Page 1 of 51 Diabetes
RNA binding protein, Ybx2, regulates RNA stability during cold induced brown fat activation Dan Xu1,2*, Shaohai Xu3, Aung Maung Maung Kyaw2, Yen Ching Lim1, Sook Yoong Chia2, Diana Teh Chee Siang2, Juan R. Alvarez Dominguez5, Peng Chen3, Melvin Khee Shing Leow6,7,8, Lei Sun2,4*
1School of Laboratory Medicine and Life Science, Wenzhou Medical University, Wenzhou, Zhejiang 325035, China 2Cardiovascular and Metabolic Disorders Program, Duke NUS Medical School, 8 College Road, Singapore 169857, Singapore 3Division of Bioengineering, Nanyang Technological University, 70 Nanyang Drive, Singapore 637457, Singapore 4Institute of Molecular and Cell Biology, 61 Biopolis Drive, Proteos, Singapore 138673, Singapore 5Department of Stem Cell and Regenerative Biology, Harvard Stem Cell Institute, Harvard University, 7 Divinity Avenue, Cambridge, MA 02138, USA 6Clinical Nutrition Research Centre, Singapore Institute for Clinical Sciences, Agency for Science, Technology and Research (A*STAR), Singapore, Republic of Singapore. 7Department of Endocrinology, Tan Tock Seng Hospital, 11 Jalan Tan Tock Seng, Singapore 308433, Singapore 8Office of Clinical Sciences, Duke NUS Medical School, 8 College Road, Singapore 169857, Singapore
*Correspondence: [email protected] (D.X.); sun.lei@duke nus.edu.sg (L.S.)
Diabetes Publish Ahead of Print, published online September 29, 2017 Diabetes Page 2 of 51
Abstract
Recent years have seen an upsurge of interest on brown adipose tissue (BAT) to combat the epidemic of obesity and diabetes. How its development and activation are regulated at the post transcriptional level, however, has yet to be fully understood. RNA binding proteins (RBPs) lie in the center of post transcriptional regulation. To systemically study the role of RBPs in BAT, we profiled >400 RBPs in different adipose depots and identified Y box binding protein 2 (Ybx2) as a novel regulator in BAT activation. Knockdown of Ybx2 blocks brown adipogenesis, while its overexpression promotes BAT marker expression in brown and white adipocytes. Ybx2 knockout mice could form BAT but failed to express a full thermogenic program. Integrative analysis of RNA seq and RNA immunoprecipitation study revealed a set of Ybx2’s mRNA targets, including Pgc1α, that were destabilized by Ybx2 depletion during cold induced activation. Thus, Ybx2 is a novel regulator that controls BAT activation by regulating mRNA stability.
Page 3 of 51 Diabetes
INTRODUCTION Obesity has reached an epidemic scale in many countries, resulting in a steep escalation in health care expenditure and a growing burden of chronic obesity related morbidities(1). An attractive approach to improve metabolic health is to augment the mass and activity of brown adipose tissue (BAT)(2 7). There are at least two types of thermogenic adipocytes in mammals, namely, classical brown adipocytes and inducible/beige adipocytes. Classical BAT is located as a discernible depot in the interscapular region in small mammals and human infants. Beige/inducible adipocytes exist in defined anatomical white adipose tissue (WAT) depots, particularly in subcutaneous WAT, and express a gene program more like WAT at thermoneutrality. In response to prolonged cold exposure, chronic treatment of β adrenergic receptor agonist, or intensive exercise, the number of beige adipocytes dramatically increases, accompanied by enhanced Ucp1 levels and mitochondria biogenesis, a process known as “browning” (2; 5; 6).
Understanding the detailed mechanisms underlying BAT differentiation and function is an area of immense research interest. A vast array of factors has been identified that regulate BAT development and activity by acting at the transcriptional level(6 16). How these processes are regulated at the post transcriptional level, however, has yet to be fully understood. RNA binding proteins (RBPs) comprise a large and diverse group(17; 18) that lie at the center of posttranscriptional regulation by governing the fate of mRNA transcripts from biogenesis, stabilization, translation to RNA decay. Several RBPs have been reported to modulate adipocyte development and lipid metabolism. SFRS10 (splicing factor arginine/serine rich10) inhibits lipogenesis by controlling the alternative splicing of LPIN1, a key regulator in lipid metabolism(19; 20). Sam68 (the Src associated substrate during mitosis of 68 kDa) is required for white adipose tissue (WAT) adipogenesis by regulating mTOR alternative splicing(21). Knockout of KSRP (KH type splicing regulatory protein) promotes browning of WAT by reducing miR 150 expression(22). IGF2 mRNA binding protein 2 (IGF2BP2) is a widely expressed RBP and a SNP in its intron is associated with type 2 diabetes mellitus by GWAS studies(23). Knockout of IGF2BP2 results in resistance to diet induced obesity, largely due to an enhanced translational efficiency of Ucp1 and other mitochondria mRNAs in the knockout BAT(24). Recently, paraspeckle component 1 (PSPC1) was identified as an essential RBP for adipose differentiation in vitro and in vivo by regulating the export of adipogenic RNA from nucleus to cytosol (25). Despite these advances, our understanding of RBPs in adipocytes, particularly in brown adipocytes, is still at its early stage and the functions of most RBPs remain unknown.
In this study, we systemically profiled 413 RBPs in different fat depots, during white fat browning and brown adipogenesis, and identified 5 BAT enriched RBPs. We demonstrated Diabetes Page 4 of 51
the role of Ybx2 in development and activation of BAT in vitro and in vivo, which could be, at least partially, explained by stabilizing mRNA.
METHODS Animal Studies Ybx2 heterozygous mice (NSA (CF-1) Background) were originally imported from Dr. Paula Stein in University of Pennsylvania. C57BL6 mice were obtained from The Jackson Laboratory and subsequently bred in house. All mice were maintained at the animal vivarium at DUKE NUS Medical School. For cold challenge experiments, animals were housed individually in a 4oC chamber for 6 hours. The rectal body temperature was recorded with a probe thermometer (Advance Technology) at a constant depth. All animal experimental protocols were approved by the Singapore SingHealth Research Facilities Institutional Animal Care and Use Committee.
Glucose tolerance test (GTT) and Insulin tolerance test (ITT) was performed as described before (26) and EchoMRI was used to measure fat and lean mass. For in vivo insulin signalling study, Ybx2 KO and WT mice were fasted for 6hr at RT or 4oC. Then the mice were injected with insulin (1 U per kg body weight). After 5 min, mice were sacrificed and BAT were collected. Lipolysis assay was performed as described before (26).
Cell culture 293T cells for retroviral packing were cultured in Dulbecco's modified Eagle medium containing 10% fetal bovine serum (FBS) (HyClone™). Primary brown and white pre adipocytes were isolated from 3 4 week old C57BL6 mice. The procedure for pre adipocytes isolation, culture and differentiation and Oil Red O staining was described previously (26). Human primary interscapular brown adipocytes were obtained from Zenbio Inc and cultured and differentiated as previously described (27).
Retrovirus transduction A MSCV based retroviral vector (MSCV pgkGFP U3 U6P Bbs vector)(28) was used to generate shRNAs to infect preadipocytes; XZ201 vector(29) was used to overexpress Ybx2 for gain of function studies. All the retroviruses were packaged in 293T cells with the pCL eco packaging vector and then used to transduce pre adipocytes in the presence of 4 mg/ml polybrene (Sigma), followed by induction of differentiation. FuGENE® 6 Transfection Reagent (Promega) was used for plasmid transfection according to manufacturer’s instruction.
RNA immunoprecipitation (RIP). Primary brown and white adipocytes were infected with retroviral Ybx2 and differentiated for 4 days. RNA immunoprecipitation was performed using Magna RIP kit (Merck Millipore) Page 5 of 51 Diabetes
according to manufacturer’s instruction. RNA samples retrieved from Anti Ybx2 (Abcam) and IgG control with Magna RIP kit were used for RNA seq.
RNA pull down RNA pull down was performed according to our published protocol with a few modifications (30). In this study, we used tissue lysate from mouse BAT instead of primary cell culture prepared as described above. The tissue lysate was prepared as described in the RIP section. The rest of the experiment followed our published protocol (30).
Extracellular Flux Analysis Primary brown pre adipocytes were seeded in an X 24 cell culture plate, infected by retroviral constructs as indicated in the text, followed by induction of differentiation. Differentiated cells were analyzed by Extracellular Flux Analyzer (Seahorse bioscience) according to the manufacturer's instructions. Oxygen consumption rates were normalized by protein concentration.
Animals were kept at 4oC for 6 hours before experiment. BAT and skeletal muscle (Gastrocnemius) were harvested and minced with micro mincer (Glen Mills Inc). The minced tissue was kept in ice chilled mitochondrial respiration media (MiR05) (EGTA 0.5mM, MgCl2.6H2O 3mM, Lactobionic acid 60mM, Taurine 20mM, KH2PO4 10mM, HEPES 20mM, D Sucrose 110mM, BSA 1g/l). 2mg and 10mg tissue lysate, respectively, was immediately loaded into Oroboros Respirometry together with substrates including Glutamate, Malate, Pyruvate and ADP (10mM, 2mM, 5mM, ADP 5mM, respectively). OCR was monitored at basal level and when the samples were treated with different drugs Oligomycin(5mM), FCCP (1uM), and Antimycin (5mM).
Western Blot Western blot were performed to detect target proteins using Ybx2 (Abcam), Gapdh (Abcam), Ucp 1(Abcam), Pgc1α (Santa Cruz), Cidea (Santa Cruz), Pparϒ (Santa Cruz), P AKT (Cell signalling), AKT (Cell Signalling), Cpt1a (Proteintech), MCad (Santa Cruz) , β actin (Sigma), Tubulin (Cell signalling) antibodies.
Gene Ontology analysis and GSEA Gene lists were analyzed for enrichment of Gene Ontology (GO) terms using DAVID Functional Annotation Tools (31; 32). Gene set enrichment analysis (GSEA)(33) was performed using default parameters with the pre ranked gene sets.
RNA decay analysis Diabetes Page 6 of 51
Brown preadipocytes were cultured and differentiated for 5 days. We treated cells with 5ug/ml Actinomycin D (Sigma) and harvested RNA at different time points indicated in the figures. We took the same proportion of RNA from each sample at different time point, conducted reverse transcription with random primers and realtime PCR. CTs from each sample were used to calculate the remaining percentage of mRNA at each point. We fit these data into a first phase decay model to derive mRNAs’ half life.
Yt=(Y0 Plateau)*exp( kdecay*t) + Plateau
Yt, the remaining percentage at a given time
Y0, the initial amount of RNA t, time after transcription inhibition kdecay, the rate constant
Statistical analysis Data are presented as mean ± SEM. Statistical significance was assessed using the unpaired, 2 tailed Student t test. Statistical significance for samples with more than 2 groups was determined by one way ANOVA. The distribution difference between different cumulative curves was determined by Kolmogorov Smirnov Test. P values of < .05 were considered to be significant.
ACCESSION NUMBERS The accession number for the RNA seq data reported in this paper is NCBI GEO: GSE66686, GSE29899, GSE86590, GSE86338
RESULTS Genome wide identification of BAT enriched RBPs To identify RNA binding proteins (RBPs) functionally important for BAT, we profiled the gene expression of 413 RBPs annotated in the RBP database(18) in interscapular BAT, inguinal WAT (iWAT) and epididymal WAT (eWAT), which led to identification of 26 BAT enriched RBPs. To further assess whether these RBPs are dynamically regulated during WAT browning and brown adipogenesis, we examined their expression alternation during inguinal WAT browning induced by a β3 agonist (CL 316, 243), and in primary brown preadipocytes vs mature adipocytes. By intersecting these gene sets, we discovered 6 BAT enriched RBPs that were induced during browning and brown adipogenesis, including Pgc1β, Larp4, Rbpms2, Grsf1, Akap1 and Ybx2 F (Fig. 1A D), for further investigation.
Because Pgc1β is not a typical RBP, we excluded it from our subsequent experiments. For the other 5 candidates, their tissue enrichment and dynamic regulation during WAT browning were successfully validated by real time PCR across 15 major mice organs (Fig. 1E) and in inguinal WAT after housing animals for 7 days at 4oC (Fig. 1G). In BAT, only Ybx2 was significantly induced upon cold treatment (Fig. 1F). To test whether these RBPs were Page 7 of 51 Diabetes
repressed upon BAT and beige fat inactivation, we housed mice at thermoneutrality (30oC) for 7 days to induce “whitening” of BAT and iWAT. All 5 RBPs were down regulated during BAT and iWAT “whitening” (Fig 1H I). Next, we examined their expression during an in vitro differentiation time course of primary brown and white adipocyte culture. All 5 RBPs were up regulated during brown and white adipogenesis, with a higher expression level in brown adipocytes (Fig. 1J). Finally, to test the human relevance of these observations, we examined their expression across a differentiation time course of primary preadipocytes isolated from human fetal interscapular BAT and subcutaneous WAT(27). The expression of YBX2 and RBPMS2 increased throughout the human cell differentiation course with higher levels in BAT adipocytes. AKAP1 exhibited a significant induction from Day 0 to Day 7 and then decreased towards the end of differentiation, but its level was still higher in brown adipocytes than white adipocytes (Fig. 1K).
To investigate the function of these 5 RBPs in brown adipocyte differentiation, we depleted them by infecting brown preadipocytes with retroviral shRNAs and then induced cells to differentiate for 5 days. Depletion of each of these RBPs resulted in distinct phenotypes. Knocking down Ybx2 expression by ~90% (sh 3) severely blocked lipid accumulation (Fig. 2A) and reduced the expression of pan adipogenic markers Fabp4 and PparΥ2, indicating a block of pan adipogenesis gene program, while inhibiting Ybx2 by ~70% (sh 1) affected BAT markers but didn’t affect pan marker expression and lipid accumulation (Fig.2B), suggesting that the expression of BAT selective genes is more sensitive to Ybx2 depletion. To determine the role of Ybx2 in cellular respiration, we inhibited its expression by ~70% (sh 1) in brown adipocytes, and used the Seahorse XFp Extracellular Flux Analyzer to measure the oxygen consumption rate (OCR). A significant decrease of ORC for basal respiration and proton leakage was observed (Fig. 2E).
While knockdown of Akap1 slightly reduced lipids accumulation (Fig. 2A), it didn’t affect pan adipogenic marker expression but the BAT selective markers were down regulated (Fig. 2C, Fig S1A). Inhibiting Rbpms2 had a slightly influence on lipid accumulation (Fig. 2A) and pan adipogenic marker expression (Fig. 2D), but stronger effects on BAT selective markers (Fig. 2D, Fig S1A). Consistently, OCR analysis showed a significant decrease of OCR attributed to proton leak in the Rbpms2 and Akap1 depleted cells (Fig. S1B, C). In contrast, Inhibiting Grsf1 and Larp4, didn’t affect lipid accumulation (not shown) or marker expression (Fig. S2A D).
Ybx2 is an essential regulator of brown adipocyte differentiation in vitro Ybx2 harbors an ultra conserved cold shock RNA binding domain (CSD). Proteins bearing CSDs, known as cold shock proteins, have been reported to regulate cellular adaptation response, mainly at posttranscriptional levels, to cold stress in prokaryotes(34; 35). Because Diabetes Page 8 of 51
BAT is a major organ for cold adaption in mammals, the presence of CSD in Ybx2 suggests that Ybx2 may play a role in BAT thermogenesis. We validated the expression of Ybx2 at the protein level by Western blot in different adipose depots (Fig. 4A) and during brown and white adipogenesis (Fig. 2F). Consistent with its mRNA expression pattern, Ybx2 protein level is higher in BAT and induced during differentiation. To determine its function in beige adipocytes, we knocked it down in preadipocytes isolated from inguinal WAT, followed by induction of differentiation, and observed a clear reduction of BAT markers (Fig. S2E G). To ensure the phenotypes of Ybx2 knockdown are not due to off targeting effect, we further targeted different regions in its mRNA using a different shRNA retroviral vector. Inhibiting Ybx2 invariably impaired lipid accumulation and BAT marker expression in both BAT and iWAT adipocyte cultures (Fig. S2H L).
We next tested whether Ybx2 is sufficient to promote beige and brown adipogenesis by overexpressing Ybx2 in primary white and brown preadipocytes with retroviral vector (Fig. 3A,D), followed by induction of differentiation. Ectopic expression of Ybx2 in white adipocytes enhanced lipid accumulation assessed by bodipy staining (Fig. 3B) and increased the expression of key BAT markers such as Ucp1 and Pgc1α (Fig. 3C). Overexpression of Ybx2 in primary brown adipocyte culture also enhanced lipid accumulation (Fig. 3E) and BAT marker expression (Fig. 3F) in the early phase of differentiation (day 3), which was accompanied by a higher basal ORC and proton leakage ORC (Fig3 G). Western blot showed elevated protein levels of Ucp1 and two fatty acid oxidization regulators, Mcad and Cpt1a at day 3 of differentiation (Fig 3H). After 6 days of differentiation, the expression of BAT markers in control cells caught up with that in the Ybx2 overexpressing cells, probably because the abundance of endogenous Ybx2 at this stage is sufficient to support full induction of the BAT selective gene program. Taken together, these observations indicate that Ybx2 can promote brown adipogenesis in white adipocyte culture and accelerate brown adipogenesis in brown adipocyte culture.
Ybx2 is needed for full BAT development in vivo To determine the function of Ybx2 in BAT in vivo, we imported Ybx2 knockout (KO) mice. Knockout animals were infertile(36) but viable and born at expected Mendelian ratios. We confirmed their lack of Ybx2 by Western blot (Fig. 4A). Knockout animals didn’t exhibit significant alternation in their body weight (Fig. 4B), fat and lean mass (Fig. S3A, B). The iWAT and eWAT of KO animals didn’t change significantly in size either (Fig. S3C, D), whereas their iBATs were moderately but significantly smaller (Fig. 4B), coincident with slightly smaller lipid droplets under microscope (Fig. 4C, D). To study the effect of Ybx2 knockout at the molecular level, we quantified the expression of pan adipogenic and BAT selective marker genes by real time PCR, and observed no change in pan adipogenic markers (Fig. S3E) but a detectable decrease in Ucp1, Prdm16 and Dio2 (Fig. S3F). RNA Page 9 of 51 Diabetes
seq was performed to examine the global effects of Ybx2 KO on gene expression, but very few genes showed significant difference (Supplemental File 2), indicating that Ybx2 is dispensable for BAT to maintain its gene expression program at room temperature. In iWAT, we didn’t observe significant change of BAT selective markers as well as a WAT marker, HoxC10 (Fig. S3G). Glucose tolerance test (GTT) revealed a glucose intolerance (Fig. S3H); Insulin tolerance test (ITT) detected a trend of insulin intolerance but the difference was not statistically significant (Fig. S3H). Nevertheless, to what extent the impaired glucose tolerance can be accounted by a smaller BAT or by systemic effects from other organs needs to be investigated in the future.
Since whole body Ybx2 deficiency may have indirect effects on BAT phenotypes, to confirm whether Ybx2 knockout may exert cell autonomous effect, we isolated brown pre adipocytes from KO and WT mice for differentiation. Real time PCR revealed decreased expression of pan adipogenic markers and a more significant reduction of BAT selective markers in the KO cells (Fig. S4A C), consistent with the shRNA knockdown phenotypes. RNA seq was then performed to profile the genome wide effect of Ybx2 KO, and gene set enrichment analysis (GSEA) revealed that the pathways of adipogenesis, fatty acid oxidation, oxidative phosphorylation and cellular respiration were significantly down regulated (Fig. S4D). Thus, Ybx2 should have cell autonomous effects on brown adipocyte differentiation in vitro but such an effect was much ameliorated in vivo.
Ybx2 is required for cold induced BAT activation To determine the role of Ybx2 in BAT activation, we exposed WT and KO animals to 4oC for 6 hours. The WT BAT mass upon cold activation became smaller than that at room temperature, but the KO BAT mass didn’t decrease after cold exposure (Fig. 4E). Consistently, Hematoxylin and Eosin staining revealed that lipids in WT BAT but not the KO BAT were largely depleted (Fig.4F G), indicating that the KO BAT failed to combust lipids upon cold activation. To directly assess the effects of Ybx2 KO’s function, we measured the OCRs for cold activated WT and KO BAT with Oroboros respirometry. We observed a decreased OCR in KO BAT before but not after Fccp treatment, which suggested that loss of Ybx2 didn’t change the maximal OCR capacity but reduced the cold provoked mitochondria activity (Fig. S5A). Consistently the core body temperature of KO mice dropped faster than that of WT animals at cold temperature (Fig. 4H). Although the BAT defect is a certain culprit of the cold intolerance, we can not preclude the possibility that the effect of Ybx2 KO on other organs can also contribute to this phenotype.
We examined the lipolysis rates in the WT and KO BAT and didn’t observe any significant change (Fig S5B), indicating that the larger BAT mass in the KO BAT is unlikely due to any change in lipolysis. In addition, to test whether loss of Ybx2 affects insulin signaling in BAT, we performed Western blot to detect p AKT in BAT and found that cold challenge could Diabetes Page 10 of 51
enhance the insulin sensitivity in WT but not in KO BAT (Figure S5C). To test whether Ybx2 KO may affect BAT selective gene expression in beige adipocytes, we performed real time PCR for iWATs and found a significant down regulation of Ucp1 but not other detected markers (Figure S5D).
To examine the effect of Ybx2 on BAT activation at the molecular level, we conducted RNA seq of BAT isolated from WT and KO mice at both room temperature and after cold activation. One of the most striking observations was that the cold induced thermogenic program in BAT was severely hindered in KO animals. Ucp1, Dio2, Pgc1α, and Elvol3 were among the most significantly depleted genes in KO upon cold exposure (Fig. 5A, S6A), which we validated by real time PCR and Western blot (Fig. 5C, D). Consistent with the individual markers, pathways analysis revealed that one of the most enriched pathways associated with the down regulated genes is oxidation reduction (Fig. 5B).
To integrate the gene expression profiles at room temperature and after cold exposure, we calculated the fold change of each gene after cold exposure in both WT and KO BAT (Fig. S6B), and looked for enriched pathways among the most differentially regulated genes. The mitochondrion and fatty acid metabolic process pathways were among the top down regulated pathways (Fig. S6C). Importantly, the BAT mass and gene expression changes in KO animals were not gender dependent and were also observed among female animals (Fig. S7A D). Thus, although BAT can still form in the absence of Ybx2, its thermogenic response to cold temperature is impaired.
As a part of BAT adaptation to cold exposure, glucose uptake, lipogenesis and combustion of long chain fatty acids (LCFAs) are increased in coordination with stimulation of β oxidation and thermogenesis(37; 38). In Ybx2 KO BAT, besides thermogenic genes, those involved in glucose uptake (Glut4), lipogenesis (Scd1, Fasn, Dgat1, Dgat2, Acaca) and long chain fatty acid generation (Elvol3, Elvol6) were also reduced (Fig. 5E, S7E), which was further supported by pathway analysis (Fig. 5B, S6C). Thus, Ybx2 is a regulator orchestrating glucose metabolism, lipid metabolism and thermogenesis during BAT activation.
Ybx2 stabilizes mRNA targets encoding proteins enriched for mitochondrial functions To identify the mRNA targets of Ybx2, we performed RNA immunoprecipitation followed by RNA seq (RIP Seq) using an antibody against Ybx2 in both brown and white adipocyte culture (Fig. S8A). First, we confirmed the successful Ybx2 precipitation by Western blot (Fig. 6A). We then selected candidates with at least 8 fold enrichment in the Ybx2 IP sample compared with IgG control, which revealed 800 and 1822 potential mRNA targets in BAT and WAT, respectively. Targets in BAT and WAT significantly overlapped, leading to identification of 414 common targets (Fig. 6B). As expected, Ybx2 can target many mRNAs encoding proteins involved in post transcriptional RNA processing, a general feature of Page 11 of 51 Diabetes
RBPs(39 42). Functional terms enriched among Ybx2 targets include ribosome, ribonucleoprotein complex and translation (Fig. 6C). Interestingly, these targets were also enriched for mitochondria term (Fig. 6C). To further confirm this observation, we calculated the relative abundance of each mRNA in Ybx2 vs IgG sample and plotted the cumulative distributions for mitochondrion related genes (206 genes) as well as for all genes detectable in the RIP seq assay (4095 genes). The cumulative curve of mitochondrion significantly shifts towards the right (Fig. 6D), confirming that Ybx2’s targets are enriched for mitochondrial functions.
Next, we asked if Ybx2 exerts a functional impact on its mRNA targets. Utilizing RNA seq data, we calculated the fold change of each mRNA between KO vs. WT BAT, and plotted the cumulative distributions for Ybx2 target and non target mRNAs. At room temperature, targets and non targets distributions didn’t show significant difference (Fig. 6E), but upon cold activation, Ybx2’s targets were markedly repressed in KO BAT (Fig. 6F). These data support a role of Ybx2 in stabilizing its target mRNAs, which was suggested by earlier work in ooctyes(43).
Ybx2 targets and stabilizes Pgc1α mRNA Among the top Ybx2 targets was the Pgc1α mRNA that is significantly decreased in KO BAT. We used Pgc1α as an example to illustrate how Ybx2 recognizes and affects its targets. To confirm binding between Pgc1α mRNA and Ybx2 in vivo, we performed the RIP PCR in tissue lysate from KO and WT BAT to detect Pgc1α mRNA precipitated by Ybx2. A clear reduction of Pgc1α signal was detected in RIP from KO BAT, while such a reduction was not observed for Fabp4 mRNA, which bears a short 3’UTR (180bp) and is used as a control (Fig. 7A). To dissect Ybx2 binding sites within Pgc1α mRNA, we performed RNA pulldown assay using 4 in vitro transcribed sequential RNA fragments from Pgc1α 3’UTR and found that a 1101nt RNA fragment (fragment 3) can readily retrieve Ybx2 protein (Fig. 7B). We then generated 8 small RNA fragments (200 300bp) from this segment for a second round of pulldown assays, and found that fragments 3.1, 3.3, 3.5 and 3.7 can retrieve Ybx2 (Fig. 7C). Intersecting segments 3.1 vs. 3.5, and 3.3 vs. 3.7 locate two Ybx2 binding sites harboring regions. Further truncation of these two fragments abolished their interactions with Ybx2 (data not shown), suggesting that a secondary or tertiary nucleotide structure may be necessary for Ybx2 binding. To test whether this identified RNA fragment can define the Ybx2 binding site in human, we blasted the human Pgc1α 3’UTR and mouse Pgc1α 3’UTR and identified a ~1kb segment with >90% homologous to the fragment 3 in Figure 7B (Fig 7D). We cloned this fragment for pulldown assay. As expected, this fragment can retrieve Ybx2 in BAT lysate (Fig 7D), indicating that the Ybx2 Pgc1α interaction is conserved.
To test whether the interactions between Ybx2 and Pgc1α is enhanced at cold exposure, we performed RIP PCR in BAT before and after cold exposure, and found that Ybx2 could Diabetes Page 12 of 51
retrieve more Pgc1α mRNAs upon cold exposure (Fig 7E). To further study whether this apparent increase is due to an enhanced binding affinity or an elevated Pgc1α mRNA abundance upon cold exposure, we inhibited transcription with Actinomycin D in cultured brown adipocytes and then performed RIP PCR to detect the Ybx2 Pgc1α mRNA interaction in the presence or absence of norepinephrine treatment. Interestingly, in the Actinomycin D treatment cells, the Pgc1α mRNA retrieved by Ybx2 antibody was similar before and after norepinephrine treatment (Figure S8B). Therefore, BAT activation likely increases the Ybx2 retrived Pgc1α mRNA by stimulating Pgc1α mRNA expression but not by changing their binding affinity.
To examine the influence of Ybx2 knockout on Pgc1α mRNA stability, we used Actinomycin D to stop mRNA transcription in WT and KO brown adipocyte culture and measured the decay rates for Pgc1α and Fabp4 mRNA. The half life of Pgc1α mRNA decreased from 2.39 to 1.29 hours in the absence of Ybx2 (Fig. 7F), supporting a role of Ybx2 in stabilizing Pgc1α mRNA. To investigate whether the above identified Ybx2 binding sites in Pgc1α 3’UTR can mediate the mRNA stabilizing effect from Ybx2, we constructed two reporter plasmids: one containing a ~2kb Pgc1α 3’UTR after the renilla luciferase (WT) and another containing a truncated 3’UTR without the Ybx2 binding fragment (Mutant). We measured the decay rates of the renilla luciferase mRNA in 293 cells in the presence and absence of a Ybx2 expressing vector. In the absence of Ybx2, both reporter constructs manifested similar decay rates (Fig S8C); in the presence of Ybx2, the mRNA decay rate of the WT reporter is ~2 fold slower than that of the mutant reporter (~8.4 hours vs. ~4.1 hours), indicating our identified Ybx2 binding sites (Fig 7B,C) in the Pgc1α 3’UTR is required for Ybx2’s mRNA stabilization function.
We further examined the functional interactions between Ybx2 and Pgc1α by overexpressing a full length ORF Pgc1α in the Ybx2 inhibited brown adipocytes. As described above (Fig 2B), knockdown of Ybx2 reduced BAT marker expression, but Pgc1α overexpression could significantly rescue the phenotype (Fig 7G). Therefore, although stabilizing Pgc1α alone is unlikely to account for all the phenotypes of Ybx2 KO, Ybx2 may be a key target of Ybx2 and Ybx2’s function at some extent relies on Pgc1α expression.
DISCUSSION Early studies have suggested a role of Ybx2 in global mRNA stabilization. Schultz group knocked down Ybx2 in oocytes by expressing a transgenic Ybx2 hairpin dsRNA. They observed 60% reduction of Ybx2 protein and 75 80% reduction of poly (A) mRNAs(44). In another study, they generated a knockout strain and observed severe defects in spermatogenesis and oocyte development(36), accompanied by a ~25% decrease of mRNAs in the mutant oocytes(43). Exogenous mRNAs injected into mutant oocytes were Page 13 of 51 Diabetes
lower than that in wild type cells, consistent with a decreased mRNA stability in the absence of Ybx2(43). This is consistent with our conclusion which demonstrated a role of Ybx2 in enhancing mRNA stability in a more systemic manner (Fig 6F).
As a RBP, Ybx2 may affect multiple RNA processing steps including but not limited to RNA stability. Given its cytosol localization (Fig S9C), it is not surprising if Ybx2 can influence translational control for certain mRNAs. This may explain why the changes in mRNA and protein levels for some genes, to some extent, may display discordance. The potential influence of Ybx2 on translation will be further studied in the future.
Skeletal muscle is known to contribute to non shivering thermogenesis (NST) mainly through Sarcolipin mediated ATP hydrolysis by SERCA(45; 46). To examine whether Ybx2 KO can alter this pathway, we examined the NST genes in muscles. Despite an increase of Sarcolipin expression observed in KO muscle, Ybx2 KO did not affect Serca1 3 expression (Fig S9A) and OCRs(Fig S9B) directly measured by Oroboros respirometry. Therefore, although it is unclear whether the increase of Sarcolipin expression in muscle is due to a tissue autonomous effect or a cross organ response to the compromised KO BAT, the NTS function of muscle was not altered.
In sum, we profiled the expression of >400 RBPs across different fat depots, during adipogenesis and WAT browning, and identified Ybx2, a CSD containing protein that orchestrates BAT activation. CSD containing proteins are among the most phylogenetically conserved families and are known for their role in cold adaptation in prokaryotes (34; 35). Because BAT activation is a part of cold adaptation in mammals, we speculated that CSD proteins, exemplified by Ybx2, may be evolutionarily conserved to mediate cold adaptation at the whole organismal level via roles in BAT activation.
Diabetes Page 14 of 51
FIGURE LEGENDS Fig. 1. Genome wide identification of BAT enriched RBPs. (A C) Gene expression of RBPs by RNA seq in (A) BAT, iWAT and eWAT, (B) during iWAT browning, and (C) primary brown preadipocyte and mature adipocytes. Heatmaps showed the row mean centred abundance. (D) Selection of gene expression from profiling studies A C, plotted in Venn diagrams. (E) Real time PCR validation of gene expression for 5 RBPs across 15 mouse organs. Heatmap shows the row mean centered expression. (F) Gene expression of RBPs by real time PCR in BAT and (G) iWAT after housing mice (8 weeks old) at 4oC for 7 days. n=6 (H, I) Gene expression of RBPs by real time PCR in (H) BAT and (I) iWAT after housing mice (8 weeks old) at 30oC for 7 days. Mouse housed at RT (Room temperature) was used as control group n=5 per group. (J) Gene expression of RBPs during the differentiation of mouse primary brown and white adipocyte cultures. n=4. (K) Gene expression of RBPs by real time PCR during in vitro differentiation of stromal vascular fraction (SVF) cells isolated from human fetal BAT and subcutaneous WAT. n=4. Error bars are mean ± SEM, *p<0.05, Student’s T test.
Fig. 2. Ybx2 is an essential regulator of brown adipocyte differentiation in vitro. (A) Primary brown pre adipocytes were infected by retroviral shRNAs targeting RBPs, Ybx2, and Akap1, followed by induction of differentiation for 5 days. Oil Red O staining was used to assess lipid accumulation. (B D) Real time PCR to measure the knockdown efficiency (left), pan adipogenic marker expression (right), and BAT selective marker expression (bottom) in cultured primary brown adipocytes (Day 5) infected by retroviral shRNAs targeting Ybx2 (B), Akap1(C) and Rbpms2 (D). n=3. Error bars are mean ± SEM, *p<0.05, one way ANOVA. (E) Representative metabolic flux curves from cultured brown adipocytes (Day 5) infected by retroviral shRNA targeting Ybx2. Cells were sequentially treated with Oligomycin, FCCP, Retenone. Oxygen consumption rates (OCR) are normalized by protein concentration. n=5. Error bars are mean ± SEM, *p<0.05, Student’s T test. (F) Western blot to examine the protein levels of Ybx2 during primary brown and white adipocyte differentiation in culture.
Fig. 3. Ybx2 can promote BAT selective gene expression in white and brown adipocyte cultures. (A) Western blot to confirm the overexpression of Ybx2 in primary white adipocyte culture. (B) Representative picture of Bodipy staining for lipids in primary white adipocytes infected by Ybx2 expressing or empty vector. (C) Real time PCR to examine marker gene expression during the time course of white adipocyte cultures expressing Ybx2 or vector. n=4. (D F) Same as in (A C), but in primary brown adipocyte culture. n=4. Error Page 15 of 51 Diabetes
bars are mean ± SEM, *p<0.05. (G) Representative metabolic flux curves from cultured brown adipocytes (Day 3) infected by retroviral overexpressing Ybx2. Cells were sequentially treated with Oligomycin, FCCP, Retenone. Oxygen consumption rates (OCR) are normalized by protein concentration. n=5. (H) Western blot to detect the protein levels of Ucp1, and two FAO components Cpt1a and Mcad at day 3.
Fig. 4. Ybx2 is needed for cold induced BAT activation. (A) Western blot to detect Ybx2 expression in eWAT, BAT and iWAT from WT and KO mice. (B) Body weight and BAT organ weight of WT and KO male mice at 8 9 weeks old. WT n=6; KO n=7. (C) Representative picture of H&E staining under the microscope of WT and KO BAT. (D) Distribution of the diameters of lipid droplets from (C) measured by Image J software. (E) Body weight and BAT weight of 8 9 week old WT and KO animals after 6 hours at 4oC exposure. n=5. (F) Representative picture and H&E staining under microscope of BAT from WT and KO mice after cold exposure. (G) Distribution of the diameters of lipid droplets from (F). (H) Body temperature was measured by rectal probe at the indicated times at 4oC. n=5. Error bars are mean ± SEM, *p<0.05.
Fig. 5. The effect of Ybx2 knockout on cold induced gene expression in BAT. (A) Heatmap of the gene expression in WT and KO BAT after 6 hours cold exposure. Heatmap showed the row mean centred abundance. (B) 5 top non redundant gene ontology (GO) terms enriched among mRNAs that showed significantly low (top) or high (bottom) expression (p<0.05, CUffdiff) in KO vs. WT BAT. (C) Real time PCR to confirm gene expression of BAT selective genes in WT and KO BAT. n=5. (D) Western blot to confirm gene expression of BAT markers in WT and KO BAT. (E) Real time PCR to confirm the expression of genes involved in lipogenesis and glucose uptake. n=5. Error bars are mean ± SEM, *p<0.05.
Fig. 6. Ybx2 stabilizes mRNA targets encoding proteins enriched for mitochondria functions. (A) Western blot to confirm immunoprecipitation of Ybx2 protein by Ybx2 antibody. 10% IP cell lysate was used as the input. (B) Targets of Ybx2 were selected based on their enrichment in the Ybx2 IP vs. IgG control. Venn diagram showed the overlapping of candidates from brown and white adipocytes. (C) Bubble chart to show the GO terms enriched in the common targets. X axis indicates P values, Y axis indicates the enrichment score. The bubble size indicated the number of targets in that GO category. (D) Relative Diabetes Page 16 of 51
abundance of each mRNA was calculated in Anti Ybx2 vs IgG RIP seq. The cumulative fraction of mRNAs involved in mitochondrion and all other detectable genes were plotted. Kolmogorov–Smirnov test was performed to determine the distribution difference. (E) Relative expression of each gene in KO vs. WT BAT at room temperature based on RNA seq data. The cumulative fraction curves were plotted for 414 common target mRNAs and other genes detectable in the RIP seq assays. (F) The cumulative fraction curves were plotted for common target mRNAs and other genes after cold exposure. Kolmogorov– Smirnov test was performed to determine the statistical significance of the difference in the distributions.
Fig. 7. Ybx2 binds and stabilizes Pgc1α mRNA. (A) RIP assay with anti Ybx2 in brown adipose tissue lysate from WT and KO animals to examine the amount of Pgc1α mRNA in the IP samples. Fabp4 was used as a control. 5% tissue lysate in the IP reaction was used as the input. n=3. (B,C) RNA pulldown assay was conducted to determine which RNA segments from Pgc1α 3’UTR can bind Ybx2. Segments in 3’UTR as shown in the diagram were cloned for in vitro transcription to generate RNA fragments which were used for RNA pulldown assay in BAT lysate, followed by Western blot to determine presence of Ybx2 in each pulldown reaction. An AU enriched ~100nt fragment from androgen receptor (AR) was used as a negative control. (D) RNA pulldown assay was conducted using a ~1kb fragment from human Pgc1α 3’UTR that is homologous to the fragment 3 in (C). (E) RIP PCR was conducted to determine Pgc1α mRNA retrieved by anti Ybx2 in BAT from RT and Cold exposed animals (n=3). (F) Primary brown preadipocytes were isolated from WT and KO BAT for culture and then induced to differentiate for 5 days (left). Actinomycin D was added to stop transcription, and RNAs were harvested at the indicated time points (X axis) after transcription inhibition. Real time PCR was carried to determine remaining RNA level compared to the starting time point. The trajectory of Pgc1α mRNA was fit into a first order decay curve to derive the RNA half life (WT T1/2=2.39 hours; KO T1/2=1.29 hours). Fabp4 mRNA was used as a control. n=6. (G) We used retroviral constructs to knock down Ybx2 and overexpress Pgc1α in primary brown preadipocytes, followed by induction of differentiation. BAT selective markers were examined by reat time PCR at day 6 (n=4, Error bars are mean ± SEM, *p<0.05.)
Page 17 of 51 Diabetes
ACKNOWLEDGEMENTS Thanks to Dr.Paula Stein, University of Pennsylvania, for the KO mice as a generous gift. Thanks for Dr. Manvendra Singh, Duke NUS Medical School, for the coordination of mice transportation. This work was supported by Singapore NRF fellowship (NRF 2011NRF NRFF 001 025) to L.S. This research is also supported by the Singapore National Research Foundation under its CBRG grant (NMRC/CBRG/0070/2014 and NMRC/CBRG/0101/2016) and administrated by the Singapore Ministry of Health's National Medical Research Council. Dr. Lei SUN is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis
AUTHOR CONTRIBUTIONS X.D., X.S, K.A.M.M., L.Y.C, C.S.Y., and A D.J.R., performed experiments. S.L. and X.D. designed experiments and wrote the manuscript. M.L. and C.P. discussed the experiment design and critically reviewed the manuscript.
CONFLICTS of INTEREST The authors declare no conflicts of interest.
Diabetes Page 18 of 51
REFERENCES:
1. Olshansky SJ, Passaro DJ, Hershow RC, Layden J, Carnes BA, Brody J, Hayflick L, Butler RN, Allison DB, Ludwig DS: A potential decline in life expectancy in the United States in the 21st century. The New England journal of medicine 2005;352:1138-1145 2. Kajimura S, Spiegelman BM, Seale P: Brown and Beige Fat: Physiological Roles beyond Heat Generation. Cell Metab 2015;22:546-559 3. Lee P, Swarbrick MM, Ho KK: Brown adipose tissue in adult humans: a metabolic renaissance. Endocrine reviews 2013;34:413-438 4. Tseng Y-H, Cypess AM, Kahn CR: Cellular bioenergetics as a target for obesity therapy. Nature Reviews Drug Discovery 2010;9:465-482 5. Wu J, Cohen P, Spiegelman BM: Adaptive thermogenesis in adipocytes: Is beige the new brown? Genes Dev 2013;27:234-250 6. Harms M, Seale P: Brown and beige fat: development, function and therapeutic potential. Nature medicine 2013;19:1252-1263 7. Rosen ED, Spiegelman BM: What we talk about when we talk about fat. Cell 2014;156:20-44 8. Qiang L, Wang L, Kon N, Zhao W, Lee S, Zhang Y, Rosenbaum M, Zhao Y, Gu W, Farmer SR, Accili D: Brown remodeling of white adipose tissue by SirT1-dependent deacetylation of Ppargamma. Cell 2012;150:620-632 9. Kong X, Banks A, Liu T, Kazak L, Rao RR, Cohen P, Wang X, Yu S, Lo JC, Tseng YH, Cypess AM, Xue R, Kleiner S, Kang S, Spiegelman BM, Rosen ED: IRF4 is a key thermogenic transcriptional partner of PGC-1alpha. Cell 2014;158:69-83 10. Rajakumari S, Wu J, Ishibashi J, Lim HW, Giang AH, Won KJ, Reed RR, Seale P: EBF2 determines and maintains brown adipocyte identity. Cell metabolism 2013;17:562-574 11. Seale P, Kajimura S, Yang W, Chin S, Rohas LM, Uldry M, Tavernier G, Langin D, Spiegelman BM: Transcriptional control of brown fat determination by PRDM16. Cell Metab 2007;6:38-54 12. Kajimura S, Seale P, Tomaru T, Erdjument-Bromage H, Cooper MP, Ruas JL, Chin S, Tempst P, Lazar MA, Spiegelman BM: Regulation of the brown and white fat gene programs through a PRDM16/CtBP transcriptional complex. Genes Dev 2008;22:1397-1409 13. Kajimura S, Seale P, Kubota K, Lunsford E, Frangioni JV, Gygi SP, Spiegelman BM: Initiation of myoblast to brown fat switch by a PRDM16-C/EBP-beta transcriptional complex. Nature 2009;460:1154-1158 14. Harms MJ, Ishibashi J, Wang W, Lim HW, Goyama S, Sato T, Kurokawa M, Won KJ, Seale P: Prdm16 is required for the maintenance of brown adipocyte identity and function in adult mice. Cell metabolism 2014;19:593-604 15. Villarroya F, Vidal-Puig A: Beyond the sympathetic tone: the new brown fat activators. Cell metabolism 2013;17:638-643 Page 19 of 51 Diabetes
16. Liu T, Kong D, Shah BP, Ye C, Koda S, Saunders A, Ding JB, Yang Z, Sabatini BL, Lowell BB: Fasting activation of AgRP neurons requires NMDA receptors and involves spinogenesis and increased excitatory tone. Neuron 2012;73:511-522 17. Gerstberger S, Hafner M, Tuschl T: A census of human RNA-binding proteins. Nat Rev Genet 2014;15:829-845 18. Cook KB, Kazan H, Zuberi K, Morris Q, Hughes TR: RBPDB: a database of RNA-binding specificities. Nucleic acids research 2011;39:D301-308 19. Pihlajamaki J, Lerin C, Itkonen P, Boes T, Floss T, Schroeder J, Dearie F, Crunkhorn S, Burak F, Jimenez-Chillaron JC, Kuulasmaa T, Miettinen P, Park PJ, Nasser I, Zhao Z, Zhang Z, Xu Y, Wurst W, Ren H, Morris AJ, Stamm S, Goldfine AB, Laakso M, Patti ME: Expression of the splicing factor gene SFRS10 is reduced in human obesity and contributes to enhanced lipogenesis. Cell metabolism 2011;14:208-218 20. Brosch M, von Schonfels W, Ahrens M, Nothnagel M, Krawczak M, Laudes M, Sipos B, Becker T, Schreiber S, Rocken C, Schafmayer C, Hampe J: SFRS10--a splicing factor gene reduced in human obesity? Cell metabolism 2012;15:265-266; author reply 267-269 21. Huot ME, Vogel G, Zabarauskas A, Ngo CT, Coulombe-Huntington J, Majewski J, Richard S: The Sam68 STAR RNA-binding protein regulates mTOR alternative splicing during adipogenesis. Mol Cell 2012;46:187-199 22. Chou CF, Lin YY, Wang HK, Zhu X, Giovarelli M, Briata P, Gherzi R, Garvey WT, Chen CY: KSRP Ablation Enhances Brown Fat Gene Program in White Adipose Tissue through Reduced miR-150 Expression. Diabetes 2014; 23. Scott LJ, Mohlke KL, Bonnycastle LL, Willer CJ, Li Y, Duren WL, Erdos MR, Stringham HM, Chines PS, Jackson AU, Prokunina-Olsson L, Ding CJ, Swift AJ, Narisu N, Hu T, Pruim R, Xiao R, Li XY, Conneely KN, Riebow NL, Sprau AG, Tong M, White PP, Hetrick KN, Barnhart MW, Bark CW, Goldstein JL, Watkins L, Xiang F, Saramies J, Buchanan TA, Watanabe RM, Valle TT, Kinnunen L, Abecasis GR, Pugh EW, Doheny KF, Bergman RN, Tuomilehto J, Collins FS, Boehnke M: A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 2007;316:1341-1345 24. Dai N, Zhao L, Wrighting D, Kramer D, Majithia A, Wang Y, Cracan V, Borges-Rivera D, Mootha VK, Nahrendorf M, Thorburn DR, Minichiello L, Altshuler D, Avruch J: IGF2BP2/IMP2-Deficient mice resist obesity through enhanced translation of Ucp1 mRNA and Other mRNAs encoding mitochondrial proteins. Cell Metab 2015;21:609-621 25. Wang J, Rajbhandari P, Damianov A, Han A, Sallam T, Waki H, Villanueva CJ, Lee SD, Nielsen R, Mandrup S, Reue K, Young SG, Whitelegge J, Saez E, Black DL, Tontonoz P: RNA-binding protein PSPC1 promotes the differentiation-dependent nuclear export of adipocyte RNAs. J Clin Invest 2017;127:987-1004 26. Kim HJ, Cho H, Alexander R, Patterson HC, Gu M, Lo KA, Xu D, Goh VJ, Nguyen LN, Chai X, Huang CX, Kovalik JP, Ghosh S, Trajkovski M, Silver DL, Lodish H, Sun L: MicroRNAs are required for the feature maintenance and differentiation of brown adipocytes. Diabetes 2014;63:4045-4056 Diabetes Page 20 of 51
27. Seiler SE, Xu D, Ho JP, Lo KA, Buehrer BM, Ludlow YJ, Kovalik JP, Sun L: Characterization of a primary brown adipocyte culture system derived from human fetal interscapular fat. Adipocyte 2015;4:303-310 28. Hattangadi SM, Burke KA, Lodish HF: Homeodomain-interacting protein kinase 2 plays an important role in normal terminal erythroid differentiation. Blood 2010;115:4853-4861 29. Sun L, Xie H, Mori MA, Alexander R, Yuan B, Hattangadi SM, Liu Q, Kahn CR, Lodish HF: Mir193b- 365 is essential for brown fat differentiation. Nature cell biology 2011;13:958-965 30. Bai Q, Bai Z, Sun L: Detection of RNA-binding Proteins by In Vitro RNA Pull-down in Adipocyte Culture. J Vis Exp 2016; 31. Huang da W, Sherman BT, Lempicki RA: Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 2009;4:44-57 32. Huang da W, Sherman BT, Lempicki RA: Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 2009;37:1-13 33. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP: Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 2005;102:15545-15550 34. Obokata J, Ohme M, Hayashida N: Nucleotide sequence of a cDNA clone encoding a putative glycine-rich protein of 19.7 kDa in Nicotiana sylvestris. Plant molecular biology 1991;17:953-955 35. Graumann PL, Marahiel MA: A superfamily of proteins that contain the cold-shock domain. Trends in biochemical sciences 1998;23:286-290 36. Yang J, Medvedev S, Yu J, Tang LC, Agno JE, Matzuk MM, Schultz RM, Hecht NB: Absence of the DNA-/RNA-binding protein MSY2 results in male and female infertility. Proc Natl Acad Sci U S A 2005;102:5755-5760 37. Townsend KL, Tseng YH: Brown fat fuel utilization and thermogenesis. Trends in endocrinology and metabolism: TEM 2014;25:168-177 38. Yu XX, Lewin DA, Forrest W, Adams SH: Cold elicits the simultaneous induction of fatty acid synthesis and beta-oxidation in murine brown adipose tissue: prediction from differential gene expression and confirmation in vivo. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2002;16:155-168 39. Pullmann R, Jr., Kim HH, Abdelmohsen K, Lal A, Martindale JL, Yang X, Gorospe M: Analysis of turnover and translation regulatory RNA-binding protein expression through binding to cognate mRNAs. Mol Cell Biol 2007;27:6265-6278 40. Keene JD: Minireview: global regulation and dynamics of ribonucleic Acid. Endocrinology 2010;151:1391-1397 41. Diaz-Munoz MD, Bell SE, Fairfax K, Monzon-Casanova E, Cunningham AF, Gonzalez-Porta M, Andrews SR, Bunik VI, Zarnack K, Curk T, Heggermont WA, Heymans S, Gibson GE, Kontoyiannis DL, Ule J, Turner M: The RNA-binding protein HuR is essential for the B cell antibody response. Nature immunology 2015;16:415-425 Page 21 of 51 Diabetes
42. Mukherjee N, Corcoran DL, Nusbaum JD, Reid DW, Georgiev S, Hafner M, Ascano M, Jr., Tuschl T, Ohler U, Keene JD: Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability. Mol Cell 2011;43:327-339 43. Medvedev S, Pan H, Schultz RM: Absence of MSY2 in mouse oocytes perturbs oocyte growth and maturation, RNA stability, and the transcriptome. Biology of reproduction 2011;85:575-583 44. Yu J, Deng M, Medvedev S, Yang J, Hecht NB, Schultz RM: Transgenic RNAi-mediated reduction of MSY2 in mouse oocytes results in reduced fertility. Developmental biology 2004;268:195-206 45. Bal NC, Maurya SK, Sopariwala DH, Sahoo SK, Gupta SC, Shaikh SA, Pant M, Rowland LA, Bombardier E, Goonasekera SA, Tupling AR, Molkentin JD, Periasamy M: Sarcolipin is a newly identified regulator of muscle-based thermogenesis in mammals. Nat Med 2012;18:1575-1579 46. Rowland LA, Bal NC, Periasamy M: The role of skeletal-muscle-based thermogenic mechanisms in vertebrate endothermy. Biol Rev Camb Philos Soc 2015;90:1279-1297
Diabetes Page 22 of 51 A B C D
3 agonist β BAT iWAT eWAT Control PreadipocytesAdipocytes 8 -1 -1 -2 FC FC 2 FC 2 3 2 7 log log log 12 +1 +1 +2 6 23 24 33 26 1
E BAT BAT BAT Epi Epi Epi Ing Ing Ing SpleenIntestineColon StomachKidneyLiver ThymusHeart Lung MuscleEye Brain Rbpms2
Ybx2 FC 2 Akap1 log Grsf1 Larp4
F RTControl G RTControlH RTControl I RTControl BAT iWAT o o BAT 3030oCoC iWAT 3030oCoC 4 430oCoC 4 430C C 1.5 * * * 1.5 * * 3 3 * * * * * * * * 1.0 * * * 1.0 2 2 0.5 0.5 1 1
0 0.0 0.0
Relative expression 0
Grsf1 Larp4 Ybx2 Grsf1 Larp4 Ybx2 Grsf1 Ybx2 Grsf1 Larp4 Ybx2 Akap1 Akap1 Akap1 Larp4 Akap1 Larp4 Rbpms2 Rbpms2 Rbpms2 Rbpms2
J Ucp1 Rbpms2 Ybx2Ybx2 2.0Akap1 Grsf1 Larp4 mBAT 40000 25 600 40 5 2.0 BAT mWAT 30000 * * 20 * *30 BAT 4 * 1.5 * WAT 15 400 WAT1.5 3 * 20000 * * 20 1.0 * 10 2 200 * 10000 5 10 1 0.5
mouse 1.0 0 * 0 0 0 0 0.0 Relative expression
Relativeexpression 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6 Days after induction 0.5 Larp4
K 0.02.0
UCP1 RBPMS2 YBX2 Relative expression AKAP1 GRSF1 LARP4 10000 20 15 4 0 1.5 2 1.54 6 hBATBAT 5000 15 3 hWAT * 10 * WAT * * 1.5 1.0 1.0 10 * 10 2 5 Days0.5 after induction0.5 5 5 1 1.0 0 0 0 0 0.0 0.0 Relativeexpression 0 7 14 21 0 7 14 21 0 7 14 21 0 7 14 21 0 7 14 21 0 7 14 21 0.5 0.0 Relative expression 0 2 4 6 Days after induction
Figure 1 Page 23 of 51 Diabetes
D A Knockdown Pan-adipocyte markers Control Ybx2 1.5 1.5 * * VectorShRNA-Control Sh-Ctl Vector Sh-1 Sh-2 Sh-3 * * 1.0 1.0 Sh-ctlVector Sh-1ShRNA-1 0.5 0.5 Sh-2ShRNA-2 3 Sh-3ShRNA-2 0.0 0.0
Rbpms2 Akap1 expression Relative α γ2
Rbpms2 Fabp42 AdipQ Cebp Ppar Sh-1 Sh-2 Sh-3 Sh-1 Sh-2 Sh-3 BAT-selective genes 1 1.5 * * * * * * * * * * * * 1.0 0 Relative expression α γ 0.5 B Ppar ShRNA-Control Fabp4 AdipQ Cebp Knockdown PanVector-adipocyte markers ShRNA-1 0.0 Relative expression Relative 1.5 1.5 ShRNA-2 ShRNA-3 Dio2 Cox7 * Ucp-1 Cidea Pgc1a Ppara * * Prdm16 1.0 1.0 *
0.5 0.5 F 100 FCCP Rotenone 0.0
Relative expression Relative 0.0 80 α γ2 sh-Ctl YBX2 AdipQ Cebp FABP4 Ppar 60 sh-1 BAT-selective genes /(min*µg)) Oligomycin * 40 1.5 * pMol * * * * * * * * * * 1.0 * * 20 OCR ( 0.5 0 0 20 40 60 80 100 Relative expression Relative 0.0 α α Ucp1 Dio2 Cox7 Cidea Pgc1 Ppar 5000 Prdm16 Proton Maximal ATP Basal C 4000 leak capacity turnover Knockdown Pan-adipocyte markers 25 10 60 15 sh-CtlControl 3000 20 8 sh-1Sh-Ybx2 /(min*µg)) * 40 10 * 15 6 P=0.07 1.5 3 2000 Vector * * ShRNA-ControlpMol 10 4 * Sh-ctlVector 20 5 1.0 2 5 2 1000 Sh-1ShRNA-1
OCR ( 0 BAT0 0 0 0.5 1 Sh-2ShRNA-2 WAT 3 0 Sh-3ShRNA-2 0.0 0 0 20 40 60 80 100 Relative expression Relative α γ2 During cell 2 BAT WAT Akap1 Fabp4 AdipQ Cebp Ppar E 0 2 4 6 0 2 4 6 Days 1 BAT-selective genes differentiation 2.5 Ybx2 2.0 1.5 *0 * * *
* Relative expression * * * * *γ 1.0 * * α β-actin 0.5 Ppar Fabp4 AdipQ Cebp 0.0 Tubulin Relative expression Relative α α B tubulin Ucp1 Dio2 Cox7 Cidea Pgc1 Ppar Prdm16
Cold induced multiple western blot B Tubulin
Figure 2 Diabetes Page 24 of 51 A Vector Ybx2 Vector Ybx2 B 100µm 100µm
Ybx2
β-actin
C Pparϒ2 Ucp1 Pgc1α Cidea 150 50 200 250 * 40 * 200 * 100 * 150 * 30 150 * 100 50 20 100 10 50 50 0 0 0 0 0 3 6 Relativeexpression 0 3 6 0 3 6 0 3 6 Prdm16 Cox4 Pparα 6 * * 40 * 200 150 4 30 Vector 20 * 100 Ybx2 2 * 10 50 0 0
Relativeexpression 0 0 3 6 0 3 6 0 3 6
D E Vector Ybx2 Vector Ybx2 100µm 100µm 100µm100µm FAO and UCP1 Western blot in overexpression cells Ybx2 FAO and UCP1 Western blot in overexpression cells FAO and UCP1 Western blot in overexpressionβ-actin cells F Pparϒ2 Ucp1FAO and UCP1Pgc1α WesternCidea blot in overexpression cells 40 200 20 3000 Vector 100 * 30 CPT1A* 15 * 2000 Ybx2 20 10 100 * 20 80 CPT1A 10 60 10 5 40 20 0 0 0 0
Relative expression Relative 0 3 6 CPT1A 0 3 6 0 3 6 0 2 4 6 CPT1A
G 50 Rotenone H
g)) FCCP µ 40 Ybx2 Vector Ybx2 Control 30 Oligomycin Cpt1a MAcd 20 UCP-1 Ucp1 10 MAcd UCP-1
OCR (pMol/(min* OCR 0 MAcd Mcad UCP-1 B actin 0 20 40 60 80 100 B actin β-actin MAcd ProtonUCP ATP-1
Basal leak turnoverB actinMaxi g)) µ 10 * 6 5 * 40 8 4 30 4 6 3 20 B actin 4 2 2 10 2 1
0 0 0 0 OCR (pMol/(min* OCR Figure 3 Page 25 of 51 Diabetes
A E WT KO Body weight iBAT 50 1.0 * 45 0.8 Ybx2 40 0.6 β-actin 35 0.4 30 0.2 Body weight (g) B Fat mass(%BW) Body weight BAT 25 0.0
50 1.0 * WT KO WT KO 0.8 40 0.6 F WT KO 30 0.4 0.2 Fat mass (%BW) Fat mass (%BW) 20 0.0 WT KO WT KO
C WT KO
G 0.5 WT KO 0.4 0.3 0.2 0.1
D fraction Reative 0.0
10 20 30 40 50 60 70 80 90 10 20 30 40 50 60 70 80 90 100 100 Diameter (arbitrary units)
0.4 WT KO H
0.3 C) 40 o WT KO 0.2 38 0.1 36 Reative fraction Reative 0.0
10 20 30 40 50 60 70 80 90 10 20 30 40 50 60 70 80 90 34 100 100 * * Diameter (arbitrary units) 32
Body temperature30 ( 0 2 4 6 Cold exposure (h)
Figure 4 Diabetes Page 26 of 51 A B Cold 6 hours
Scd1 Ucp1 Scd1 Fasn Phospholipid biosynthetic process
Dgat2
Ppargc1a
Acaca
Slc2a4 Ucp1 Dio2 Fasn Dgat1 Triglyceride metabolic process Dgat2 Elovl3
Ybx2 Tob1 Oxidation reduction
Pgc1α Acss2
regulated GO regulated Glucose metabolic process Acaca - Slc2a4 Lipid biosynthetic process
Dio2 Down Dgat1 Elovl6 0 5 10 20 25 30 -log2(P-value) Elovl3 BAT WAT Blood vessel development During cellCell adhesion Cell motion 50 - differentiationCytoskeleton regulated GO regulated - Actin binding 0 Up FPKM change 50 0 5 10 15 20 25 -log2(P-value) B tubulin C D WT KO 1.5 WT Pgc1α KO Ucp1 1.0 * Cold induced* multiple westernCidea blot 0.5 * * Pparγ
Relative expression Relative 0.0 B β-actin α α Dio2 Ucp1 Pgc1 Ppar Elovl3 Cidea Prdm16Tubulin Tubulin E 2.0
1.5
1.0 * * 0.5 * * * * * * Relative expression Relative 0.0
Dgat1 Fasn Dgat2 scd1 Glut4 Mogat1 Acaca Srebf1 Elovl6
Figure 5 Page 27 of 51 Diabetes B A BAT WAT
IP Input IgG Anti-Ybx2 Input IgG Anti-Ybx2 Ybx2 386 414 1408
Gapdh BAT WAT C D 100 8 100 Backgroup Backgroup translation Mitochondrion Mitochondrion 80 80 6 endomembrane 60 60 4 system ribonucleoprotein40 40
Enrichment 2 complex20 40 20 P=0.0115 mitochondria 0 0 -4 -2 0 2 4 6
CumulativePercentage 0 0 5 10 15 20 25 -4 -2 0 2 4 6 -log10(P-value) log2(anti-Ybx2/IgG)
F E Room temperature cold 100 100
80 80 P=2.5e-11 60 60
40 40 Targets Targets 20 20 Other genes Other genes Cummulative percentage Cummulative 0 percentage Cummulative 0 -1.5 -1.0 -0.5 0.0 0.5 1.0 1.5 -1.5 -1.0 -0.5 0.0 0.5 1.0 1.5 log2(KO/Wt) log2(KO/Wt)
Figure 6 Diabetes Page 28 of 51
A B C HUMAN PULL WT 317nt 335nt NM_008904.2 Ybx2 binding site1 15 Ybx2 binding site2 3.8KO kb 3 DOWN WT CDS 3’UTR 20 KO 1 3.1 10 2 3 3.2 4 3.3 15 3.5 3.6 3.4 3.7 10 5 3.8 (IP/Input)%
(IP/Input)% 5 * 0 Ybx2 0
Dio2 Gapdh HUMAN PULL Gapdh Pgc1a Pgc1a Fabp4 YBX2 DOWN D mouse CDS E 100 RT * human CDS NM_013261.4 75 Cold 50 * 10
Ybx2 5 *
YBX2 RelativeExpression 100 WT 0 Gapdh Input IgG Anti-Ybx2 Gapdh 80 KO 60 40 20 Fabp4 F 100 WT 0 80 Percentage Remaining 0 2 4 6 8 10 HoursKO 100
60 WT T1/2 = 2.39 hr KO T = 1.29 hr 40 1/2 50 Gapdh 20 0 0 Remaining Percentage Remaining Remaining Percentage Remaining 0 2 4 6 8 10 0 2 4 6 8 10 Hours Hours
G 1.5 WT* T1/2 = 2.391.5 hr* * * * * Sh-Ctl * * * * 1.0 KO T1/2 = 1.291.0 hr * * * sh-Ybx2 * shYbx2+Pgc1α 0.5 0.5 Relative expression 0.0 Relative expression 0.0 α Dio2 Ybx2 Ucp1 Ppar Cidea Cox7 Prdm16
Figure 7 Page 29 of 51 Diabetes
RNA-seq data analysis RNA seq was performed in the Illumina HiSeq2000 platform. Sequencing reads were first quality checked with FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/), subsequently aligned to mm10 using Tophat (version tophat 2.0.9). Aligned reads were then qualified using Cuffdiff (Version 2.1.1), which also performs statistical tests between tested conditions. Genes with low expression, defined by FPKM<0.1 in both tested conditions, were removed.
Complete list of RBP was downloaded from http://rbpdb.ccbr.utoronto.ca/help.php. A RBP was considered significantly differentially expressed if (i) q value<0.05 and (ii) more than 1.5 fold change between tested conditions.
RIP-seq analysis RNA seq analysis was performed as described above to obtain FPKM values for each gene. Genes with FPKM<1 in the RNA seq from brown adipocytes were considered as undetectable in cells and were excluded. Genes with FPKM <5 in both IgG and anti Ybx2 RIP seq were regarded as unbound by Ybx2 and IgG and therefore also excluded. 5227 and 5883 genes passed these filters in WAT and BAT RIP seq data for downstream analysis. The gene expression ratios between anti Ybx2 and IgG were calculated as an indicator for the enrichment of each transcript by Ybx2 RIP. Because low FPKM values will introduce large noises to the ratios between anti Ybx2 and IgG, RIP seq data were adjusted by adding 0.5 FPKM on all genes before the ratios between anti Ybx2 and IgG were derived.
SUPPLEMETNAL FIGURE LENGENDS: Figure S1 (A) Western blots to detect the Ucp1 change in cultured primary brown adipocytes (day 5) where AKAP1 and RBPMS2 were knocked down by retroviral shRNA. (B, C) Metabolic flux curves from cultured brown adipocytes (Day 5) where AKAP1 and RBPMS2 were knocked down by retroviral shRNA. Oxygen consumption rates (OCR) are normalized by protein concentration. n=8. *p<0.05, one way ANOVA.
Figure S2. (A D) Real time PCR to examine the knockdown efficiency and marker expression in brown adipocytes expressing shRNAs targeting (A, B) Grsf1 and (C,D) Larp4. n=3. Error bars are mean ± SEM, *p<0.05, student’s t test. (E G) Real time PCR to measure the (E) knockdown efficiency, (F) pan adipogenic markers and (G) BAT selective markers in cultured primary white adipocytes (Day 5) that were infected by retroviral shRNAs targeting Ybx2. n=3. Error bars are mean ± SEM, *p<0.05, student’s t test. (H K) Primary brown preadipocytes were infected by retroviral shRNAs (pMKO vector) targeting different regions of Ybx2 mRNA, followed by induction of differentiation for 5 days. (H) Oil Red O staining (top) and TAG quantification (bottom) were used to assess lipid accumulation. Real time PCR was performed to examine the (I) knockdown efficiency, (J) pan adipogenic markers and (K) BAT selective markers. (L) Similar to I K, but in primary white adipocyte culture. n=4. Error bars are mean ± SEM, *p<0.05. one way ANOVA
Figure S3. (A) Fat and (B) lean mass of male mice measured by EchoMRI. (C, D) Organ weight of iWAT and eWAT in WT and KO male mice at 9 weeks old. n≥6. Error bars are mean ± SEM, *p<0.05, student’s t test. Diabetes Page 30 of 51
(E) Real time PCR of pan abiogenic markers and (F) BAT selective markers in WT and KO BAT. n≥7. (G) Real time PCR of marker expression in iWAT. n≥6. Error bars are mean ± SEM, *p<0.05, student’s t test. (H) Blood glucose levels during glucose tolerance test (n=5) and insulin tolerance test (n=10), 16 weeks old male animals. Error bars are mean ± SEM, *p<0.05, student’s t test.
Figure S4. (A C) primary brown preadipocytes were isolated from WT BAT and KO BAT for in vitro culture and differentiation for 5 days. Real time PCR was used to confirm the (A) knockdown efficiency (B) pan adipogenic markers (C) BAT selective markers. n=3, Error bars are mean ± SEM, *p<0.05. Student’s t test. (D) Genes were pre ranked by their relative expression between KO and WT, followed by GSEA analysis.
Figure S5. (A) The OCRs of WT and KO BAT were measured with Oroboros respirometry after housing 8 9 weeks old animals at 4oC for 6 hours. n=6, Error bars are mean ± SEM, *p<0.05. Student’s t test (B) Lipolysis assay to assess the lipolysis rate of WT and KO BAT isolated from animals exposed to acute cold temperature. n=6. (C) 8 9 weeks old Ybx2 KO and WT male mice were fasted for 6 hours at RT or 4OC. Insulin (1 U per kg body weight) were injected into these animals. Mice were then sacrificed after 5 mins injection. Brown adipose tissue were collected. Western Blot was performed to detect protein levels of P AKT and AKT in BAT. (D) Real time PCR to examine BAT selective markers in iWAT after acute cold exposure. n≥9, *p<0.05, Student’s t test.
Figure S6. (A) FPKM of thermogenic markers in WT and KO BAT at room temperature and after cold treatment. (B) The fold changes (FC) of gene expression upon cold exposure were calculated for WT and KO BAT. The genes with more than 2 fold difference in FC were plotted in heatmap, and the color code represents the column mean centered FC. (C) Pathway analysis was performed using DAVID Tools.
Figure S7 (A) Body weight, (B) BAT mass (C) iWAT mass of female mice at 8 9 weeks after 6 hours cold challenge. n=6 (D) Real time PCR to examine BAT selective and (E) lipogenesis markers in BAT from female mice upon cold treatment (4oC,6 hours). 9 weeks old, n=6. Error bars are mean ± SEM, *p<0.05, student’s t test.
Figure S8 (A) Diagram of the RIP seq experiments. (B) RIP PCR analysis to detect the Ybx2 Pgc1a mRNA interaction in differentiated brown adipocytes which was treated with NE for 6 hours in the presence of Actinomycin D. (C) 293 cells were transfected with a reporter plasmid (psi Check2) harboring a ~2kb WT Pgc1a 3’UTR or a mutant plasmid without the Ybx2 binding sites in the presence or absence of YBX2. Actinomycin D was added to stop transcription, and RNAs were harvested at the indicated time points (X axis) after transcription inhibition. Real time PCR was carried to determine remaining RNA level compared to the starting time point. The trajectory of Pgc1a mRNA was fit into a first order decay curve to derive the RNA half life. n=4.
Figure S9 (A) WT and KO animals (8 9 weeks old) were housed at 4oC for 6 hours. Skeletal muscle tissues (Gastrocnemius) were harvested for real time PCR analysis. (B) The OCRs of muscle lysates were measured with Oroboros respirometry. n=6, Error bars Page 31 of 51 Diabetes
are mean ± SEM, *p<0.05, Student’s t test. (C) Western blot to examine the cellular distribution of Ybx2 in BAT nuclear vs. cytosolic lysate.
Diabetes Page 32 of 51
SUPPLEMENTAL FILES Suppl file1_oligo sequences
Suppl file2_BAT_WT and KO_RNA seq https://www.dropbox.com/s/olt27q7d2o2i1jo/Suppl%20file2_BAT_WT%20and%20K O_RNA seq.xlsx?dl=0
Suppl file3_AdipocyteD5_WT and KO_RNA seq https://www.dropbox.com/s/1u4y0p0kk6jjt4c/Suppl%20file3_AdipocyteD5_WT%20an d%20KO_RNA seq.xlsx?dl=0
Suppl file4_RIP seq and targets https://www.dropbox.com/s/3s21ch019fi4zqm/Suppl%20file4_RIP seq%20and%20targets.xlsx?dl=0
Suppl file5_target expression https://www.dropbox.com/s/0rdd40n630u8zdy/Suppl%20file5_target%20expression.x lsx?dl=0
Page 33 of 51 Diabetes
A B
Sh-Ctl Sh-AKPA1
Ucp1 sh-Ctl ) sh-RBPMS2 Gapdh 120 FCCP ug
90 Retenone sh-AKAP1 /min* Sh-Ctl Sh-RBPMS2 60 Oligomycin
pMol 30 Ucp1 0
Gapdh OCR ( 0 20 40 60 80 100
C Basal ATP turnover Maximal Proton leak ) * * ug * * * * * * Control 40 15 100 30
/min* sh-AKAP1 30 80 10 60 20 sh-RBPMS2 pMol 20 5 40 10 10 20
OCR ( 0 0 0 0
Figure S1 Knockdown of Grsf1 and Larp4 Sh-Ctl Sh-Grsf1 Diabetes Page 34 of 51 A B C Sh-Ctl D Sh-Ctl 2 2 Sh-Grsf1 2 2 Sh-Ctl Sh-Larp4Sh-Larp4
1 2 1 * 1 1 * * Relative expression Relative expression 0 1 0 Relative expression 0 0 α γ α γ Ucp1 Cox7 Ucp1 Cox7 Grsf1 Pgc1 Cidea Ppar Larp4 Pgc1 Cidea Ppar 0 Relative expression Grsf1 E F GG ShSh-Ctl-Ctl 1.5 1.5 1.5 ShSh-3-1 1.0 1.0 * * 1.0 * * * * 0.5 * 0.5 0.5 * * Relative expression Relative Relative expression Relative 0.0 0.0 expression Relative 0.0 α α α α Ybx2 Ucp1 Dio2 Cox7 Fabp4 Adipoq Cebp Ppar Cidea Pgc1 Ppar Sh-Ctl(pMKO) Prdm16 Sh-1(pMKO) pMKO-shRNA, BAT Sh-3(pMKO) H I J 1.5 1.5 Sh-CtlShRNA-Control (pMKO) Sh-Ctl Sh-1 Sh-2 * Sh-1ShRNA-1 (pMKO) 1.0 * 1.0 Sh-2ShRNA-3 (pMKO)
0.5 0.5
Relative expression Relative 0.0 0.0 γ Ybx2 Fabp4 Adipoq Cebpa Ppar 1.5 K * 1.5 * * Sh-CtlShRNA-Control (pMKO) * * * Sh-1ShRNA-1 (pMKO) * * * 1.0 * * * * Sh-2ShRNA-3 (pMKO) 1.0 * 0.5 0.5 TAG/protein 0.0
Relative expression Relative 0.0 sh-1 sh-2 α sh-Ctl Dio2 Ucp1 Cidea Ppar Cox4 Cox7 Prdm16 L pMKO-shRNA, WAT Sh-CtlShRNA-Control (pMKO) 2.0 Sh-1ShRNA-1 (pMKO) 1.5 Sh-2ShRNA-3 (pMKO) 1.0 * * * * * 0.5 * * * * * * *
Relative expression Relative 0.0 γ α Ybx2 Ucp1 Cidea Fabp4 Adipoq Ppar Pgc1
Figure S2 Page 35 of 51 Diabetes
A Fat B Lean C iWAT D eWAT 7 100 1.8 2.0
1.6 6 95 1.8 1.4 1.6 5 90 1.2 1.4 Fat mass (%BW) Fat mass (%BW) Fat mass (%BW) 4 Fat mass (%BW) 85 1.0 1.2 WT KO WT KO WT KO WT KO
1.5 BAT F BAT E 1.5
1.0 1.0 WT * * * 0.5 KO 0.5 Relative expression 0.0 Relative expression 0.0 α 2 γ α α Adipoq Cebp Fabp4 Dio2 Ppar Ucp1 Ppar Pgc1 Cidea Prdm16
G iWAT 2.0
1.5
1.0
0.5
0.0 Relative expression Relative α α γ2 Ucp1 YBX2 Pgc1 Ppar Prdm16 Ppar Hoxc10
H Glucose tolerance test Insulin tolerance test 150 400 * WT WT * KO KO 300 100 200 50
100 Glucose (%) Glucose (mg/dl) Glucose 0 0 0 30 60 90 120 0 30 60 90 120 Time (min) Time (min)
Figure S3 Diabetes Page 36 of 51
A B 1.5 1.5 WT 1.0 1.0 * * WT 0.5 0.5 KO KO * 0.0 0.0 2 α γ Relative Expression Relative Ybx2 Adipoq Cebp Ppar C 1.5 1.0 * * * * 0.5 * 0.0 α
Relative Expression Relative Ucp1 Cox8 Pgc1 Cidea Prdm16
D Adipogenesis Fatty acid oxidation 0.00 0.00
-0.15 -0.20 NES: -1.9 -0.40 -0.30 NES= -1.7 P-value: 0.0 -0.60 P-value<10-5 -0.45 Enrichment score Enrichment
Rank (KO/WT) Rank (KO/WT) Oxidative Phosphorylation Cellular respiration 0.00 0.00
-0.20 -0.20
-0.40 NES= -2.2 -0.40 NES= -1.8 P-value<10-5 P-value<10-5 -0.60 -0.60 Enrichment score Enrichment
Rank (KO/WT) Rank (KO/WT)
Figure S4 Page 37 of 51 Diabetes
A FCCP FCCP AntiA AntiA O2 concentration O2 consumption rate 20 WT
250 20 g) KO 250 20 µ 15 200 WT 15 200 KO 15 150 150 10 10 10 * 100 100
(nmol/ml) 5 2 50 5 50 5 pmol/(s*
O
pmol/(s*ug) pmol/(s*ug) 0 0 0 0 0 0 5 10 15 20 0 5 10 15 20
minutes minutes Basal Fccp
B C 10 Cold RT 8 WT KO WT WT KO KO WT KO WT WT KO KO 6 - - + + + + - - + + + + Insulin 4 WT P-AKT 2 KO OD/weight(g) 0 AKT 0 50 100 150 200 minutes
D
1.5
1.0 * 0.5
Relative expression 0.0 α α Ybx2 Ucp1 Pgc1 Ppar Prdm16
Figure S5 Diabetes Page 38 of 51 A Ucp1
8000 400 Pgc1α
6000 300 4000
FPKM FPKM 200 FPKM FPKM 2000 100
0 0
WT WT WT KO KO KO WT WT WT KO KO KO WT-ColdWT-ColdWT-Cold KO-ColdKO-ColdKO-Cold WT-ColdWT-ColdWT-Cold KO-ColdKO-ColdKO-Cold 250 Dio2 150 Elovl3 200 100 150 FPKM FPKM 100 FPKM FPKM 50 50 0 0 Room Temp Cold 6 hrs Room Temp Cold 6 hrs Room Temp Cold 6 hrs Room Temp Cold 6 hrs WT WT WT KO KO KO WT WT WT KO KO KO
WildWT-Cold WT-ColdtypeWT-Cold knockoutKO-ColdKO-Cold KO-Cold WildWT-Cold typeWT-Cold WT-Cold knockoutKO-ColdKO-Cold KO-Cold Agpat2 PGc1a Slc2a4 Acaca Elovl3 Dgat2 Fasn
B Dio2 Log2(fold change)
2 0 -2
WTCOLD
WTRT
KOCOLD
KORT
C Cell-cell adhesion Fatty acid metabolic process
Tube development Mitochondrion
Vasculature development Triglyceride metabolic process
regulated GO regulated Phospholipid biosynthetic process
External side of plasma membrane - regulated GO regulated - Polysaccharide binding Lipid biosynthetic process Up Down
0 2 4 6 8 10 0 1 2 3 4 5 10 15 -log2(P-value) -log2(P-value)
Figure S6 Page 39 of 51 Diabetes
A B C BW BAT iWAT 40 0.8 * 2.0 30 0.6 1.5
20 0.4 1.0 mass (% BW) 10 0.2 0.5 Body weight(g) iWAT 0 BAT mass (% BW) 0.0 0.0
WT KO WT KO WT KO
D 1.5 WT 1.0 * KO * * 0.5 * * *
Relative expression Relative 0.0 α α Dio2 Ucp1 Pgc1 Ppar Elovl3 Cidea E Prdm16 1.5
WT 1.0 KO
0.5 * * * * * * Relative expression Relative 0.0
Dgat1 Fasn Dgat2 Scd1 Glut4 Mogat1 Acaca Srebf1 Elovl6
Figure S7 Diabetes Page 40 of 51
A
B
NE 80 Basal 60
40
IP/Input 20 0
IgG
Anti-Ybx2
C 120 Vector+WT Vector+Mutant Ybx2+Mutant 100 Ybx2+WT
80
Vector+WT T1/2 = 4.797 hours
60 Vector+Mutant T1/2 = 4.915 hours Remaining percentage Ybx2+WT T1/2 = 8.385 hours
40 Ybx2+Mutant T1/2 = 4.105 hours 0 2 4 6 8 Hours
Figure S8 Page 41 of 51 Diabetes
A
8 WT * KO 6 4 2
Relative Expression 0
Ybx2 Serca1 Serca2 Serca3 Sarcolipin WT KO B
150 WT KO 100
50
pmol/(s*mg) 0
ATP Basal Maximal Uncoupling
C RT 4oC Nuclear cytosol Nuclear cytosol Ybx2
Gapdh
Figure S9 Diabetes Page 42 of 51
Q-PCR Primers sets for mouse genes Name ucp1 Prdm16 pgc1α Cidea Dio2 Elovl3 ppar α AdipoQ CEBPα Fabp4 pparg2 Cox7a1 Cox8b Ybx2 Rbpms2 Akap1 Grsf1 Larp4 Mogat1 Acaca Srebf1 Dgat1 Fasn Elovl6 Dgat2 Scd1 Glut4 ATP2A1 ATP2A2 ATP2A3 SLN Page 43 of 51 Diabetes
Q-PCR Primers sets for Human genes hYBX2 hRBPMS2 hGRSF1 hAKAP1 hLARP4
YBX2 cloning primers in XZ201 YBX2 F1 YBX2 R1 Pgc1a cloning primers for XZ201 mPGC1a F mPGC1a R
Oligo for MSCV-pgkGFP-U3-U6P-Bbs vector shRNA control AKAP1_Sh1 AKAP1_Sh2 AKAP1_sh3 Rbpms2_sh1 Rbpms2_sh2 Rbpms2_sh3 Ybx2_sh1 Ybx2_sh2 Ybx2_sh3 Oligo for pMKO shRNA plasmids sh Ctl_top sh Ctl_bottom Ybx2 sh1_top Ybx2 sh1_bottom Ybx2 sh2_top Ybx2 sh2_bottom Oligo for pSUPER.GFP.NEO shRNA plasmids mPGC1a-sh-T2 Diabetes Page 44 of 51
mPGC1a-sh-B2
PCR primers used to segments of Pgc1a's 3'UTR T7 Pgc1a Seq1 F T7 Pgc1a Seq1 R T7 Pgc1a Seq2 F T7 Pgc1a Seq2 R T7 Pgc1a Seq3 F T7 Pgc1a Seq3 R T7 Pgc1a Seq4 F T7 Pgc1a Seq4 R T7 Pgc1a Seq3.1 F T7 Pgc1a Seq3.1 R T7 Pgc1a Seq3.2 F T7 Pgc1a Seq3.2 R T7 Pgc1a Seq3.3 F T7 Pgc1a Seq3.3 R T7 Pgc1a Seq3.4 F T7 Pgc1a Seq3.4 R T7 Pgc1a Seq3.5 F T7 Pgc1a Seq3.5 R T7 Pgc1a Seq3.6 F T7 Pgc1a Seq3.6 R T7 Pgc1a Seq3.7 F T7 Pgc1a Seq3.7 R T7 Pgc1a Seq3.8 F T7 Pgc1a Seq3.8 R Pgc1aFrag_psicheck2_F-XhoI Pgc1aFrag_psicheck2_R2_WT Pgc1aFrag_psicheck2_R1_mutant Page 45 of 51 Diabetes
Forward primers ACTGCCACACCTCCAGTCATT CAGCACGGTGAAGCCATTC CCCTGCCATTGTTAAGACC TGCTCTTCTGTATCGCCCAGT CAGTGTGGTGCACGTCTCCAATC TCCGCGTTCTCATGTAGGTCT AGAGCCCCATCTGTCCTCTC CGATTGTCAGTGGATCTGACG TGCGCAAGAGCCGAGATAAA ACAAGCTGGTGGTGGAATGTG GCATGGTGCCTTCGCTGA CAGCGTCATGGTCAGTCTGT GAACCATGAAGCCAACGACT
TGGGCACAGTCAAATGGTTC TCCATTCAAGGGCTATGAAGGG ACATTTTCCCCCAACACAGC TTGCCTTTCCAAGCCAATGC ATGCTGAAGTGTGCCAGAAG TGGTGCCAGTTTGGTTCCAG GATGAACCATCTCCGTTGGC TGACCCGGCTATTCCGTGA GTGCCATCGTCTGCAAGATTC GGAGGTGGTGATAGCCGGTAT GAAAAGCAGTTCAACGAGAACG GCGCTACTTCCGAGACTACTT TTCTTGCGATACACTCTGGTGC CTGTCGCTGGTTTCTCCAACT TGTTTGTCCTATTTCGGGGTG GAGAACGCTCACACAAAGACC CGTCGCTTCTCGGTGACAG AGAGACTGAGGTCCTTGGTA Diabetes Page 46 of 51
GATTCATCAACAGGAATGA CCTGATCAAGCTCACTGCAA GCCAGCGGTATGTGGAAGTAT TGTCTCGGGAGCATGTCTTG AAAGTGAGACCAAGTCATAAGCG
AAACTCGAGATGAGCGAGGCGGAGGCGT AAAGAATTCGGAGGGGGATGCTGGGTAG
GACTCGAGatggcttgggacatgTGCAGCCAAGACTCTGTAT GAGTTAACttacctgcgcaagcttctct
AAAACAACAAGATGAAGAGCACCAAGTCGACTTGGTGCTCTTCATCTTGTTG AAAAGGAAGTTGCCGAGTAGCTTTGGTCGACCAAAGCTACTCGGCAACTTCC AAAAGGCAAATTAGGTCTGACTTTGGTCGACCAAAGTCAGACCTAATTTGCC AAAAGGAAGTTGCCGAGTAGCTTTGGTCGACCAAAGCTACTCGGCAACTTCC AAAAGCAAATGTGTGTATGGTTTGTGTCGACACAAACCATACACACATTTGC AAAAGCGACACCAAATCCCACCAGTGTCGACACTGGTGGGATTTGGTGTCGC AAAAGCATTGAATGGTATTCGCTTTGTCGACAAAGCGAATACCATTCAATGC AAAAGGTGATCAACAGCAGGGAGATGTCGACATCTCCCTGCTGTTGATCACC AAAAGTCCACGAAACCGTCCCTACTGTCGACAGTAGGGACGGTTTCGTGGAC AAAAGGAATGGTTACGGATTCATCAGTCGACTGATGAATCCGTAACCATTCC
CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG AATTCAAAAACAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTG CCGGACCCAAGGAGACAGCACCATTCTCGAGAATGGTGCTGTCTCCTTGGGTTTTTG AATTCAAAAACCCAAGGAGACAGCACCATTCTCGAGAATGGTGCTGTCTCCTTGGGT CCGGGGTGATCAACAGCAGGGAGATCTCGAGATCTCCCTGCTGTTGATCACCTTTTTG AATTCAAAAAGGTGATCAACAGCAGGGAGATCTCGAGATCTCCCTGCTGTTGATCACC Oligo for pSUPER.GFP.NEO shRNA plasmids GATCCCCGCAACATGCTCAAGCCAAACCCGAAGGTTTGGCTTGAGCATGTTGCTTTTTA Page 47 of 51 Diabetes
AGCTTAAAAAGCAACATGCTCAAGCCAAACCTTCGGGTTTGGCTTGAGCATGTTGCGGG
PCR primers used to segments of Pgc1a's 3'UTR GATCTAATACGACTCACTATAGGTGTTCCCAGGCTGAGGAAT CAGGACAAAGGACAAACTAC GATCTAATACGACTCACTATAGGAAGTTTCTGTAGTTTGTCC TCTTCAGACACACATTGACT GATCTAATACGACTCACTATAGCTTTGAAGCCAGTATCTCTT CAAGACAACGTATGTTTTTAAAGTTGG GATCTAATACGACTCACTATAGCCCTGGATCATGGACATGA AGGCTGATGTGTACTGCACA GATCTAATACGACTCACTATAGCTTTGAAGCCAGTATCTCTT CCTGATGCTCAAAATGGAG GATCTAATACGACTCACTATAGATGGTGTTGTTCTTGGTGAC GTAAGATAGTGTTGGGTGAGAGAG GATCTAATACGACTCACTATAGGCATTTACTGTTTGGCTGAC CCTGCATTTATCCTACAGAACAAG GATCTAATACGACTCACTATAGGTTCACAGGTTCTGCGTTAC CAAGACAACGTATGTTTTTAAAGTTGG GATCTAATACGACTCACTATAGCTTTGAAGCCAGTATCTCTT AACACCATGGTCGTATCAGA GATCTAATACGACTCACTATAGTCGTTTGGGAAACTCAGCTCTC TCCAGAAAATTCATGTCAGC GATCTAATACGACTCACTATAGGGAGTCACTAAACTTTGGAG CGCAGAACCTGTGAACACAA GATCTAATACGACTCACTATAGGTCGAATGCTTGCTCAAGTG CAAGACAACGTATGTTTTTAAAGTTGG TTTctcgaggccattgaatctgggtgg TTTgcggccgcctttagtttggcgttcacaaaga TTTgcggccgcaagatagtcttcagacacacattgact Diabetes Page 48 of 51
Reverse primers CTTTGCCTCACTCAGGATTGG GCGTGCATCCGCTTGTG TGCTGCTGTTCCTGTTTTC GCCGTGTTAAGGAATCTGCTG TGAACCAAAGTTGACCACCAG GGACCTGATGCAACCCTATGA ACTGGTAGTCTGCAAAACCAAA CAACAGTAGCATCCTGAGCCCT CCTTCTGTTGCGTCTCCACG CCTTTGGCTCATGCCCTTT TGGCATCTCTGTGTCAACCATG AGAAAACCGTGTGGCAGAGA GCGAAGTTCACAGTGGTTCC
AACACTCCGCAGAAACTTCC ATGCGTTTTTGGCTGCTTCC AGCAGTGGAAAGGTGTAAGC TCAAAGTGCACGTCAGCTTC TTCTCATGCGGCTTCTCAAC TGCTCTGAGGTCGGGTTCA GACCCAATTATGAATCGGGAGTG CTGGGCTGAGCAATACAGTTC GCATCACCACACACCAATTCAG TGGGTAATCCATAGAGCCCAG AGATGCCGACCACCAAAGATA GGGCCTTATGCCAGGAAACT CGGGATTGAATGTTCTTGTCGT CCCATAGCATCCGCAACATA AATCCGCACAAGCAGGTCTTC CAATTCGTTGGAGCCCCAT AAGAGGTCCTCAAACTGCTCC GGTGATGAGGACAACTGTGA Page 49 of 51 Diabetes
CCAGTTACATTAGTGGCTTC CTCTTGGCCATCTTGGTGTT AGGCGAAGATTTGACCTGCAA GCCGACTCGATGAACCTACTT ACCAGTTGCTATTGTGTGCAAA
AAAAGGAAGTTGCCGAGTAGCTTTGGTCGACCAAAGCTACTCGGCAACTTCC
AAAAGGAAGTTGCCGAGTAGCTTTGGTCGACCAAAGCTACTCGGCAACTTCC
AAAAGCGACACCAAATCCCACCAGTGTCGACACTGGTGGGATTTGGTGTCGC
AAAAGGTGATCAACAGCAGGGAGATGTCGACATCTCCCTGCTGTTGATCACC AAAAGTCCACGAAACCGTCCCTACTGTCGACAGTAGGGACGGTTTCGTGGAC
CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG AATTCAAAAACAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTG CCGGACCCAAGGAGACAGCACCATTCTCGAGAATGGTGCTGTCTCCTTGGGTTTTTG AATTCAAAAACCCAAGGAGACAGCACCATTCTCGAGAATGGTGCTGTCTCCTTGGGT CCGGGGTGATCAACAGCAGGGAGATCTCGAGATCTCCCTGCTGTTGATCACCTTTTTG AATTCAAAAAGGTGATCAACAGCAGGGAGATCTCGAGATCTCCCTGCTGTTGATCACC
GATCCCCGCAACATGCTCAAGCCAAACCCGAAGGTTTGGCTTGAGCATGTTGCTTTTTA Diabetes Page 50 of 51
AGCTTAAAAAGCAACATGCTCAAGCCAAACCTTCGGGTTTGGCTTGAGCATGTTGCGGG Page 51 of 51 Diabetes
GACCCAATTATGAATCGGGAGTG