgins, J.,

McEachin, R.C., Robins, D.M., Merry, D.E. , et al. (2015). Disrupting SUMOylation

201

enhances transcriptional function and ameliorates polyglutamine androgen receptor- mediated disease. The Journal of clinical investigation 125 , 831-845.

Ciamei, A., Detloff, P.J., and Morton, A.J. (2015). Progression of behavioural despair in

R6/2 and Hdh knock-in mouse models recapitulates depression in Huntington's disease.

Behav Brain Res 291 , 140-146.

Cisbani, G., and Cicchetti, F. (2012). An in vitro perspective on the molecular mechanisms underlying mutant huntingtin protein toxicity. Cell Death Dis 3, e382.

Colon-Ramos, D.A., and Shen, K. (2008). Cellular conductors: glial cells as guideposts during neural circuit development. PLoS biology 6, e112.

Conchillo-Sole, O., de Groot, N.S., Aviles, F.X., Vendrell, J., Daura, X., and Ventura, S.

(2007). AGGRESCAN: a server for the prediction and evaluation of "hot spots" of aggregation in polypeptides. BMC Bioinformatics 8, 65.

Cortes, C.J., and La Spada, A.R. (2014). The many faces of autophagy dysfunction in

Huntington's disease: from mechanism to therapy. Drug discovery today 19 , 963-971.

Coyle, J.T., and Schwarcz, R. (1976). Lesion of striatal neurones with kainic acid provides a model for Huntington's chorea. Nature 263 , 244-246.

Craig, T.J., and Henley, J.M. (2015). Fighting polyglutamine disease by wrestling with

SUMO. The Journal of clinical investigation 125 , 498-500.

Crotti, A., Benner, C., Kerman, B.E., Gosselin, D., Lagier-Tourenne, C., Zuccato, C.,

Cattaneo, E., Gage, F.H., Cleveland, D.W., and Glass, C.K. (2014). Mutant Huntingtin promotes autonomous microglia activation via myeloid lineage-determining factors.

Nature neuroscience 17 , 513-521.

202

Cubenas-Potts, C., and Matunis, M.J. (2013). SUMO: a multifaceted modifier of chromatin structure and function. Developmental cell 24 , 1-12.

Datwyler, A.L., Lattig-Tunnemann, G., Yang, W., Paschen, W., Lee, S.L., Dirnagl, U.,

Endres, M., and Harms, C. (2011). SUMO2/3 conjugation is an endogenous neuroprotective mechanism. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 31 , 2152-

2159. de Groot, N.S., Castillo, V., Grana-Montes, R., and Ventura, S. (2012). AGGRESCAN: method, application, and perspectives for drug design. Methods Mol Biol 819 , 199-220.

Desmond, C.R., Maiuri, T., and Truant, R. (2013). A multifunctional, multi-pathway intracellular localization signal in Huntingtin. Communicative & integrative biology 6, e23318.

Dettmer, U., Newman, A.J., Soldner, F., Luth, E.S., Kim, N.C., von Saucken, V.E.,

Sanderson, J.B., Jaenisch, R., Bartels, T., and Selkoe, D. (2015). Parkinson-causing alpha-synuclein missense mutations shift native tetramers to monomers as a mechanism for disease initiation. Nature communications 6, 7314.

DiFiglia, M. (1997). Clinical Genetics, II. Huntington's disease: from the gene to pathophysiology. Am J Psychiatry 154 , 1046.

Dotiwala, F., Eapen, V.V., Harrison, J.C., Arbel-Eden, A., Ranade, V., Yoshida, S., and

Haber, J.E. (2013). DNA damage checkpoint triggers autophagy to regulate the initiation of anaphase. Proc Natl Acad Sci U S A 110 , E41-49.

203

Dragatsis, I., Levine, M.S., and Zeitlin, S. (2000). Inactivation of Hdh in the brain and testis results in progressive neurodegeneration and sterility in mice. Nature genetics 26 ,

300-306.

Duyao, M.P., Auerbach, A.B., Ryan, A., Persichetti, F., Barnes, G.T., McNeil, S.M., Ge,

P., Vonsattel, J.P., Gusella, J.F., Joyner, A.L. , et al. (1995). Inactivation of the mouse

Huntington's disease gene homolog Hdh. Science 269 , 407-410.

Ehrnhoefer, D.E., Sutton, L., and Hayden, M.R. (2011). Small changes, big impact: posttranslational modifications and function of huntingtin in Huntington disease. The

Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry 17 ,

475-492.

Ellrichmann, G., Reick, C., Saft, C., and Linker, R.A. (2013). The role of the immune system in Huntington's disease. Clin Dev Immunol 2013 , 541259.

Erdjument-Bromage, H., Lui, M., Lacomis, L., Grewal, A., Annan, R.S., McNulty, D.E.,

Carr, S.A., and Tempst, P. (1998). Examination of micro-tip reversed-phase liquid chromatographic extraction of peptide pools for mass spectrometric analysis. J

Chromatogr A 826 , 167-181.

Eyo, U.B., and Wu, L.J. (2013). Bidirectional microglia-neuron communication in the healthy brain. Neural plasticity 2013 , 456857.

Farre, J.C., Burkenroad, A., Burnett, S.F., and Subramani, S. (2013). Phosphorylation of mitophagy and pexophagy receptors coordinates their interaction with Atg8 and Atg11.

EMBO reports 14 , 441-449.

Frid, P., Anisimov, S.V., and Popovic, N. (2007). Congo red and protein aggregation in neurodegenerative diseases. Brain research reviews 53 , 135-160.

204

Garcia-Ruiz, P.J., Garcia-Caldentey, J., Feliz, C., Del Val, J., Herranz, A., and Martinez-

Castrillo, J.C. (2016). Late onset Huntington's disease with 29 CAG repeat expansion. J

Neurol Sci 363 , 114-115.

Gareau, J.R., and Lima, C.D. (2010). The SUMO pathway: emerging mechanisms that shape specificity, conjugation and recognition. Nat Rev Mol Cell Biol 11 , 861-871.

Gauthier, L.R., Charrin, B.C., Borrell-Pages, M., Dompierre, J.P., Rangone, H.,

Cordelieres, F.P., De Mey, J., MacDonald, M.E., Lessmann, V., Humbert, S. , et al.

(2004). Huntingtin controls neurotrophic support and survival of neurons by enhancing

BDNF vesicular transport along microtubules. Cell 118 , 127-138.

Geiss-Friedlander, R., and Melchior, F. (2007). Concepts in sumoylation: a decade on.

Nat Rev Mol Cell Biol 8, 947-956.

Geng, J., Baba, M., Nair, U., and Klionsky, D.J. (2008). Quantitative analysis of autophagy-related protein stoichiometry by fluorescence microscopy. The Journal of cell biology 182 , 129-140.

Geoffroy, M.C., and Hay, R.T. (2009). An additional role for SUMO in ubiquitin-mediated proteolysis. Nat Rev Mol Cell Biol 10 , 564-568.

Gestwicki, J.E., and Garza, D. (2012). Protein quality control in neurodegenerative disease. Prog Mol Biol Transl Sci 107 , 327-353.

Gibbings, D., Mostowy, S., Jay, F., Schwab, Y., Cossart, P., and Voinnet, O. (2012).

Selective autophagy degrades DICER and AGO2 and regulates miRNA activity. Nature cell biology 14 , 1314-1321.

205

Gidalevitz, T., Ben-Zvi, A., Ho, K.H., Brignull, H.R., and Morimoto, R.I. (2006).

Progressive disruption of cellular protein folding in models of polyglutamine diseases.

Science 311 , 1471-1474.

Gil, J.M., and Rego, A.C. (2008). Mechanisms of neurodegeneration in Huntington's disease. Eur J Neurosci 27 , 2803-2820.

Godin, J.D., Colombo, K., Molina-Calavita, M., Keryer, G., Zala, D., Charrin, B.C.,

Dietrich, P., Volvert, M.L., Guillemot, F., Dragatsis, I. , et al. (2010). Huntingtin is required for mitotic spindle orientation and mammalian neurogenesis. Neuron 67 , 392-

406.

Goehler, H., Lalowski, M., Stelzl, U., Waelter, S., Stroedicke, M., Worm, U., Droege, A.,

Lindenberg, K.S., Knoblich, M., Haenig, C. , et al. (2004). A protein interaction network links GIT1, an enhancer of huntingtin aggregation, to Huntington's disease. Mol Cell 15 ,

853-865.

Goto, S., and Hirano, A. (1990). Synaptophysin expression in the striatum in

Huntington's disease. Acta Neuropathol 80 , 88-91.

Graham, R.K., Deng, Y., Slow, E.J., Haigh, B., Bissada, N., Lu, G., Pearson, J.,

Shehadeh, J., Bertram, L., Murphy, Z. , et al. (2006). Cleavage at the caspase-6 site is required for neuronal dysfunction and degeneration due to mutant huntingtin. Cell 125 ,

1179-1191.

Gray, M., Shirasaki, D.I., Cepeda, C., Andre, V.M., Wilburn, B., Lu, X.H., Tao, J.,

Yamazaki, I., Li, S.H., Sun, Y.E. , et al. (2008). Full-length human mutant huntingtin with a stable polyglutamine repeat can elicit progressive and selective neuropathogenesis in

206

BACHD mice. The Journal of neuroscience : the official journal of the Society for

Neuroscience 28 , 6182-6195.

Group, T.H.s.D.C.R. (1993a). A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell 72 , 971-983.

Group, T.H.s.D.C.R. (1993b). A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. . Cell 72 , 971-983.

Gu, X., Greiner, E.R., Mishra, R., Kodali, R., Osmand, A., Finkbeiner, S., Steffan, J.S.,

Thompson, L.M., Wetzel, R., and Yang, X.W. (2009). Serines 13 and 16 are critical determinants of full-length human mutant huntingtin induced disease pathogenesis in

HD mice. Neuron 64 , 828-840.

Gu, X., Li, C., Wei, W., Lo, V., Gong, S., Li, S.H., Iwasato, T., Itohara, S., Li, X.J., Mody,

I. , et al. (2005). Pathological cell-cell interactions elicited by a neuropathogenic form of mutant Huntingtin contribute to cortical pathogenesis in HD mice. Neuron 46 , 433-444.

Guo, H., Callaway, J.B., and Ting, J.P. (2015). Inflammasomes: mechanism of action, role in disease, and therapeutics. Nature medicine 21 , 677-687.

Gusella, J.F., Wexler, N.S., Conneally, P.M., Naylor, S.L., Anderson, M.A., Tanzi, R.E.,

Watkins, P.C., Ottina, K., Wallace, M.R., Sakaguchi, A.Y. , et al. (1983). A polymorphic

DNA marker genetically linked to Huntington's disease. Nature 306 , 234-238.

Gutekunst, C.A., Li, S.H., Yi, H., Mulroy, J.S., Kuemmerle, S., Jones, R., Rye, D.,

Ferrante, R.J., Hersch, S.M., and Li, X.J. (1999). Nuclear and neuropil aggregates in

Huntington's disease: relationship to neuropathology. The Journal of neuroscience : the official journal of the Society for Neuroscience 19 , 2522-2534.

207

Hadano, S., Otomo, A., Kunita, R., Suzuki-Utsunomiya, K., Akatsuka, A., Koike, M.,

Aoki, M., Uchiyama, Y., Itoyama, Y., and Ikeda, J.E. (2010). Loss of ALS2/Alsin exacerbates motor dysfunction in a SOD1-expressing mouse ALS model by disturbing endolysosomal trafficking. PloS one 5, e9805.

Hanna, R.A., Quinsay, M.N., Orogo, A.M., Giang, K., Rikka, S., and Gustafsson, A.B.

(2012). Microtubule-associated protein 1 light chain 3 (LC3) interacts with Bnip3 protein to selectively remove endoplasmic reticulum and mitochondria via autophagy. The

Journal of biological chemistry 287 , 19094-19104.

Hara, T., Nakamura, K., Matsui, M., Yamamoto, A., Nakahara, Y., Suzuki-Migishima, R.,

Yokoyama, M., Mishima, K., Saito, I., Okano, H. , et al. (2006). Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 441 , 885-

889.

Hari, K.L., Cook, K.R., and Karpen, G.H. (2001). The Drosophila Su(var)2-10 locus regulates chromosome structure and function and encodes a member of the PIAS protein family. Genes & development 15 , 1334-1348.

Harper, S.Q., Staber, P.D., He, X., Eliason, S.L., Martins, I.H., Mao, Q., Yang, L., Kotin,

R.M., Paulson, H.L., and Davidson, B.L. (2005). RNA interference improves motor and neuropathological abnormalities in a Huntington's disease mouse model. Proc Natl

Acad Sci U S A 102 , 5820-5825.

Hattula, K., and Peranen, J. (2000). FIP-2, a coiled-coil protein, links Huntingtin to Rab8 and modulates cellular morphogenesis. Curr Biol 10 , 1603-1606.

Hayden, M.S., and Ghosh, S. (2012). NF-kappaB, the first quarter-century: remarkable progress and outstanding questions. Genes & development 26 , 203-234.

208

He, C., and Klionsky, D.J. (2009). Regulation mechanisms and signaling pathways of autophagy. Annual review of genetics 43 , 67-93.

Hecker, C.M., Rabiller, M., Haglund, K., Bayer, P., and Dikic, I. (2006). Specification of

SUMO1- and SUMO2-interacting motifs. The Journal of biological chemistry 281 ,

16117-16127.

Herbst, A., and Tansey, W.P. (2000). HAM: a new epitope-tag for in vivo protein labeling. Mol Biol Rep 27 , 203-208.

Hickey, M.A., Gallant, K., Gross, G.G., Levine, M.S., and Chesselet, M.F. (2005). Early behavioral deficits in R6/2 mice suitable for use in preclinical drug testing. Neurobiology of disease 20 , 1-11.

Hickey, M.A., Kosmalska, A., Enayati, J., Cohen, R., Zeitlin, S., Levine, M.S., and

Chesselet, M.F. (2008). Extensive early motor and non-motor behavioral deficits are followed by striatal neuronal loss in knock-in Huntington's disease mice. Neuroscience

157 , 280-295.

Hinckelmann, M.V., Zala, D., and Saudou, F. (2013). Releasing the brake: restoring fast axonal transport in neurodegenerative disorders. Trends Cell Biol 23 , 634-643.

Hockly, E., Woodman, B., Mahal, A., Lewis, C.M., and Bates, G. (2003).

Standardization and statistical approaches to therapeutic trials in the R6/2 mouse. Brain

Res Bull 61 , 469-479.

Hoppins, S., Collins, S.R., Cassidy-Stone, A., Hummel, E., Devay, R.M., Lackner, L.L.,

Westermann, B., Schuldiner, M., Weissman, J.S., and Nunnari, J. (2011). A mitochondrial-focused genetic interaction map reveals a scaffold-like complex required

209

for inner membrane organization in mitochondria. The Journal of cell biology 195 , 323-

340.

Hsiao, H.Y., Chen, Y.C., Chen, H.M., Tu, P.H., and Chern, Y. (2013). A critical role of astrocyte-mediated nuclear factor-kappaB-dependent inflammation in Huntington's disease. Hum Mol Genet 22 , 1826-1842.

Huang, W., Xu, L., Zhou, X., Gao, C., Yang, M., Chen, G., Zhu, J., Jiang, L., Gan, H.,

Gou, F. , et al. (2013). High glucose induces activation of NF-kappaB inflammatory signaling through IkappaBalpha sumoylation in rat mesangial cells. Biochemical and biophysical research communications 438 , 568-574.

Hunter, T., and Sun, H. (2008). Crosstalk between the SUMO and ubiquitin pathways.

Ernst Schering Found Symp Proc, 1-16.

Irwin, S. (1968). Comprehensive observational assessment: Ia. A systematic, quantitative procedure for assessing the behavioral and physiologic state of the mouse.

Psychopharmacologia 13 , 222-257.

Iwai, A. (2000). Properties of NACP/alpha-synuclein and its role in Alzheimer's disease.

Biochimica et biophysica acta 1502 , 95-109.

Jeong, H.K., Ji, K., Min, K., and Joe, E.H. (2013). Brain inflammation and microglia: facts and misconceptions. Exp Neurobiol 22 , 59-67.

Jia, H., Kast, R.J., Steffan, J.S., and Thomas, E.A. (2012). Selective histone deacetylase (HDAC) inhibition imparts beneficial effects in Huntington's disease mice: implications for the ubiquitin-proteasomal and autophagy systems. Hum Mol Genet.

Jochum, T., Ritz, M.E., Schuster, C., Funderburk, S.F., Jehle, K., Schmitz, K.,

Brinkmann, F., Hirtz, M., Moss, D., and Cato, A.C. (2012). Toxic and non-toxic

210

aggregates from the SBMA and normal forms of androgen receptor have distinct oligomeric structures. Biochimica et biophysica acta 1822 , 1070-1078.

Johnson, E.S. (2004). Protein modification by SUMO. Annu Rev Biochem 73 , 355-382.

Juenemann, K., Schipper-Krom, S., Wiemhoefer, A., Kloss, A., Sanz Sanz, A., and

Reits, E.A. (2013). Expanded polyglutamine-containing N-terminal huntingtin fragments are entirely degraded by mammalian proteasomes. The Journal of biological chemistry

288 , 27068-27084.

Juhasz, G., Erdi, B., Sass, M., and Neufeld, T.P. (2007). Atg7-dependent autophagy promotes neuronal health, stress tolerance, and longevity but is dispensable for metamorphosis in Drosophila. Genes & development 21 , 3061-3066.

Jung, C.H., Jun, C.B., Ro, S.H., Kim, Y.M., Otto, N.M., Cao, J., Kundu, M., and Kim,

D.H. (2009). ULK-Atg13-FIP200 complexes mediate mTOR signaling to the autophagy machinery. Molecular biology of the cell 20 , 1992-2003.

Kalvari, I., Tsompanis, S., Mulakkal, N.C., Osgood, R., Johansen, T., Nezis, I.P., and

Promponas, V.J. (2014). iLIR: A web resource for prediction of Atg8-family interacting proteins. Autophagy 10 .

Kang, S., and Hong, S. (2010). SUMO-1 interacts with mutant ataxin-1 and colocalizes to its aggregates in Purkinje cells of SCA1 transgenic mice. Archives italiennes de biologie 148 , 351-363.

Kassubek, J., Juengling, F.D., Ecker, D., and Landwehrmeyer, G.B. (2005). Thalamic atrophy in Huntington's disease co-varies with cognitive performance: a morphometric

MRI analysis. Cereb Cortex 15 , 846-853.

211

Kerscher, O. (2007). SUMO junction-what's your function? New insights through SUMO- interacting motifs. EMBO reports 8, 550-555.

Keryer, G., Pineda, J.R., Liot, G., Kim, J., Dietrich, P., Benstaali, C., Smith, K.,

Cordelieres, F.P., Spassky, N., Ferrante, R.J. , et al. (2011). Ciliogenesis is regulated by a huntingtin-HAP1-PCM1 pathway and is altered in Huntington disease. The Journal of clinical investigation 121 , 4372-4382.

Khoshnan, A., Ko, J., Watkin, E.E., Paige, L.A., Reinhart, P.H., and Patterson, P.H.

(2004). Activation of the IkappaB kinase complex and nuclear factor-kappaB contributes to mutant huntingtin neurotoxicity. J Neurosci 24 , 7999-8008.

Khoshnan, A., and Patterson, P.H. (2011). The role of IkappaB kinase complex in the neurobiology of Huntington's disease. Neurobiology of disease 43 , 305-311.

Kim, M., Park, H.L., Park, H.W., Ro, S.H., Nam, S.G., Reed, J.M., Guan, J.L., and Lee,

J.H. (2013). Drosophila Fip200 is an essential regulator of autophagy that attenuates both growth and aging. Autophagy 9, 1201-1213.

Kim, S., and Kim, K.T. (2014). Therapeutic Approaches for Inhibition of Protein

Aggregation in Huntington's Disease. Exp Neurobiol 23 , 36-44.

Kim, Y.M., Jang, W.H., Quezado, M.M., Oh, Y., Chung, K.C., Junn, E., and Mouradian,

M.M. (2011). Proteasome inhibition induces alpha-synuclein SUMOylation and aggregate formation. J Neurol Sci 307 , 157-161.

Komatsu, M., Waguri, S., Chiba, T., Murata, S., Iwata, J., Tanida, I., Ueno, T., Koike,

M., Uchiyama, Y., Kominami, E. , et al. (2006). Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature 441 , 880-884.

212

Kotaja, N., Karvonen, U., Janne, O.A., and Palvimo, J.J. (2002). PIAS proteins modulate transcription factors by functioning as SUMO-1 ligases. Molecular and cellular biology 22 , 5222-5234.

Kraft, C., Peter, M., and Hofmann, K. (2010). Selective autophagy: ubiquitin-mediated recognition and beyond. Nature cell biology 12 , 836-841.

Kruger, R., Kuhn, W., Muller, T., Woitalla, D., Graeber, M., Kosel, S., Przuntek, H.,

Epplen, J.T., Schols, L., and Riess, O. (1998). Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson's disease. Nature genetics 18 , 106-108.

Krumova, P., Meulmeester, E., Garrido, M., Tirard, M., Hsiao, H.H., Bossis, G., Urlaub,

H., Zweckstetter, M., Kugler, S., Melchior, F. , et al. (2011). Sumoylation inhibits alpha- synuclein aggregation and toxicity. The Journal of cell biology 194 , 49-60.

Krumova, P., and Weishaupt, J.H. (2012). Sumoylation in neurodegenerative diseases.

Cell Mol Life Sci.

Krumova, P., and Weishaupt, J.H. (2013). Sumoylation in neurodegenerative diseases.

Cellular and molecular life sciences : CMLS 70 , 2123-2138.

Kung, C.C., Naik, M.T., Wang, S.H., Shih, H.M., Chang, C.C., Lin, L.Y., Chen, C.L., Ma,

C., Chang, C.F., and Huang, T.H. (2014). Structural analysis of poly-SUMO chain recognition by the RNF4-SIMs domain. Biochem J 462 , 53-65.

La Spada, A.R., and Taylor, J.P. (2010). Repeat expansion disease: progress and puzzles in disease pathogenesis. Nature reviews Genetics 11 , 247-258.

Labbadia, J., Cunliffe, H., Weiss, A., Katsyuba, E., Sathasivam, K., Seredenina, T.,

Woodman, B., Moussaoui, S., Frentzel, S., Luthi-Carter, R. , et al. (2011). Altered

213

chromatin architecture underlies progressive impairment of the heat shock response in mouse models of Huntington disease. J Clin Invest 121 , 3306-3319.

Lamark, T., and Johansen, T. (2012). Aggrephagy: selective disposal of protein aggregates by macroautophagy. International journal of cell biology 2012 , 736905.

Landles, C., Sathasivam, K., Weiss, A., Woodman, B., Moffitt, H., Finkbeiner, S., Sun,

B., Gafni, J., Ellerby, L.M., Trottier, Y. , et al. (2010). Proteolysis of mutant huntingtin produces an exon 1 fragment that accumulates as an aggregated protein in neuronal nuclei in Huntington disease. The Journal of biological chemistry 285 , 8808-8823.

Laprairie, R.B., Warford, J.R., Hutchings, S., Robertson, G.S., Kelly, M.E., and

Denovan-Wright, E.M. (2014). The cytokine and endocannabinoid systems are co- regulated by NF-kappaB p65/RelA in cell culture and transgenic mouse models of

Huntington's disease and in striatal tissue from Huntington's disease patients. Journal of neuroimmunology 267 , 61-72.

Lee, C., Zhang, H., Baker, A.E., Occhipinti, P., Borsuk, M.E., and Gladfelter, A.S.

(2013a). Protein aggregation behavior regulates cyclin transcript localization and cell- cycle control. Developmental cell 25 , 572-584.

Lee, D.H., and Goldberg, A.L. (1998). Proteasome inhibitors: valuable new tools for cell biologists. Trends Cell Biol 8, 397-403.

Lee, J., Hwang, Y.J., Kim, K.Y., Kowall, N.W., and Ryu, H. (2013b). Epigenetic mechanisms of neurodegeneration in Huntington's disease. Neurotherapeutics 10 , 664-

676.

Lee, J.H., Park, S.M., Kim, O.S., Lee, C.S., Woo, J.H., Park, S.J., Joe, E.H., and Jou, I.

(2009). Differential SUMOylation of LXRalpha and LXRbeta mediates transrepression of

214

STAT1 inflammatory signaling in IFN-gamma-stimulated brain astrocytes. Mol Cell 35 ,

806-817.

Lee, J.H., Tecedor, L., Chen, Y.H., Monteys, A.M., Sowada, M.J., Thompson, L.M., and

Davidson, B.L. (2015). Reinstating aberrant mTORC1 activity in Huntington's disease mice improves disease phenotypes. Neuron 85 , 303-315.

Lee, S.T., and Kim, M. (2006). Aging and neurodegeneration. Molecular mechanisms of neuronal loss in Huntington's disease. Mech Ageing Dev 127 , 432-435.

Lee, Y.J., Johnson, K.R., and Hallenbeck, J.M. (2012). Global Protein Conjugation by

Ubiquitin-Like-Modifiers during Ischemic Stress Is Regulated by MicroRNAs and

Confers Robust Tolerance to Ischemia. PloS one 7, e47787.

Li, F., Chung, T., and Vierstra, R.D. (2014). AUTOPHAGY-RELATED11 plays a critical role in general autophagy- and senescence-induced mitophagy in Arabidopsis. The

Plant cell 26 , 788-807.

Liang, C.C., Wang, C., Peng, X., Gan, B., and Guan, J.L. (2010). Neural-specific deletion of FIP200 leads to cerebellar degeneration caused by increased neuronal death and axon degeneration. The Journal of biological chemistry 285 , 3499-3509.

Liang, Q., Ouyang, X., Schneider, L., and Zhang, J. (2011). Reduction of mutant huntingtin accumulation and toxicity by lysosomal cathepsins D and B in neurons. Mol

Neurodegener 6, 37.

Lin, C.H., Tallaksen-Greene, S., Chien, W.M., Cearley, J.A., Jackson, W.S., Crouse,

A.B., Ren, S., Li, X.J., Albin, R.L., and Detloff, P.J. (2001). Neurological abnormalities in a knock-in mouse model of Huntington's disease. Hum Mol Genet 10 , 137-144.

215

Liu, B., Mink, S., Wong, K.A., Stein, N., Getman, C., Dempsey, P.W., Wu, H., and

Shuai, K. (2004). PIAS1 selectively inhibits interferon-inducible genes and is important in innate immunity. Nat Immunol 5, 891-898.

Liu, B., and Shuai, K. (2008). Targeting the PIAS1 SUMO ligase pathway to control inflammation. Trends in pharmacological sciences 29 , 505-509.

Liu, B., and Shuai, K. (2009). Summon SUMO to wrestle with inflammation. Mol Cell 35 ,

731-732.

Liu, B., Yang, R., Wong, K.A., Getman, C., Stein, N., Teitell, M.A., Cheng, G., Wu, H., and Shuai, K. (2005). Negative regulation of NF-kappaB signaling by PIAS1. Molecular and cellular biology 25 , 1113-1123.

Liu, B., Yang, Y., Chernishof, V., Loo, R.R., Jang, H., Tahk, S., Yang, R., Mink, S.,

Shultz, D., Bellone, C.J. , et al. (2007). Proinflammatory stimuli induce IKKalpha- mediated phosphorylation of PIAS1 to restrict inflammation and immunity. Cell 129 ,

903-914.

Liu, Y., Zhang, Y.D., Guo, L., Huang, H.Y., Zhu, H., Huang, J.X., Liu, Y., Zhou, S.R.,

Dang, Y.J., Li, X. , et al. (2013). Protein inhibitor of activated STAT 1 (PIAS1) is identified as the SUMO E3 ligase of CCAAT/enhancer-binding protein beta (C/EBPbeta) during adipogenesis. Molecular and cellular biology 33 , 4606-4617.

Lois, L.M., and Lima, C.D. (2005). Structures of the SUMO E1 provide mechanistic insights into SUMO activation and E2 recruitment to E1. Embo J 24 , 439-451.

Lu, B., Al-Ramahi, I., Valencia, A., Wang, Q., Berenshteyn, F., Yang, H., Gallego-

Flores, T., Ichcho, S., Lacoste, A., Hild, M. , et al. (2013). Identification of NUB1 as a

216

suppressor of mutant Huntington toxicity via enhanced protein clearance. Nature neuroscience 16 , 562-570.

Lu, T., Aron, L., Zullo, J., Pan, Y., Kim, H., Chen, Y., Yang, T.H., Kim, H.M., Drake, D.,

Liu, X.S. , et al. (2014). REST and stress resistance in ageing and Alzheimer's disease.

Nature 507 , 448-454.

Lumsden, A.L., Henshall, T.L., Dayan, S., Lardelli, M.T., and Richards, R.I. (2007).

Huntingtin-deficient zebrafish exhibit defects in iron utilization and development. Hum

Mol Genet 16 , 1905-1920.

Madadkar-Sobhani, A., and Guallar, V. (2013). PELE web server: atomistic study of biomolecular systems at your fingertips. Nucleic Acids Res 41 , W322-328.

Mancias, J.D., Wang, X., Gygi, S.P., Harper, J.W., and Kimmelman, A.C. (2014).

Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature 509 , 105-109.

Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C.,

Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W., et al. (1996a). Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 87 , 493-506.

Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C.,

Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W., et al. (1996b). Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 87 , 493-506.

217

Mao, K., Wang, K., Liu, X., and Klionsky, D.J. (2013). The scaffold protein atg11 recruits fission machinery to drive selective mitochondria degradation by autophagy.

Developmental cell 26 , 9-18.

Maragakis, N.J., and Rothstein, J.D. (2001). Glutamate transporters in neurologic disease. Archives of neurology 58 , 365-370.

Maragakis, N.J., and Rothstein, J.D. (2004). Glutamate transporters: animal models to neurologic disease. Neurobiology of disease 15 , 461-473.

Marcora, E., and Kennedy, M.B. (2010). The Huntington's disease mutation impairs

Huntingtin's role in the transport of NF-kappaB from the synapse to the nucleus. Hum

Mol Genet 19 , 4373-4384.

Margulis, J., and Finkbeiner, S. (2014). Proteostasis in striatal cells and selective neurodegeneration in Huntington's disease. Front Cell Neurosci 8, 218.

Marsh, J.L., and Thompson, L.M. (2006). Drosophila in the study of neurodegenerative disease. Neuron 52 , 169-178.

Martin, D.D., Ladha, S., Ehrnhoefer, D.E., and Hayden, M.R. (2015). Autophagy in

Huntington disease and huntingtin in autophagy. Trends Neurosci 38 , 26-35.

Martinez-Vicente, M., Talloczy, Z., Wong, E., Tang, G., Koga, H., Kaushik, S., de Vries,

R., Arias, E., Harris, S., Sulzer, D. , et al. (2010). Cargo recognition failure is responsible for inefficient autophagy in Huntington's disease. Nature neuroscience 13 , 567-576.

Maskey, D., Yousefi, S., Schmid, I., Zlobec, I., Perren, A., Friis, R., and Simon, H.U.

(2013). ATG5 is induced by DNA-damaging agents and promotes mitotic catastrophe independent of autophagy. Nature communications 4, 2130.

218

McBride, J.L., Boudreau, R.L., Harper, S.Q., Staber, P.D., Monteys, A.M., Martins, I.,

Gilmore, B.L., Burstein, H., Peluso, R.W., Polisky, B. , et al. (2008). Artificial miRNAs mitigate shRNA-mediated toxicity in the brain: implications for the therapeutic development of RNAi. Proc Natl Acad Sci U S A 105 , 5868-5873.

McMillan, L.E., Brown, J.T., Henley, J.M., and Cimarosti, H. (2011). Profiles of SUMO and ubiquitin conjugation in an Alzheimer's disease model. Neuroscience letters 502 ,

201-208.

Michalik, A., and Van Broeckhoven, C. (2003). Pathogenesis of polyglutamine disorders: aggregation revisited. Hum Mol Genet 12 Spec No 2 , R173-186.

Monteys, A.M., Spengler, R.M., Dufour, B.D., Wilson, M.S., Oakley, C.K., Sowada, M.J.,

McBride, J.L., and Davidson, B.L. (2014). Single nucleotide seed modification restores in vivo tolerability of a toxic artificial miRNA sequence in the mouse brain. Nucleic Acids

Res 42 , 13315-13327.

Myers, R.H., Vonsattel, J.P., Paskevich, P.A., Kiely, D.K., Stevens, T.J., Cupples, L.A.,

Richardson, E.P., Jr., and Bird, E.D. (1991). Decreased neuronal and increased oligodendroglial densities in Huntington's disease caudate nucleus. Journal of neuropathology and experimental neurology 50 , 729-742.

Myre, M.A., Lumsden, A.L., Thompson, M.N., Wasco, W., MacDonald, M.E., and

Gusella, J.F. (2011). Deficiency of huntingtin has pleiotropic effects in the social amoeba Dictyostelium discoideum. PLoS genetics 7, e1002052.

Nachury, M.V., Loktev, A.V., Zhang, Q., Westlake, C.J., Peranen, J., Merdes, A.,

Slusarski, D.C., Scheller, R.H., Bazan, J.F., Sheffield, V.C. , et al. (2007). A core

219

complex of BBS proteins cooperates with the GTPase Rab8 to promote ciliary membrane biogenesis. Cell 129 , 1201-1213.

Nagy, P., Karpati, M., Varga, A., Pircs, K., Venkei, Z., Takats, S., Varga, K., Erdi, B.,

Hegedus, K., and Juhasz, G. (2014). Atg17/FIP200 localizes to perilysosomal Ref(2)P aggregates and promotes autophagy by activation of Atg1 in Drosophila. Autophagy 10 ,

453-467.

Nakano, M., Oenzil, F., Mizuno, T., and Gotoh, S. (1995). Age-related changes in the lipofuscin accumulation of brain and heart. Gerontology 41 Suppl 2 , 69-79.

Nasir, J., Floresco, S.B., O'Kusky, J.R., Diewert, V.M., Richman, J.M., Zeisler, J.,

Borowski, A., Marth, J.D., Phillips, A.G., and Hayden, M.R. (1995). Targeted disruption of the Huntington's disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell 81 , 811-823.

Neufeld, T.P. (2008). Genetic manipulation and monitoring of autophagy in Drosophila.

Methods in enzymology 451 , 653-667.

Nezis, I.P., Simonsen, A., Sagona, A.P., Finley, K., Gaumer, S., Contamine, D., Rusten,

T.E., Stenmark, H., and Brech, A. (2008). Ref(2)P, the Drosophila melanogaster homologue of mammalian p62, is required for the formation of protein aggregates in adult brain. The Journal of cell biology 180 , 1065-1071.

Noda, N.N., Kumeta, H., Nakatogawa, H., Satoo, K., Adachi, W., Ishii, J., Fujioka, Y.,

Ohsumi, Y., and Inagaki, F. (2008). Structural basis of target recognition by Atg8/LC3 during selective autophagy. Genes Cells 13 , 1211-1218.

O'Doherty, C., Favorov, A., Heggarty, S., Graham, C., Favorova, O., Ochs, M.,

Hawkins, S., Hutchinson, M., O'Rourke, K., and Vandenbroeck, K. (2009). Genetic

220

polymorphisms, their allele combinations and IFN-beta treatment response in Irish multiple sclerosis patients. Pharmacogenomics 10 , 1177-1186.

O'Rourke, J.G., Gareau, J.R., Ochaba, J., Song, W., Rasko, T., Reverter, D., Lee, J.,

Monteys, A.M., Pallos, J., Mee, L. , et al. (2013). SUMO-2 and PIAS1 modulate insoluble mutant huntingtin protein accumulation. Cell reports 4, 362-375.

Ochaba, J., Lukacsovich, T., Csikos, G., Zheng, S., Margulis, J., Salazar, L., Mao, K.,

Lau, A.L., Yeung, S.Y., Humbert, S. , et al. (2014). Potential function for the Huntingtin protein as a scaffold for selective autophagy. Proc Natl Acad Sci U S A 111 , 16889-

16894.

Ochaba, J., Monteys, A.M., O'Rourke, J.G., Reidling, J.C., Steffan, J.S., Davidson, B.L., and Thompson, L.M. (2016). PIAS1 Regulates Mutant Huntingtin Accumulation and

Huntington's Disease-Associated Phenotypes In vivo . Neuron 90 , 507-520.

Oeckinghaus, A., and Ghosh, S. (2009). The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol 1, a000034.

Oh, Y., Kim, Y.M., Mouradian, M.M., and Chung, K.C. (2011). Human Polycomb protein

2 promotes alpha-synuclein aggregate formation through covalent SUMOylation. Brain research 1381 , 78-89.

Olsen, S.K., Capili, A.D., Lu, X., Tan, D.S., and Lima, C.D. (2010). Active site remodelling accompanies thioester bond formation in the SUMO E1. Nature 463 , 906-

912.

Orr, H.T., and Zoghbi, H.Y. (2007). Trinucleotide repeat disorders. Annu Rev Neurosci

30 , 575-621.

221

Ostrerova-Golts, N., Petrucelli, L., Hardy, J., Lee, J.M., Farer, M., and Wolozin, B.

(2000). The A53T alpha-synuclein mutation increases iron-dependent aggregation and toxicity. The Journal of neuroscience : the official journal of the Society for

Neuroscience 20 , 6048-6054.

Palvimo, J.J. (2007). PIAS proteins as regulators of small ubiquitin-related modifier

(SUMO) modifications and transcription. Biochemical Society transactions 35 , 1405-

1408.

Pardo, R., Molina-Calavita, M., Poizat, G., Keryer, G., Humbert, S., and Saudou, F.

(2010). pARIS-htt: an optimised expression platform to study huntingtin reveals functional domains required for vesicular trafficking. Molecular brain 3, 17.

Parzych, K.R., and Klionsky, D.J. (2014). An overview of autophagy: morphology, mechanism, and regulation. Antioxidants & redox signaling 20 , 460-473.

Pekny, M., and Pekna, M. (2014). Astrocyte reactivity and reactive astrogliosis: costs and benefits. Physiological reviews 94 , 1077-1098.

Peng, Q., Wu, B., Jiang, M., Jin, J., Hou, Z., Zheng, J., Zhang, J., and Duan, W. (2016).

Characterization of Behavioral, Neuropathological, Brain Metabolic and Key Molecular

Changes in zQ175 Knock-In Mouse Model of Huntington's Disease. PloS one 11 , e0148839.

Pennuto, M., Palazzolo, I., and Poletti, A. (2009). Post-translational modifications of expanded polyglutamine proteins: impact on neurotoxicity. Hum Mol Genet 18 , R40-47.

Pohl, C., and Jentsch, S. (2009). Midbody ring disposal by autophagy is a post- abscission event of cytokinesis. Nature cell biology 11 , 65-70.

222

Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B.,

Root, H., Rubenstein, J., Boyer, R. , et al. (1997). Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 276 , 2045-2047.

Popova, B., Kleinknecht, A., and Braus, G.H. (2015). Posttranslational Modifications and Clearing of alpha-Synuclein Aggregates in Yeast. Biomolecules 5, 617-634.

Poukka, H., Karvonen, U., Janne, O.A., and Palvimo, J.J. (2000). Covalent modification of the androgen receptor by small ubiquitin-like modifier 1 (SUMO-1). Proc Natl Acad

Sci U S A 97 , 14145-14150.

Praefcke, G.J., Hofmann, K., and Dohmen, R.J. (2012). SUMO playing tag with ubiquitin. Trends in biochemical sciences 37 , 23-31.

Rasmussen, S., Wang, Y., Kivisakk, P., Bronson, R.T., Meyer, M., Imitola, J., and

Khoury, S.J. (2007). Persistent activation of microglia is associated with neuronal dysfunction of callosal projecting pathways and multiple sclerosis-like lesions in relapsing--remitting experimental autoimmune encephalomyelitis. Brain : a journal of neurology 130 , 2816-2829.

Reindle, A., Belichenko, I., Bylebyl, G.R., Chen, X.L., Gandhi, N., and Johnson, E.S.

(2006). Multiple domains in Siz SUMO ligases contribute to substrate selectivity. J Cell

Sci 119 , 4749-4757.

Reverter, D., and Lima, C.D. (2005). Insights into E3 ligase activity revealed by a

SUMO-RanGAP1-Ubc9-Nup358 complex. Nature 435 , 687-692.

Riley, B.E., Zoghbi, H.Y., and Orr, H.T. (2005). SUMOylation of the polyglutamine repeat protein, ataxin-1, is dependent on a functional nuclear localization signal. The

Journal of biological chemistry 280 , 21942-21948.

223

Rockabrand, E., Slepko, N., Pantalone, A., Nukala, V.N., Kazantsev, A., Marsh, J.L.,

Sullivan, P.G., Steffan, J.S., Sensi, S.L., and Thompson, L.M. (2007). The first 17 amino acids of Huntingtin modulate its sub-cellular localization, aggregation and effects on calcium homeostasis. Hum Mol Genet 16 , 61-77.

Rosenstock, T.R., Duarte, A.I., and Rego, A.C. (2010). Mitochondrial-associated metabolic changes and neurodegeneration in Huntington's disease - from clinical features to the bench. Current drug targets 11 , 1218-1236.

Ross, C.A. (2002). Polyglutamine pathogenesis: emergence of unifying mechanisms for

Huntington's disease and related disorders. Neuron 35 , 819-822.

Ross, C.A., Aylward, E.H., Wild, E.J., Langbehn, D.R., Long, J.D., Warner, J.H., Scahill,

R.I., Leavitt, B.R., Stout, J.C., Paulsen, J.S. , et al. (2014). Huntington disease: natural history, biomarkers and prospects for therapeutics. Nat Rev Neurol 10 , 204-216.

Ross, C.A., and Tabrizi, S.J. (2011). Huntington's disease: from molecular pathogenesis to clinical treatment. Lancet neurology 10 , 83-98.

Rui, Y.N., Xu, Z., Patel, B., Cuervo, A.M., and Zhang, S. (2015). HTT/Huntingtin in selective autophagy and Huntington disease: A foe or a friend within? Autophagy 11 ,

858-860.

Ruiz, C., Casarejos, M.J., Gomez, A., Solano, R., de Yebenes, J.G., and Mena, M.A.

(2012). Protection by glia-conditioned medium in a cell model of Huntington disease.

PLoS currents 4, e4fbca54a2028b.

Russell, R.C., Tian, Y., Yuan, H., Park, H.W., Chang, Y.Y., Kim, J., Kim, H., Neufeld,

T.P., Dillin, A., and Guan, K.L. (2013). ULK1 induces autophagy by phosphorylating

Beclin-1 and activating VPS34 lipid kinase. Nature cell biology 15 , 741-750.

224

Rytinki, M.M., Kaikkonen, S., Pehkonen, P., Jaaskelainen, T., and Palvimo, J.J. (2009).

PIAS proteins: pleiotropic interactors associated with SUMO. Cellular and molecular life sciences : CMLS 66 , 3029-3041.

Sabate, R., Espargaro, A., Grana-Montes, R., Reverter, D., and Ventura, S. (2012).

Native structure protects SUMO proteins from aggregation into amyloid fibrils.

Biomacromolecules 13 , 1916-1926.

Sachdev, S., Bruhn, L., Sieber, H., Pichler, A., Melchior, F., and Grosschedl, R. (2001).

PIASy, a nuclear matrix-associated SUMO E3 ligase, represses LEF1 activity by sequestration into nuclear bodies. Genes & development 15 , 3088-3103.

Saitoh, H., and Hinchey, J. (2000). Functional heterogeneity of small ubiquitin-related protein modifiers SUMO-1 versus SUMO-2/3. J Biol Chem 275 , 6252-6258.

Sandalon, Z., Bruckheimer, E.M., Lustig, K.H., Rogers, L.C., Peluso, R.W., and

Burstein, H. (2004). Secretion of a TNFR:Fc fusion protein following pulmonary administration of pseudotyped adeno-associated virus vectors. J Virol 78 , 12355-12365.

Sapp, E., Schwarz, C., Chase, K., Bhide, P.G., Young, A.B., Penney, J., Vonsattel, J.P.,

Aronin, N., and DiFiglia, M. (1997). Huntingtin localization in brains of normal and

Huntington's disease patients. Ann Neurol 42 , 604-612.

Sarge, K.D., and Park-Sarge, O.K. (2009). Sumoylation and human disease pathogenesis. Trends in biochemical sciences 34 , 200-205.

Sarkar, S., Ravikumar, B., Floto, R.A., and Rubinsztein, D.C. (2009). Rapamycin and mTOR-independent autophagy inducers ameliorate toxicity of polyglutamine-expanded huntingtin and related proteinopathies. Cell death and differentiation 16 , 46-56.

225

Sassone, J., Colciago, C., Cislaghi, G., Silani, V., and Ciammola, A. (2009).

Huntington's disease: the current state of research with peripheral tissues. Exp Neurol

219 , 385-397.

Saudou, F., Finkbeiner, S., Devys, D., and Greenberg, M.E. (1998). Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell 95 , 55-66.

Savas, J.N., Makusky, A., Ottosen, S., Baillat, D., Then, F., Krainc, D., Shiekhattar, R.,

Markey, S.P., and Tanese, N. (2008). Huntington's disease protein contributes to RNA- mediated gene silencing through association with Argonaute and P bodies. Proc Natl

Acad Sci U S A 105 , 10820-10825.

Schipper-Krom, S., Juenemann, K., and Reits, E.A. (2012). The Ubiquitin-Proteasome

System in Huntington's Disease: Are Proteasomes Impaired, Initiators of Disease, or

Coming to the Rescue? Biochemistry research international 2012 , 837015.

Schmidt, D., and Muller, S. (2002). Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity. Proc Natl Acad Sci U S A 99 , 2872-2877.

Schulte, J., and Littleton, J.T. (2011). The biological function of the Huntingtin protein and its relevance to Huntington's Disease pathology. Curr Trends Neurol 5, 65-78.

Sen, N., and Snyder, S.H. (2010). Protein modifications involved in neurotransmitter and gasotransmitter signaling. Trends Neurosci 33 , 493-502.

Shao, J., and Diamond, M.I. (2007). Polyglutamine diseases: emerging concepts in pathogenesis and therapy. Hum Mol Genet 16 Spec No. 2 , R115-123.

226

Shibata, M., Lu, T., Furuya, T., Degterev, A., Mizushima, N., Yoshimori, T., MacDonald,

M., Yankner, B., and Yuan, J. (2006). Regulation of intracellular accumulation of mutant

Huntingtin by Beclin 1. The Journal of biological chemistry 281 , 14474-14485.

Shuai, K. (2006). Regulation of cytokine signaling pathways by PIAS proteins. Cell research 16 , 196-202.

Shuai, K., and Liu, B. (2005). Regulation of gene-activation pathways by PIAS proteins in the immune system. Nat Rev Immunol 5, 593-605.

Sieradzan, K.A., Mechan, A.O., Jones, L., Wanker, E.E., Nukina, N., and Mann, D.M.

(1999). Huntington's disease intranuclear inclusions contain truncated, ubiquitinated huntingtin protein. Exp Neurol 156 , 92-99.

Silvestroni, A., Faull, R.L., Strand, A.D., and Moller, T. (2009). Distinct neuroinflammatory profile in post-mortem human Huntington's disease. Neuroreport 20 ,

1098-1103.

Simard, A.R., Soulet, D., Gowing, G., Julien, J.P., and Rivest, S. (2006). Bone marrow- derived microglia play a critical role in restricting senile plaque formation in Alzheimer's disease. Neuron 49 , 489-502.

Simmons, D.A., Casale, M., Alcon, B., Pham, N., Narayan, N., and Lynch, G. (2007).

Ferritin accumulation in dystrophic microglia is an early event in the development of

Huntington's disease. Glia 55 , 1074-1084.

Singleton, A.B., Farrer, M., Johnson, J., Singleton, A., Hague, S., Kachergus, J.,

Hulihan, M., Peuralinna, T., Dutra, A., Nussbaum, R. , et al. (2003). alpha-Synuclein locus triplication causes Parkinson's disease. Science 302 , 841.

227

Sivanandam, V.N., Jayaraman, M., Hoop, C.L., Kodali, R., Wetzel, R., and van der Wel,

P.C. (2011). The aggregation-enhancing huntingtin N-terminus is helical in amyloid fibrils. Journal of the American Chemical Society 133 , 4558-4566.

Sontag, E.M., Lotz, G.P., Agrawal, N., Tran, A., Aron, R., Yang, G., Necula, M., Lau, A.,

Finkbeiner, S., Glabe, C. , et al. (2012a). Methylene blue modulates huntingtin aggregation intermediates and is protective in Huntington's disease models. The

Journal of neuroscience : the official journal of the Society for Neuroscience 32 , 11109-

11119.

Sontag, E.M., Lotz, G.P., Yang, G., Sontag, C.J., Cummings, B.J., Glabe, C.G.,

Muchowski, P.J., and Thompson, L.M. (2012b). Detection of Mutant Huntingtin

Aggregation Conformers and Modulation of SDS-Soluble Fibrillar Oligomers by Small

Molecules. J Huntingtons Dis 1, 127-140.

Stack, E.C., Kubilus, J.K., Smith, K., Cormier, K., Del Signore, S.J., Guelin, E., Ryu, H.,

Hersch, S.M., and Ferrante, R.J. (2005). Chronology of behavioral symptoms and neuropathological sequela in R6/2 Huntington's disease transgenic mice. J Comp

Neurol 490 , 354-370.

Stankovic-Valentin, N., Deltour, S., Seeler, J., Pinte, S., Vergoten, G., Guerardel, C.,

Dejean, A., and Leprince, D. (2007). An acetylation/deacetylation-SUMOylation switch through a phylogenetically conserved psiKXEP motif in the tumor suppressor HIC1 regulates transcriptional repression activity. Mol Cell Biol 27 , 2661-2675.

Stefanis, L. (2012). alpha-Synuclein in Parkinson's disease. Cold Spring Harb Perspect

Med 2, a009399.

228

Steffan, J.S. (2010). Does Huntingtin play a role in selective macroautophagy? Cell

Cycle 9, 3401-3413.

Steffan, J.S., Agrawal, N., Pallos, J., Rockabrand, E., Trotman, L.C., Slepko, N., Illes,

K., Lukacsovich, T., Zhu, Y.Z., Cattaneo, E. , et al. (2004). SUMO modification of

Huntingtin and Huntington's disease pathology. Science 304 , 100-104.

Steffan, J.S., Bodai, L., Pallos, J., Poelman, M., McCampbell, A., Apostol, B.L.,

Kazantsev, A., Schmidt, E., Zhu, Y.Z., Greenwald, M. , et al. (2001). Histone deacetylase inhibitors arrest polyglutamine-dependent neurodegeneration in

Drosophila. Nature 413 , 739-743.

Steffan, J.S., Kazantsev, A., Spasic-Boskovic, O., Greenwald, M., Zhu, Y.Z., Gohler, H.,

Wanker, E.E., Bates, G.P., Housman, D.E., and Thompson, L.M. (2000). The

Huntington's disease protein interacts with p53 and CREB-binding protein and represses transcription. Proc Natl Acad Sci U S A 97 , 6763-6768.

Stelzl, U., Worm, U., Lalowski, M., Haenig, C., Brembeck, F.H., Goehler, H., Stroedicke,

M., Zenkner, M., Schoenherr, A., Koeppen, S. , et al. (2005). A human protein-protein interaction network: a resource for annotating the proteome. Cell 122 , 957-968.

Subramaniam, S., Sixt, K.M., Barrow, R., and Snyder, S.H. (2009). Rhes, a striatal specific protein, mediates mutant-huntingtin cytotoxicity. Science 324 , 1327-1330.

Sun, H., and Hunter, T. (2012). Poly-Small Ubiquitin-like Modifier (PolySUMO)-binding

Proteins Identified through a String Search. The Journal of biological chemistry 287 ,

42071-42083.

Suzuki, K. (2013). Selective autophagy in budding yeast. Cell death and differentiation

20 , 43-48.

229

Suzumura, A. (2013). Neuron-microglia interaction in neuroinflammation. Current protein & peptide science 14 , 16-20.

Tanaka, M., Machida, Y., Niu, S., Ikeda, T., Jana, N.R., Doi, H., Kurosawa, M., Nekooki,

M., and Nukina, N. (2004). Trehalose alleviates polyglutamine-mediated pathology in a mouse model of Huntington disease. Nature medicine 10 , 148-154.

Tatham, M.H., Geoffroy, M.C., Shen, L., Plechanovova, A., Hattersley, N., Jaffray, E.G.,

Palvimo, J.J., and Hay, R.T. (2008). RNF4 is a poly-SUMO-specific E3 ubiquitin ligase required for arsenic-induced PML degradation. Nature cell biology 10 , 538-546.

Tatham, M.H., Matic, I., Mann, M., and Hay, R.T. (2011). Comparative proteomic analysis identifies a role for SUMO in protein quality control. Sci Signal 4, rs4.

Thompson, L.M., Aiken, C.T., Kaltenbach, L.S., Agrawal, N., Illes, K., Khoshnan, A.,

Martinez-Vincente, M., Arrasate, M., O'Rourke, J.G., Khashwji, H. , et al. (2009). IKK phosphorylates Huntingtin and targets it for degradation by the proteasome and lysosome. J Cell Biol 187 , 1083-1099.

Trager, U., Magnusson, A., Lahiri Swales, N., Wild, E., North, J., Lowdell, M., and

Bjorkqvist, M. (2013). JAK/STAT Signalling in Huntington's Disease Immune Cells.

PLoS currents 5.

Tronche, F., Kellendonk, C., Kretz, O., Gass, P., Anlag, K., Orban, P.C., Bock, R., Klein,

R., and Schutz, G. (1999). Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nature genetics 23 , 99-103.

Trushina, E., Dyer, R.B., Badger, J.D., 2nd, Ure, D., Eide, L., Tran, D.D., Vrieze, B.T.,

Legendre-Guillemin, V., McPherson, P.S., Mandavilli, B.S. , et al. (2004). Mutant

230

huntingtin impairs axonal trafficking in mammalian neurons in vivo and in vitro .

Molecular and cellular biology 24 , 8195-8209.

Turner, C., and Schapira, A.H. (2010). Mitochondrial matters of the brain: the role in

Huntington's disease. Journal of bioenergetics and biomembranes 42 , 193-198.

Ulrich, H.D. (2009). SUMO Protocols. Preface. Methods Mol Biol 497 , v-vi.

Vashishtha, M., Ng, C.W., Yildirim, F., Gipson, T.A., Kratter, I.H., Bodai, L., Song, W.,

Lau, A., Labadorf, A., Vogel-Ciernia, A. , et al. (2013). Targeting H3K4 trimethylation in

Huntington disease. Proc Natl Acad Sci U S A 110 , E3027-3036.

Vekrellis, K., and Stefanis, L. (2012). Targeting intracellular and extracellular alpha- synuclein as a therapeutic strategy in Parkinson's disease and other synucleinopathies.

Expert Opin Ther Targets 16 , 421-432.

Vilar, M., Chou, H.T., Luhrs, T., Maji, S.K., Riek-Loher, D., Verel, R., Manning, G.,

Stahlberg, H., and Riek, R. (2008). The fold of alpha-synuclein fibrils. Proc Natl Acad

Sci U S A 105 , 8637-8642.

Waelter, S., Boeddrich, A., Lurz, R., Scherzinger, E., Lueder, G., Lehrach, H., and

Wanker, E.E. (2001). Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation. Molecular biology of the cell 12 , 1393-1407.

Waldron-Roby, E., Ratovitski, T., Wang, X., Jiang, M., Watkin, E., Arbez, N., Graham,

R.K., Hayden, M.R., Hou, Z., Mori, S. , et al. (2012). Transgenic mouse model expressing the caspase 6 fragment of mutant huntingtin. J Neurosci 32 , 183-193.

Walsh, I., Seno, F., Tosatto, S.C., and Trovato, A. (2014). PASTA 2.0: an improved server for protein aggregation prediction. Nucleic Acids Res 42 , W301-307.

231

Wang, L., Wansleeben, C., Zhao, S., Miao, P., Paschen, W., and Yang, W. (2014a).

SUMO2 is essential while SUMO3 is dispensable for mouse embryonic development.

EMBO reports 15 , 878-885.

Wang, N., Gray, M., Lu, X.H., Cantle, J.P., Holley, S.M., Greiner, E., Gu, X., Shirasaki,

D., Cepeda, C., Li, Y. , et al. (2014b). Neuronal targets for reducing mutant huntingtin expression to ameliorate disease in a mouse model of Huntington's disease. Nature medicine 20 , 536-541.

Wang, Z.M., and Lashuel, H.A. (2013). Discovery of a novel aggregation domain in the huntingtin protein: implications for the mechanisms of Htt aggregation and toxicity.

Angew Chem Int Ed Engl 52 , 562-567.

Wanker, E.E., Scherzinger, E., Heiser, V., Sittler, A., Eickhoff, H., and Lehrach, H.

(1999). Membrane filter assay for detection of amyloid-like polyglutamine-containing protein aggregates. Methods in enzymology 309 , 375-386.

Warby, S.C., Doty, C.N., Graham, R.K., Carroll, J.B., Yang, Y.Z., Singaraja, R.R.,

Overall, C.M., and Hayden, M.R. (2008). Activated caspase-6 and caspase-6-cleaved fragments of huntingtin specifically colocalize in the nucleus. Hum Mol Genet 17 , 2390-

2404.

Warby, S.C., Doty, C.N., Graham, R.K., Shively, J., Singaraja, R.R., and Hayden, M.R.

(2009). Phosphorylation of huntingtin reduces the accumulation of its nuclear fragments.

Mol Cell Neurosci 40 , 121-127.

Wee Yong, V. (2010). Inflammation in neurological disorders: a help or a hindrance?

The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry

16 , 408-420.

232

Wexler, N.S., Lorimer, J., Porter, J., Gomez, F., Moskowitz, C., Shackell, E., Marder, K.,

Penchaszadeh, G., Roberts, S.A., Gayan, J. , et al. (2004). Venezuelan kindreds reveal that genetic and environmental factors modulate Huntington's disease age of onset.

Proc Natl Acad Sci U S A 101 , 3498-3503.

Weydt, P., Pineda, V.V., Torrence, A.E., Libby, R.T., Satterfield, T.F., Lazarowski, E.R.,

Gilbert, M.L., Morton, G.J., Bammler, T.K., Strand, A.D. , et al. (2006). Thermoregulatory and metabolic defects in Huntington's disease transgenic mice implicate PGC-1alpha in

Huntington's disease neurodegeneration. Cell metabolism 4, 349-362.

Wild, P., Farhan, H., McEwan, D.G., Wagner, S., Rogov, V.V., Brady, N.R., Richter, B.,

Korac, J., Waidmann, O., Choudhary, C. , et al. (2011). Phosphorylation of the autophagy receptor optineurin restricts Salmonella growth. Science 333 , 228-233.

Wilkinson, K.A., Nakamura, Y., and Henley, J.M. (2010). Targets and consequences of protein SUMOylation in neurons. Brain research reviews 64 , 195-212.

Wong, Y.C., and Holzbaur, E.L. (2014). The regulation of autophagosome dynamics by huntingtin and HAP1 is disrupted by expression of mutant huntingtin, leading to defective cargo degradation. The Journal of neuroscience : the official journal of the

Society for Neuroscience 34 , 1293-1305.

Woodman, B., Butler, R., Landles, C., Lupton, M.K., Tse, J., Hockly, E., Moffitt, H.,

Sathasivam, K., and Bates, G.P. (2007). The Hdh(Q150/Q150) knock-in mouse model of HD and the R6/2 exon 1 model develop comparable and widespread molecular phenotypes. Brain Res Bull 72 , 83-97.

Wooten, M.W., Geetha, T., Babu, J.R., Seibenhener, M.L., Peng, J., Cox, N., Diaz-

Meco, M.T., and Moscat, J. (2008). Essential role of sequestosome 1/p62 in regulating

233

accumulation of Lys63-ubiquitinated proteins. The Journal of biological chemistry 283 ,

6783-6789.

Wrighton, K.H. (2013). Cytoskeleton: Autophagy and ciliogenesis come together. Nat

Rev Mol Cell Biol 14 , 687.

Wyttenbach, A., Carmichael, J., Swartz, J., Furlong, R.A., Narain, Y., Rankin, J., and

Rubinsztein, D.C. (2000). Effects of heat shock, heat shock protein 40 (HDJ-2), and proteasome inhibition on protein aggregation in cellular models of Huntington's disease.

Proc Natl Acad Sci U S A 97 , 2898-2903.

Yang, W., Thompson, J.W., Wang, Z., Wang, L., Sheng, H., Foster, M.W., Moseley,

M.A., and Paschen, W. (2012). Analysis of oxygen/glucose-deprivation-induced changes in SUMO3 conjugation using SILAC-based quantitative proteomics. Journal of proteome research 11 , 1108-1117.

Yorimitsu, T., and Klionsky, D.J. (2005). Atg11 links cargo to the vesicle-forming machinery in the cytoplasm to vacuole targeting pathway. Molecular biology of the cell

16 , 1593-1605.

Yunus, A.A., and Lima, C.D. (2009). Structure of the Siz/PIAS SUMO E3 ligase Siz1 and determinants required for SUMO modification of PCNA. Mol Cell 35 , 669-682.

Zala, D., Hinckelmann, M.V., and Saudou, F. (2013). Huntingtin's function in axonal transport is conserved in Drosophila melanogaster. PloS one 8, e60162.

Zarranz, J.J., Alegre, J., Gomez-Esteban, J.C., Lezcano, E., Ros, R., Ampuero, I., Vidal,

L., Hoenicka, J., Rodriguez, O., Atares, B. , et al. (2004). The new mutation, E46K, of alpha-synuclein causes Parkinson and Lewy body dementia. Ann Neurol 55 , 164-173.

234

Zeitlin, S., Liu, J.P., Chapman, D.L., Papaioannou, V.E., and Efstratiadis, A. (1995).

Increased apoptosis and early embryonic lethality in mice nullizygous for the

Huntington's disease gene homologue. Nature genetics 11 , 155-163.

Zhang, F.P., Mikkonen, L., Toppari, J., Palvimo, J.J., Thesleff, I., and Janne, O.A.

(2008). Sumo-1 function is dispensable in normal mouse development. Molecular and cellular biology 28 , 5381-5390.

Zhang, J., and Ney, P.A. (2009). Role of BNIP3 and NIX in cell death, autophagy, and mitophagy. Cell death and differentiation 16 , 939-946.

Zhang, S., Feany, M.B., Saraswati, S., Littleton, J.T., and Perrimon, N. (2009).

Inactivation of Drosophila Huntingtin affects long-term adult functioning and the pathogenesis of a Huntington's disease model. Disease models & mechanisms 2, 247-

266.

Zhao, Q., Xie, Y., Zheng, Y., Jiang, S., Liu, W., Mu, W., Liu, Z., Zhao, Y., Xue, Y., and

Ren, J. (2014). GPS-SUMO: a tool for the prediction of sumoylation sites and SUMO- interaction motifs. Nucleic Acids Res 42 , W325-330.

Zhao, T., Hong, Y., Li, X.J., and Li, S.H. (2016). Subcellular Clearance and

Accumulation of Huntington Disease Protein: A Mini-Review. Front Mol Neurosci 9, 27.

Zheng, Q., and Joinnides, M. (2009). Hunting for the function of Huntingtin. Disease models & mechanisms 2, 199-200.

Zheng, S., Clabough, E.B., Sarkar, S., Futter, M., Rubinsztein, D.C., and Zeitlin, S.O.

(2010). Deletion of the huntingtin polyglutamine stretch enhances neuronal autophagy and longevity in mice. PLoS genetics 6, e1000838.

235

Zheng, S., Ghitani, N., Blackburn, J.S., Liu, J.P., and Zeitlin, S.O. (2012). A series of N- terminal epitope tagged Hdh knock-in alleles expressing normal and mutant huntingtin: their application to understanding the effect of increasing the length of normal

Huntingtin's polyglutamine stretch on CAG140 mouse model pathogenesis. Molecular brain 5, 28.

Zheng, Z., and Diamond, M.I. (2012). Huntington disease and the huntingtin protein.

Progress in molecular biology and translational science 107 , 189-214.

Zheng, Z., Li, A., Holmes, B.B., Marasa, J.C., and Diamond, M.I. (2013). An N-terminal

Nuclear Export Signal Regulates Trafficking and Aggregation of Huntingtin (Htt) Protein

Exon 1. J Biol Chem 288 , 6063-6071.

Zuccato, C., Valenza, M., and Cattaneo, E. (2010). Molecular mechanisms and potential therapeutical targets in Huntington's disease. Physiological reviews 90 , 905-981.

236