(A) Co-IP of HA Tagged ARMC9 with Flag Tagged Interactors
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplementary Data
Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2). -
Análise Integrativa De Perfis Transcricionais De Pacientes Com
UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. -
A CRISPR-Based Screen for Hedgehog Signaling Provides Insights Into Ciliary Function and Ciliopathies
ARTICLES https://doi.org/10.1038/s41588-018-0054-7 A CRISPR-based screen for Hedgehog signaling provides insights into ciliary function and ciliopathies David K. Breslow 1,2,7*, Sascha Hoogendoorn 3,7, Adam R. Kopp2, David W. Morgens4, Brandon K. Vu2, Margaret C. Kennedy1, Kyuho Han4, Amy Li4, Gaelen T. Hess4, Michael C. Bassik4, James K. Chen 3,5* and Maxence V. Nachury 2,6* Primary cilia organize Hedgehog signaling and shape embryonic development, and their dysregulation is the unifying cause of ciliopathies. We conducted a functional genomic screen for Hedgehog signaling by engineering antibiotic-based selection of Hedgehog-responsive cells and applying genome-wide CRISPR-mediated gene disruption. The screen can robustly identify factors required for ciliary signaling with few false positives or false negatives. Characterization of hit genes uncovered novel components of several ciliary structures, including a protein complex that contains δ -tubulin and ε -tubulin and is required for centriole maintenance. The screen also provides an unbiased tool for classifying ciliopathies and showed that many congenital heart disorders are caused by loss of ciliary signaling. Collectively, our study enables a systematic analysis of ciliary function and of ciliopathies, and also defines a versatile platform for dissecting signaling pathways through CRISPR-based screening. he primary cilium is a surface-exposed microtubule-based approach. Indeed, most studies to date have searched for genes that compartment that serves as an organizing center for diverse either intrinsically affect cell growth or affect sensitivity to applied Tsignaling pathways1–3. Mutations affecting cilia cause ciliopa- perturbations16–23. thies, a group of developmental disorders including Joubert syn- Here, we engineered a Hh-pathway-sensitive reporter to enable drome, Meckel syndrome (MKS), nephronophthisis (NPHP), and an antibiotic-based selection platform. -
Identification of Genetic Factors Underpinning Phenotypic Heterogeneity in Huntington’S Disease and Other Neurodegenerative Disorders
Identification of genetic factors underpinning phenotypic heterogeneity in Huntington’s disease and other neurodegenerative disorders. By Dr Davina J Hensman Moss A thesis submitted to University College London for the degree of Doctor of Philosophy Department of Neurodegenerative Disease Institute of Neurology University College London (UCL) 2020 1 I, Davina Hensman Moss confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Collaborative work is also indicated in this thesis. Signature: Date: 2 Abstract Neurodegenerative diseases including Huntington’s disease (HD), the spinocerebellar ataxias and C9orf72 associated Amyotrophic Lateral Sclerosis / Frontotemporal dementia (ALS/FTD) do not present and progress in the same way in all patients. Instead there is phenotypic variability in age at onset, progression and symptoms. Understanding this variability is not only clinically valuable, but identification of the genetic factors underpinning this variability has the potential to highlight genes and pathways which may be amenable to therapeutic manipulation, hence help find drugs for these devastating and currently incurable diseases. Identification of genetic modifiers of neurodegenerative diseases is the overarching aim of this thesis. To identify genetic variants which modify disease progression it is first necessary to have a detailed characterization of the disease and its trajectory over time. In this thesis clinical data from the TRACK-HD studies, for which I collected data as a clinical fellow, was used to study disease progression over time in HD, and give subjects a progression score for subsequent analysis. In this thesis I show blood transcriptomic signatures of HD status and stage which parallel HD brain and overlap with Alzheimer’s disease brain. -
Gibco, 11995-065) Supplemented with 10%
Supplemental Materials and Methods Patient Fibroblast Culture Patient fibroblasts were cultured at 37⁰C, 5% CO2 in DMEM (Gibco, 11995-065) supplemented with 10% FBS, 1% penicillin/streptomycin. Fibroblasts are seeded at 5x10^5 and allowed to reach 70-80% confluency prior to passages. For experiments, cells are serum starved in DMEM only for 48 hours to induce ciliogenesis. All cell lines used were within 1 passage number of each other and ≤10 total passages. All cell lines were routinely tested for mycoplasma. CRISPR/Cas9 generation of TOGARAM1 mut hTERT-RPE1 cell lines hTERT-RPE1 were maintained in culture according to ATCC specifications. Cells were plated in 1 well of a 6 well plate. At ~70-80% confluency, cells were co-transfected with the Cas9 backbone px459v2 containing gRNAs to TOGARAM1. Transfections were performed with lipofectamine 2000 (Thermo Fisher). Sequencing primers for genotyping targeted the 5’UTR CTGAAGCTGTTCTTTTGCCTCT (forward) and exon 1 CTACCTCCTTCCACAAGCACTC (reverse). Both TOGARAM1 mut clone 1 and 2 have compound heterozygous mutations which result in large deletions including the ATG site and a portion of exon 1. TOGARAM1 mut line 1: NM_001308120.2:c.[2_269del;270dup]; [2_269inv]. TOGARAM1 mut line 2: NM_001308120.2:c.[-33_314del]; [2_269inv; 269_270insTC] (Supplemental Figure 5 A, B). Cloning was performed as previously described (1). gRNAs to the 5’UTR and ATG site, 5'-CACCTGACAACCCTGCATGG- 3’ and exon 1, 5’-TCTGGAGGCGGTTTGTCAGG-3’, were designed utilizing the web-based tool CHOPCHOP. pSpCas9(BB)-2A-Puro (PX459) V2.0 from Feng Zhang (Addgene plasmid # 62988) was purchased from Addgene. hTERT-RPE1 Immunofluorescence and microscopy 1 Human telomerase-immortalized retinal pigment epithelium (hTERT-RPE1) cells were cultured according to ATCC specifications. -
A Comprehensive Portrait of Cilia and Ciliopathies from a CRISPR-Based Screen for Hedgehog Signaling
bioRxiv preprint doi: https://doi.org/10.1101/156059; this version posted June 27, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. A comprehensive portrait of cilia and ciliopathies from a CRISPR-based screen for Hedgehog signaling David K. Breslow1,2,6,*, Sascha Hoogendoorn3,6, Adam R. Kopp2, David W. Morgens4, Brandon K. Vu2, Kyuho Han4, Amy Li4, Gaelen T. Hess4, Michael C. Bassik4, James K. Chen3,5,*, Maxence V. Nachury2,* 1. Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT 06511 2. Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, CA 94305 3. Department of Chemical and Systems Biology, Stanford University School of Medicine, Stanford, CA 94305 4. Department of Genetics, Stanford University School of Medicine, Stanford, CA 94305 5. Department of Developmental Biology, Stanford University School of Medicine, Stanford, CA 94305 6. Co-first author * Correspondence David K. Breslow [email protected] (203) 432-8280 James K. Chen [email protected] (650) 725-3582 Maxence V. Nachury [email protected] (650) 721-1999 bioRxiv preprint doi: https://doi.org/10.1101/156059; this version posted June 27, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. -
Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ...................................................... -
Supplementary Table 1 Double Treatment Vs Single Treatment
Supplementary table 1 Double treatment vs single treatment Probe ID Symbol Gene name P value Fold change TC0500007292.hg.1 NIM1K NIM1 serine/threonine protein kinase 1.05E-04 5.02 HTA2-neg-47424007_st NA NA 3.44E-03 4.11 HTA2-pos-3475282_st NA NA 3.30E-03 3.24 TC0X00007013.hg.1 MPC1L mitochondrial pyruvate carrier 1-like 5.22E-03 3.21 TC0200010447.hg.1 CASP8 caspase 8, apoptosis-related cysteine peptidase 3.54E-03 2.46 TC0400008390.hg.1 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1.86E-03 2.41 TC1700011905.hg.1 DNAH17 dynein, axonemal, heavy chain 17 1.81E-04 2.40 TC0600012064.hg.1 GCM1 glial cells missing homolog 1 (Drosophila) 2.81E-03 2.39 TC0100015789.hg.1 POGZ Transcript Identified by AceView, Entrez Gene ID(s) 23126 3.64E-04 2.38 TC1300010039.hg.1 NEK5 NIMA-related kinase 5 3.39E-03 2.36 TC0900008222.hg.1 STX17 syntaxin 17 1.08E-03 2.29 TC1700012355.hg.1 KRBA2 KRAB-A domain containing 2 5.98E-03 2.28 HTA2-neg-47424044_st NA NA 5.94E-03 2.24 HTA2-neg-47424360_st NA NA 2.12E-03 2.22 TC0800010802.hg.1 C8orf89 chromosome 8 open reading frame 89 6.51E-04 2.20 TC1500010745.hg.1 POLR2M polymerase (RNA) II (DNA directed) polypeptide M 5.19E-03 2.20 TC1500007409.hg.1 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 6.48E-03 2.17 TC2200007132.hg.1 RFPL3 ret finger protein-like 3 5.91E-05 2.17 HTA2-neg-47424024_st NA NA 2.45E-03 2.16 TC0200010474.hg.1 KIAA2012 KIAA2012 5.20E-03 2.16 TC1100007216.hg.1 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 7.43E-03 2.15 TC0400012977.hg.1 SH3D19 -
Potential of Data Integration to Identify Regulatory Snps in Late-Onset Alzheimer’S Disease GWAS Findings
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by D-Scholarship@Pitt Connecting the Dots: Potential of Data Integration to Identify Regulatory SNPs in Late-Onset Alzheimer’s Disease GWAS Findings Samantha L. Rosenthal1, M. Michael Barmada1, Xingbin Wang1, F. Yesim Demirci1, M. Ilyas Kamboh1,2* 1 Department of Human Genetics, University of Pittsburgh, Pittsburgh, Pennsylvania, United States of America, 2 Alzheimer’s Disease Research Center, University of Pittsburgh, Pittsburgh, Pennsylvania, United States of America Abstract Late-onset Alzheimer’s disease (LOAD) is a multifactorial disorder with over twenty loci associated with disease risk. Given the number of genome-wide significant variants that fall outside of coding regions, it is possible that some of these variants alter some function of gene expression rather than tagging coding variants that alter protein structure and/or function. RegulomeDB is a database that annotates regulatory functions of genetic variants. In this study, we utilized RegulomeDB to investigate potential regulatory functions of lead single nucleotide polymorphisms (SNPs) identified in five genome-wide association studies (GWAS) of risk and age-at onset (AAO) of LOAD, as well as SNPs in LD (r2$0.80) with the lead GWAS SNPs. Of a total 614 SNPs examined, 394 returned RegulomeDB scores of 1–6. Of those 394 variants, 34 showed strong evidence of regulatory function (RegulomeDB score ,3), and only 3 of them were genome-wide significant SNPs (ZCWPW1/ rs1476679, CLU/rs1532278 and ABCA7/rs3764650). This study further supports the assumption that some of the non-coding GWAS SNPs are true associations rather than tagged associations and demonstrates the application of RegulomeDB to GWAS data. -
Detection of H3k4me3 Identifies Neurohiv Signatures, Genomic
viruses Article Detection of H3K4me3 Identifies NeuroHIV Signatures, Genomic Effects of Methamphetamine and Addiction Pathways in Postmortem HIV+ Brain Specimens that Are Not Amenable to Transcriptome Analysis Liana Basova 1, Alexander Lindsey 1, Anne Marie McGovern 1, Ronald J. Ellis 2 and Maria Cecilia Garibaldi Marcondes 1,* 1 San Diego Biomedical Research Institute, San Diego, CA 92121, USA; [email protected] (L.B.); [email protected] (A.L.); [email protected] (A.M.M.) 2 Departments of Neurosciences and Psychiatry, University of California San Diego, San Diego, CA 92103, USA; [email protected] * Correspondence: [email protected] Abstract: Human postmortem specimens are extremely valuable resources for investigating trans- lational hypotheses. Tissue repositories collect clinically assessed specimens from people with and without HIV, including age, viral load, treatments, substance use patterns and cognitive functions. One challenge is the limited number of specimens suitable for transcriptional studies, mainly due to poor RNA quality resulting from long postmortem intervals. We hypothesized that epigenomic Citation: Basova, L.; Lindsey, A.; signatures would be more stable than RNA for assessing global changes associated with outcomes McGovern, A.M.; Ellis, R.J.; of interest. We found that H3K27Ac or RNA Polymerase (Pol) were not consistently detected by Marcondes, M.C.G. Detection of H3K4me3 Identifies NeuroHIV Chromatin Immunoprecipitation (ChIP), while the enhancer H3K4me3 histone modification was Signatures, Genomic Effects of abundant and stable up to the 72 h postmortem. We tested our ability to use H3K4me3 in human Methamphetamine and Addiction prefrontal cortex from HIV+ individuals meeting criteria for methamphetamine use disorder or not Pathways in Postmortem HIV+ Brain (Meth +/−) which exhibited poor RNA quality and were not suitable for transcriptional profiling. -
Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility. -
Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein