Long Non‑Coding RNA SNHG16 Inhibits the Oxygen‑Glucose
Total Page：16
File Type：pdf, Size：1020Kb
MOLECULAR MEDICINE REPORTS 22: 2685-2694, 2020 Long non‑coding RNA SNHG16 inhibits the oxygen‑glucose deprivation and reoxygenation‑induced apoptosis in human brain microvascular endothelial cells by regulating miR‑15a‑5p/bcl‑2 HONGWEI TENG1*, MING LI2*, LEI QIAN2, HUA YANG1 and MINGZHI PANG3 Departments of 1Neurosurgery and 2Laboratory Medicine, Binhai County People's Hospital, Yancheng, Jiangsu 224500; 3Department of Neurosurgery, Wuxi No. 2 Hospital Affiliated to Nanjing Medical University, Wuxi, Jiangsu 214002, P.R. China Received January 21, 2019; Accepted June 3, 2020 DOI: 10.3892/mmr.2020.11385 Abstract. MicroRNA (miR) 15a-5p can promote isch- by increasing apoptosis. SNHG16 overexpression decreased emia/reperfusion (I/R)-induced apoptosis of cerebral vascular miR‑15a-5p expression levels in hBMECs. SNHG16 gradually endothelial cells, which is inhibited by long non-coding RNAs decreased following OGD‑R and its overexpression decreased (lncRNAs). The present study investigated the potential of miR‑15a-5p expression levels and promoted the proliferation lncRNAs targeting miR‑15a-5p to regulate oxygen-glucose of hBMECs by decreasing apoptosis. SNHG16 enhanced deprivation and reoxygenation (OGD‑R)-induced apoptosis Bcl-2 expression levels in hBMECs, which was abrogated of human brain microvascular endothelial cells (hBMECs). by miR‑15a-5p. Bioinformatics suggest that SNHG16 may hBMECs were transfected with or without miR‑15a-5p or its antagonize the binding of miR‑15a-5p to the 3'UTR of Bcl-2 mutant, together with p-small nucleolar RNA host gene 16 mRNA. These findings suggest that SNHG16 may protect (SNHG16) or its mutant. Following OGD‑R, proliferation, hBMECs from OGD‑R‑induced apoptosis by antagonizing apoptosis and miR‑15a-5p, SNHG16 and Bcl-2 expression the miR‑15a-5p/bcl-2 axis. Thus, targeting SNHG16-based levels were determined using MTT, flow cytometry, reverse mechanisms may provide novel therapeutic strategies for treat- transcription-quantitative PCR or western blotting. The ment of ischemic stroke. potential interaction of SNHG16 with miR‑15a-5p was analyzed by pull-down, luciferase and immunoprecipitation Introduction assays. OGD‑R induced apoptosis of hBMECs and increased miR‑15a-5p expression levels in a time-dependent manner. Ischemic stroke is the most common type of brain disease miR‑15a-5p overexpression decreased the proliferation of in adults worldwide; it is characterized by high incidence, hBMECs and promoted apoptosis by decreasing Bcl-2 expres- disability and mortality rates (1). In China, the number of sion levels. SNHG16 was pulled-down by miR‑15a-5p and stroke-associated deaths has notably increased over the anti‑Ago2. miR‑15a‑5p overexpression significantly decreased past two decades (1,2). Although rapid recanalization of the SNHG16-regulated luciferase activity and hBMEC survival relevant artery and subsequent promotion of brain revascu- larization can successfully treat patients, reperfusion can increase the production of reactive oxygen species (ROS), inflammation and endoplasmic reticulum stress, leading to ischemia-reperfusion (I/R) injury, such as human brain micro- Correspondence to: Dr Mingzhi Pang, Department of vascular endothelial cell (hBMEC) apoptosis (3). hBMECs, Neurosurgery, Wuxi No. 2 Hospital Affiliated to Nanjing Medical located between the blood and the brain parenchyma, are University, 68 Zhongshan Road, Chongan, Wuxi, Jiangsu 214002, essential for normal neurological function and are responsible P. R. Ch i na for transferring essential nutrients and removing potentially E‑mail: [email protected] harmful toxins (4). I/R injury-induced hBMEC apoptosis *Contributed equally impairs the therapeutic effect of relevant artery recanaliza- tion (5-7). Thus, protection of hBMECs from I/R injury may Abbreviations: OGD‑R, oxygen-glucose deprivation and be crucial for intervention of ischemic stroke. reoxygenation; RIP, RNA immunoprecipitation; ceRNA, competitive MicroRNAs (miR) can bind to the 3' untranslated endogenous RNA; lncRNA, long non-coding RNA region (3'UTR) of mRNAs, and inhibit their translation and promote their degradation, regulating a number of biological Key words: small nucleolar host gene 16, microRNA‑15a-5p, processes (8). For example, there is evidence to indicate that ischemia/reperfusion, human brain endothelial cells miR‑15a-5p is involved in the pathogenesis of vascular endo- thelial cell injury following I/R (9). Induction of miR‑15a-5p overexpression inhibits vascularization in a mouse model 2686 TENG et al: SNHG16 INHIBITS OGD‑R‑INDUCED APOPTOSIS IN HBMECs of hind limb ischemia (9). Furthermore, increased levels of (miR‑NC; ON‑TARGETplus SMARTpool; GE Healthcare miR‑15a-5p are detected in the heart following myocardial Dharmacon, Inc.) at a final concentration of 100 nM using infarction, and inhibition of miR‑15a-5p decreases infarct Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, size and enhances cardiac function in mice that have expe- Inc.) according to the manufacturer's recommendation. At 6 h rienced myocardial infarction (10). Notably, miR‑15a-5p can post-transfection, the cells were subjected to OGD‑R. The decrease Bcl-2 expression levels and increase apoptosis of transfection efficiency in cells was determined using reverse cerebral vascular endothelial cells following oxygen-glucose transcription quantitative PCR (RT-qPCR). deprivation and reoxygenation (OGD‑R) (11). However, little is currently known about which factors regulate miR‑15a-5p Measurement of miR-15a-5p and SNHG16 using RT-qPCR. expression levels following OGD‑R in hBMECs. Total RNA was extracted from individual groups of hBMECs Long non‑coding RNAs (lncRNAs) are defined as being using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, >200 nucleotides in length and function as miR sponges to Inc.) and reverse transcribed into cDNA at 50˚C for 30 min regulate numerous biological processes, including apoptosis, using the cDNA Reverse Transcription kit (Applied Biosystems; inflammation and I/R injury (12,13). For example, expression Thermo Fisher Scientific, Inc.). The relative levels of target levels of antisense non-coding RNA in the INK4 locus (ANRIL) SNHG16 to control GAPDH mRNA transcripts were deter- are upregulated in the cortex in a rat model of cerebral infarc- mined via RT-qPCR using SYBR Green (Thermo Fisher tion and ANRIL can activate the NF-κB signaling pathway Scientific, Inc.) and specific primers in an Applied Biosystems to promote inflammation (12). The UCA1 lncRNA expression 7500 PCR system (Applied Biosystems; Thermo Fisher level is downregulated in myocardial tissues in a mouse model Scientific, Inc.). The sequences of primers were: SNHG16: of I/R injury by targeting P27 to induce apoptosis (13). On Forward 5'‑CAGAATGCCATGGTTTCCCC‑3'; reverse, the other hand, metastasis-associated lung adenocarcinoma 5'-TGGCAAGAGACTTCCTGAGG-3'; GAPDH: Forward, transcript 1 (MALAT1) can target the pro-apoptotic protein 5'-GCACCGTCAAGGCTGAGAAC‑3'; reverse, 5'‑ATGGT Bim to decrease pro-inflammatory cytokine production in GGTGAAGACGCCA GT-3'. Similarly, the relative levels of BMECs of mice with I/R‑induced brain injury (14). The small miR‑15a-5p to control U6 small nuclear RNA were analyzed nucleolar RNA host gene 16 (SNHG16) is a newly identified using RT-qPCR using the TaqMan miRNA assay kit (Applied oncogenic lncRNA that regulates the progression and metas- Biosystems; Thermo Fisher Scientific, Inc.). The thermocy- tasis of lung, breast and bladder cancer (15,16). Previous studies cling conditions were as follows: 20 sec at 95˚C, followed by have demonstrated that lncRNAs can share miRNA response 40 cycles of 15 sec at 95˚C and 60 sec at 60˚C, and 60˚C for elements (MREs) and induce gene silencing (17,18). However, 1 min. The data were normalized to the control and analyzed it is currently unknown whether SNHG16 can interact with using the 2-ΔΔCq method (21). miR‑15a-5p to regulate the proliferation and apoptosis of hBMECs during I/R. Cell apoptosis assay. The frequency of apoptotic hBMECs The present study used hBMECs to investigate the effect was determined by flow cytometry. Briefly, hBMECs of OGD‑R on proliferation, apoptosis and miR‑15a-5p, Bcl-2 (1x105 cells/well) were cultured in 10% FBS/DMEM and SNHG16 expression levels. The potential interaction of (Gibco; Thermo Fisher Scientific, Inc.) for 24 h at 37˚C in SNHG16 with miR‑15a-5p was analyzed via pull-down, lucif- 5% CO2 and subjected to OGD‑R. Cells were collected at erase and immunoprecipitation assays. the indicated time points post-reoxygenation. The cells were stained with phycoerythrin-conjugated propidium iodide and Materials and methods FITC‑conjugated Annexin V (both 1:10; both BD Biosciences) for 20 min at room temperature. The percentages of apoptotic Establishment of an in vitro model of OGD-R. The hBMEC cells were analyzed using a BD FACSCalibur flow cytometer line hCMEC/D3 was obtained from Procell Life Science & (BD Biosciences). Technology Co., Ltd. The cells were cultured in complete DMEM containing 10% fetal bovine serum (FBS; Gibco; Measurement of cell proliferation. Cell proliferation was Thermo Fisher Scientific, Inc.) for 24 h at 37˚C in a humidified measured using MTT assay. Briefly, hBMECs (1x10 4 cells/well) atmosphere of 5% CO2. I/R injury of hBMECs was induced by were cultured in 10% FBS/DMEM (Gibco; Thermo Fisher OGD‑R (19,20). Briefly, the cells were cultured in a medium Scientific, Inc.) for 24 h at 37˚C in 5% CO2 and subjected to without glucose and serum (Gibco; Thermo Fisher Scientific, OGD‑R. The cells were exposed to 10 µl of 5 mg/ml MTT Inc.) at 37˚C in a 5% CO2 and 95% N2 hypoxic cell culture for 4 h. The generated purple formazan in individual wells system (H35; Don Whitley Scientific) for 4 h and then cultured was dissolved in 50 µl DMSO. Absorbance was measured at in complete medium at 37˚C in 5% CO2. hBMECs cultured in 540 nm in a microplate reader (SpectraMax M5; Molecular complete medium at 37˚C in 5% CO2 were used as the control. Devices, LLC). Transfection with RNA oligoribonucleotides.