Evaluation of YBX2 and Jhdm2a Mrna Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesis

Page 1 of 18

Original Article

) 5 Evaluation of YBX2 and Jhdm2a mRNA Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesis

, Serial Number: 6 Number: ,Serial Running title:YBX2 and Jhdm2a mRNA Contents on Testicular Tissue

1 , No: ,No:

J, Vol: 1 Vol: J,

Sahar Moghbelinejad, Ph.D1,2*, Amir Samimi Hashjin, M.Sc1, Reza Najafipour, Ph.D1,2,

(Cell

s Farzad Rajaei, Ph.D2, Zahra Rashvand, M.Sc2

1. Cellular and Molecular Research Centre, Qazvin University of Medical Sciences, Qazvin, Iran 2. Dept of Medical Genetics, Qazvin University of Medical Sciences, Qazvin, Iran

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh) *Corresponding address: Cellular and Molecular Research Centre, Qazvin University of

Medical Sciences, Qazvin, Iran

Cell Journal Cell

E-mail address: [email protected]

Received: 26/November/2013, Accepted: 4/Mar/2014

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed -

This article has been peer been has article This Evaluation of YBX2 and Jhdm2a mRNA Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesi of Classes Different Men with Azoospermic of Tissues Testicular Contentson mRNA Jhdm2a and YBX2 of Evaluation

Page 2 of 18

Abstract:

) 5 Objective: Animal model studies have shown that MSY2 and Jhdm2a genes have an important role in spermatogenesis process and fertility of male mice. But the potential role of

these genes in human spermatogenesis and fertility is not known yet. In this experimental study , Serial Number: 6 Number: ,Serial

1 we evaluated expression ratio of these genes in testis tissues of men with normal and , No: ,No:

7 impaired spermatogenesis. J, Vol: 1 Vol: J,

Methods: After RNA extraction and cDNA synthesis from 50 non-obstructive azoospermic

(Cell

s and 12 normal testis tissues, the expression ratio of genes was evaluated by Real time PCR technique. Hematoxcylin and eosin staining was used for histological classification of testis tissues. For statistical analysis One Way Anova test was run.

Results: Our results showed a significant reduction of YBX2 mRNA in samples with impaired spermatogenesis (P<0.001) compared to samples with qualitatively normal

spermatogenesis and normal spermatogenesis, but about Jhdm2a gene, despite sensible

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh)

reduction in gene expression in men with impaired spermatogenesis, no significant differences was shown (P>0.05). A significant negative correlation was demonstrated

Cell Journal Cell between the efficiency score of spermatogenesis and the CT for YBX2 (r = -0.7; P < 0.0001), but about the Jhdm2a this negative correlation was not significant (r = -0.4; P = 0.06).

Conclusion: Generally, these data indicated that YBX2 and Jhdm2a may play an important role in male infertility, and suggested that these molecules can act as useful biomarkers for predicting male infertility.

Key words: Non-Obstructive Azoospermia, Impaired Spermatogenesis, YBX2, Jhdm2a

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed -

Introduction

YBX2 and Jhdm2a are germ-cell-specific molecules which are essential for the production of

functional spermatozoa. Therefore, their inactivation could lead to male infertility. Y box This article has been peer been has article This Evaluation of YBX2 and Jhdm2a mRNA Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesi of Classes Different Men with Azoospermic of Tissues Testicular Contentson mRNA Jhdm2a and YBX2 of Evaluation binding protein 2 (YBX2), also known as Contrin, is a human homologue of Xenopus DNA/RNA-binding and mouse MSY2 proteins (1,2). Contrin or YBX2 located on human chromosome 17p11.2-13.1. This gene appears to be testis-specific and distinct from other mammalian Y-box-binding proteins (3). In the mouse testis, this gene is expressed from

Page 3 of 18

pachytene spermatocyte to late spermatid stages, but the active form of YBX2 factor is in

round spermatid stage(4). YBX2 is a protein which is highly similar to its mouse and xenopus

)

germ-cell Y-box protein homologues. YBX2 acts as an mRNA stabilizer and a transcription factor of some testis specific genes such as Protamine genes. Consequently, its loss of

expression is likely to contribute to the nuclear condensation defects that occur in MSY2-null

, Serial Number: 6 Number: ,Serial 1

late-stage spermatids (4-6). Histone 3 lysine 9 (H3K9) methylation is one of the best-

, No: ,No: 7

characterized modifications in the study of germ cell development, such as meiotic J, Vol: 1 Vol: J,

chromosomal recombination, segregation, and histone removal followed by chromatin

(Cell

s condensation in spermiogenesis.

In order to do these processes, simultaneous function of methyltransferase and demethylase enzymes is unavoidable (7). JmjC-containing histone demethylase 2a (Jhdm2a), also known as Jmjd1a or Kdm3a, was identified as an H3K9 demethylase (for mono methylation and dimethylation); it was originally cloned as a testis-specific gene transcript (8). Location of

this gene on human chromosome is 2p11.2. Jhdm2a specifically regulates the expression of

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh) the genes encoding transition protein 1(Tnp1) and Protamine, and this gene is necessary for

the proper chromatin reorganization during spermatid maturation by directly promoting the

Cell Journal Cell transcription of the Tnp1 and Protamine1 genes (9,10). Since both of two candidate genes in this research involve in expression regulation of some testis specific and important genes such as Protamine 1,2,Transition protein1,2 etc, different studies have pointed out that targeting YBX2 and Jhdm2a genes in animal models causes male infertility and different degrees of impaired spermatogenesis. To access this fact, for the first time, we evaluated the expression level of these genes in testicular tissues of men with non-obstructive azoospermia, with different class of spermatogenesis.

Materials & methods:

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed - Testicular tissue

This experimental study was approved by the Ethical Committee of the Faculty of Medical

Sciences of Qazvin University of Medical Sciences (Qazvin, Iran). Sampling was done under This article has been peer been has article This

Evaluation of YBX2 and Jhdm2a mRNA Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesi of Classes Different Men with Azoospermic of Tissues Testicular Contentson mRNA Jhdm2a and YBX2 of Evaluation supervision of urologist, in Fertility and Infertility Center of Shariati Hospital. After patients gave their informed written consent, testicular biopsies were obtained from 50 azoospermic men with mean age of 31.3 ± 3.7 years old; these patients were candidate of ART (Assisted reproductive technique) and exhibited impaired spermatogenesis. In 12 patients with

Page 4 of 18

obstructive azoospermia after vasectomy, biopsies were carried out for diagnostic reasons

during vasectomy reversal. These biopsies revealed normal spermatogenesis and served as

)

controls, the mean age of these individuals was 35 ± 2.9 years old. The limitation of this study was scarcity of tissue samples with normal spermatogenesis, for this reason sampling

time prolonged so much.

, Serial Number: 6 Number: ,Serial 1

To decrease possible confounding factors, patients were excluded for these criteria: Y

, No: ,No: 7

chromosome microdeletion, cystic fibrosis, varicocele, Klinefelter syndrome, or exposure to J, Vol: 1 Vol: J,

chemotherapy and radiation. In infertile patients with non-obstructive azoospermia, one part

(Cell

s of testicular tissue specimen was used for testicular sperm extraction, while the other part was cut into two pieces; one piece was immediately prepared and frozen for RNA extraction procedure, and the other piece was fixed in Bouin’s fixative and embedded in paraffin.

For histological evaluation, 5 µm paraffin sections were stained in hematoxylin and eosin, and then scored according to the modified Johnsen scoring system. In this system of

classification, all tubular sections in each piece of the testicular biopsy are evaluated

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh) systematically, and each is given a score from 1 to 10. Complete spermatogenesis with many spermatozoa is evaluated as)score 10, slightly impaired spermatogenesis, many late

Cell Journal Cell spermatids, disorganized epithelium (score 9), less than five spermatozoa per tubule, few late spermatids(score 8), no spermatozoa, no late spermatids, many early spermatids(score7), no spermatozoa, no late spermatids, few early spermatids(score6), No spermatozoa or spermatids, many spermatocytes (score5), no spermatozoa or spermatids, few spermatocytes(score4), spermatogonia only (score3), no germinal cells, Sertoli cells only (score2), No seminiferous epithelium (Score1) (11). to follow this classifying method, our samples were divided into 3 groups based on above scoring: normal spermatogenesis (score

10), qualitatively normal spermatogenesis (scores 8-9), impaired spermatogenesis (scores 1- reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed - 7) (Table 2).

RNA extraction and first strand cDNA synthesis In summary, frozen testis tissues are homogenized in lysis buffer using an Ultrasonic

Processor UP100H (Hielsher, Germany), and then RNA is extracted using RNeasy Mini Kit This article has been peer been has article This Evaluation of YBX2 and Jhdm2a mRNA Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesi of Classes Different Men with Azoospermic of Tissues Testicular Contentson mRNA Jhdm2a and YBX2 of Evaluation (Qiagene, Germany). In this regard 1 volume of %70 ethanol was added to the homogenized lysate, then up to 700 μl of the sample was transferred to an RNeasy spin column placed in a 2 ml collection tube. We used column DNase digestion to remove the residual DNA. After using different washing buffers, the RNeasy spin column was placed in a new 1.5 ml

Page 5 of 18

collection tube and 30–50 μl RNase-free water was added directly to the spin column

membrane to elute the RNA , then RNA was frozen at -80°. Quality and quantity of isolated

)

total RNA is measured using Nano Drop 2000c (Thermo, USA). In this case RNA samples with A260/A280 ratios of >2 were selected for quantitative analysis. First strand

complementary DNA (cDNA) synthesis was also performed using the Revert Aid First

, Serial Number: 6 Number: ,Serial 1

Strand cDNA Synthesis Kit (Thermo Scientific, Fermentas, Waltham, MA, USA). For cDNA

, No: ,No: 7

synthesis, 1-5 µg total RNA and 0.5 µg oligo (dt) were added to sterile, nuclease-free tube on J, Vol: 1 Vol: J,

ice, and total volume reached to 11.5 µl with DEPC-treated water. This solution was mixed

(Cell

s and centrifuged briefly and then was incubated at 65°C for 5 minute. 4 μl 5X reaction buffer for reverse transcription, 0.5 μl RiboLock™ RNase inhibitor, 2 μl dNTP mix and 1 μl revert aid™ H minus reverse transcriptase were added to solution, and total volume was reached to 25μl with DEPC-treated water. After centrifuge the solution was incubated 60 minute at 42°C. Ultimately the reaction was terminated by heating at 70°C for 10 minute.

Real-time PCR and comparative threshold cycle method

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh) In this experiment we used Gapdh gene as an internal control for quantification of target

genes expression. Two target genes (YBX2 and Jhdm2ab) and Gapdh (as internal control) Cell Journal Cell were amplified with appropriate primers and probes (Table 1). All primers and probes were designed using gene runner software (Version 3.05). Taq man real time PCR assay was carried out in final reaction volumes of 20 µl with 10 µl of Taq man master mix (Takara, Shiga, Japan), 0.2 μM of forward and reverse primers, and 2 μl of cDNA. Thermal cycling was performed on the ABI-7500 (Applied Biosystems, Foster, CA, USA) sequence detection system using the following cycling condition: 30 seconds at 95 ºC as first denaturation step, followed by 40 cycles at 95 °C for 5 seconds and 60 °C for 34 seconds.

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed Optimization of real-time PCR assay -

The efficiency of each gene was determined by using 10 fold series of normal cDNA dilutions. Validation of experiments was performed to determine PCR efficiencies of target

and reference gene. The slopes of the fit lines were within the acceptable range of - This article has been peer been has article This

Page 6 of 18

to the CT values of the internal control (Gapdh) in treated and untreated samples (ΔCT =

CTtarget – CTGapdh) (12).

)

Statistical analysis

Statistical analysis including mean, standard deviation (SD), and correlation coefficients (R)

, Serial Number: 6 Number: ,Serial 1

were done using Prism (version 3) software. Additionally, one-way analysis of variance , No: ,No:

7 (ANOVA) carried out to determine the significant differences between the studied groups. P- J, Vol: 1 Vol: J,

value of <0.05 was considered as statistically significant.

(Cell

s Results:

Men with impaired spermatogenesis (group III) exhibited a significant (P<0.001) lower level of YBX2 mRNA (2-ΔCt: 0.5 ± 0.7) when compared to the samples with normal spermatogenesis (group I) (2-ΔCt : 3.6 ±1.8) and qualitatively normal spermatogenesis (group II) (2-ΔCt: 3.03 ± 1.5). In the testicular tissues of azoospermic men with impaired

spermatogenesis, YBX2 transcripts were 7.2 folds less than testicular tissues of men with

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh) normal spermatogenesis (Figure 1a), but there is no significant difference in 2-ΔCt ratio of YBX2 mRNA between group I and group II samples (P>0.05). The Jhdm2a mRNA content Cell Journal Cell in testis tissues of studied groups results showed that despite sensible reduction in gene expression in samples with impaired spermatogenesis (2-ΔCt: 0.17 ± 0.1), compared to samples with normal and qualitatively normal spermatogenesis (2-ΔCt: 0.25 ± 0.19) (2-ΔCt: 0.24 ± 0.15) respectively, there was no significant difference in 2-ΔCt ratio among the 3 studied groups (P>0.05) (Figure 1b). A significant negative correlation could be seen between the efficiency score of spermatogenesis and the mean CT value of YBX2 mRNA (r = -0.7, P< 0.0001), but Jhdm2a showed no significant

negative correlation (r = -0.4, P= 0.06) (Figure 2 a,b). reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed -

Discussion:

Generally “male infertility is estimated to affect about 5% of adult human males, but 75% of This article has been peer been has article This

Evaluation of YBX2 and Jhdm2a mRNA Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesi of Classes Different Men with Azoospermic of Tissues Testicular Contentson mRNA Jhdm2a and YBX2 of Evaluation the cases are diagnosed as idiopathic, because the molecular mechanisms underlying the defects have not been elucidated” (13). In spermatogenic cells spatiotemporal gene expression, strongly translation repressed in meiotic and haploid male germ cells stringently regulated. A vast variety of molecules and proteins are involved in these processes (14,15). In this research we investigated two of these important molecules (YBX2 and Jhdm2a). These

Page 7 of 18

two proteins expressed specifically and highly in testicular tissue and are involved in

functional regulation of some strategic meiotic and postmeiotic genes. YBX2 is a

)

transcription and translation regulatory factor and a germ-cell-specific molecule which is essential for the production of functional spermatozoa.

, Serial Number: 6 Number: ,Serial About the molecular function of this protein, animal models and in vitro assay studies 1

, No: ,No: showed that MSY2 acts as a transcription factor and an mRNA stabilizer which regulates 7

expression of some testis specific genes in transcription and translation level. In this regard J, Vol: 1 Vol: J,

MSY2 marks specific mRNAs (those transcribed from Y-box promoters) in the nucleus for

(Cell

s cytoplasmic storage, thereby links mRNA transcription and storage/translational delay. In this process, MSY2 recognizes the CTG ATTGGC/ TC/TAA sequence, a DNA motif in the promoter of many genes specifically expressed in male germ cells. MSY2 binds to its consensus promoter sequence, then binds to transcripts of this gene, stabilizes and represses their translation as RNA-protein complexes (16-19).

Yang et al. (2005) generated Msy2-null mice. They found that the mutant males had an

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh)

abnormally high number of apoptotic meiotic spermatocytes, lacked spermatozoa in the epididymis, and were sterile. Their results emphasized on the major role of this protein in

Cell Journal Cell male - of male factor infertility (23). Our results, in the same path, showed significant down regulation of this gene in testicular tissues of azoospermic men with impaired spermatogenesis compared to men with normal spermatogenesis (P<0. 001) (Figure1 (a)), (Table2). Significant negative correlation between the score for efficiency of spermatogenesis and the mean CT value of YBX2 mRNA in our samples was the other reason which emphasizes on the role of this gene in human spermatogenesis. Other regulatory factor which was studied in this research was Jhdm2a. JmjC-containing histone demethylase 2a (Jhdm2a),

also known as Jmjd1a or Kdm3a, was identified as an H3K9 demethylase (for reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed

- monomethylation and dimethylation (7); Okada et al (2007) originally cloned this gene as a testis-specific gene transcript. Their other results about the immune histochemical analysis using anti Jhdm2a antibody showed an intense nuclear expression of this gene in round spermatids and a sub-nuclear distribution. Co-expression of Jhdm2a gene with RNA

This article has been peer been has article This polymerase II indicates that Jhdm2a may contribute to transcriptional activation of some Evaluation of YBX2 and Jhdm2a mRNA Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesi of Classes Different Men with Azoospermic of Tissues Testicular Contentson mRNA Jhdm2a and YBX2 of Evaluation testis specific genes. Jhdm2a stimulates the transcriptional activation of transition nuclear protein1 and protamine 1 genes, by bonding to core promoter and removing H3K9

methylation. Histone demethylase Jhdm2a is critical for Tnp1 and Pr1 transcription and spermatogenesis (24). Jhdm2a-deficient mice have shown infertility and smaller testes (25).

Page 8 of 18

Despite the fact that animal model studies showed the role of this protein in male infertility,

expression ratio of this gene did not show significant difference between azoospermic and

)

fertile men samples (P>0.05). Despite the negative correlation between the efficiency score of spermatogenesis and the mean CT value of Jhdm2a mRNA in studied samples, this

correlation was not significant. Probably the role of this gene is not very influential in human

, Serial Number: 6 Number: ,Serial 1

fertility; hence more samples must be studied.

, No: ,No: 7

Conclusion:

J, Vol: 1 Vol: J,

(Cell

s Consequently, our findings indicated significant down regulation of YBX2 gene in testis tissue of azoospermic men , but future studies are needed to study the role of YBX2 and Jhdm2a genes in regulating some specific genes of testis involving in human meiotic and post meiotic .

Acknowledgment

The authors wish to express their sincere thanks to all patients and normal individuals for

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh) their contribution, and Mrs Z. Rezaeian and Dr. P. Fallahi for arrangements of sample collection and preparation.

Cell Journal Cell Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed

- The authors disclosed receipt of the following financial support for the research, authorship,

and/or publication of this article: supported by the University of Qazvin.

Page 9 of 18

) 5 References:

1. Gu W, Tekur S, Reinbold R, Eppig JJ, Choi YC, Zheng JZ, et al. Mammalian male and

female germ cells express a germ-cell specific Y-box protein MSY2. Biol Reprod. 1998;

, Serial Number: 6 Number: ,Serial 1

59(5):1266–1274. , No: ,No:

7 2. Wolffe AP. Structural and functional properties of the evolutionarily ancient Y-box family J, Vol: 1 Vol: J,

of nucleic acid binding proteins. Bio Essays. 1994; 16(4): 245–251.

(Cell

s 3. Tekur S, Pawlak A, Guellaen G, Hecht NB. Contrin, the human homologue of a germ-cell Y-box-binding protein: cloning, expression, and chromosomal localization. J of Androl. 1999; 20(1):135-144. 4. Bettegowda A, Wilkinson MF. Transcription and post-transcriptional regulation of spermatogenesis. Phil Trans R Soc. 2010; 365(1546): 1637–1651. 5. Minshall N, Thom G, Standart N. A conserved role of a DEAD box helicase in mRNA

masking. RNA. 2001;7(12):1728-42.

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh)

6. Nikolajczyk BS, Murray MT, Hecht NB. A mouse homologue of the Xenopus germ cell-

Cell Journal Cell specific ribonucleic acid/deoxyribonucleic acid-binding proteins p54/p56 interacts with the protamin 2 promoter. Biol Reprod. 1995;52(3):524-30. 7.Godmann M, Lambrot R, Kimmins S. The dynamic epigenetic program in male germ cells: its role in spermatogenesis, testis cancer, and its response to the environment. Microsc Res Tech. 2009;72(8):603–619. 8. Klose RJ, Kallin EM, Zhang Y. JmjC-domain-containing proteins and histone de methylation. Nat Rev Genet. 2006;7:715–727.

9. Martins RP, Ostermeier GC, Krawetz SA. Nuclear matrix interactions at the human

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed - protamine domain: a working model of potentiation. J Biol Chem. 2004; 279(50): 51862– 51868.

10. Godmann M, Lambrot R, Kimmins S. The dynamic epigenetic program in male germ This article has been peer been has article This Evaluation of YBX2 and Jhdm2a mRNA Contents on Testicular Tissues of Azoospermic Men with Different Classes of Spermatogenesi of Classes Different Men with Azoospermic of Tissues Testicular Contentson mRNA Jhdm2a and YBX2 of Evaluation cells: its role in spermatogenesis, testis cancer, and its response to the environment. Microsc Res Tech. 2009;72(8):603–619.

Page 10 of 18

11. Johnsen SG . Testicular biopsy score count - a method for registration of spermatogenesis

in human testis: normal values and results in 325 hypogonadal males. Hormones.

)

1970;1(1):1-24. 12. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C (T)

method. Nat Protoc. 2008; 3(6): 1101-1108.

, Serial Number: 6 Number: ,Serial 1

13. Okada H, Tajima A, Shichiri K, Tanaka A, Tanaka K, Inoue I. Genome-Wide Expression

, No: ,No: 7

of Azoospermia Testes Demonstrates a Specific Profile and Implicates ART3 in Genetic J, Vol: 1 Vol: J,

Susceptibility. PLoS Genet. 2008; 4(2): 26.

(Cell

s 14. Sun F, Turek P, Greene C, Ko E, Rademaker A, Martin RH. Abnormal progression through meiosis in men with non obstructive azoospermia. Fertil Steril. 2007; 87(3):565-571. 15. Sun F, Trpkov K, Rademaker A, Ko E, Martin RH. Variation in meiotic recombination frequencies among human males. Hum Genet. 2005;116(3):172-178. 16. Yang J, Medvedev S, Reddi PP, Schultz RM, Hecht NB. The DNA/RNA binding protein MSY2 marks specific transcripts for cytoplasmic storage in mouse male germ cells. Proc Natl

Acad Sci. 2005; 102(5):1513– 1518.

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh)

17. Gu W, Tekur S, Reinbold R, Eppig JJ, Choi YC, Zheng JZ, et al. Mammalian male and Cell Journal Cell female germ cells express a germ-cell specific Y-box protein MSY2. Biol Reprod. 1998; 59(5):1266–1274. 18. Kwon YK, Murray M, Hecht NB. Proteins homologous to the Xenopus germ cell-specific RNA-binding proteins p54/p56 are temporally expressed in mouse male germ cells. Dev Biol. 1993; 158(1):90–100.

19. Horvath GC, Kistler WS, Kistler MK. RFX2 is a potential transcriptional regulatory factor for histone H1t and other genes expressed during the meiotic phase of

spermatogenesis. Biol Reprod. 2004;71(5):1551-9.

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed - 20. Juxiang Y, Sergey M, Junying Y, Linda C, Tang JE, et al. Absence of the DNA- RNA- binding protein MSY2 results in male and female infertility. PNAS. 2005; 102(16): 5755– 5760.

21. Meng X, Xue Y, Sun D, Li P, Fu S. Study on the distribution of the MSY2 polymorphism

22. Deng Y, Zhang W, Su D, Yang Y, Ma Y, Zhang H, et al. Some single nucleotide polymorphisms of MSY2 gene might contribute to susceptibility to spermatogenic

impairment in idiopathic infertile men. Urology. 2008;71(5):878-82.

Page 11 of 18

23. Hammoud S, Emery BR, Dunn D, Weiss RB, Carrell DT. Sequence alterations in the

)

YBX2 gene are associated with male factor infertility. Fertil Steril. 2009;91(4):1090-5. 24. Okada Y, Scott G, Manas K, Mishina RY, Zhang Yi. Histone demethylase JHDM2A is

critical for Tnp1 and Prm1 transcription and spermatogenesis. Nature. 2007; 450(7166):119-

, Serial Number: 6 Number: ,Serial 1

23.

, No: ,No: 7

24. Tachibana M, Nozaki M, Takeda N, Shinkai Y. Functional dynamics of H3K9 J, Vol: 1 Vol: J,

methylation during meiotic prophase progression. Embo J. 2007;26(14): 3346–3359.

(Cell

s 25. Inagaki T, Tachibana M, Magoori K, Kudo H, Tanaka T, Okamura M, et al. Obesity and

metabolic syndrome in histone demethylase JHDM2a-deﬁcient mice. Genes to Cells. 2009; 14(8):991–1001.

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh)

Cell Journal Cell

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed

Page 12 of 18

Table 1.The oligonucleotid primers and probes used in real time PCR assay

)

, Serial Number: 6 Number: ,Serial

1 Target and internal Sequence Amplicon size (bp) control , No: ,No:

7 genes

J, Vol: 1 Vol: J,

(Cell YBX2 F:CCCTACCCAGTACCCTGCT

s R:CCTTCCTTCAACCCTTGATAA 150 P:CAGGAGGACCAAAGCAGCAGCC

Jhdm2a F: GTTCCACAAGCATTGACTGG 145 R :CTGGTGCATTTGAAACATCC

P:TGCCAATCCTCCTGAACTGCAGA

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh)

Gapdh F: TCAAGAAGGTGGTGAAGCAG 93

Cell Journal Cell R:CGCTGTTGAAGTCAGAGGAG P:CCTCAAGGGCATCCTGGGCT

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed -

Page 13 of 18

)

Table 2. Characterization of patient groups I-III and results of quantitative PCR analysis

, Serial Number: 6 Number: ,Serial 1

, No: ,No: 7 Group 1 Group 2 Group 3 Histological

J, Vol: 1 Vol: J, Qualitatively normal

classification (Cell

Normal s spermatogenesis Impaired spermatogenesis spermatogenesis Scores 10 8-9 1-7

Number of patients 12 16 34

Ct YBX2 (mean±SD) 21.75 ± 1.2 21.2 ± 0.99 24.1 ± 1.9

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh)

Ct Gapdh (mean±SD) 23.6 ± 0.85 23.1± 1.1 23.12 ±2.3 Cell Journal Cell 2-ΔCt 3.6 ± 1.8 3.7 ± 1.5 0.5 ± 0.7

Ct Jhdm2a (mean±SD) 25.9 ± 0.96 26.33 ± 1.1 27 ± 1.7

Ct Gapdh (mean±SD) 23.95 ± 1.5 24.3 ± 1.4 24.5 ± 1.2

2-ΔCt 0.25 ± 0.19 0.24 ± 0.15 0.17 ± 0.1 reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed -

Page 14 of 18

) 5

, Serial Number: 6 Number: ,Serial

, No: ,No:

J, Vol: 1 Vol: J,

(Cell

Figure 1: Expression of YBX2 mRNA (a) men with normal spermatogenesis (n=12), men

with qualitatively normal spermatogenesis (n=16) and in azoospermic men with impaired

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go (Yakhteh)

spermatogenesis (n=34), Values are mean ± SD. **P<0. 001 compared to control groups,

One way ANOVA test. Cell Journal Cell

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed

This article has been peer been has article This

Page 15 of 18

0.4

)

0.3

0.2

ratio

, Serial Number: 6 Number: ,Serial

1 , No: ,No:

7 0.1

Jhdm2a experssion Jhdm2a

J, Vol: 1 Vol: J,

(Cell 0.0

s Score 10 Score 9-8 Score 7-1

Figure 2: Expression of Jhdm2a mRNA (a) men with normal spermatogenesis (n=12), men with qualitatively normal spermatogenesis (n=16) and in azoospermic men with impaired spermatogenesis (n=34), Values are mean ± SD.

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh)

Cell Journal Cell

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed

Page 16 of 18

)

, Serial Number: 6 Number: ,Serial

, No: ,No:

J, Vol: 1 Vol: J,

(Cell

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh) 27

Cell Journal Cell 23 Ct of Jhdm2a mRNA Ct Jhdm2a of

19 0 1 2 3 4 5 6 7 8 9 10 Score

Figure 3. Scatterplots of (a) CT YBX2 mRNA(r=-0.7, P < 0.001), (b) CT Jhdm2a (r=-0.4 P = 0.06) mRNA against score value for efficiency of spermatogenesis with regression lines, CT

= reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed - threshold cycle.

Page 17 of 18

Figure 4: Typical photomicrographs of Hematoxylin & eosin staining of tissues, magnification

×1000 (a) hyospermatogenesis (b) maturation arrest in round spermatid stage (c) maturation arrest in

) 5 spermatocyt stage (d) maturation arrest in spermatogony stage.

, Serial Number: 6 Number: ,Serial

, No: ,No:

J, Vol: 1 Vol: J,

(Cell

(a) (b)

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh)

Cell Journal Cell

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed -

Page 18 of 18

)

, Serial Number: 6 Number: ,Serial

, No: ,No:

J, Vol: 1 Vol: J,

(Cell

go editing and proof correcting so printed version of it may differ from this version. this from may differ it of version printed so correcting proof and editing go

(Yakhteh)

Cell Journal Cell

reviewed and accepted for publication, but has not been under been not has but publication, for accepted and reviewed