Original Article
Evaluation of mRNA Contents of YBX2 and JHDM2A Genes on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesis
Reza Najafipour, Ph.D.1, 2, Sahar Moghbelinejad, Ph.D.1, 2*, Amir Samimi Hashjin, M.Sc.1, Farzad Rajaei, Ph.D.2, Zahra Rashvand, M.Sc.2
1. Cellular and Molecular Research Centre, Qazvin University of Medical Sciences, Qazvin, Iran 2. Department of Medical Genetics, Qazvin University of Medical Sciences, Qazvin, Iran
*Corresponding Address: P.O.Box: 341197-5981, Cellular and Molecular Research Centre, Qazvin University of Medical Sciences, Qazvin, Iran Email: [email protected]
Received: 27/Nov/2013, Accepted: 08/Mar/2014 Abstract Objective: Animal model studies have shown that MSY2 and JHDM2A genes have an important role in spermatogenesis process and fertility of male mice. But the potential role of these genes in human spermatogenesis and fertility is not known yet. Therefore, we evaluated expression ratios of these genes in testis tissues of men with normal and impaired spermatogenesis. Materials and Methods: In this experimental study, after RNA extraction and cDNA syn- thesis from 50 non-obstructive azoospermic and 12 normal testis tissues, the expression ratios of genes were evaluated by real time polymerase chain reaction (PCR) technique. Hematoxcylin and eosin (H&E) staining was used for histological classification of testis tis- sues. For statistical analysis, one way analysis of variance (ANOVA) test was carried out. Results: Our results showed a significant reduction in mRNA level of YBX2 in samples with impaired spermatogenesis (p<0.001) compared to samples with qualitatively nor- mal spermatogenesis and normal spermatogenesis; however, in JHDM2A gene, despite sensible reduction in gene expression level in men with impaired spermatogenesis, no significant differences were shown (p>0.05). Furthermore in YBX2, a significant negative correlation was demonstrated between the efficiency score of spermatogenesis and the threshold cycle (CT) (r=-0.7, p<0.0001), whereas in JHDM2A, this negative correlation was not significant (r=-0.4, p=0.06). Conclusion: Generally, these data indicated that YBX2 and JHDM2A genes may play an important role in male infertility, and suggested that these molecules can act as useful biomarkers for predicting male infertility.
Keywords: Azoospermia, YBX2, JHDM2A
Cell Journal(Yakhteh), Vol 17, No 1, Spring 2015, Pages: 121-128
Citation: Najafipour R, Moghbelinejad S, Samimi Hashjin A, Rajaei F, Rashvand Z. Evaluation of mRNA contents of YBX2 and JHDM2A genes on testicular tissues of azoospermic men with different classes of spermatogenesis. Cell J. 2015; 17(1): 121-128.
Introduction mosome 17p11.2-13.1. This gene appears to be YBX2 and JHDM2A genes are germ-cell-specific testis-specific and distinct from other mammalian molecules which are essential for the production Y-box-binding proteins (3). In the mouse testis, of functional spermatozoa; therefore, their inacti- this gene is expressed from pachytene spermato- vation could lead to male infertility. Y box binding cyte to late spermatid stages, but the active form of protein 2 (YBX2), also known as Contrin, is a hu- YBX2 factor is in round spermatid stage (4). YBX2 man homologue of Xenopus DNA/RNA-binding protein is highly similar to its mouse and xenopus and mouse MSY2 proteins (1, 2). The gene encod- germ-cell Y-box protein homologues. YBX2 also ing Contrin or YBX2 is located on human chro- acts as an mRNA stabilizer and a transcription fac-
CELL JOURNAL(Yakhteh), Vol 17, No 1, Spring 2015 121 mRNA Contents of YBX2 and JHDM2A on Testicular Tissue tor of some testis specific genes such asprotamine old; these patients were candidates of assisted genes. Consequently, its loss of expression is like- reproductive technique (ART) and exhibited im- ly to contribute to the nuclear condensation defects paired spermatogenesis. In 12 patients with ob- that occur in MSY2-null late-stage spermatids (4- structive azoospermia after vasectomy, biopsies 6). Histone H3 lysine 9 (H3K9) methylation is were carried out for diagnostic reasons during va- one of the best-characterized modifications in the sectomy reversal. These biopsies revealing normal study of germ cell development, such as meiotic spermatogenesis were served as controls, while the chromosomal recombination, segregation, and his- mean age of these individuals was 35 ± 2.9 years tone removal followed by chromatin condensation old. The limitation of this study was scarcity of tis- in spermiogenesis. sue samples with normal spermatogenesis, for this reason sampling time was prolonged. In order to do these processes, simultaneous function of methyltransferase and demethylase To decrease possible confounding factors, the enzymes is unavoidable (7). JmjC-containing patients were excluded for these criteria: Y chro- histone demethylase 2a (JHDM2A), also known mosome microdeletion, cystic fibrosis, varicocele, as JMJD1A or KDM3A, has been identified as Klinefelter syndrome, or exposure to chemothera- an H3K9 demethylase (for monomethylation py and radiation. In infertile patients with non-ob- and dimethylation), while it has been originally structive azoospermia, one part of testicular tissue cloned as a testis-specific gene transcript (7). specimens was used for testicular sperm extrac- Location of this gene on human chromosome tion, while the other part was cut into two pieces; is 2p11.2. JHDM2A specifically regulates the one piece was immediately prepared and frozen expression of the genes encoding transition for RNA extraction procedure, and the other piece protein 1 (Tp1) and protamine proteins, while was fixed in Bouin’s fixative (Sigma, USA) and this gene is necessary for the proper chromatin embedded in paraffin. reorganization during spermatid maturation by For histological evaluation, 5-µm-thick paraf- directly promoting the transcription of the tran- fin sections were stained in hematoxylin and eosin sition nuclear protein 1 (TNP1) and protamine1 (H&E), and then scored according to the modified (PRM 1) genes (8, 9). Since both of two candi- date genes in this research involve in expression Johnsen scoring system. In this system of classi- regulation of some testis specific and important fication, all tubular sections in each piece of the genes such as PRM1, PRM2, TNP1, TNP2, etc., testicular biopsy are evaluated systematically, and different studies have pointed out that targeting each is given a score from 1 to 10 as follows: score YBX2 and JHDM2A genes in animal models 10 including complete spermatogenesis with many causes male infertility and different degrees of spermatozoa; score 9 including slightly impaired impaired spermatogenesis. To access this fact, spermatogenesis, many late spermatids, and disor- for the first time, we evaluated the expression ganized epithelium; score 8 including less than five level of these genes in testicular tissues of men spermatozoa per tubule and few late spermatids; with non-obstructive azoospermia, with differ- score 7 including no spermatozoa, no late sperma- ent class of spermatogenesis. tids and many early spermatids; score 6 including no spermatozoa, no late spermatids and few early Materials and Methods spermatids; score 5 including no spermatozoa or spermatids and many spermatocytes; score 4 in- Testicular tissue cluding no spermatozoa or spermatids and few This experimental study was approved by the spermatocytes; score 3 including only spermato- Ethical Committee of the Faculty of Medical Sci- gonia; score 2 including no germinal cells andSer- ences of Qazvin University of Medical Sciences, toli cells only; as well as score 1 no seminiferous Qazvin, Iran. Sampling was done under supervi- epithelium (10). To follow this classifying method, sion of urologist in Fertility and Infertility Center our samples were divided into 3 main groups based of Shariati Hospital., Tehran, Iran, during 2012. on above scoring: normal spermatogenesis (score After patients gave an informed written consent, 10), qualitatively normal spermatogenesis (scores testicular biopsies were obtained from 50 azoo- 8-9), and impaired spermatogenesis (scores 1-7) spermic men with mean age of 31.3 ± 3.7 years (Table 1).
CELL JOURNAL(Yakhteh), Vol 17, No 1, Spring 2015 122 Najaf ipour et al.
Table 1: Characterization of patient groups I-III and results of quantitative PCR analysis Histological classification Group 1 Group 2 Group 3
Normal spermatogenesis Qualitatively normal spermatogenesis Impaired spermatogenesis
Scores 10 8-9 1-7
Number of patients 12 16 34
Ct YBX2 (mean ± SD) 21.75 ± 1.2 21.2 ± 0.99 24.1 ± 1.9
Ct GAPDH (mean ± SD) 23.6 ± 0.85 23.1± 1.1 23.12 ± 2.3
2-ΔCt 3.6 ± 1.8 3.7 ± 1.5 0.5 ± 0.7
Ct JHDM2A (mean ± SD) 25.9 ± 0.96 26.33 ± 1.1 27 ± 1.7
Ct GAPDH (mean ± SD) 23.95 ± 1.5 24.3 ± 1.4 24.5 ± 1.2
2-ΔCt 0.25 ± 0.19 0.24 ± 0.15 0.17 ± 0.1
PCR: Polymerase chain reaction and SD; Standard deviation.
RNA extraction and first strand cDNA synthesis minutes. Next 4 μl 5X reaction buffer for reverse transcription, 0.5 μl RiboLock™ RNase inhibi- In summary, frozen testis tissues are homog- tor, 2 μl dNTP mix and 1 μl revertaid™ H minus enized in lysis buffer (Qiagen, Germany) using reverse transcriptase (Bioneer, Korea) were add- an ultrasonic processor UP100H (100W, 30 kHz) ed to solution, and total volume reached to 25 (Hielsher, Germany), and RNA is then extracted μl with DEPC-treated water. After being centri- using RNeasy Mini Kit (Qiagen, Germany). In fuged, the solution was incubated for 60 minutes this regard, 1 volume of 70% ethanol was added at 42˚C. Ultimately the reaction was terminated to the homogenized lysate, and up to 700 μl of by heating at 70˚C for 10 minutes. the sample was then transferred to an RNeasy spin column placed in a 2 ml collection tube. We Real-time polymerase chain reaction (PCR) and used column DNase digestion to remove the re- comparative threshold cycle (CT) method sidual DNA. After using different washing buff- ers, the RNeasy spin column was placed in a new In this experiment, we used GAPDH gene as an 1.5 ml collection tube, 30-50 μl RNase-free water internal control for quantification of target genes was added directly to the spin column membrane expression. Two target genes (YBX2 and JHDM2A) to elute the RNA, and finally RNA was frozen at and GAPDH (as internal control) were amplified -80˚C. Quality and quantity of isolated total RNA with appropriate primers and probes (Table 2). All was measured using Nano Drop 2000c (Thermo, primers and probes were designed using gene run- USA). In this case, RNA samples with A260/A280 ner software version 3.05 (Hastings SoftwareInc. ratios of >2 were selected for quantitative analy- Hastings, NY, USA). TaqMan real time PCR assay sis. First strand complementary DNA (cDNA) was carried out in final reaction volumes of 20 µl synthesis was also performed using the RevertAid with 10 µl of a TaqManMaster Mix (Takara, Shi- First Strand cDNA Synthesis Kit (Thermo Scien- ga, Japan), 0.2 μM of forward and reverse primers, tific, Fermentas, Waltham, MA, USA). For cDNA and 2 μl of cDNA. Thermal cycling was performed synthesis, 1-5 µg total RNA and 0.5 µg oligo (dt) using the ABI-7500 sequence detection system were added to sterile, nuclease-free tube on ice, (Applied Biosystems, Foster, CA, USA) with the and total volume reached to 11.5 µl with DEPC- following cycling condition: 30 seconds at 95˚C treated water. This solution was mixed and centri- as first denaturation step, followed by 40 cycles at fuged briefly and then was incubated at 65˚C for 5 95˚C for 5 seconds and 60˚C for 34 seconds.
CELL JOURNAL(Yakhteh), Vol 17, No 1, Spring 2015 123 mRNA Contents of YBX2 and JHDM2A on Testicular Tissue
Table 2: The oligonucleotid primers and probes used in real time PCR assay Target and internal (bp) control genes Sequence Amplicon size YBX2 F: CCCTACCCAGTACCCTGCT 150 R: CCTTCCTTCAACCCTTGATAA P: CAGGAGGACCAAAGCAGCAGCC JHDM2A F: GTTCCACAAGCATTGACTGG 145 R: CTGGTGCATTTGAAACATCC P: TGCCAATCCTCCTGAACTGCAGA GAPDH F: TCAAGAAGGTGGTGAAGCAG 93 R: CGCTGTTGAAGTCAGAGGAG P: CCTCAAGGGCATCCTGGGCT
PCR: Polymerase chain reaction.
Optimization of real-time PCR assay exhibited a significant (p<0.001) lower mRNA -ΔCt The efficiency of each gene was determined level of YBX2 (2 : 0.5 ± 0.7) when compared using 10 fold series of normal cDNA dilutions. to the samples with normal spermatogenesis (group I) (2-ΔCt: 3.6 ± 1.8) and qualitatively Validation of experiments was performed to de- -ΔCt termine PCR efficiencies of target and reference normal spermatogenesis (group II) (2 : 3.03 ± 1.5). In the testicular tissues of azoospermic gene. The slopes of the fit lines were within the men with impaired spermatogenesis, YBX2 acceptable range of -3.6
CELL JOURNAL(Yakhteh), Vol 17, No 1, Spring 2015 124 Najaf ipour et al.
Fig.1: mRNA expression of YBX2. Men with normal spermatogenesis (n=12, score 10), men with qualitatively normal spermatogenesis (n=16, scores 8-9) and in azoospermic men with impaired spermatogenesis (n=34, scores 1-7). Values are presented as mean ± SD. **; P<0.001 as compared to control groups using one way ANOVA test. SD; Standard deviation and ANOVA; One-way analysis of variance.
Fig.2: mRNA expression of JHDM2A. Men with normal spermatogenesis (n=12, score 10), men with qualitatively normal spermatogenesis (n=16, scores 8-9), and in azoospermic men with impaired spermatogenesis (n=34, scores 1-7). Values are presented as mean ± SD. SD; Standard deviation.
CELL JOURNAL(Yakhteh), Vol 17, No 1, Spring 2015 125 mRNA Contents of YBX2 and JHDM2A on Testicular Tissue
A B
Fig.3: A. Scatter plots of CT of mRNA level of YBX2 (r=-0.7; p<0.001) and B. CT of mRNA level of JHDM2A (r=-0.4; p= 0.06). mRNA against score value for efficiency of spermatogenesis with regression lines. CT; Threshold cycle.
A B
C D
Fig.4: Typical photomicrographs of hematoxcylin and eosin (H&E) staining of tissues, magnification ×1000. A. Hyospermatogenesis, B. Maturation arrest in round spermatid stage, C. Maturation arrest in spermatocyt stage and D. Maturation arrest in spermatogony stage.
CELL JOURNAL(Yakhteh), Vol 17, No 1, Spring 2015 126 Najaf ipour et al.
Discussion azoospermia, severe oligozoospermia, and abnor- mal protamine expression. Their results showed Generally 5% of adult human males are affect- seven polymorphisms were present at a statisti- ed by male infertility, whereas, 75% are diag- cally higher frequency in patients with infertility, nosed as idiopathic due to unknown molecular particularly in men with abnormal protamine ex- mechanisms underlying the defects (12). Sper- pression. This study showed t hat YBX2 gene has matogenic cells are known through regulated a potential role in male spermatogenesis, leading spatiotemporal gene expression and strongly re- to male factor infertility (21). Our results, in the pressed translation in meiotic and haploid male same path, showed significant down-regulation of germ cells. A vast variety of molecules and pro- this gene in testicular tissues of azoospermic men teins are involved in these processes (13, 14). In this research, we investigated two of these with impaired spermatogenesis compared to men important molecules (YBX2 and JHDM2A). The with normal spermatogenesis (p<0.001) (Fig.1A, proteins encoded by these two genes express Table 2). There is asignificant negative correlation specifically and highly in testicular tissue and between the score for efficiency of spermatogene- are involved in functional regulation of some sis and the mean CT value of mRNA level of YBX2 strategicmeiotic and post meiotic genes. Contrin in our samples, indicating the role of this gene in (YBX2) is a transcription and translation regu- human spermatogenesis. Other regulatory factor latory factor and a germ-cell-specific molecule which was studied in this research was JHDM2A which is essential for the production of func- gene. Okada et al. (22) originally cloned this gene tional spermatozoa. as a testis-specific gene transcript. Their results showed an intense nuclear expression of this gene About the molecular function of this protein, an- in round spermatids and a sub-nuclear distribution. imal models and in vitro assay studies showed that Co-expression of JHDM2A gene with RNA poly- MSY2 acts as a transcription factor and an mRNA merase II indicates that this gene may contribute stabilizer which regulates expression of some tes- to transcriptional activation of some testis specific tis specific genes in transcription and translation genes. JHDM2A also stimulates TNP1 and PRM 1 level. In this regard, MSY2 marks specific -mR genes, by bonding to core promoter and remov- NAs (those transcribed from Y-box promoters) in ing H3K9 methylation. Histone demethylase JH- the nucleus for cytoplasmic storage, thereby links DM2A is critical for Tnp1 and PRM 1 transcription mRNA transcription and storage/translational de- and spermatogenesis (22). Jhdm2a-deficient mice lay. In this process, MSY2 recognizes the CTG ATTGGC/ TC/TAA sequence as a DNA motif in have shown infertility and smaller testes (23). De- the promoter of many genes that are specifically spite the fact that animal model studies showed the expressed in male germ cells. After MSY2 binds role of this protein in male infertility, expression to its consensus promoter sequence, binds to tran- ratio of this gene did not show significant differ- scripts of this gene. Subsequently this protein ence between azoospermic and fertile men sam- stabilizes and represses their translation as RNA- ples (p>0.05). Despite the negative correlation be- protein complexes (15-17). tween the efficiency score of spermatogenesis and the mean CT value of mRNA level of JHDM2A Yang et al. (18) generated Msy2-null mice. They in studied samples, this correlation was not sig- found that the mutant males had an abnormally nificant. Probably the role of this gene is not very high number of apoptotic meiotic spermatocytes, influential in human fertility; therefore, more sam- lacked spermatozoa in the epididymis, and were ples must be studied. sterile. Their results emphasized on the major role of this protein in male fertility. Meng et al. Conclusion (19) and Deng et al. (20) reported single nucleo- tide polymorphisms (SNP) of this gene in China’s Our findings indicated significant down-regula- population, while SNP frequency was significantly tion of YBX2 gene in testis tissue of azoospermic higher in infertile men compared to fertile ones. men, but future studies are needed to investigate In other study, Hammoud et al. (21) investigated the role of YBX2 and JHDM2A genes in regulating YBX2 gene alterations in blood samples of men some specific genes of testis involving in human with severe defects in spermatogenesis, including meiotic and post meiotic.
CELL JOURNAL(Yakhteh), Vol 17, No 1, Spring 2015 127 mRNA Contents of YBX2 and JHDM2A on Testicular Tissue
Acknowledgments 1970; 1(1): 2-25. 11. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C (T) method. Nat Protoc. 2008; 3(6): The authors wish to express their sincere 1101-1108. thanks to all patients and normal individuals for 12. Okada H, Tajima A, Shichiri K, Tanaka A, Tanaka K, Inoue their contribution. Also we express our appre- I. Genome-wide expression of azoospermia testes dem- onstrates a specific profile and implicates ART3 in genetic ciation to Mrs. Z. Rezaeian and Dr. P. Fallahi for susceptibility. PLoS Genet. 2008; 4(2): e26. arrangements of sample collection and prepara- 13. Sun F, Turek P, Greene C, Ko E, Rademaker A, Martin tion. This article was financially supported by RH. Abnormal progression through meiosis in men with nonobstructive azoospermia. Fertil Steril. 2007; 87(3): the University of Qazvin. The authors declared 565-571. no potential conflicts of interest with respect to 14. Sun F, Trpkov K, Rademaker A, Ko E, Martin RH. Varia- the research, authorship, and/or publication of tion in meiotic recombination frequencies among human males. Hum Genet. 2005; 116(3): 172-178. this article. 15. Yang J, Medvedev S, Reddi PP, Schultz RM, Hecht NB. The DNA/RNA-binding protein MSY2 marks specific tran- References scripts for cytoplasmic storage in mouse male germ cells. Proc Natl Acad Sci USA. 2005; 102(5): 1513-1518. 1. Gu W, Tekur S, Reinbold R, Eppig JJ, Choi YC, Zheng JZ, 16. Kwon YK, Murray M, Hecht NB. Proteins homologous to et al. Mammalian male and female germ cells express a the Xenopus germ cell-specific RNA-binding proteins p54/ germ cell-specific Y-box protein MSY2. Biol Reprod. 1998; p56 are temporally expressed in mouse male germ cells. 59(5): 1266-1274. D e v B i o l . 1 9 9 3 ; 1 5 8 ( 1 ) : 9 9 - 1 0 0 . 2. Wolffe AP. Structural and functional properties of the evo- 17. Horvath GC, Kistler WS, Kistler MK. RFX2 is a potential lutionarily ancient Y-box family of nucleic acid binding pro- transcriptional regulatory factor for histone H1t and other teins. Bioessays. 1994; 16(4): 245-251. genes expressed during the meiotic phase of spermato- 3. Tekur S, Pawlak A, Guellaen G, Hecht NB. Contrin, the g e n e s i s . B i o l R e p r o d . 2 0 0 4 ; 7 1 ( 5 ) : 1 5 5 1 - 1 5 5 9 . human homologue of a germ-cell Y-box-binding protein: 18. Yang J, Medvedev S, Yu J, Tang LC, Agno JE, Matzuk cloning, expression, and chromosomal localization. J An- MM, et al. Absence of the DNA-/ RNA-binding protein drol. 1999; 20(1): 135-144. MSY2 results in male and female infertility. Proc Natl Acad 4. Bettegowda A, Wilkinson MF. Transcription and post-tran- Sci USA. 2005; 102(16): 5755-5760. scriptional regulation of spermatogenesis. Philos Trans R 19. Meng X, Xue Y, Sun D, Li P, Fu S. Study on the distribu- Soc Lond B Biol Sci. 2010; 365(1546): 1637-1651. tion of the MSY2 polymorphism in 9 Chinese populations. 5. Minshall N, Thom G, Standart N. A conserved role of a Anthropol Anz. 2005; 63(1): 23-27. DEAD box helicase in mRNA masking. RNA. 2001; 7(12): 20. Deng Y, Zhang W, Su D, Yang Y, Ma Y, Zhang H, et al. Some 1728-1742. 6. Nikolajczyk BS, Murray MT, Hecht NB. A mouse homo- single nucleotide polymorphisms of MSY2 gene might con- logue of the Xenopus germ cell-specific ribonucleic acid/ tribute to susceptibility to spermatogenic impairment in idi- deoxyribonucleic acid-binding proteins p54/p56 interacts opathic infertile men. Urology. 2008; 71(5): 878-882. with the protamin 2 promoter. Biol Reprod. 1995; 52(3): 21. Hammoud S, Emery BR, Dunn D, Weiss RB, Carrell DT. 524-530. Sequence alterations in the YBX2 gene are associated 7. Klose RJ, Kallin EM, Zhang Y. JmjC-domain-containing with male factor infertility. Fertil Steril. 2009; 91(4): 1090- proteins and histone demethylation. Nat Rev Genet. 2006; 1095. 7(9): 715-727. 22. Okada Y, Scott G, Ray MK, Mishina Y, Zhang Y. Histone 8. Martins RP, Ostermeier GC, Krawetz SA. Nuclear matrix demethylase JHDM2A is critical for Tnp1 and Prm1 tran- interactions at the human protamine domain: a working scription and spermatogenesis. Nature. 2007; 450(7166): model of potentiation. J Biol Chem. 2004; 279(50): 51862- 119-123. 51868. 23. Tachibana M, Nozaki M, Takeda N, Shinkai Y. Functional 9. Godmann M, Lambrot R, Kimmins S. The dynamic epige- dynamics of H3K9 methylation during meiotic prophase netic program in male germ cells: its role in spermatogen- progression. EMBO J. 2007; 26(14): 3346-3359. esis, testis cancer, and its response to the environment. 24. Inagaki T, Tachibana M, Magoori K, Kudo H, Tanaka T, Microsc Res Tech. 2009; 72(8): 603-619. Okamura M, et al. Obesity and metabolic syndrome in his- 10. Johnsen SG. Testicular biopsy score count--a method for tone demethylase JHDM2a-deficient mice. Genes Cells. registration of spermatogenesis in human testis: normal 2009; 14(8): 991-1001. values and results in 325 hypogonadal males. Hormones.
CELL JOURNAL(Yakhteh), Vol 17, No 1, Spring 2015 128