Dissecting Transcriptomic Signatures of Neuronal Differentiation and Maturation Using Ipscs
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Exploring Prostate Cancer Genome Reveals Simultaneous Losses of PTEN, FAS and PAPSS2 in Patients with PSA Recurrence After Radical Prostatectomy
Int. J. Mol. Sci. 2015, 16, 3856-3869; doi:10.3390/ijms16023856 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Exploring Prostate Cancer Genome Reveals Simultaneous Losses of PTEN, FAS and PAPSS2 in Patients with PSA Recurrence after Radical Prostatectomy Chinyere Ibeawuchi 1, Hartmut Schmidt 2, Reinhard Voss 3, Ulf Titze 4, Mahmoud Abbas 5, Joerg Neumann 6, Elke Eltze 7, Agnes Marije Hoogland 8, Guido Jenster 9, Burkhard Brandt 10 and Axel Semjonow 1,* 1 Prostate Center, Department of Urology, University Hospital Muenster, Albert-Schweitzer-Campus 1, Gebaeude 1A, Muenster D-48149, Germany; E-Mail: [email protected] 2 Center for Laboratory Medicine, University Hospital Muenster, Albert-Schweitzer-Campus 1, Gebaeude 1A, Muenster D-48149, Germany; E-Mail: [email protected] 3 Interdisciplinary Center for Clinical Research, University of Muenster, Albert-Schweitzer-Campus 1, Gebaeude D3, Domagkstrasse 3, Muenster D-48149, Germany; E-Mail: [email protected] 4 Pathology, Lippe Hospital Detmold, Röntgenstrasse 18, Detmold D-32756, Germany; E-Mail: [email protected] 5 Institute of Pathology, Mathias-Spital-Rheine, Frankenburg Street 31, Rheine D-48431, Germany; E-Mail: [email protected] 6 Institute of Pathology, Klinikum Osnabrueck, Am Finkenhuegel 1, Osnabrueck D-49076, Germany; E-Mail: [email protected] 7 Institute of Pathology, Saarbrücken-Rastpfuhl, Rheinstrasse 2, Saarbrücken D-66113, Germany; E-Mail: [email protected] 8 Department -
Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C
Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation -
The Future of Dermatopathology
Modern Pathology (2006) 19, S155–S163 & 2006 USCAP, Inc All rights reserved 0893-3952/06 $30.00 www.modernpathology.org The future of dermatopathology A Neil Crowson Departments of Dermatology, Pathology, and Surgery, University of Oklahoma and Regional Medical Laboratory, St John Medical Center, Tulsa, OK, USA Of the major issues that dermatopathology will face in the immediate future, two powerful challenges loom large. The first is the application of novel nondestructive imaging technologies to in vivo diagnosis in humans. The second is the application of molecular technologies to a diagnostic arena which formerly belonged exclusively to the light microscopist. The first to be considered in this context is the application of near infrared spectroscopy to the noninvasive in vivo diagnosis of neoplastic skin disease. The second will be a discussion of application, methodology and the current state of the art in microarray technologies as they apply to neoplastic dermatopathology and, in particular, the diagnosis and prognostication of melanoma. Modern Pathology (2006) 19, S155–S163. doi:10.1038/modpathol.3800513 Keywords: in vivo microscope; tissue microarray; basal cell carcinoma; infrared spectroscopy Noninvasive assessment of skin lesions keratoses and squamous cell carcinomata in vitro. by near infrared (IR) spectroscopy Melanocytic nevi could be subdivided into banal vs dysplastic nevi based upon their spectral differences In the late 1990s, working with Dr Laura McIntosh and melanomas could be separately recognized as and colleagues at the National Research Council of well. Furthermore, the different types of lesion were Canada, the University of Manitoba, Central Medical shown to have distinct mid-IR signatures when Laboratories and the Misericordia General Hospital compared to adjacent normal epidermal and dermal in Winnipeg, Canada, we designed and patented a compartments. -
Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol . -
Transcriptomic and Proteomic Profiling Provides Insight Into
BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes. -
The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons
The function and evolution of C2H2 zinc finger proteins and transposons by Laura Francesca Campitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Laura Francesca Campitelli 2020 The function and evolution of C2H2 zinc finger proteins and transposons Laura Francesca Campitelli Doctor of Philosophy Department of Molecular Genetics University of Toronto 2020 Abstract Transcription factors (TFs) confer specificity to transcriptional regulation by binding specific DNA sequences and ultimately affecting the ability of RNA polymerase to transcribe a locus. The C2H2 zinc finger proteins (C2H2 ZFPs) are a TF class with the unique ability to diversify their DNA-binding specificities in a short evolutionary time. C2H2 ZFPs comprise the largest class of TFs in Mammalian genomes, including nearly half of all Human TFs (747/1,639). Positive selection on the DNA-binding specificities of C2H2 ZFPs is explained by an evolutionary arms race with endogenous retroelements (EREs; copy-and-paste transposable elements), where the C2H2 ZFPs containing a KRAB repressor domain (KZFPs; 344/747 Human C2H2 ZFPs) are thought to diversify to bind new EREs and repress deleterious transposition events. However, evidence of the gain and loss of KZFP binding sites on the ERE sequence is sparse due to poor resolution of ERE sequence evolution, despite the recent publication of binding preferences for 242/344 Human KZFPs. The goal of my doctoral work has been to characterize the Human C2H2 ZFPs, with specific interest in their evolutionary history, functional diversity, and coevolution with LINE EREs. -
Biological Models of Colorectal Cancer Metastasis and Tumor Suppression
BIOLOGICAL MODELS OF COLORECTAL CANCER METASTASIS AND TUMOR SUPPRESSION PROVIDE MECHANISTIC INSIGHTS TO GUIDE PERSONALIZED CARE OF THE COLORECTAL CANCER PATIENT By Jesse Joshua Smith Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University In partial fulfillment of the requirements For the degree of DOCTOR OF PHILOSOPHY In Cell and Developmental Biology May, 2010 Nashville, Tennessee Approved: Professor R. Daniel Beauchamp Professor Robert J. Coffey Professor Mark deCaestecker Professor Ethan Lee Professor Steven K. Hanks Copyright 2010 by Jesse Joshua Smith All Rights Reserved To my grandparents, Gladys and A.L. Lyth and Juanda Ruth and J.E. Smith, fully supportive and never in doubt. To my amazing and enduring parents, Rebecca Lyth and Jesse E. Smith, Jr., always there for me. .my sure foundation. To Jeannine, Bill and Reagan for encouragement, patience, love, trust and a solid backing. To Granny George and Shawn for loving support and care. And To my beautiful wife, Kelly, My heart, soul and great love, Infinitely supportive, patient and graceful. ii ACKNOWLEDGEMENTS This work would not have been possible without the financial support of the Vanderbilt Medical Scientist Training Program through the Clinical and Translational Science Award (Clinical Investigator Track), the Society of University Surgeons-Ethicon Scholarship Fund and the Surgical Oncology T32 grant and the Vanderbilt Medical Center Section of Surgical Sciences and the Department of Surgical Oncology. I am especially indebted to Drs. R. Daniel Beauchamp, Chairman of the Section of Surgical Sciences, Dr. James R. Goldenring, Vice Chairman of Research of the Department of Surgery, Dr. Naji N. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name thymosin beta 15a Gene Symbol TMSB15A Organism Human Gene Summary Description Not Available Gene Aliases TMSB15, TMSB15B, TMSL8, TMSNB, Tb15, TbNB RefSeq Accession No. NC_000023.10, NT_011651.17 UniGene ID Hs.56145 Ensembl Gene ID ENSG00000158164 Entrez Gene ID 11013 Assay Information Unique Assay ID qHsaCED0045803 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000289373, ENST00000601407 Amplicon Context Sequence TTAAAACAGGCTTATCCAGTATAGGATGCAAGAACTACATACACAAAGGTCATCA ATGGTGAGATTATTGACAGCATCTGCCATCTGGAACATATGCACCAATGGTAAGT TTAAAAATGAATT Amplicon Length (bp) 93 Chromosome Location X:101768728-101768850 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9994 cDNA Cq 21.97 cDNA Tm (Celsius) 79 gDNA Cq 25.12 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report TMSB15A, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. -
A Molecular Classification of Human Mesenchymal Stromal Cells Florian Rohart1, Elizabeth Mason1, Nicholas Matigian1, Rowland
bioRxiv preprint doi: https://doi.org/10.1101/024414; this version posted August 11, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Rohart'et'al,'The'MSC'Signature' 1' 1' A Molecular Classification of Human Mesenchymal Stromal Cells 2' Florian Rohart1, Elizabeth Mason1, Nicholas Matigian1, Rowland Mosbergen1, 3' Othmar Korn1, Tyrone Chen1, Suzanne Butcher1, Jatin Patel2, Kerry Atkinson2, 4' Kiarash Khosrotehrani2,3, Nicholas M Fisk2,4, Kim-Anh Lê Cao3 and Christine A 5' Wells1,5* 6' 1 Australian Institute for Bioengineering and Nanotechnology, The University of 7' Queensland, Brisbane, QLD Australia 4072 8' 2 The University of Queensland Centre for Clinical Research, Herston, Brisbane, 9' Queensland, Australia, 4029 10' 3 The University of Queensland Diamantina Institute, Translational Research 11' Institute, Woolloongabba, Brisbane QLD Australia, 4102 12' 4 Centre for Advanced Prenatal Care, Royal Brisbane & Women’s Hospital, Herston, 13' Brisbane, Queensland, Australia, 4029 14' 5 Institute for Infection, Immunity and Inflammation, College of Medical, Veterinary & 15' Life Sciences, The University of Glasgow, Scotland, UK G12 8TA 16' *Correspondence to: Christine Wells, [email protected] 17' bioRxiv preprint doi: https://doi.org/10.1101/024414; this version posted August 11, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. -
Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation. -
A Transcriptional Signature of Postmitotic Maintenance in Neural Tissues
Neurobiology of Aging 74 (2019) 147e160 Contents lists available at ScienceDirect Neurobiology of Aging journal homepage: www.elsevier.com/locate/neuaging Postmitotic cell longevityeassociated genes: a transcriptional signature of postmitotic maintenance in neural tissues Atahualpa Castillo-Morales a,b, Jimena Monzón-Sandoval a,b, Araxi O. Urrutia b,c,*, Humberto Gutiérrez a,** a School of Life Sciences, University of Lincoln, Lincoln, UK b Milner Centre for Evolution, Department of Biology and Biochemistry, University of Bath, Bath, UK c Instituto de Ecología, Universidad Nacional Autónoma de México, Ciudad de México, Mexico article info abstract Article history: Different cell types have different postmitotic maintenance requirements. Nerve cells, however, are Received 11 April 2018 unique in this respect as they need to survive and preserve their functional complexity for the entire Received in revised form 3 October 2018 lifetime of the organism, and failure at any level of their supporting mechanisms leads to a wide range of Accepted 11 October 2018 neurodegenerative conditions. Whether these differences across tissues arise from the activation of Available online 19 October 2018 distinct cell typeespecific maintenance mechanisms or the differential activation of a common molecular repertoire is not known. To identify the transcriptional signature of postmitotic cellular longevity (PMCL), Keywords: we compared whole-genome transcriptome data from human tissues ranging in longevity from 120 days Neural maintenance Cell longevity to over 70 years and found a set of 81 genes whose expression levels are closely associated with Transcriptional signature increased cell longevity. Using expression data from 10 independent sources, we found that these genes Functional genomics are more highly coexpressed in longer-living tissues and are enriched in specific biological processes and transcription factor targets compared with randomly selected gene samples.