Studying Human Prostate Cancer Radioresistance

Studying human prostate cancer radioresistance

LEI CHANG

A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy

St George and Sutherland Clinical School Faculty of Medicine University of New South Wales August 2015

ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contributions made to the research by others, with whom I have worked at UNSW or elsewhere, are explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ……………………………………………......

Abstract

Radiotherapy (RT) plays a prominent role in the treatment of prostate cancer (CaP) alone or as an adjuvant therapy. However, radioresistance is a major challenge in CaP RT. This thesis provides an overview of the literature regarding the mechanisms of CaP radioresistance, radiosensitisers research as well as radioresistance-related biomarkers discovery using proteomic approaches. The aims of the study were to: 1) investigate the roles and association of epithelial-mesenchymal transition (EMT), cancer stem cells (CSCs) and the PI3K/Akt/mTOR signalling pathway in CaP radioresistance; 2) identify proteins involved in CaP radioresistance using liquid chromatography tandem mass spectrometry (LC-MS/MS), validate the identified potential proteins and perform functional study; 3) investigate the therapeutic potential of combination therapy with PI3K/mTOR inhibitors and RT in CaP-radioresistant (RR) cell lines; 4) investigate the therapeutic potential of combination therapy with a PI3K/mTOR dual inhibitor BEZ235 and RT in CaP-RR tumour xenografts. I developed three novel CaP-RR cell lines (PC-3RR, DU145RR and LNCaPRR) by fractioned RT and found enhanced EMT/CSC phenotypes, activation of cell cycle checkpoints, autophagy, DNA repair as well as the PI3K/Akt/mTOR pathway and inactivation of apoptosis proteins in these cell lines. I identified 19 potential proteins in three paired CaP cell lines using LC-MS/MS proteomics. I also chose one identified potential protein marker-ALDOA for functional study and demonstrated that the depletion of ALDOA combined with RT effectively increased radiosensitivity in CaP- RR cells. In in vitro study, I found, in comparison with the combination of single PI3K or mTOR inhibitors and radiation, low-dose of dual PI3K/mTOR inhibitors combined with radiation greatly improved treatment efficacy. I also established PC-3-luc (from PC-3 by transduction) and PC-3RR-luc (from PC-3-luc cell line using fractioned radiation) tumours in subcutaneous (s.c) and orthotopic mouse models, and demonstrated BEZ235 combined with RT could significantly reduce tumour growth

iii

compared with RT or BEZ235 alone or vehicle control in PC-3RR-luc s.c and orthotopic models. Collectively, findings from my PhD study suggest that CaP radioresistance is related to by multifactorial traits especially associated with EMT, CSCs, PI3K/Akt/mTOR and other signalling pathways. Targeting these proteins or signalling pathways is promising for CaP radiotherapy to overcome radioresistance.

Acknowledgments

I would never have been able to finish my dissertation without the guidance of my dear supervisor, my group members, and support from my family and my friends.

Foremost, I would like to express my sincere gratitude to my supervisor Associate Professor Yong Li for his patience, motivation, enthusiasm, and immense knowledge. His encouragement and help have been invaluable for my thesis and my development as a researcher at large. In particular, he supported me during all my research work, encouraged me to apply for several awards and travel grants, supported me to attend several international and domestic conferences and taught me a lot about how to improve my observations, basic experimental skills, manuscript writing, conference presentation and response to all comments; he even personally revised my papers word by word. His guidance helped me in all the time of research and writing of this thesis. I could not have imagined having a better advisor and mentor for my PhD study.

Besides my supervisor, I also would like to thank my co-supervisor Associate Professor Peter Graham. He has taken time out of his busy schedule to help me with radiation experiment design in in vitro and in vivo studies, and provided radiation facility for me to carry out all the in vitro radiation experiments. In the past several years, he had always kindly financially supported my research project and funded me to attend several international conferences. I am so lucky to have Peter as my co-supervisor.

I would like to thank Dr Valerie Wasinger from Bioanalytical Mass Spectrometry Facility. She led me to the proteomics world and taught me from zero. Val spent plenty of time explaining to me the meaning of proteome, designing proteomics study, carried out experiments, analysing all the data with me, and reviewing my papers and conference abstracts.

I also wanted to thank all collaborators of our group in the animal study. Dr. Carl Power demonstrated and taught me how to establish the orthotopic animal model. Dr Eric Hau helped me to design lead container for mice radiation in animal study. Dr Kevin Qian Wang from Centenary Institute of Cancer, University of Sydney kindly provided me PC-3-luc cell line for my animal study. Dr Martin Bucknall aided me to analyse drug pharmacokinetics in mice. Dr Josephine Joya and Ms Katrina Blazek gave me lots of helpful advice from aminal ethics applications, experiment designing, experiment techniques, to data analysis. I also learned a lot from them about animal experiments and research ethics. Without them, the animal experiments would not have been completed.

The same sincere acknowledgement goes to Associate Professor Paul Cozzi for kindly providing constant financial support for my studies and Dr Joseph Bucci for his help for my radiation study and clinical consultant for radioresistance in prostate cancer. I also want to thank Mr Ken Hopper, Mr Ese Enari, Mr Alex Wallace and Mr Peter Treacy from Cancer Care Centre, St George Hospital for their technical support in my radiation studies.

In addition, I thank all funding bodies including NHMRC; ARC; Cancer Research Trust Fund at Cancer Care Centre, St George Hospital; Cancer Institute NSW; St George and Southerland Medical Research Foundation; Urology Research Fund; Prostate and Breast Cancer Foundation and China Scholarship Council for their generous supports.

Furthermore, my appreciation also extends to my past and present colleagues in the Cancer Research Group in St. George Hospital. Dr. Julia Beretov helped me with all animal histology preparation in this thesis; Dr. Jingli Hao has taught me all the biology and animal experimental skills. We faced the problems, and then discussed and solved them together. She is more like a sister to me and always cares about my morale and my life. Dr. Jie Ni and I helped each other and pulled through together during my whole PhD life. He is always there to support me not only in my study but also in my life. Dr. Junli Deng, and Dr. Ning Li also kindly supported my study and we shared happiness and sorrow together in the past years.

My very special note of thanks to my dear friends Ms Ning Liu, Ms Lingxi Wu, Ms Xiaoyu Gu, Mr Huizhong Li, Mr David Wei, who brought me lots of joyous time in the past four years.

Last but not least, I want to thank my beloved parents, Ms Aijie Zhang and Mr Guoxiang Chang, both of whom have been there for the whole time and exceptionally tolerant and patient throughout. Without my dear parents, I could never fly from China to Australia to achieve my dream. My parents helped me survive all the stress from the past four years and not let me give up. They give me their unlimited love and support throughout my life.

vii

List of Publications, Presentations and Awards

Publications as the first author

1. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. "Acquisition of epithelial–mesenchymal transition and cancer stem cell phenotypes is associated with activation of the PI3K/Akt/mTOR pathway in prostate cancer radioresistance." Cell Death and Disease (2013) 4(10): e875-e875.

2. Chang L, Graham PH, Hao JL, Bucci J, Cozzi PJ, Kearsley JH and Li Y. "Emerging roles of radioresistance in prostate cancer metastasis and radiation therapy." Cancer Metastasis Review (2014) 33(2-3): 469-496.

3. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. "PI3K/Akt/mTOR pathway inhibitors enhance radiosensitivity in radioresistant prostate cancer cells through inducing apoptosis, reducing autophagy, suppressing NHEJ and HR repair pathways." Cell Death and Disease (2014) 5: e1437.

4. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. " Targeting PI3K/Akt/mTOR signalling pathway in the treatment of prostate cancer radioresistance." Critical reviews in Hematology/Oncology. 2015 in press. (DOI: http://dx.doi.org/10.1016/j.critrevonc.2015.07.005)

5. Chang L, Graham PH, Hao JL, Bucci J, Malouf D, Gillatt D, Li Y. Proteomics discovery of radioresistant cancer biomarkers for radiotherapy. Cancer Letters. 2015 in press. (DOI:10.1016/j.canlet.2015.09.013.)

viii

6. Chang L, Graham P, Hao JL, Ni J, Deng JL, Bucci J, Malouf D, Gillatt D, Li Y. Cancer stem cells and signaling pathways in the management of cancer radioresistance. Submitted to Cancer Treat Rev in July 2015.

7. Chang L, Graham P, Hao JL, Wasinger V, Ni J, Beretov J, Bucci J, Cozzi P, Li Y. Identification of protein biomarkers and main signaling pathways involved in prostate cancer radioresistance using label-free LC-MS/MS proteomic approach. Submitted to Mol Cell Proteomics in August 2015.

Publications as a co-author

1. Hao JL, Madigan MC, Khatri A, Power CA, Hung TT, Beretov J, Chang L, Xiao W, Cozzi PJ, Graham PH, Kearsley JH and Li Y. "In vitro and in vivo prostate cancer metastasis and chemoresistance can be modulated by expression of either CD44 or CD147." PLoS One (2012) 7(8): e40716.

2. Chao H, Wang L, Hao JL, Ni J, Chang L, Graham PH, Kearsley JH and Li Y. "Low dose histone deacetylase inhibitor, LBH589, potentiates anticancer effect of docetaxel in epithelial ovarian cancer via PI3K/Akt pathway in vitro." Cancer Letter (2013) 329(1): 17-26.

3. Xiao W, Graham PH, Hao JL, Chang L, Ni J, Power CA, Dong Q, Kearsley JH and Li Y. "Combination therapy with the histone deacetylase inhibitor LBH589 and radiation is an effective regimen for prostate cancer cells." PLoS One (2013) 8(8): e74253.

4. Ni J, Cozzi P, Hao JL, Beretov J, Chang L, Duan W, Shigdar S, Delprado W, Graham PH, Bucci J, Kearsley JH and Li Y. "Epithelial cell adhesion molecule (EpCAM) is associated with prostate cancer metastasis and chemo/radioresistance via the PI3K/Akt/mTOR signalling pathway." The International Journal of Biochemistry & Cell Biology (2013) 45(12): 2736-2748.

5. Ni J, Cozzi PJ, Hao JL, Beretov J, Chang L, Duan W, Shigdar S, Delprado WJ, Graham PH, Bucci J, Kearsley JH and Li Y. "CD44 variant 6 is associated with prostate cancer metastasis and chemo-/radioresistance." Prostate (2014) 74(6): 602-617.

Oral conference presentations

1. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi P, Kearsley JH, Li Y (2013). Acquisition of epithelial-mesenchymal transition and cancer stem cell phenotypes is associated with activation of the PI3K/Akt/mTOR pathway in prostate cancer radioresistance. Prostate Cancer World Congress, 6-10 August 2013, Melbourne, Australia.

2. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi P, Kearsley JH, Li Y (2014). Preclinical studies of the combination of dual PI3K/Akt/mTOR inhibitors with radiotherapy to overcome radioresistant prostate cancer. 19th World Congress on Advances in Oncology and 17th International Symposium on Molecular Medicine, 9-11 Oct 2014, Athens, Greece.

Poster conference presentations

1. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi P, Kearsley JH, Li Y (2012) Epithelial mesenchymal transition (EMT) is involved in the prostate cancer radiation resistance. The St George & Sutherland Medical Research Symposium, 11Oct, 2012, Sydney, Australia.

2. Ni J, Cozzi P, Hao JL, Beretov J, Chang L, Duan W, Delprado W, Graham PH, Bucci J, Kearsley JH, Li Y (2012) EpCAM (CD326) and CD44 variants are biomarkers associated with prostate cancer metastasis and progression. The St George & Sutherland Medical Research Symposium, 11Oct, 2012, Sydney, Australia.

3. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi P, Kearsley JH, Li Y (2012) Developing radiation resistant prostate cancer cell lines with epithelial mesenchymal

transition (EMT) characteristic for prostate cancer treatment. IPOS 14th World Congress and COSA’s 39th Annual Scientific Meeting, 13-15Nov, 2012, Brisbane, Australia. (Conference travel award)

4. Li Y, Wang L, Chao H, Hao JL, Ni J, Chang L, Deng J, Graham PH, Kearsley JH (2013). Combining low dose LBH589 with docetaxel increases apoptosis in epithelial ovarian cancer cells via PI3K/Akt/mTOR signalling pathway. IGCS, 11-13April2013, Bali, Indonesia.

5. Ni J, Cozzi P, Hao JL, Beretov J, Chang L, Duan W, Delprado W, Graham PH, Bucci J, Kearsley JH, Li Y (2013). CD44 variant 6 is a biomarker associated with prostate cancer metastasis and progression. LOWY Cancer Symposium, 15-17 May 2013, Sydney, NSW, Australia.

6. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi P, Kearsley JH, Li Y (2013) Identification of novel biomarkers for prostate cancer radioresistance using the label- free LC-MS/MS approach. HUPO 12thAnnual World Congress, 14 Sep 2013,Yokohama, Japan.(Conference travel award)

7. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi P, Kearsley JH, Li Y (2013). PI3K/Akt/mTOR dual inhibitors have obvious advantages over single inhibitors in overcoming prostate cancer radioresistance. Molecular Targets and Cancer Therapeutics AACR, 19-23 Oct 2013, Boston, USA. (University travel fund)

8. Li Y, Chang L, Graham PH, Hao JL, N J, Bucci J, Cozzi P, Kearsley JH (2013). Prostate cancer radioresistance is associated with acquisition of epithelial-mesenchymal transition and cancer stem cell phenotypes via activation of the PI3K/Akt/mTOR pathway. 6th International EMT Meeting, 13-16 Nov 2013, Alicante, Spain.

9. Ni J, Cozzi P, Hao JL, Beretov J, Chang L, Duan W, Delprado W, Graham PH, Bucci J, Kearsley JH, Li Y (2014). CD44 isoform variant 6 is associated with prostate cancer progression, metastasis and chemo-/radio-resistance via PI3K/Akt/mTOR and Wnt/β-catenin signalling pathwaysin vitro. AACR, 5-9 April 2014, San Diego, CA. xi

10. Chang L, Valerie W, Graham PH, Hao JL, Ni J, Julia B, Bucci J ,Cozzi P, Kearsley JH, Li Y (2014) Identification of novel biomarkers for prostate cancer radioresistance using the label-free LC-MS/MS approach. HUPO13thAnnual World Congress, 5-8 Oct 2014, Madrid, Spain. (Conference travel award)

11. Chang L, Graham PH, Hao JL, Bucci J, Cozzi P, Kearsley JH, Li Y (2014). PI3K/Akt/mTOR pathway inhibitors enhance radiosensitivity in radioresistant prostate cancer cells through inducing apoptosis, reducing autophagy, suppressing NHEJ and HR repair pathways. COSA’s 41th Annual Scientific Meeting, 2-4 Dec, 2014, Melbourne, Australia. (Conference travel award)

12. Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi P, Kearsley JH, Li Y (2014) PI3K/Akt/mTOR pathway inhibitors enhance radiosensitivity in radioresistant prostate cancer cells through inducing apoptosis, reducing autophagy, suppressing NHEJ and HR repair pathways. The St George & Sutherland Medical Research Symposium, 13Oct, 2014, Sydney, Australia.

13. Hao JL, Graham PH, Chang L, Ni J, Wasinger V, Beretov J, Bucci J, Cozzi P, Li Y (2014) Identification of radioresistant biomarkers in prostate cancer xenograft animal models using a label-free LC-MS/MS proteomic approach. The St George & Sutherland Medical Research Symposium, 13Oct, 2014, Sydney, Australia.

14. Hao JL, Graham PH, Chang L, Ni J, Wasinger V, Beretov J, Bucci J, Cozzi P, Li Y. Identification of lactate dehydrogenase A (LDHA) as a potential therapeutic target for prostate cancer radiotherapy. The American Association for Cancer Research Annual Meeting 2015, April 18 - 22 2015, Philadelphia, USA.

xii

Awards

2012: Travel award from IPOS 14th World Congress and COSA’s 39th Annual Scientific Meeting, Brisbane, Australia.

2012: Prostate and Breast Cancer Foundation of Australia scholarship, Sydney, Australia.

2013: The Postgraduate Research Student Support (PRSS) Conference Travel Fund, UNSW, Australia.

2013: Chinese Government Award for Outstanding Self-financed Students Abroad, China Scholarship Council, China.

2013: Travel award from HUPO 12th Annual World Congress, Yokohama, Japan.

2014: Travel award from HUPO 2014 association for HUPO 13th Annual World Congress, Madrid, Spain.

2014: St George and Sutherland Clinical School 2013 Research Excellence Award, UNSW, Australia.

2014: Travel award from COSA’s 41th Annual Scientific Meeting, Melbourne, Australia.

2015: St George and Sutherland Clinical School 2014 Research Excellence Award, UNSW, Australia.

xiii

Table of Contents

ORIGINALITY STATEMENT ...... ii

Abstract ...... iii

Acknowledgments ...... v

List of Publications, Presentations and Awards ...... viii Publications as the first author ...... viii Publications as a co-author ...... ix Oral conference presentations ...... x Poster conference presentations ...... x Awards ...... xiii Table of Contents ...... 1

List of Figures ...... 6

List of Tables ...... 13

List of Abbreviations ...... 16

1. Literature Review and Aims ...... 23 1.1 Prostate cancer (CaP) ...... 1 1.1.1 The physical structure and roles of prostate ...... 1 1.1.2 CaP pathogenesis and diagnosis ...... 4 1.1.3 Current progress in CaP treatment ...... 10 1.2 Current obstacles in CaP radiation therapy ...... 12 1.3 CaP radioresistance ...... 13 1.3.1 PI3K/Akt/mTOR in CaP radioresistance ...... 14 1.3.2 The controversial roles of autophagy in cancer RT ...... 27 1.3.3 EMT in CaP metastasis and radioresistance ...... 31 1.3.4 CSCs in CaP radioresistance ...... 36 1.4 Improving radiation sensitivity in CaP with different agents ...... 47 1.4.1 Small molecular inhibitors ...... 52 1.4.2 Growth factor inhibitors ...... 54 1.4.3 Gene therapies ...... 56 1.4.4 Antisense therapies...... 56 1.4.5 Histone deacetylase inhibitors (HDACIs) ...... 57 1.4.6 Natural products ...... 58 1.4.7 Other novel agents...... 59 1

1.5 Targeting PI3K/Akt/mTOR pathway to overcome CaP radioresistance ...... 61 1.5.1 PI3K inhibitors ...... 66 1.5.2 Akt inhibitors ...... 68 1.5.3 mTOR inhibitors ...... 69 1.5.4 Dual PI3K/Akt/mTOR inhibitors ...... 71 1.6 Proteomic studies of RR biomarkers for CaP RT ...... 73 1.6.1 MS-based proteomics techniques in cancer RR biomarker discovery and validation ...... 75 1.6.2 RR biomarkers in cancers ...... 83 1.7 Summary of literature review ...... 93 1.8 Thesis aims ...... 93 2. General materials and methods ...... 95 2.1 Ethical approval ...... 96 2.2 Materials ...... 96 2.2.1 Preparation of media and buffers...... 96 2.2.2 Cell lines ...... 97 2.2.3 Antibodies ...... 100 2.2.4 Chemicals and reagents ...... 104 2.2.5 Inhibitors preparation for stock and treatment ...... 106 2.2.6 siRNA ...... 107 2.3 Methods ...... 107 2.3.1 Cell culture ...... 107 2.3.2 Cell viability ...... 108 2.3.3 Cell preservation/cell thawing ...... 108 2.3.4 Radiation treatment for developing CaP-RR cell lines ...... 109 2.3.5 Clonogenic survival assay ...... 109 2.3.6 Sphere formation assay ...... 110 2.3.7 Matrigel invasion assay ...... 110 2.3.8 Colony assay ...... 111 2.3.9 Immunofluorescence (IF) staining...... 111 2.3.10 Protein extraction ...... 112 2.3.11 Protein quantification ...... 112 2.3.12 WB analysis ...... 112 2.3.13 Quantitative real time-PCR (qRT-PCR) ...... 113 2.3.14 MTT assay ...... 113 2.3.15 Detection of apoptosis ...... 114 2.3.16 Flow cytometric analysis for cell cycle distribution ...... 115 2.3.17 LC-MS/MS proteomics study ...... 116 2.3.18 siRNA transfection ...... 119 2.3.19 Animal model development...... 119 2.3.20 Toxicity studies in NOD/SCID mice without tumour ...... 122 2.3.21 Pharmacokinetics study in NOD/SCID mice with PC-3RR-luc s.c tumours 123 2.3.22 Radiation treatment on animal models ...... 124 2.3.23 Non-invasive BLI tumour imaging ...... 124 2.3.24 Efficacy study in two CaP animal models ...... 124 2.3.25 Paraffin sections ...... 125 2.3.26 Cryosections ...... 125 2

2.3.27 IHC assay ...... 126 2.3.28 Assessment of immunostaining results ...... 127 2.3.29 Statistical analysis ...... 127 3. Acquisition of EMT and CSC phenotype is associated with activation of the PI3K/Akt/mTOR pathway in CaP radioresistance ...... 128 3.1 Introduction ...... 129 3.2 Materials and methods ...... 130 3.2.1 Antibodies and reagents ...... 130 3.2.2 Cell lines and cell culture ...... 134 3.2.3 Radiation for CaP cell lines...... 134 3.2.4 Clonogenic survival assay ...... 134 3.2.5 Sphere assay ...... 134 3.2.6 Matrigel invasion assay ...... 134 3.2.7 IF staining ...... 134 3.2.8 WB analysis ...... 135 3.2.9 qRT-PCR ...... 135 3.2.10 MTT assay ...... 135 3.2.11 Radiosensitivity assay ...... 135 3.2.12 AO/EB assay ...... 135 3.2.13 Assessment of immunostaining results ...... 136 3.2.14 Statistical Analysis ...... 136 3.3 Results ...... 136 3.3.1 Establishment of CaP-RR cell lines ...... 136 3.3.2 Validation of radioresistance in three CaP-RR cell lines ...... 136 3.3.3 CaP-RR cells increase cell invasion and sphere formation capability 140 3.3.4 EMT phenotypic expression in CaP-RR cells ...... 142 3.3.5 Enhanced CSC phenotypes in CaP-RR cells ...... 142 3.3.6 Activation of checkpoint proteins in CaP-RR cells ...... 148 3.3.7 Activation of the PI3K/Akt/mTOR signalling pathway in CaP-RR cells 148 3.3.8 A dual PI3K/mTOR inhibitor BEZ235 on the expression EMT/CSC phenotypes ...... 150 3.3.9 Combination therapy with BEZ235 and RT increases radiosensitivity and induces more apoptosis in CaP-RR cells ...... 151 3.4 Discussion ...... 155 4. Identification of protein biomarkers and main signalling pathways involved in CaP radioresistance using label-free LC-MS/MS proteomics approach ...... 163 4.1 Introduction ...... 164 4.2 Material and methods ...... 165 4.2.1 Antibodies ...... 165 4.2.2 Cell line and cell culture ...... 168 4.2.3 LC-MS/MS proteomics study ...... 168 4.2.4 WB analysis ...... 168 4.2.5 S.c CaP xenograft model development ...... 168 4.2.6 Radiation treatment on animal models ...... 168 3

4.2.7 IHC assay ...... 168 4.2.8 SiRNA transfection ...... 169 4.2.9 Colony assay ...... 169 4.2.10 AO/EB assay ...... 169 4.2.11 Assessment of immunostaining ...... 169 4.2.12 Statistical analysis ...... 169 4.3 Results ...... 170 4.3.1 Proteomic analysis of differences between CaP and CaP-RR cells 170 4.3.2 Important signalling pathways in CaP-RR cells ...... 174 4.3.3 Establishment of s.c CaP xenograft models and confirmation of radioresistance ...... 180 4.3.4 Validation of key signalling pathway proteins in CaP cell lines and animal xenografts ...... 183 4.3.5 Verification of potential marker ALDOA in CaP cell lines and animal xenografts ...... 183 4.3.6 Combination therapy with suppression of ALDOA and RT increases radiosensitivity and induces more apoptosis in CaP-RR cells ...... 190 4.4 Discussion ...... 193 5. PI3K/Akt/mTOR pathway inhibitors enhance radiosensitivity in CaP- RR cells through inducing apoptosis, reducing autophagy, suppressing NHEJ and HR repair pathways ...... 201 5.1 Introduction ...... 202 5.2 Material and methods ...... 203 5.2.1 Antibodies and reagents ...... 203 5.2.2 Cell lines and cell culture ...... 203 5.2.3 MTT assay ...... 204 5.2.4 Flow cytometric analysis for cell cycle distribution ...... 204 5.2.5 Colony assay ...... 204 5.2.6 Detection of apoptosis ...... 204 5.2.7 WB analysis ...... 204 5.2.8 Statistical analysis ...... 205 5.3 Results ...... 207 5.3.1 Cell cycle distribution and checkpoint protein changes in CaP-RR cells 207 5.3.2 CaP radioresistance inhibits apoptosis pathway, activates autophagy and both NHEJ and HR DNA repair pathways ...... 207 5.3.3 Cytotoxicity of dual or single inhibitors on CaP and CaP-RR cells in vitro 213 5.3.4 Effect of combination treatment with dual or single PI3K/mTOR inhibitors on colony formation in CaP-RR cells ...... 215 5.3.5 Comparison of the effect of combination treatment with dual or single PI3K/mTOR inhibitors on apoptosis in CaP-RR cells ...... 219 5.3.6 Combination treatment affects cell cycle distribution and inactivates cell cycle checkpoint proteins in CaP-RR cells ...... 223 5.3.7 Effect of combination treatment with dual or single PI3K/mTOR inhibitors on autophagy and DNA repair pathways in CaP-RR cells ...... 223 5.4 Discussion ...... 225

6. PI3K/mTOR dual inhibitor BEZ235 sensitises radiation response in CaP RR animal models through repression of CSCs ...... 235 6.1 Introduction ...... 236 6.2 Material and methods ...... 236 6.2.1 Antibodies and reagents ...... 236 6.2.2 Cell lines and cell culture ...... 238 6.2.3 Pharmacokinetics study in NOD/SCID mice with PC-3RR-luc s.c tumours ...... 238 6.2.4 Animal model development ...... 238 6.2.5 Non-invasive BLI tumour imaging ...... 238 6.2.6 Toxicity studies in NOD/SCID mice without tumours ...... 238 6.2.7 Radiation treatment on animal models ...... 239 6.2.8 Efficacy study in two CaP-RR animal models ...... 239 6.2.9 Mouse xenograft tumour tissues and histology ...... 239 6.2.10 IHC ...... 239 6.2.11 TUNEL assay ...... 239 6.2.12 Assessment of immunostaining ...... 240 6.2.13 Statistical analysis ...... 240 6.3 Results ...... 240 6.3.1 Toxicologic evaluation and pharmacokinetics of BEZ235 ...... 240 6.3.2 Establishment of PC-3RR-luc s.c and orthotopic mouse models ... 243 6.3.3 Activation of the PI3K/Akt/mTOR pathway in CaP-RR models ... 246 6.3.4 Enhanced CSC phenotypes, cell proliferation, angiogenesis, as well as autophagy and reduced DNA repair and apoptosis pathways in CaP-RR models 247 6.3.5 Combination therapy with BEZ235 and fractioned RT significantly regresses tumour growth in PC-3RR-luc xenograft models ...... 252 6.3.6 Combination therapy with BEZ235 and RT reduces CSC expression and cell proliferation, blocks angiogenesis and autophagy, and induces DNA repair and apoptosis pathway in CaP-RR tumour xenograft models ...... 258 6.4 Discussion ...... 267 7. General discussion and future perspectives ...... 272 7.1 General discussion ...... 273 7.2 Future perspectives...... 275 8. References ...... 279

9. Appendix ...... 344

List of Figures

Figure 1-1 Position and structure of the prostate ...... 1

Figure 1-2 The structure of male reproductive system ...... 2

Figure 1-3 Zones of the prostate ...... 3

Figure 1-4 Diagram showing the Gleason Grades ...... 7

Figure 1-5 Diagram showing TNM staging system for CaP ...... 8

Figure 1-6 Overview of PI3K/Akt/PTEN/mTOR signalling pathway ...... 20

Figure 1-7 A schematic model of EMT in cancer metastasis ...... 32

Figure 1-8 Overview of the PI3K/Akt/mTOR pathway inhibitor targets ...... 62

Figure 1-9 The work flow of LC-MS/MS proteomics technique for CaP-RR biomarker discovery and validation ...... 80

Figure 2-1 The demonstration of s.c injection procedure ...... 120

Figure 2-2 The series of images showing intra-prostatic orthotopic implantation procedure ...... 121

Figure 3-1 Morphological changes in CaP-RR cells after radiation treatment ...... 137

Figure 3-2 Different radiosensitivity to RT in CaP-RR and CaP cells ...... 138

Figure 3-3 Validation of radioresistance in CaP-RR cell lines by colony formation assay ...... 139 6

Figure 3-4 Matrigel invasion in CaP-RR and CaP cells ...... 140

Figure 3-5 Sphere formation in CaP-RR and CaP cells ...... 141

Figure 3-6 EMT phenotypic expression in CaP-RR and CaP cells by IF staining...... 143

Figure 3-7 EMT phenotypic protein expression in CaP-RR and CaP cells using WB ...... 144

Figure 3-8 EMT phenotypic RNA expression in CaP-RR and CaP cells using qRT-PCR ...... 144

Figure 3-9 CSC phenotypic expression in CaP-RR and CaP cells by IF staining ...... 146

Figure 3-10 CSC protein expression in CaP-RR and CaP cells using WB .. 147

Figure 3-11 CSC RNA expression in CaP-RR and CaP cells using qRT-PCR ...... 147

Figure 3-12 Activation of checkpoint proteins and PI3K/Akt/mTOR pathway in CaP-RR cells ...... 149

Figure 3-13 Effect of RT and BEZ235 on the expression of PI3K/Akt/mTOR pathway proteins ...... 152

Figure 3-14 Effect of RT and BEZ235 on the expression of EMT/CSCs in CaP-RR cells ...... 153

Figure 3-15 Effect of RT and BEZ235 on radiosensitivity in CaP-RR cells by colony assay ...... 154

Figure 3-16 Effect of RT and BEZ235 on radiosensitivity in CaP-RR cells by apoptosis assay ...... 155

Figure 4-1 A schematic diagram showing the brief procedure of LC-MS/MS from protein preparation to data analysis ...... 170

Figure 4-2 Identification of protein differences between CaP and CaP-RR cells ...... 172

Figure 4-3 Distribution of identified proteins in each pair CaP cell lines .... 172

Figure 4-4 Expression profiles of the identified proteins between CaP and CaP-RR cell lines ...... 175

Figure 4-5 Subcellular distribution of the identified proteins between CaP and CaP-RR cell lines ...... 175

Figure 4-6 Functional categories of the identified proteins between CaP and CaP-RR cell lines (PC-3 VS PC-3RR (A), DU145 VS DU145RR (B), LNCaP VS LNCaPRR (C)) ...... 177

Figure 4-7 Identification of the top five potential pathways associated with CaP radioresistance ...... 178

Figure 4-8 Diagram showing that radiotherapy associated signalling pathways in CaP-RR cells ...... 179

Figure 4-9 The heatmaps show the disease and function pathways between CaP and CaP-RR cell lines ...... 180

Figure 4-10 Comparison of PC-3-luc and PC-3RR-luc tumour development post cell inoculation in s.c animal xenograft models ...... 182

Figure 4-11 Validation of key pathway proteins from top five pathways identified from CaP-RR cell lines ...... 184

Figure 4-12 Validation of key pathway proteins from top five pathways identified from PC-3RR-luc s.c xenograft tumours ...... 186

Figure 4-13 Validation of ALDOA in CaP-RR cell lines ...... 188

Figure 4-14 The comparison of ALDOA protein in CaP (PC-3, DU145 and LNCaP) and CaP-RR (PC-3RR, DU145RR and LNCaPRR) cells using LC- MS/MS ...... 188

Figure 4-15 Validation of ALDOA in PC-3RR-luc s.c xenograft tumours ... 189

Figure 4-16 The effect of ALDOA suppression on radiosensitivity of CaP-RR cells by colony assay ...... 191

Figure 4-17 The effect of ALDOA suppression on radiosensitivity of CaP-RR cells by apoptosis assay ...... 192

Figure 5-1 CaP-RR cells induce cell cycle redistribution ...... 208

Figure 5-2 CaP-RR cells induce cell cycle pathway proteins ...... 209

Figure 5-3 CaP-RR cells reduce apoptosis pathway proteins, increase autophagy, NHEJ, and HR pathway proteins ...... 211

Figure 5-4 Quantification of WB results from CaP and CaP-RR cells ...... 212

Figure 5-5 Effects of PI3K/mTOR inhibitors by MTT assay ...... 213

Figure 5-6 Effects of combination treatment with inhibitors and RT or RT alone on colony formation in CaP-RR cells ...... 216

Figure 5-7 Effects of combination treatment with inhibitors and RT, RT alone, or inhibitor alone on colony formation of CaP-RR cells ...... 218

Figure 5-8 Effects of combination treatment with inhibitors and RT or RT alone on apoptosis in CaP-RR cells ...... 221

Figure 5-9 Effects of combination treatment with inhibitors and RT or RT alone on cell cycle checkpoint, apoptosis, autophagy, DSB, NHEJ and HR pathway related proteins in CaP-RR cells...... 222

Figure 5-10 Effects of combination treatment with inhibitors and RT or RT alone on cell cycle distribution in CaP-RR cells ...... 224

Figure 5-11 Diagram showing that CaP-RR cells are associated with the induction of cell cycle redistribution, inactivation of apoptosis proteins, activation of cell cycle checkpoint, autophagy, DSB, NHEJ and HR DNA repair pathway proteins compared with CaP cells ...... 226

Figure 5-12 Diagram showing that the model proposed for two dual PI3K/mTOR inhibitors (BEZ235 or PI103) combined with RT induces cell cycle redistribution and apoptosis, increases DNA DSB, reduces autophagy, inactivates NHEJ and HR repair pathways, and enhances radiosensitivity in CaP-RR cells ...... 227

Figure 5-13 Diagram showing that radiotherapy is associated with induction of apoptosis pathway by up-regulation of Bcl-xl and Bcl-2 and down- regulation of Caspase-3, Caspase-7, Cleaved PARP and Bax in CaP-RR cells ...... 229

Figure 5-14 Diagram showing that radiotherapy is associated with induction of autophagy pathway by activation of Becline-1 and LC3A/B in CaP-RR cells ...... 230

Figure 6-1 The effect of single dose administration of BEZ235 and fractioned doses of radiation on weight changes in NOD/SCID mice without tumours 241

Figure 6-2 Standard curves of BEZ235 determination in tumour (A) and plasma (B) calculated by the UHPLC method ...... 243

Figure 6-3 Tumour concentration to time profile after the administration of BEZ235 with an intraperitoneal dose of 10 mg/kg to mice ...... 243

Figure 6-4 Comparison of PC-3-luc and PC-3RR-luc tumour development in orthotopic animal xenograft models ...... 245

Figure 6-5 The expression of p-Akt and p-mTOR in orthotopic xenografts 246

Figure 6-6 The expression of CSC markers-OCT4, Snail, Nanog, CD326, CD44 and CD44V6 in s.c and orthotopic xenografts ...... 249

Figure 6-7 The expression of Ki67, CD31, Becline-1, LC3 A/B in s.c and orthotopic xenografts ...... 249

Figure 6-8 The expression of Caspase-3 (Active), Caspase-7 (Active), PARP-1 (Cleaved), γH2AX, TUNEL in s.c and orthotopic xenografts ...... 250

Figure 6-9 BEZ235 and RT regressed tumour growth in PC-3RR-luc s.c model ...... 255

Figure 6-10 BEZ235 and RT inhibited tumour growth in PC-3RR-luc orthotopic model ...... 257

Figure 6-11 The expression of p-Akt and p-mTOR in s.c (A) and orthotopic (B) xenografts after different treatments at the end of experiments ...... 259

Figure 6-12 The expression of CSC markers OCT4, Snail, Nanog, CD326, CD44 and CD44V6 in s.c (A) and orthotopic (B) xenografts after different treatments at the end of experiments ...... 261

Figure 6-13 The expression of Ki67, CD31, Becline-1 and LC3 A/B in s.c and orthotopic xenografts after different treatments at the end of experiments 263

List of Tables

Table 1-1 Putative CSC markers from human CaP cancer cell lines, animal xenografts and primary human CaP tissues ...... 38

Table 1-2 Summary of combination of radiosensitisers with RT for CaP treatment in preclinical studies ...... 48

Table 1-3 Pre-clinical studies on combination of RT and PI3K/Akt/mTOR pathway inhibitors in CaP ...... 63

Table 1-4 Putative RR biomarkers identified in four cancers by proteomics approaches ...... 84

Table 2-1 Characteristics of all cell lines used in this thesis ...... 99

Table 2-2 The details of four PI3K/mTOR inhibitors ...... 107

Table 3-1 Antibodies used for WB and IF in this Chapter ...... 131

Table 3-2 Intensity of expression of EMT markers in CaP-RR and CaP cells by IF staining ...... 145

Table 3-3 Intensity of expression of CSC markers in CaP-RR and CaP cells by IF ...... 148

Table 3-4 IC50 values for BEZ235 by MTT assay in CaP-RR and CaP cells ...... 150

Table 4-1 Antibodies used for WB and IHC in this Chapter ...... 166

Table 4-2 19 proteins overlapped among three paired cell lines and involved in CaP metastasis, progression, signalling pathways and radioresistance ... 173

Table 4-3 Intensity of the representative proteins from top four interested pathways in PC-3-luc and PC-3RR-luc animal xenografts by IHC ...... 187

Table 4-4 Expression of ALDOA in PC-3-luc and PC-3RR-luc animal xenografts by IHC ...... 189

Table 4-5 Expression of PC-3RR and LNCaPRR cell lines after different treatments in CaP-RR cells by IF staining ...... 192

Table 5-1 Antibodies used for WB in this Chapter...... 205

Table 5-2 Difference of cell cycle distribution between CaP and CaP-RR cell lines ...... 209

Table 5-3 Summary of P values for protein fold variation of CaP-RR cells in relative to CaP cells ...... 210

Table 5-4 IC50 values for dual inhibitors (BEZ235 and PI103) and single inhibitor (BKM120 and Rapamycin) tested by MTT assay in CaP-RR and CaP cell lines for 24 h treatment ...... 214

Table 5-5 Cell cycle redistribution after combination with dual or single PI3K/mTOR inhibitors with RT or RT alone in CaP-RR cells ...... 225

Table 6-1 Antibodies used for IHC in this Chapter ...... 237

Table 6-2 The intensity of expression of PI3K/Akt/mTOR pathway proteins, CSC markers, Ki67, CD31, autophagy proteins, apoptosis pathway proteins, γH2AX and TUNEL in PC-3-luc and PC-3RR-luc tumour xenografts by IHC ...... 251

Table 6-3 The intensity of expression of PI3K/Akt/mTOR pathway proteins, CSC markers, Ki67, CD31, autophagy proteins, apoptosis pathway proteins,

γH2AX and TUNEL in tumour xenografts from BEZ235 with RT or BEZ235 or RT alone or vehicle control treatment by IHC ...... 266

List of Abbreviations

2D Two dimensional 2D-DIGE 2D fluorescence difference gel electrophoresis 2DE Two-Dimensional Electrophoresis 3D-CRT Three-dimensional conformal radiation therapy 4E-BPs 4E binding proteins ACEC Animal Care and Ethics Committee Ad-E2F1 Adenoviral-mediated E2F1 AdPTEN Adenoviral vector-expressed PTEN ADT Androgen deprivation therapy AFS Anterior fibromuscular stroma AHSG Alpha-2-HS-glycoprotein precursor AI Androgen-independent ALDH Aldehyde dehydrogenase ALDOA Aldolase A, Fructose-Bisphosphate AO Acridine Orange AR Androgen receptor AS Antisense ASODN AS-Bcl-2 oligodeoxynucleotide ATCC American Type Culture Collection ATM Ataxia telangiectasia mutated ATO Arsenic trioxide ATP Adenosine triphosphate BC Breast cancer Bcl2 B cell lymphoma 2 BCR Biochemical recurrence BCRP Breast cancer resistance protein BCSCs Breast cancer stem cells

bFGF Basic fibroblast growth factor bHLH Basic helix-loop-helix BLI Bioluminescence BPH Benign prostatic hyperplasia bPSA Benign PSA BSA Bovine serum albumin CAFs Cancer-associated fibroblasts CaP Prostate cancer Cat No. Catalogue Number CDK Cyclin-dependent kinases Chk Checkpoint kinase CK Cytoskeleton CLIC1 Chloride intracellular channel 1 COX-2 Cyclooxygenase-2 cPSA Complexed PSA CRPC Castration-resistant prostate cancer CRT Chemoradiotherapy CSC Cancer stem cell CTCs Circulating tumour cells CZ Central zone DAB Diaminobenzidine DCA Dichloroacetate DDA Data dependent acquisition DDR DNA damage response DEPs Differentially expression proteins DHMEQ Dehydroxymethyl derivative of epoxyquinomicin DIA Data independent acquisition DMSO Dimethyl sulfoxide DPBS Dulbecco’s phosphate buffered saline DRE Digital rectal examination DSBs Double strand breaks EB Ethidium Bromide

EBRT External beam radiation therapy ECL Enhanced chemiluminescence EGF Epidermal growth factor EGFR Epidermal growth factor receptor eIF4E Eukaryotic translation initiation factor 4E ELISA Enzyme-linked immunosorbent assay EMT Epithelial- mesenchymal transition EPCA-2 Early prostate cancer antigen-2 EpCAM Epithelial cell adhesion molecule ER Endoplasmic reticulum ERK Extracellular signal-regulated kinases ESI Electrospray ionization FACS Fluorescence-activated cell sorting FAK Focal adhesion kinase FBS Fetal bovine serum FDR False discovery rate FGFR2IIIb Fibroblast growth factor receptor 2IIIb FLT3 Fms-like tyrosine kinase-3 fPSA Free PSA GKS Gamma Knife Surgery H&E Hematoxylin and eosin HCC Hepatocellular carcinoma HDACIs Histone deacetylase inhibitors HFBA Heptafluorobutyric acid HIF-1 Hypoxia-inducible factor 1 HLA Human lung adenocarcinoma HMAF Hydroxymethylacylfulvene HNC Head and neck cancer HNSCC Head and neck squamous cell carcinoma hpf High power field HPLC High performance liquid chromatography HR Homologous recombination

iBCSCs Induced BCSCs IF Immunofluorescence IGF1R Insulin-like growth factor-type 1 receptor IGRT Image guided radiation therapy IHC Immunohistochemistry IMRT Intensity modulated radiation therapy ip Intraperitoneally IPA Ingenuity pathways analysis IR Ionizing radiation IS Internal standard iTRAQ Isobaric tags for relative and absolute quantitation JNK C-Jun N-terminal kinase KD Knock down KRas Kirsten rat sarcoma K-SFM Keratinocyte serum free medium LC-MS/MS Liquid chromatography- tandem mass spectrometry MAbs Monoclonal antibodies MACS Magnetic activated cell sorting MALDI-TOF- Matrix-assisted laser desorption/ionization time-of-flight mass MS spectrometry MAPK Mitogen-activated protein kinase MDR Multiple drug resistance MET Mesenchymal epithelial transition MIC-1 Macrophage inhibitory cytokine-1 miRNA Micro RNA MLCK Myosin light chain kinase MP Monascuspiloin MPF Mitotic/maturation promoting factor MRI Magnetic resonance imaging MRM Multiple reaction monitoring MRP-1 Multidrug resistance protein 1 MS Mass spectrometry

MTD Maximum tolerance dose mTOR Mammalian target of rapamycin MW Molecular weight NF-κB Nuclear factor-κB NHEJ Non-homologous end joining NO Nitric oxide NOD/SCID Non-obese diabetic/severe combined immunodeficiency NPC Nasopharyngeal cancer NQO1 NAD (P) H quinone oxidoreductase 1 NR3C4 Nuclear receptor subfamily 3, group C, member 4 NSAIDs Non-steroidal anti-inflammatory drugs NSCLC Non-small cell lung carcinoma o/n Overnight OD Optical density p/s Photons/second P529 Palomid 529 p70S6K P70S6 kinase PAb Polyclonal antibody PAP Prostatic acid phosphatase PCR Polymerase chain reaction PDGF Platelet-derived growth factor PDGFR Platelet-derived growth factor receptor PDK Pyruvate dehydrogenase kinase PDX Patients-derived xenografts PH Pleckstrin homology pI Isoelectric point PI (3) P phosphatidylinositol 3-phosphate PI (3, 4) P2 Phosphatidylinositol 3,4- bisphosphate PI(3,4,5)P3 Phosphatidylinositol 3,4,5-trisphosphate PI(4)P Phosphatidylinositol 4-phosphate PI(4,5)P2 Phosphatidylinositol 4,5-bisphosphate PI3K Phosphoinositide 3-kinase

PIK3A Phosphoinositide 3-kinase a PKB Protein kinase B PRDX6 Peroxiredoxin 6 PrxII Peroxiredoxin II PSA Prostate specific antigen PSMA Prostate specific membrane antigen PTEN Phosphatase and tensin homolog PTMs Post-translational modifications PVDF Polyvinyl difluoride PZ Peripheral zone QC Quality control qRT-PCR Quantitative real time-PCR R-2 Receptor 2 Ras Rat sarcoma RP Radical prostatectomy RR Radioresistant RT Radiotherapy rt Room temperature RTKs Receptor tyrosine kinases RT-PCR Reverse transcription polymerase chain reaction RUNX2 Runt-related transcription factor s.c Subcutaneous SAHA Suberoylanilide hydroxamic acid SBRT Stereotactic body radiation therapy SCLC Small-cell lung carcinoma SD Standard deviation shRNA Small hairpin RNA SILAC Stable isotope labeling by amino acids in cell culture siRNA Small interfering RNA SLD Sublethal radiation damage SSD Source surface distance SSE Sodium selenite

SWATH-MS Sequential Window Acquisition of all THeoretical Mass Spectra TBS Tris buffer saline TGF-β Transforming growth factor beta TKIs Tyrosine kinase inhibitors TNM Tumour/Nodes/Metastases TRUS Transrectal ultrasound TrxR Thioredoxin reductase TSC2 Tuberous sclerosis complex 2 TZ Transition zone UHPLC/MS/MS Ultra-high performance liquid chromatography/tandem mass spectrometer UNSW University of New South Wales US Ultrasound v/v Volume per volume VEGF Vascular endothelial growth factor VEGFR Vascular endothelial growth factor receptor VPA Valproic acid w/w Weight per weight WB Western blotting YWHAE Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon α1-AT Alpha-1-antitrypsin αSMA Alpha smooth muscle actin β-lap β-lapachone

1. Literature Review and Aims

Parts of this literature review have been published in:

Chang L, Graham PH, Hao JL, Bucci J, Cozzi PJ, Kearsley JH and Li Y. "Emerging roles of radioresistance in prostate cancer metastasis and radiation therapy." Cancer Metastasis Review (2014) 33(2-3): 469-496.

Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. " Targeting PI3K/Akt/mTOR signalling pathway in the treatment of prostate cancer radioresistance." Critical reviews in Hematology/Oncology. 2015 Accepted. (DOI: http://dx.doi.org/10.1016/j.critrevonc.2015.07.005)

Chang L, Graham PH, Hao JL, Bucci J, Maloufc D, Gillattc D and Li Y. " Proteomics discovery of radioresistant cancer biomarkers for radiotherapy." Cancer Letters. 2015 Accepted. (DOI:10.1016/j.canlet.2015.09.013.)

1.1 Prostate cancer (CaP)

CaP is developed from the prostate that is a gland in the male reproductive system. The progression of most CaPs is very slow. However, some grow relatively quickly. Like other solid tumours, CaP cells may spread from the prostate to distant organs such as bone, lung, liver, brain or lymph nodes (Bubendorf, Schopfer et al. 2000), which may not result in any symptoms at the early stage. In the late stage, several severe symptoms such as urinating difficulty, blood urine and pelvic pain can occur. The treatments for CaP include active surveillance as well as a combination of surgery, radiotherapy (RT), hormone therapy or chemotherapy (Klotz 2010).

1.1.1 The physical structure and roles of prostate

The prostate helps make and store seminal fluid. A typical prostate is located in the front of the rectum, under the urinary bladder and surrounding parts of the urethra (Figure 1-1), which is approximately 3 centimetres long and 11 grams weight (Aumüller 1979, Leissner and Tisell 1979).

Figure 1-1 Position and structure of the prostate The upper picture shows the prostate and nearby organs. The lower picture shows the inside of the prostate, urethra, rectum and bladder. The image is adapted from National Cancer Institute Website http://www.cancer.gov/cancertopics/wyntk/prostate/allpages#ab3d4f20-6ab9- 4428-9717-067035d2e691 1

The prostate contains many small glands that make about twenty percent of the fluid constituting semen (Patrick O. Manafa 2015). This gland is covered in a layer of connective tissue called the prostatic capsule which is made up of different types of cells including gland cells that produce the fluid portion of semen, muscle cells that control urine flow and ejaculation, and fibrous cells that provide the supportive structure of the gland (Liu and True 2002). There are also some other structures around the prostate such as seminal vesicles that are located in both sides of the prostate and can produce semen; vas deferens that carry sperm from the testicles to the seminal vesicles; nerve bundles that control bladder as well as erectile function; and muscles that control urination (Figure 1-2).

Figure 1-2 The structure of male reproductive system Adapted from Canadian Cancer Society Website http://www.cancer.ca/en/cancer-information/cancer-type/prostate/anatomy-and- physiology/?region=on

The prostate gland has four distinct glandular regions, two of which arise from different segments of the prostatic urethra: peripheral zone (PZ), transition zone (TZ), central zone (CZ) and anterior fibromuscular stroma (AFS) (Figure 1-3) (Myers 2000). PZ is the area of the prostate that is closest to the rectum, which can easily be felt by doctors during a digital rectal examination (DRE). It is the largest zone of the prostate gland, in which, approximately 75% of CaP arise. TZ that surrounds the urethra is the middle area of the prostate between PZ and CZ. 2

In TZ, up to 20% of the prostate gland can enlarge after 40 years old and prostatic hyperplasia develops. Also, around 10-20% of CaPs originate in TZ. CZ is in front of TZ and surrounds the ducts. As it is the farthest prostate part from the rectum, CaP in this zone cannot be felt by doctors during a DRE. CZ accounts for roughly 2.5% of CaPs, and these cancers tend to be more aggressive and more likely to invade the seminal vesicles (Cohen, Shannon et al. 2008). AFS is usually devoid of glandular components and only composed of muscle and fibrous tissue.

Figure 1-3 Zones of the prostate Adapted from Radiation Oncology Synopsis Website https://www.waltr.net/oncology/html/gu-male/prostate.html

The main function of the prostate is to secrete the fluid portion of semen that is made alkaline overall with the secretions from other glands such as the seminal vesicle fluid. The gland cells within the prostate produce a thin fluid rich in proteins and minerals that maintain and nourish sperm. The prostate also plays a part in controlling the flow of urine. The urethra runs from the bladder, through the prostate, and out through the penis. The muscle fibres of the prostate are wrapped around the urethra and are under involuntary nervous system control.

The prostate can be affected by some disorders including prostatitis, benign prostate hyperplasia (BPH), and cancer.

1.1.2 CaP pathogenesis and diagnosis

1.1.2.1 Pathogenesis in CaP

CaP is classified as an adenocarcinoma, or glandular cancer, that begins when normal semen-secreting prostate gland cells mutate into cancer cells. However, the pathogenesis of CaP is understood unclearly. Over the past decade, research on CaP has been significantly raised, with a concomitant increase in funding for the basic investigation. Although CaP typically manifests in men aged 65 years and older, growing evidence suggests that prostatic carcinogenesis is initiated much earlier (Grover and Martin 2002). CaP progression is related to a number of genetic abnormalities that affect the androgen receptor (AR), signalling pathways and other molecules that are involved in cell survival and apoptosis (Chang, Graham et al. 2013).

AR, also known as nuclear receptor subfamily 3, group C, member 4 (NR3C4), is a type of nuclear receptor (Lu, Wardell et al. 2006) that is activated by binding either of the androgenic hormones, testosterone, or dihydrotestosterone (Roy, Lavrovsky et al. 1999) in the cytoplasm and then translocating into the nucleus. The main function of the AR is as a DNA-binding transcription factor that regulates gene expression (MOORADIAN, MORLEY et al. 1987). Androgen- regulated genes are also critical for the development and maintenance of the male sexual phenotype (Heinlein and Chang 2002). Prostate differentiation and function, as well as CaP growth and progression, are critically dependent upon AR signalling pathway (Narizhneva, Tararova et al. 2009).

Phosphoinositide 3-kinase (PI3K) signalling is important for regulating cell growth and survival, particularly during tumour progression and metastases. PI3K activates a number of downstream targets including the serine/threonine kinase Akt, a downstream member of the PI3K cascade, which plays an important role in 4

cell growth, death, adhesion and migration, and is frequently activated in cancer cells (Jiang, Aoki et al. 1999, Lin, Hu et al. 2003). Recent studies highlight the importance of the PI3K/Akt signalling pathway in CaP invasion, progression and angiogenesis (Pommery and Henichart 2005, Fang, Ding et al. 2007, Shukla, Maclennan et al. 2007). Clinical CaP specimens were reported to show up- regulation of the PI3K/Akt pathway associated with phosphorylation of the AR during the development of castration-resistant prostate cancer (CRPC) (McCall, Gemmell et al. 2008). PI3K activation can also lead to the development of chemoresistant CaP cells, through the up-regulation of multidrug resistance protein 1 (MRP-1) (Lee, Steelman et al. 2004). Furthermore, the PI3K/Akt signalling pathway works with the transforming growth factor beta (TGF-β) /SMAD signalling cascade to ensure CaP cell survival and protection against apoptosis (Zha and Huang 2009).

There are also many other molecules involved in CaP. Prostate specific membrane antigen (PSMA) stimulates the development of CaP by increasing folate levels for the cancer cells to survive and grow (Yao, Berkman et al. 2010). Runt-related transcription factor 2 (RUNX2) is a transcription factor that prevents cancer cells from undergoing apoptosis, thereby contributing to the development of CaP (Wafa, Cheng et al. 2003). Macrophage inhibitory cytokine-1 (MIC-1) stimulates the focal adhesion kinase (FAK) signalling pathway that leads to CaP cell growth and survival (Bonaccorsi, Muratori et al. 2004).

1.1.2.2 Diagnosis in CaP

There are several methods that can diagnosis CaP such as prostate-specific antigen (PSA) level, DRE, prostate imaging, biopsy and tumour markers. The only test that can fully confirm the diagnosis of CaP is a biopsy, the removal of small pieces of the prostate for microscopic examination. However, prior to a biopsy, less invasive testing can be conducted.

PSA is a 33 kDa glycoprotein and a neutral serine protease, belonging to human kallikerin proteins familiy. PSA level examination can measure the level of PSA 5

in the blood but can not guarantee the absence of CaP. When it is present in the blood at an abnormal level, it may indicate the possibility of CaP. The risk of disease increases as the PSA level increases, from about 8% with a PSA level of 1 ng/mL to about 25% with a PSA level of 4-10 ng/mL (Lojanapiwat, Anutrakulchai et al. 2014). PSA has several isoforms with its isoelectric point (pI) including free PSA (fPSA), proPSA, complexed PSA (cPSA) and benign PSA (bPSA). fPSA, which refers to the PSA not bound to plasma proteins, is the most studied PSA isoform so far (You, Cozzi et al. 2010). ProPSA is the precursor protein for PSA, and it consists of four truncated forms: (-2), (-4), (-5), and (-7). cPSA has shown that it could improve the specificity of total PSA, but this was not better than f/tPSA (Djavan, Remzi et al. 2002). BPSA was identified in 2000, and is an altered form of fPSA found to be enriched in the nodular TZ tissue of BPH which suggests that it could be a biomarker for BPH (Mikolajczyk, Millar et al. 2000). When compared with PSA and fPSA, serum bPSA has been found to have a better predictive power for prostatic enlargement (Canto, Singh et al. 2004). However, PSA can also increase in men without cancer condition such as an enlarged prostate BPH or infection or inflammation of the prostate (prostatitis). Thus, it is important to find other possible biomarkers to diagnose this disease.

DRE, as a fast, painless procedure, is performed by a general practitioner during a normal consultation. The physician inserts a finger into the patient’s rectum to feel the prostate. CaP in PZ may be found by DRE. A prostate biopsy needs to be performed when an abnormality is found during a DRE or transrectal ultrasound (TRUS) or the PSA level is high for a man’s age. During a biopsy, several biopsies (6–12) are usually removed from the prostate so they can be tested in a laboratory. They are collected from several areas of the whole prostate as well as from any suspicious areas. The pathology report from the laboratory will confirm whether or not cancer cells are present in the sample.

Clinical grading of CaP is normally done with the Gleason Grade and score. The Gleason Grade is a grade assigned to CaP specimens that reflects the microscopic degree of aggressiveness based on the degree of resemblance to normal prostatic tissue. The Gleason Grades are shown in Figure 1-4 and described as: Grade 1: 6

small, well-formed glands, closely packed; Grade 2: well-formed glands but more tissue between them; Grade 3: darker cells, some of which are invading the surrounding tissue; Grade 4: few recognizable glands with many cells invading the surrounding tissue; Grade 5: no recognizable glands; sheets of cells throughout the surrounding tissue. The Gleason score describes how aggressive the prostate tumour is and how likely it is to spread. A system of grading CaP tissue is based on how it looks under a microscope. Gleason scores ranging from 2 to 10 indicate how likely it is that a tumour will spread. A low Gleason score means the cancer tissue is similar to normal prostate tissue and the tumour is less likely to spread while a high Gleason score means the cancer tissue is very different from normal, and the tumour is more likely to spread.

Figure 1-4 Diagram showing the Gleason Grades Adapted from Prostate Health Website http://www.prostatehealth.org.au/home/about-prostate-cancer/staging-grading/

An important part of evaluating CaP is determining the stage, or how far cancer has spread. Knowing the stage helps define prognosis and is useful when selecting therapies. The most common system for staging CaP is the three-stage Tumour/Nodes/Metastases (TNM) system. The system is used in the world to stage cancers that develop in tumours, lymph nodes and metastases (Filson, Boer et al. 2014). In the TNM system for CaP, the staging is as follows: T1: tumour is so small that it cannot be detected by DRE or TRUS; T2: tumour can be felt, but 7

is still confined within prostate; T3: tumour extends through the prostatic capsule and may have spread into seminal vesicles; T4: tumour invades adjacent structures other than seminal vesicles, such as bladder, rectum, pelvic wall; N0: no regional lymph node metastasis; N1: tumour is found in a lymph node, no more than 2 cm in greatest dimension; N2: metastasis in a single lymph node, more than 2 cm but not more than 5 cm in greatest dimension, or multiple lymph nodes, none more than 5 cm in greatest dimension; N3: metastasis in a lymph node more than 5 cm in greatest dimension; M0: no distant metastasis; M1: distant metastasis. This staging is a simplified description. Within each stage, some subgroupings are shown in Figure 1-5, which indicates the extent of spread within that group.

Figure 1-5 Diagram showing TNM staging system for CaP Adapted from Prostate Health Website http://www.prostatehealth.org.au/home/about-prostate-cancer/staging-grading/

Ultrasound (US) and magnetic resonance imaging (MRI) are the two main imaging methods used for CaP detection. Urologists use TRUS during prostate biopsy and can find a hypoechoic area (tissues or structures that reflect relatively less of the ultrasound waves directed at them). It was reported that prostate MRI has a better soft tissue resolution than US (Bonekamp, Jacobs et al. 2011). MRI in those who are at low risk of CaP might help people choose active surveillance, in 8

those who are at intermediate risk of CaP it may help with determining the stage of disease, while in those who are at high risk of CaP it might help find bone disease (Barentsz, Richenberg et al. 2012). MRI has been used to identify targets for prostate biopsy using fusion MRI with US or MRI-guidance alone. In men who are candidates for active surveillance, fusion MRI/US guided prostate biopsy detected 33% of cancers compared to 7% with the standard US guided biopsy (Natarajan, Marks et al. 2011). Prostate MRI is also used for surgical planning for men undergoing robotic prostatectomy. It has also shown to help surgeons decide whether to resect or spare the neurovascular bundle, and help assess surgical difficulty (Tan, Margolis et al. 2012).

There are many biomarkers including PSA that can determine CaP (Natarajan, Marks et al. 2011). However, the type of prostate small cell carcinoma can not be diagnosed by PSA (Tan, Margolis et al. 2012). Emerginging modern techniques such as proteomics can identify many potential proteins associated with CaP. The oncoprotein B cell lymphoma 2 (Bcl2) is associated with the development of androgen-independent (AI) CaP due to its high levels of expression in AI tumours in advanced stages of the pathology. The up-regulation of Bcl2 after androgen ablation in CaP cell lines and a castrated-male rat model further established a connection between Bcl2 expression and CaP progression (Chuang, DeMarzo et al. 2007). It was reported the expression of Ki-67 by immunohistochemistry (IHC) may be a significant predictor of patient outcome for men with CaP (Nutting, Horwich et al. 1997). Extracellular signal-regulated kinases (ERK) 5 was found to be a marker that is present in abnormally high levels of CaP , including invasive cancer which has spread to other parts of the body (Ahmad, Singh et al. 2013). It is also present in relapsed CaP following previous hormone therapy. Research shows that reducing the amount of ERK5 found in cancerous cells also reduces their invasiveness (Wei, Xu et al. 2009). The presence of the EN2 (gene) in urine was shown to be correlated with a high probability of CaP (Killick, Morgan et al. 2013). A new blood test for early CaP antigen-2 was identified to demonstrate its promising in evaluating CaP aggressiveness (Leman, Magheli et al. 2009). Athough these protein makers hold promise for CaP

diagnosis, they still need to be tested with different clinical trials in multiple cancer centres in the world.

1.1.3 Current progress in CaP treatment

The management of CaP is determined by the stage and the degree of differentiation of the disease. Standard treatments for clinically localised CaP include active surveillance, radical prostatectomy (RP), androgen deprivation therapy (ADT) and RT. As metastatic CaP is rarely curable, the managements typically include therapy directed at relief of particular symptoms and slowing further progression of the disease.

Active surveillance is a method of delayed curative treatment for those people who suffer from slow progression CaP or are too old to benefit from the intervention (Yaxley, Yaxley et al. 2013). Active surveillance can reduce adverse effects from definitive radical treatments and maintain living quality. Only patients with low-risk CaP are suitable for active surveillance approach: men with low volume tumour (one of four cores positive or less) of Gleason score 3+3 with a PSA of less than 10 ng/mL on presentation and either a non-palpable tumour on DRE or a small tumour occupying less than half of one lobe (stage T1c–T2a) (Yaxley, Yaxley et al. 2013).

RP is an operation to remove the partial or complete prostate, as well as nearby lymph nodes. There are several different methods of RP including RP with retropubic (suprapubic) approach (Okajima, Yoshikawa et al. 2012), nerve- sparing prostatectomy approach (Tasci, Simsek et al. 2014), laparoscopic RP (Cadeddu 2015), robotic-assisted laparoscopic prostatectomy (Ledezma, Negron et al. 2015) and RP with perineal approach (Comploj and Pycha 2012). The RP with the retropubic (suprapubic) approach is the most common surgical approach. The nerve-sparing prostatectomy approach can be used when the tumour is severely tangled with the nerves. Laparoscopic RP helps the surgeon see inside during the procedure. Robotic-assisted laparoscopic prostatectomy requires special equipment and training, so it is rarely performed in a hospital. The RP 10

with the perineal approach is used less frequently than retropublic approach and is suitable when lymph nodes do not require to remove.

ADT, also called hormone therapy or androgen suppression therapy, is to reduce male hormone level and stop them from affecting CaP cells (Perlmutter and Lepor 2007). It is commonly used in clinically localised CaP, biochemical recurrence (BCR) after RP, locally advanced CaP, lymph node metastasis and asymptomatic metastatic CaP. There are two methods of ADT including surgical removal of one or both of the testicles and medication. Side effects of ADT may include a reduced bone substance, changes in breast tissue, cognitive system, etc.

RT is a widey used treament for CaP. There are two main types of RT including external beam radiation therapy (EBRT) and brachytherapy. EBRT approach consists of three-dimensional conformal radiation therapy (3D-CRT), intensity modulated radiation therapy (IMRT), stereotactic body radiation therapy (SBRT) and proton beam radiation therapy (Keilholz, Willner et al. 2014). 3D-CRT uses special computers to locate the prostate precisely and radiation beams are directed to the prostate from several angles. This method seems to be at least as effective as standard RT with lower side effects (Zhang, Liang et al. 2015). IMRT, as an advanced form of 3D therapy, is the most popular approach of EBRT for CaP (Zhang, Liang et al. 2015). It uses a computer-driven machine to remote control radiation delivery. In IMRT, the intensity of the beams can be adjusted to reduce the dose delivered to the normal tissues. A development of IMRT is volumetric modulated arc therapy that allows radiation beams to deliver very fast (Zhang, Liang et al. 2015). SBRT uses advanced image guided techniques to deliver high radiation doses to the prostate (Janowski, Chen et al. 2014). Unlike X-rays, proton beam radiation therapy may cause less damage to tissues and release the energy only after traveling a certain distance (Klodowska, Olko et al. 2015). However, this technology is not widely used because protons are very expensive to make. Brachytherapy, also called interstital radiation therapy, includes permanent brachytherapy and temporary brachytherapy. It is generally used in early stage of CaP and the small radioactive pellets are placed directly into the prostate (Kittel, Reddy et al. 2015). Although RT is very effective for CaP, it has some possible 11

side effects such as bowel and bladder problems, urinary incontinence, erection problem and fatigue.

1.2 Current obstacles in CaP radiation therapy

RP and RT (EBRT and brachytherapy) are the two main treatment options for organ-confined or locally advanced CaP. Their therapeutic efficacies are similar, being approximately 75-80% for stage T1-T2 CaP (Kupelian, Potters et al. 2004). While these primary therapies are associated with a high cancer control rates for localised disease, up to a third of patients undergoing these therapies will have a BCR after local therapy (Djavan, Moul et al. 2003, Khan, Han et al. 2003). Doses used in EBRT or brachytherapy are highly associated with therapeutic efficacy; however, the incidences of related side effects increase as the dose of radiation increases (Pollack, Zagars et al. 2002).

It was reported that the fast neutron radiation could be delivered safely and have an efficacy that is superior to conformal photon irradiation which has been seen in phase II/III clinical trials in the treatment of CaP patients (Forman, Yudelev et al. 2002). However, the cellular and molecular mechanisms and targets of action through which neutron radiation exerts its beneficial effect are still unclear. Contemporary RT approaches such as IMRT and image guided radiation therapy (IGRT) have permitted enhanced delivery of radiation to the prostate to spare adjacent organs and reduce the potential for acute and chronic toxicity (Biagioli and Hoffe 2010, Gill, Thomas et al. 2011, Amin and Konski 2012). Recent advances in volumetric based IMRT and IGRT have permitted external RT dose escalation beyond 75 Gy (Eade, Guo et al. 2012). Efforts to improve the outcome after EBRT for CaP patients have focused on delivering a higher dose to the tumour. Several randomised trials have shown a benefit of dose escalation to >70 Gy with EBRT for localised CaP (Kuban, Levy et al. 2011, Zapatero, Garcia- Vicente et al. 2011). However, there is a concern that further dose increase may lead to more toxicity. Therefore, a modality for improving the therapeutic efficacy of RT for locally confined or advanced CaP is warranted via enhancing radiation induced cytotoxicity and reducing related side effects. 12

Meanwhile, local CaP recurrence after RT is a pattern of treatment failure attributable to radioresistance of cancer cells. Understanding the mechanisms of radioresistance will help to improve treatment outcome, overcome recurrence after RT and prevent metastasis in CaP patients. The combination of radiosensitisers with RT will be very promising for future CaP clinical trials. In my thesis, I will focus on investigating the mechanisms of CaP radioresistance and finding the appropriate radiosensitisers.

1.3 CaP radioresistance

Despite increased awareness and earlier diagnosis in CaP, therapy with curative intent seems to fail to achieve the long-term effect. The patients at early-stage disease can be treated effectively with ADT, surgery, or RT. However, a significant portion of men are diagnosed with advanced stage/high-risk disease, and despite recent advances these patients can still relapse after definitive hormone treatment and/or RT (Catton, Milosevic et al. 2003), indicating that a resistant population of cancer cells may have survived the RT. One possible reason for these failures from RT may be the intrinsic radioresistance of a subpopulation of CaP clonogen within the tumour. When CaPs progress and metastasise, the tumours frequently become hormone refractory and classical chemotherapy regimens do not offer a curative approach. Failure to control a tumour with a seemingly curative dose would suggest that the tumour is ‘radioresistant (RR)’ (i.e., resists radiation treatment), whereas a ‘radiosensitive’ tumour would be controlled (Korpela, Vesprini et al. 2015).

Radioresistance is a major problem in radiation oncology and can be classified into intrinsic radioresistance and acquired resistance during fractionated RT. Due to CaP relapse after RT, it is very important to optimise CaP treatments and investigate the mechanisms impacting radiosensitivity. Radioresistance may arise from microenvironmental hypoxia, abnormal intrinsic DNA damage response (DDR) activity, deregulated survival pathway engagement (e.g., ERK or Akt) through constitutive activation of growth factor receptors, or mutations of 13

oncogenes (e.g., Kirsten rat sarcoma (KRas)) or tumour suppressors (e.g., phosphatase and tensin homolog (PTEN)) (Begg, Stewart et al. 2011).

Accumulating evidence indicates that a broad variety of the microenvironmental conditions surrounding cancer stem cell (CSC) niches as well as genetic and epigenetic changes of CSC during tumour development make molecular mechanisms of radioresistance dynamic in nature (Kreso and Dick 2014, Rycaj and Tang 2014). Emerging data indicate that PI3K/Akt/PTEN/mammalian target of rapamycin (mTOR) (Burgio, Fabbri et al. 2012, Chiu, Chen et al. 2012, Schiewer, Den et al. 2012), autophagy (Griffin, McNulty et al. 2011, Chiu, Chen et al. 2012), epithelial mesenchymal transition (EMT) (Armstrong, Marengo et al. 2011, Nauseef and Henry 2011) and CSCs (Li, Cozzi et al. 2010, Li and Tang 2011, Xiao, Graham et al. 2012) are involved in CaP metastasis, play very important roles in radioresistance and are believed to be the cause of tumour recurrence. Understanding the mechanisms and signalling pathways in the regulation of radioresistance is very important in developing combination approaches to overcome radioresistance. With the fast development in biomedical research with advanced modern techniques such as genomics and proteomics, significant progress has been made in the investigation of radioresistance associated pathways.

1.3.1 PI3K/Akt/mTOR in CaP radioresistance

PI3K/Akt/PTEN/mTOR signalling pathway is important for regulating cell growth and survival, particularly during tumour progression and metastasis. This pathway is activated in a large percentage of human cancers through a variety of mechanisms including receptor and rat sarcoma (Ras) mutation, loss of PTEN, activation of growth factor receptors such as epidermal growth factor receptor (EGFR), and mutations in phosphoinositide 3-kinase a (PIK3A) (Yuan and Cantley 2008). PI3K activates a number of downstream targets including the serine/threonine kinase Akt and mTOR, a downstream member of the PI3K cascade, which plays an important role in cell growth, death, adhesion and migration, and is frequently activated in cancer cells (Jiang, Aoki et al. 1999, Lin, 14

Hu et al. 2003) (Figure 1-6). Skvortsova et al established three CaP-RR cell lines from PC-3, DU145 and LNCaP and found higher levels of AR and EGFR were detected in the RR cell lines compared with the parental cell lines, accompanied by the activation of their downstream pathways including Ras-mitogen-activated protein kinase (MAPK), PI3K/Akt and Jak/STAT (Skvortsova, Skvortsov et al. 2008), suggesting the PI3K/Akt/mTOR signalling pathway contributes to CaP radioresistance. It was reported that the PI3K/Akt activity contributes to the resistance of human cancer cells to RT via three major mechanisms: intrinsic radioresistance, tumour cell proliferation and hypoxia (Bussink, van der Kogel et al. 2008). PI3K/Akt/mTOR pathway is very important for tumour angiogenesis. Tumour hypoxia was found to be involved in cancer cell aggressiveness and radioresistance that can cause poor clinical outcome (Hennessey, Martin et al. 2013). It was reported that hypoxia cells could be more resistant to radiation than normal cells in CaP (Hennessey, Martin et al. 2013). Hypoxia-inducible factor 1

(HIF-1) is a transcriptional activator that functions as a master regulator of O2 homeostasis (Semenza 2002). HIF-1 target genes encode proteins including vascular endothelial growth factor (VEGF) and activation of the PI3K/Akt pathway in tumour cells can also increase VEGF secretion by HIF-1 (Karar and Maity 2011). CaP cells have been shown to over-express HIF-1α and VEGF in a PI3K-dependent manner as a result of EGFR signalling (Kimbro and Simons 2006). In addition, radiation can enhance EGFR expression, which in turn, stimulates HIF-1α expression, increasing radioresistance in CaP (Zhong, Chiles et al. 2000). Hennessey et al suggested that the effect of post-irradiation hypoxic exposure correlated with modified cellular responses induced by hypoxia that was mediated by HIF-1α in CaP cells (Hennessey, Martin et al. 2013). Another study reported that targeting the PI3K pathway using LY294002 or rapamycin inhibited the expression of HIF-1 dependent reporter gene induced by the certain nitric oxide (NO) donor (Kasuno, Takabuchi et al. 2004). All these studies indicate that activation of the PI3K/Akt/mTOR signalling pathway may be associated with HIF1-dependent hypoxia mechanisms in CaP-RR cells. In addition, hypoxia may also assist to create a microenvironment enriched in poorly differentiated tumour cells and undifferentiated stromal cells, which appears to play an important role in tumour cell differentiation (Kim, Lin et al. 2009). It has been shown that tumour 15

metastasis, survival and self-renewal could be promoted by hypoxia via inducing expression of stem cell genes such as CXCR4 (Hermann, Huber et al. 2007). Furthermore, hypoxia could regulate maintenance and differentiation of stem cells via directly preventing CSCs from undergoing differentiation, inhibiting niche stromal cells differentiation and inducting expression of paracrine factors (Kim, Lin et al. 2009). Thus, hypoxia could be considered as a factor reducing CaP sensitivity to radiation and one of the major sources of CSCs. Using a label-free quantitative liquid chromatography- tandem mass spectrometry (LC-MS/MS) proteomic approach, we have identified the PI3K/Akt/mTOR signalling pathway proteins as the most activated pathway associated with radioresistance in three CaP-RR cell lines (PC-3RR, DU145RR and LNCaPRR) developed in our lab (see Chapter 4), which further confirmed the importance of this pathway in CaP radioresistance.

There is considerable evidence to suggest that, under certain experimental conditions, CSCs exhibit RR features (Eyler and Rich 2008). Martelli et al recently reviewed the evidence which linked the signals deriving from the PI3K/Akt/mTOR network with CSC biology and highlighted how therapeutic targeting of PI3K/Akt/mTOR signalling with small molecule inhibitors could improve cancer patient outcome, by eliminating CSCs (Martelli, Evangelisti et al. 2011). It was reported that CD133high/CD44high CSCs expressing colon cancer cells are associated with Akt and increased radiation resistance, that different Akt isoforms have varying effects on the expression of CSC markers (Sahlberg, Spiegelberg et al. 2014). Dubrovska et al demonstrated that the PI3K/Akt/ PTEN/ mTOR pathway is critical for the in vitro maintenance of CD133+/CD44+ CaP progenitors and that the combination of the PI3K/mTOR modulator BEZ235 targeting CaP progenitor populations and the chemotherapeutic drug Taxotere can more effectively eradicate tumours in a CaP xenograft model than monotherapy (Dubrovska, Elliott et al. 2010), indicating the importance of CSC and PI3K/Akt/mTOR pathway in the CaP treatment. We have demonstrated the small interfering RNA (siRNA) knock down (KD) of CSC markers CD326 and CD44V6 can increase radiosensitivity in CaP cells via the PI3K/Akt/mTOR signalling pathway (Ni, Cozzi et al. 2013, Ni, Cozzi et al. 2014), suggesting the 16

importance of this pathway in the regulation of CaP radioresistance. Under a low dose radiation treatment, we have recently developed three CaP-RR (PC-3RR, DU145RR and LNCaPRR) cell lines which display more aggressive characteristics including increased colony formation, invasion ability, spheroid formation capability and enhanced EMT and CSC phenotypes and activation of the PI3K/Akt/mTOR signalling pathway compared with their parental cell lines (Chang, Graham et al. 2013). In addition, we also found the PI3K/Akt/mTOR pathway is closely linked with EMT and CSCs (Chang, Graham et al. 2013) (see Chapter 3). Therefore, these CaP-RR cells, representative of the possible source of recurrence after RT, provide a very good model to mimic a clinical radioresistance condition as well as to examine the efficacy of these single and dual PI3K/Akt/mTOR inhibitors for their radiosensitisation effects.

1.3.1.1 The structure of PI3K/Akt/mTOR pathway

The PI3K/Akt/mTOR signalling pathway is implicated in a diverse array of cellular functions including survival, growth, proliferation, differentiation, stem cell-like properties, metabolism, and angiogenesis. Based on primary structure, regulation, and in vitro lipid substrate specificity, the PI3K family is divided into three different classes: Class I, Class II, and Class III (Leevers, Vanhaesebroeck et al. 1999). Class I PI3K are heterodimeric molecules composed of a regulatory (p85) and a catalytic subunit (p110) which are further divided into two subclasses: subclass IA (PI3Kα, β and ) which is activated by receptor tyrosine kinases (RTKs) and subclass IB (PI3Kγ) which is activated by G-protein-coupled receptors and Ras oncogene. Class II and Class III are differentiated from Class I PI3K by their structures and functions. Class II comprises three catalytic isoforms (C2α, C2β, and C2γ) and catalyses the production of phosphatidylinositol 3- phosphate (PI (3) P) from PI and phosphatidylinositol 3,4- bisphosphate (PI (3, 4) P2) from PIP, whereas Class III exists as a heterodimer of a catalytic (Vps34) and a regulatory (Vps15/p150) subunits and produces only PI(3)P from PI (Leevers, Vanhaesebroeck et al. 1999). PI3K serves to phosphorylate a series of membrane phospholipids including phosphatidylinositol 4-phosphate (PI(4)P) and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2), catalysing the transfer of 17

adenosine triphosphate (ATP)-derived phosphate to the D-3 position of the inositol ring of membrane phosphoinositides, thereby forming the second messenger lipid (PI(3,4)P2) and phosphatidylinositol 3,4,5-trisphosphate (PI(3,4,5)P3) (Martelli, Evangelisti et al. 2011). PI(3,4,5)P3 then recruits a subset of signalling proteins with pleckstrin homology (PH) domains of the membrane, including 3-Phosphoinositide-dependent protein kinase 1 and Akt/ protein kinase B (PKB) (Fruman, Meyers et al. 1998, Fresno Vara, Casado et al. 2004). Akt/PKB then regulates several cellular processes including survival and cell cycle. Chen et al found that activation of Akt/PKB was associated with an increased resistance to apoptosis in CaP mediated by TRAIL/APO-2L (Chen, Thakkar et al. 2001).

PI3K activates a number of downstream targets including the serine/threonine kinase Akt which activates mTOR. Akt is composed of three structurally similar isoforms, Akt1, Akt2 and Akt3, which are encoded by the genes PKBα, PKBβ and PKBγ, respectively. They consist of three domains, an N-terminal PH domain, a central kinase CAT domain, and a C-terminal extension with a hydrophobic motif. The activating process of Akt includes docking of the PH domain to PI (3,4,5)P3 on the membrane and phosphorylation of two crucial amino-acid residues (Alessi, Deak et al. 1997, Stephens, Anderson et al. 1998). Once Akt is phosphorylated and activated, it phosphorylates many other downstream proteins such as mTOR, GSK3, IRS-1 (Porta, Paglino et al. 2014), whereby playing a key role in multiple cellular processes such as glucose metabolism, apoptosis, cell proliferation, transcription, cell migration and therapeutic resistance (Manning and Cantley 2007).

As a Akt substrate that has the most significant role in tumourigenesis, mTOR is a seine/threonine protein kinase that plays an important role in the regulation of cell growth, proliferation, motility, survival, protein synthesis, and transcription (Hay and Sonenberg 2004). MTOR has two structurally distinct complexes mTORC1 and mTORC2 which both localise at different subcellular compartments, thus affecting their activation and function (Wullschleger, Loewith et al. 2006, Betz and Hall 2013). mTORC1 is composed of the mTOR catalytic subunit, raptor, 18

PRAS40 and the protein mLST8 (Wullschleger, Loewith et al. 2006). The activity of mTOR1 is stimulated by insulin, growth factors, serum, phosphatidic acid, amino acids (particularly leucine), and oxidative stress (Fang, Vilella-Bach et al. 2001, Kim, Sarbassov et al. 2002). Depending on the stimuli and microenvironment, mTORC1 controls the cell growth through p-S6K and p- 4EBP1 (Sparks and Guertin 2010). mTORC2 is composed of mTOR, Sin1, rictor and the protein mLST8 (Sabatini 2006). It is less sensitive to rapamycin and phosphorylates Akt/PKB at the serine residue S473, thus affecting metabolism and survival (Betz, Stracka et al. 2013). MTOR activation results in increased levels of multiple proteins such as cyclin D1 (Grewe, Gansauge et al. 1999) and VEGF (Abraham 2004), and leads to up-regulated tumourigenesis.

PTEN, the gene for which is localised on chromosome l0q23, is a PI(3,4,5)P3 phosphatase which antagonises the PI3K/Akt signalling pathway by dephoshorylation of PI(3,4,5)P3 to PI(3,4)P2 (Figure 1-6) (Steelman, Bertrand et al. 2004). PTEN has both plasma membrane and localised nucleus activities. The PTEN phosphatase serves at the molecular level to counteract the functions of PI3K, which promotes proliferation and cell survival, in part through activation of mTOR (Sansal and Sellers 2004). In addition, through the signalling pathway net, the PI3K/Akt/mTOR pathway is closely linked with other pathways such as AR pathway (Lin, Yeh et al. 2001), Ras/Raf/MEK/ERK pathway (De Luca, Maiello et al. 2012) for cancer survival, metastasis, progression and resistance (De Luca, Maiello et al. 2012). The structure of the PI3K/Akt/mTOR pathway and the link with other pathways are shown in Figure 1-6.

Figure 1-6 Overview of PI3K/Akt/PTEN/mTOR signalling pathway

This pathway plays a crucial role in regulating a broad range of cellular functions including cell growth, proliferation, cell survival, angiogenesis, invasion and migration, apoptosis, autophagy, cell cycle, DNA repair, chemoresistance and radioresistance in cancer cells. PI3K converts PIP2 into PIP3, while PTEN antagonises PI3K function by converting PIP3 back to PIP2, and thus inhibiting downstream signalling. Akt, which is downstream in the pathway, is activated and phosphorylated by PIP3 which subsequently causes alteration of numerous cell functions including the activation of mTOR and its substrates. This pathway is closely linked with Ras/Raf/MEK/ERK pathway, AR pathway and VEGF pathway.

1.3.1.2 Activation of the PI3K/Akt/mTOR pathway in human CaP progression

Activation of the PI3K/Akt/mTOR pathway has been strongly implicated in CaP progression (Reid, Attard et al. 2010, Taylor, Schultz et al. 2010). Preclinical studies suggest that the PI3K/Akt/mTOR pathway is important in maintaining a CSC population in CaP cells. It was demonstrated that activation of Akt signalling in CaP induced a TGF-β-mediated restraint on cancer progression and metastasis in transgenic animal models (Bjerke, Yang et al. 2014). In particular, it has been suggested that CRPC compensates for reduced AR signalling by activation of Akt/mTOR signalling (Floc'h and Abate-Shen 2012).

Morgan et al demonstrated that aberrant PI3K/Akt signalling proteins were detected in CaP cell lines and xenografts as well as 30-50% of human primary CaP tissues (Morgan, Koreckij et al. 2009). Taylor et al found that alterations in the PI3K/Akt/mTOR pathway had been found in 42% of primary prostate tumours and 100% of metastatic tumours (Taylor, Schultz et al. 2010). Clinical CaP specimens were also reported to show up-regulation of the PI3K/Akt pathway associated with phosphorylation of the AR during the development of CRPC (McCall, Gemmell et al. 2008). PI3K activation can also lead to the development of chemoresistant CaP cells, through the up-regulation of multidrug resistance protein 1 (MRP-1) (Lee, Steelman et al. 2004). It was reported that the levels of mTOR and cytoplasmic phospho-mTOR were greater in CaP tissue versus normal prostatic epithelium, with mTOR levels in cancer cells were twice than that of benign tissues (Kremer, Klein et al. 2006). 4EBP1 and S6K are also shown to express at higher levels in CaP versus normal cells (Kremer, Klein et al. 2006). These results support that the PI3K/Akt/mTOR pathway plays a prominent role in the development and progression of CaP.

1.3.1.3 PI3K/Akt in CaP metastasis and radioresistance

Altered signalling pathways within the tumour cells that affect tumour cell survival are in focus for the development of innovative anticancer treatments. The PI3K/Akt signalling pathway represents a major cell survival pathway and plays a critical role in oncogenesis and tumour cell growth (Nicholson and Anderson 2002).

The PI3K/Akt pathway is one of the most important survival signalling cascades altered in human solid tumours including CaP (Vivanco and Sawyers 2002, Yuan and Cantley 2008), and known to promote cell proliferation, cell cycle progression and resistance to cytotoxic therapies in CaP (Cantley 2002). Recent studies highlight the importance of the PI3K/Akt/mTOR signalling pathway in CaP invasion, progression and angiogenesis (Pommery and Henichart 2005, Fang, Ding et al. 2007, Shukla, Maclennan et al. 2007, Burgio, Fabbri et al. 2012). Successful progression to an AI state of CaP requires intact PI3K signalling (Murillo, Huang et al. 2001). Furthermore, using a sphere-forming model, Dubrovska et al. demonstrated that PI3K/Akt/PTEN pathways are critical for the maintenance of CaP stem-like features and that targeting PI3K signalling is beneficial in CaP treatment by eliminating CaP stem-like cells (Dubrovska, Kim et al. 2009).

The PI3K/Akt pathway plays an important role in CaP radioresistance. Hyperactivation of PI3K/Akt confers cancer cells resistance to radiation-induced cell death (McKenna, Muschel et al. 2003, Cheng, Chou et al. 2006). Gottschalk et al. tested the in vitro radiosensitisation effect of LY294002, a broad inhibitor of PI3K, in a LNCaP CaP cell line and found that inhibition of PI3K causes the increased sensitivity to RT in CaP cells through a PKB-dependent mechanism (Gottschalk, Doan et al. 2005). Although LY294002 is promising in preclinical studies, it has not progressed through clinical trials because it also inhibits a number of proteins non-specifically and is toxic to patients. More specific PI3K inhibitors are under development, such as IC486068 (Geng, Tan et al. 2004) and IC87114 (Soond, Bjorgo et al. 2010), and potentially could be useful radiosensitisation agents.

Akt is a serine/threonine protein kinase that plays a critical role in suppressing apoptosis by regulating its downstream pathways (Wang, Yang et al. 2008). It is implicated in cellular processes such as cell survival, proliferation, growth, glucose metabolism, apoptosis, angiogenesis, transcription and migration (Scheid and Woodgett 2003). After activation, Akt can translocate to the nucleus (Lee, Lehmann et al. 2008), where it affects the activity of a number of transcriptional regulators. Akt serves as an intermediate signalling molecule for mTOR, which is also a serine/threonine kinase that mediates cell growth, proliferation, survival, protein translation, and other oncogenic functions (Figure 1-6). Activation of the PI3K/Akt pathway, a well-known method to inhibit apoptosis, also inhibits autophagy (Mathew, Karantza-Wadsworth et al. 2007) via inhibition of mTOR, (Kondo, Kanzawa et al. 2005). Up-regulated activity of the kinase Akt is associated with malignant transformation characterised by accelerated tumour growth, metastasis, and angiogenesis. It was reported that the Akt/mTOR pathway plays a crucial role in the regulation of both apoptosis and autophagy (Takeuchi, Kondo et al. 2005).

Recent studies have indicated that Akt activation contributes to resistance to radiation, chemotherapy and tyrosine kinase inhibitors (TKIs) by promoting survival signals which protect cancer cells from undergoing apoptosis (Nakashio, Fujita et al. 2000, Vivanco and Sawyers 2002, Janmaat, Kruyt et al. 2003, Bjornsti and Houghton 2004). Thus, the inhibition of the Akt pathway is emerging as an attractive clinical objective for the prevention of hormone-refractory disease. As a major regulator of the PI3K pathway (Figure 1-6), Akt is a target for radiosensitisation. Palomid 529 (P529) (an inhibitor for Akt) has been shown to target Akt without in vivo toxicity (Xue, Hopkins et al. 2008). Diaz et al. reported that P529 combined with RT could increase radiosensitivity in PC-3 CaP cells in vitro compared to RT alone, and retard tumour growth in a PC-3 xenograft animal model (Diaz, Nguewa et al. 2009). Chiu et al. have recently demonstrated that the arsenic trioxide enhances the radiation sensitivity in androgen-dependent (LNCaP) and -independent (PC-3) human CaP cells primarily through the inhibition of Akt/mTOR signalling pathway (Chiu, Chen et al. 2012). These data indicate that

Akt inhibitors are promising in combination therapies to enhance the sensitivity of RT in CaP treatment.

1.3.1.4 Roles of PTEN in CaP radioresistance

Functional studies demonstrate that PTEN is a potent tumour suppressor, but it is frequently mutated, deleted, or epigenetically silenced in various human cancers (Birck, Ahrenkiel et al. 2000, Harima, Sawada et al. 2001, Byun, Cho et al. 2003, Pedrero, Carracedo et al. 2005) including CaP (Sircar, Yoshimoto et al. 2009, de Muga, Hernandez et al. 2010, Reid, Attard et al. 2010). Inactivation or deletion of PTEN which frequently occur in metastatic CaP, lead to Akt activation (Wang, Gao et al. 2003). At least 70% of CaP patients show loss or alteration of at least one PTEN allele, which may result in activation of the PI3K/Akt pathway (Gray, Stewart et al. 1998). Loss of PTEN activity plays a role in tumour resistance to chemo-agents and molecular-targeted anti-neoplastic agents (Faratian, Goltsov et al. 2009, Loupakis, Pollina et al. 2009, Sos, Koker et al. 2009, Mao, Liao et al. 2010, Negri, Bozzetti et al. 2010). Since PTEN mutations and deletions can lead to abnormal Akt activation, it is thought to play an important role in the resistance of CaP to RT (Li, Kim et al. 2009, Zafarana, Ishkanian et al. 2012).

Teng’s study indicated that 42% of CaP tissues had abnormal PTEN/Akt expression (Teng, Hu et al. 1997). Using antibodies against Akt, PTEN, its downstream targets and the respective phosphorylated proteins, Jendrossek et al demonstrated that up-regulated expression and p-Akt in the CaP tissues was found in 78% and 82% of patients, respectively, and in patients with Gleason scores of ≥6, the number were even higher (84% and 100%, respectively). PTEN expression levels of cancer cells relative to adjacent benign cells were diminished in only 20% of the CaP tissues compared with benign tissues, and the rate was 30% in those with Gleason scores of ≥6, while the expression level of p-Akt was elevated without obvious abrogation of PTEN-function in a proportion of the patients (Jendrossek, Henkel et al. 2008). These data suggested both PTEN- dependent and PTEN-independent mechanisms of Akt-activation and demonstrated the important role of deregulation of PI3K/PTEN/Akt pathway in 24

localised CaP. Additional data also demonstrated that loss of PTEN expression was correlated with Gleason score and pathologic stage of primary tumours (McMenamin, Soung et al. 1999, Dreher, Zentgraf et al. 2004) and increased the incidence of development of lymph node metastases (Schmitz, Grignard et al. 2007).

It was found that the radiosensitisation effect of parthenolide in CaP cells was mediated by nuclear factor-κB (NF-κB) inhibition and enhanced by the presence of PTEN (Sun, St Clair et al. 2007). Using a gene therapy, Rosser et al. demonstrated that PTEN restoration sensitises PC-3 and LNCaP CaP cells to RT in vitro (Rosser, Tanaka et al. 2004). In a subsequent study, this group further confirmed the radiosensitisation effect of PTEN gene therapy in vivo in a PC-3- Bcl-2 CaP xenograft animal model (Anai, Goodison et al. 2006). In another study, Tomioka et al. generated a new type of gene transfer drug, GelaTen, which is a microsphere of cationised gelatin hydrogels incorporating PTEN plasmid DNA and designed for sustained release of PTEN plasmid DNA in vitro and in vivo (Tomioka, Tanaka et al. 2008). They demonstrated a synergistic effect of GelaTen with RT in PC-3 and LNCaP cell lines and a subcutaneous (s.c) PC-3-Bcl-2 xenograft animal model (Tomioka, Tanaka et al. 2008). All data indicate that PTEN plays a critical role in the regulation of the sensitivity to RT in CaP cells and can be used as a therapeutic target for future CaP therapy.

1.3.1.5 mTOR in the regulation of CaP radioresistance

MTOR is a 289 kDa serine-threonine kinase that acts as a downstream effector for Akt (Guertin and Sabatini 2007). It regulates key processes such as cell growth and proliferation, cell cycle progression and protein translation through two distinct pathways: one involving the ribosomal p70S6 kinase (p70S6K), and the other one involving 4E binding proteins (4E-BPs) (Hay and Sonenberg 2004). MTOR signalling has been implicated as a determinant of cell survival in response to DNA damage (Shen, Lancaster et al. 2007). P70S6K regulates the efficiency of translation of certain mRNAs and also functions in a negative feedback loop to control Akt activity (Martelli, Evangelisti et al. 2010, Martelli, 25

Evangelisti et al. 2011). Akt, mTOR and p70S6K activations have been associated with a poor prognosis in breast cancer and other cancers (Tokunaga, Kimura et al. 2006, Martelli, Evangelisti et al. 2011). MTOR activity is often deregulated in CaP (Kremer, Klein et al. 2006), in part due to the prevalence of PTEN dysfunction.

Aberrant up-regulation of PI3K/mTOR signalling pathway occurs in many human malignancies and is implicated in resistance to RT in preclinical studies (Brognard, Clark et al. 2001, Tanno, Yanagawa et al. 2004) and clinical studies (Gupta, McKenna et al. 2002, Chakravarti, Zhai et al. 2004, Gupta, Soto et al. 2004). The ability of RT or chemotherapy to induce cell death in cancer cell lines that display resistance to apoptosis depends on type II programmed cell death executed by autophagy (Gozuacik and Kimchi 2004). There is ample evidence that radiation-induced cell death is affected by various intertwined biochemical processes in the autophagic and apoptotic pathways. Irradiation up-regulates autophagic programmed cell death in cells that are unable to undergo Bax/Bak- mediated apoptotic cell death (Moretti, Attia et al. 2007). Activation of PI3K/Akt/mTOR biochemical cascade confers a survival advantage in neoplastic cells by both inhibitory effects of mTOR on autophagy and the inhibitory effect of Akt on apoptosis.

MTOR is an established therapeutic target and mTOR inhibitors appear to be reasonably tolerated. Cao et al. tested the ability of the mTOR inhibitor RAD001 (everolimus) to enhance the cytotoxic effects of radiation on PC-3 and DU145 CaP cell lines, and found that both cell lines became more vulnerable to irradiation after treatment with RAD001, with the PTEN-deficient PC-3 cell line showing greater sensitivity (Cao, Subhawong et al. 2006). They also found that the zVAD (an apoptosis inhibitor)-induced inhibition of apoptosis or the RAD001-induced autophagy results in an increased radiosensitivity when employed singularly, while combination of zVAD and RAD001 led to additive, rather than synergistic, effects on cell death (Cao, Subhawong et al. 2006). Schiewer et al. demonstrated that mTOR is a selective effector of the RT response in AR-positive CaP, and mTOR inhibitors (sirolimus and temsirolimus) exhibit 26

schedule-dependent effects on the RT response in CaP cells and confer significant radiosensitisation effects when used in the adjuvant setting (Schiewer, Den et al. 2012). MTOR is a promising target for CaP RT in the future.

1.3.2 The controversial roles of autophagy in cancer RT

1.3.2.1 Paradox of autophagy in cancer treatment

The effort discovering the mechanism of autophagy has increased in the last decade. Autophagy is a cellular response to stress or nutrient deprivation, which is a way to supply amino acids as an alternative energy source by degradation of damaged cytoplasmic organelles or protein (Hait, Jin et al. 2006). On one hand, autophagy eliminates toxic and damaged cellular components. On the other hand, this process delivers new precursors for the synthesis of macromolecules. Autophagy, a process that involves autophagic/lysosomal compartment, is a genetically regulated form of programmed cell death in which the cell digests itself. It is characterised by the formation of double-membrane vacuoles in the cytoplasm, which sequester organelles such as condensed nuclear chromatin and ribosomes (Ito, Daido et al. 2005, Kuwahara, Oikawa et al. 2011).

Depending on context, autophagy can act as the oncogenic or tumour-suppressing mechanism (White 2012). In cancer therapy, the role of autophagy is also paradoxical, in which this cellular process may serve as a pro-survival or pro- death mechanism to counteract or mediate the cytotoxic effect of anticancer agents (Zhou, Zhao et al. 2012). Autophagy frequently exerts cytoprotective functions by acting as a stress response mechanism (Kroemer and Levine 2008). Up-regulation of autophagy has been observed in many types of cancer and it has been demonstrated to promote both cell survival and cell death (Kimmelman 2011). There is an accumulation evidence that highlights the important function of autophagy in cancer (Levine 2006, Jin and White 2007, Mathew, Karantza- Wadsworth et al. 2007, Chen and Karantza-Wadsworth 2009, Chen and Karantza 2011). Data reported in the literature indicate that whether autophagy enables cells to survive or induces their death depends on many factors, including the genotype 27

and phenotype of the tumour cells, stress factors, and the status of the apoptotic machinery (Rosenfeldt and Ryan 2011). Although it is still controversial about whether autophagy kills cancer cells or sustains their survival under stressful conditions, increasing reports provide data to support that autophagy promotes cancer cell survival after chemotherapy or RT (Apel, Herr et al. 2008, Chen and Karantza-Wadsworth 2009).

In recent years, the role of autophagy as an alternative cell death mechanism has been a topic of debate. Autophagy was believed as a non-apoptotic programme of cell death or “type-II” cell death to distinguish from apoptosis (Rami 2009). However, it is still fundamentally important to clarify whether autophagy is a main strategy for cell survival, or if it also serves as a trigger for cell death (Rami 2009). Although autophagy and apoptosis cell death pathways are predominantly distinct from each other, many studies have demonstrated that extensive crosstalk exists between the two (Fimia and Piacentini 2010, Maiuri, Criollo et al. 2010). The interplay between apoptosis and autophagy may need to be exploited to improve cancer therapy. Studies are ongoing to define optimal strategies to modulate autophagy for cancer prevention and therapy and to exploit autophagy as a target for anticancer drug discovery (Yang, Chee et al. 2011). Nevertheless, the molecular mechanism governing cell-fate decision during autophagy is still poorly understood, and the Janus-faced nature of autophagy may complicate the clinical development of its modulators. It is important to determine if the pro- death or pro-survival action of autophagy is associated with a particular class of cancer therapeutics.

The PI3K/Akt/mTOR pathway is a central repressor of autophagy. PTEN over- expression has been shown to promote autophagy (Arico, Petiot et al. 2001), whereas the targeted deletion of PTEN in mouse liver causes a strong inhibition of autophagy (Ueno, Sato et al. 2008). Akt inhibition also strongly promotes autophagy whereas constitutively active Akt has the opposite action (Laane, Tamm et al. 2009). Inhibitors of mTOR have also been shown to induce autophagy in various cell types (Paglin, Lee et al. 2005, Cao, Subhawong et al. 2006, Iwamaru, Kondo et al. 2007). In addition, stabilisation of tuberous sclerosis 28

complex 2 (TSC2), which inhibits the mTOR signalling, promotes autophagy and suppresses tumourigenesis (Kuo, Lee et al. 2010). The inhibitory effect of PI3K/Akt/mTOR axis on autophagy is mainly mediated through the unc-51-like kinase 1/2 /mAtg13/FIP200 (focal adhesion kinase family interacting protein of 200 kDa) complex (Ganley, Lam du et al. 2009, Jung, Jun et al. 2009). Although the link between mTOR inhibition and autophagy is well established, it is worthwhile to notice that in some situations, mTOR may stimulate autophagy. In this regard, Zeng and Kinsella demonstrated that mTOR and its downstream mediator S6K1 may positively regulate autophagy in 6-thioguanine-treated cells, possibly through the negative feedback inhibition of Akt (Zeng and Kinsella 2011). Thus, a better understanding of the PI3K/Akt/PTEN/mTOR signalling pathways that regulate autophagy and cellular fate will hopefully open new possibilities for cancer treatment.

1.3.2.2 Autophagy in CaP RT

Autophagy is an interesting research area in cancer metastasis and radioresistance. Recent studies have identified autophagy as a cell death pathway that may mediate ionizing radiation (IR) sensitivity (Palumbo and Comincini 2013). Existing data indicate that autophagy increases in tumour cells especially in response to radiation and DNA damage (Apel, Herr et al. 2008, Gewirtz, Hilliker et al. 2009, Lomonaco, Finniss et al. 2009, Kim, Moretti et al. 2010). Autophagy was found to contribute to resistance of MDA-MB-231 breast cancer (BC) cell line to IR in vitro (Chaachouay, Ohneseit et al. 2011).

Gwak et al. demonstrated that micro RNA (miRNA) 21 was a pivotal molecule for circumventing radiation-induced cell death in malignant glioma cells through the regulation of autophagy in malignant glioma cell lines and this molecule could be a novel therapeutic target for future treatment of malignant glioma to overcome radiation resistance (Gwak, Kim et al. 2012). Cao et al. showed that the mTOR inhibitor RAD001 (everolimus) can enhance radiation sensitivity in PC-3 and DU145 CaP cell lines with the PTEN-deficient PC-3 cell line showing the greater sensitivity, and this increased susceptibility to radiation , which was associated 29

with induction of autophagy (Cao, Subhawong et al. 2006). Atorvastatin (statin), an inhibitor of 3-hydroxyl-3-methylglutaryl coenzyme A reductase, is an autophagy inducer. Parikh et al. reported that statins induced autophagy and autophagy-associated cell death in PC-3 cells via inhibition of eranylgeranylation (Parikh, Childress et al. 2010). They further confirmed that the effect of statin on autophagy in PC-3 cells was mediated by the ERK and c-Jun N-terminal kinase (JNK) pathways through activation of LC3 transcription (Toepfer, Childress et al. 2011). He et al. also reported that statin was capable of radiosensitizing PC-3 CaP cells and has superior effect in inducing possibly both autophagic and apoptotic cell deaths, that activation of the autophagy pathway may be responsible for apoptosis inducing effect of statin (He, Mangala et al. 2012). Thus, these data indicate that a combined treatment with radiation and autophagic inducer, such as statin, may be synergistic in inducing cell death of CaP cells. Monascuspiloin (MP), a yellow pigment first isolated from Monascus pilosus M93-fermented rice, is structurally similar to the well-known Monascus pigment monascin. Chiu et al. demonstrated that IR combined with MP increases the therapeutic efficacy compared to each individual treatment alone in PC-3 CaP cells in vitro and in vivo with induced autophagy, endoplasmic reticulum (ER) stress and enhanced DNA damage, and this combined treatment-induced autophagy occurred primarily via inhibition of the Akt/mTOR signalling pathways, suggesting that IR combined with MP could provide a novel therapy for the treatment of andogen independent CaP (Chiu, Chen et al. 2012).

The autophagic response of cancer cells to anti-neoplastic therapy, including IR, is controversial. It can originate a protective mechanism against the treatment itself by removing proteins and organelles that are damaged, or, alternatively, produce an effective cell-death process. The autophagic paradox in cancer therapy has been recently reviewed (Wu, Coffelt et al. 2012). Our recent findings support that CaP-RR cells have increased autophay compared to CaP cell lines, and PI3K and mTOR inhibitors combined with RT could regress autophagy markers (Becline-1 and LC3 A/B) and increase radiosensitivity (Chang et al, 2014), suggesting the authophage plays an oncologic role in CaP radioresistrance. Thus, autophagy seems to play a pivotal role in both survival and death processes: these 30

processes, in fact, might be cell and tissue specific and highly dependent on the expression profile of genes and proteins regulating apoptosis. In principle, most cancers have certain defects in their apoptotic pathway, whereas therapeutic targeting of autophagy pathways might yield better clinical outcomes for patients undergoing RT and cytotoxic drug therapy. If cancer cells are regulated by both apoptosis and autophagy, targeting two death ways by combination approaches may achieve a better clinic outcome. As modulation of autophagy represents a novel approach for enhancing the therapeutic efficacies of cancer therapy including IR, research efforts have been put forth to identify agents that can induce or inhibit autophagy.

1.3.3 EMT in CaP metastasis and radioresistance

1.3.3.1 Roles of EMT in CaP metastasis and progression

Progression of most carcinomas toward malignancy is associated with the loss of epithelial differentiation and by switching toward mesenchymal phenotype, which is accompanied by increased cell motility and invasion. EMT can lead to increased cellular adhesion, apical-basal polarity, cellular motility, increasing the potential for invasion/metastasis. This phenomenon is characterised by the loss of cell-cell adhesion molecules, down-regulation of epithelial differentiation markers, and transcriptional induction of mesenchymal markers (Zeisberg and Neilson 2009) (Figure 1-7). This process is regulated by many signalling pathways (Figure 1-7). EMT plays a critical role not only in tumour metastasis but also in tumour recurrence that is believed to be tightly linked to the biology of cancer stem-like cells or cancer-initiating cell (Mani, Guo et al. 2008, Santisteban, Reiman et al. 2009). In order to establish new tumours at the metastatic sites, it is believed that the cells which transition from an epithelial to a mesenchymal state and migrate must undergo the reverse procedure, mesenchymal to mesenchymal epithelia transition (MET) (Brabletz, Jung et al. 2005). Therefore, metastasis is considered to be a dynamic and complex process involving cellular plasticity. E- cadherin is a cell-to-cell adhesion molecule in which loss of expression is a hallmark of EMT, leading to increased cell motility and invasion (Schmalhofer, 31

Brabletz et al. 2009). On the other hand, N-cadherin and fibronectin are mesenchymal markers (Zeisberg and Neilson 2009) in which expression is regulated by several transcription factors including a basichelix-loop-helix (bHLH) transcription factor Twist1, Slug, and Snail (Kwok, Ling et al. 2005, Alexander, Tran et al. 2006).

Figure 1-7 A schematic model of EMT in cancer metastasis Chemoresistant or RR cancer cells with EMT lose their cell-cell contacts and re- arrange the cytoskeleton so that they can migrate, invade the neighbouring tissue and metastasise to distant organs via blood. During EMT, the metastatic potential is acquired by the loss of epithelial markers and the acquisition of mesenchymal markers. Several EMT-related signalling pathways regulate this process.

Emerging evidence suggests that EMT plays a crucial role in the aggressiveness in CaP, including increased migration and invasion ability, and contributing to chemoresistance, radiation resistance and CSC populations (Nauseef and Henry 2011, Byles, Zhu et al. 2012, Mulholland, Kobayashi et al. 2012). CaP is a highly metastatic disease during which cells undergoing EMT lose their epithelial morphology, reorganise their cytoskeleton (CK) and acquire a motile phenotype 32

through the down-regulation of adherent junction proteins (such as cadherins) and up-regulation of mesenchymal markers (Snail, Slug and Vimentin) (Hugo, Ackland et al. 2007, Mimeault and Batra 2011). EMT is a characteristic of cancer cell intravasation and metastasis and is closely associated with CRPC. It was reported that CaP cells with more mesenchymal features exhibit a more-invasive phenotype in vitro and display a more aggressive behaviour in metastatic colonization models (Drake, Barnes et al. 2010). Pathological EMT events have been shown to potentiate the transition from localised CaP to invasive CaP and subsequent metastasis (Xu, Wang et al. 2006, Acevedo, Gangula et al. 2007, Zhang, Helfand et al. 2009, Mak, Leav et al. 2010, Lue, Yang et al. 2011). Conversely, repression of EMT events blocks the metastatic potential of CaP cells (Xie, Gore et al. 2010). In clinical specimens, measures of cancer progression correlate with loss of E-cadherin and up-regulation of EMT-inducing transcriptional factors (Kwok, Ling et al. 2005, Graham, Zhau et al. 2008, Contreras, Ledezma et al. 2010, Mak, Leav et al. 2010, Xie, Gore et al. 2010). EMT events are correlated with metastatic CaP recurrence following surgery (Zhang, Helfand et al. 2009, Mak, Leav et al. 2010), and have recently been observed concurrently following androgen withdrawal therapy (Sun, Wang et al. 2012). Therefore, the ability to identify primary tumour cells with an increased propensity to undergo EMT-like events would improve diagnostic approaches to discriminate patients at risk for progression.

Behnsawy et al. recently found that measurement of the expression of potential EMT markers (Twist and Vimentin) combined with conventional prognostic parameters in RP specimens, would contribute to a more accurate prediction of the biochemical outcome in localised CaP patients following RP (Behnsawy, Miyake et al. 2013). Mulholland et al. demonstrated that PTEN loss and Ras/ MAPK activation cooperated to promote EMT and metastasis initiated from CaP stem/progenitor cells in the conditional activatable KRas (G12D/WT) mice with the prostate conditional PTEN deletion model (Mulholland, Kobayashi et al. 2012). It was reported that SIRT1 induces EMT by cooperating with EMT transcription factors and enhances CaP cell migration and metastasis in CaP cell lines and an immunodeficient mouse model (Byles, Zhu et al. 2012). Sethi et al. 33

examined EMT markers including E-cadherin, Vimentin, ZEB1, Notch-1, platelet-derived growth factor (PDGF)-D and NF-κB using an immunohistochemical approach in primary CaP and bone metastases and found that Notch-1 plays an important role in CaP bone metastasis (Sethi, Macoska et al. 2010).

Zhu and Kyprianou found that androgens induce the EMT pattern in CaP epithelial cell with Snail activation and lead to significant changes in CaP cell migration and invasion potential (Zhu and Kyprianou 2010). It was reported that the majority (>80%) of the circulating tumour cells (CTCs) in patients with metastatic CRPC co-express epithelial proteins such as epithelial cell adhesion molecule (EpCAM), CK, and E-cadherin, as well as mesenchymal proteins including Vimentin and N-cadherin, and the stem cell marker CD133, suggesting that the improved detection of these cells in vivo can be achieved to assist in developing novel therapeutic strategies (Armstrong, Marengo et al. 2011). Tanaka et al. demonstrated a clear link between the expression of N-cadherin and metastatic CRPC and developed the N-cadherin specific monoclonal antibodies (MAbs) shown to delay the progression to castration resistance, inhibit the invasion of surrounding tissues, suppress tumour growth and reduce metastasis in castrated mice (Tanaka, Kono et al. 2010). This work provides further support for the critical role of EMT in CaP progression and the potential of immunotherapy as a strategy to combat CRPC disease.

1.3.3.2 EMT in cancer radioresistance

The investigation of the relationship between EMT and radioresistance in cancer is a new and developing research area. Until recently, the association between radiation and EMT has not been intensively investigated, and only a few studies have examined the underlying mechanism. Clinical and laboratory data suggest that IR may promote the metastatic ability of cancer cells and elicit changes in the host microenvironment that may facilitate tumour progression and the development of second malignancies (Barcellos-Hoff, Park et al. 2005, Madani, De Neve et al. 2008). EMT was reported to be related to radioresistance in many 34

cancers (Escriva, Peiro et al. 2008, Kurrey, Jalgaonkar et al. 2009, Creighton, Chang et al. 2010). Andarawewa et al. have proven that radiation can predispose non-malignant human mammary epithelial cells to undergo TGF-β mediated EMT through MAPK signalling pathways, thereby elicits heritable phenotypes that could contribute to neoplastic progression (Andarawewa, Erickson et al. 2007). Tsukamoto et al. indicated that radiation can induce EMT through promoting the expression of Twist, an organiser of EMT, thus enhance the invasive potential of endometrial carcinoma cells (Tsukamoto, Shibata et al. 2007). Zhang et al. reported that low doses IR enhances the invasiveness of BC cells by inducing EMT with down-regulation of epithelial differentiation markers and transcriptional induction of mesenchymal markers in MCF-7 BC cell line (Zhang, Li et al. 2011). Jung et al. showed that IR induces changes associated with EMT and increased cell motility in the A549 lung epithelial cancer cell line in vitro, suggesting that a subset of lung cancer patients may benefit from a combination of RT with inhibitors of EMT or cell migration (Jung, Hwang et al. 2007). Li et al. demonstrated that radiation enhances long-term metastasis potential of residual hepatocellular carcinoma (HCC) in nude mice through TMPRSS4-induced EMT and these findings provide new clues to suppress the radiation-induced dissemination and metastasis of tumour cells to improve the prognosis of HCC patients (Li, Zeng et al. 2011). Zhang et al. found that ATM-mediated stabilization of ZEB1 promoted DNA damage response and radioresistance through Chk1 in BC cells (Zhang, Wei et al. 2014). Kim et al also demonstrated that PAK1 tyrosine phosphorylation is required to induce EMT and radioresistance in lung cancer cells (Kim, Youn et al. 2014). All these findings suggest that EMT is involved in radioresistance and specifically targeting EMT may provide a new targeted approach to improve the therapeutic effectiveness of radiation in cancers.

To the best of our knowledge, very few investigations have been reported to study the role of EMT in CaP radioresistance. Our research group have recently developed three CaP RR cell lines (PC-3RR, DU145RR and LNCaPRR) with a 2 Gy fractioned irradiation each day for 5 consecutive days. Post 5 weeks treatment, these radiation-treated CaP cell lines demonstrated the morphological changes 35

including loss of glandular pattern, vacuolated cell plasma, pleomorphic nuclei and enlarged size as well as increased colony growth and invasion ability (Chang, Graham et al. 2013) (see Chapter 3). These treated CaP cell lines are consistent with our published reports for EMT characteristics such as reduced E-cadherin and increased Vimentin, SOX2 and OCT4 (Chang, Graham et al. 2013). Cojoc et al also showed that aldehyde dehydrogenase (ALDH) activity is indicative of RR prostate progenitor cells with an enhanced DNA repair capacity and activation of EMT (Cojoc, Peitzsch et al. 2015). These preliminary data indicate that EMT is involved in CaP radioresistance and may play an important role in CaP metastasis and recurrence after RT. It is worthwhile investigating the role of EMT in CaP animal models and clinical tissue samples after RT to further confirm its significance. The findings may be useful in developing novel biomarkers to monitor CaP RT and therapeutic targets to overcome radiation resistance that is one of the most common problems in the current CaP therapy.

1.3.4 CSCs in CaP radioresistance

1.3.4.1 Concept of CSCs

The CSC concept is becoming a hot research spot in studying cancer radioresistance as the CSC model provides a plausible account for poorly understood clinical phenomena, such as chemo/radioresistance. CSCs are malignant cell subsets capable of tumour initiation and self-renewal, which give rise to bulk populations of non-tumourigenic cancer cell progeny through differentiation (Zhou, Zhang et al. 2009). CSCs embody the refractory nature observed among many cancers: very competent initial establishment, extremely aggressive metastatic nature, resistance to chemo-/radiotherapy, correlation with advanced disease and resistance to current therapies. Therefore, if CSCs survive after anti-cancer treatment, recurrence and metastasis are expected due to the ability of these cells to give rise to new tumours.

Despite continuous improvements in cancer management, locoregional recurrence or metastatic spread still occurs in a high proportion of patients after RT or combined treatments. One underlying reason might be a low efficacy of current treatments on the eradication of CSCs. Despite the ongoing debate on the abundance and origin of CSCs, it is generally accepted that they represent the root of cancer that must be eradicated in order to cure cancer. However, an effective therapeutic modality targeting CSCs is yet to be developed.

1.3.4.2 Putative prostate CSC markers Although some studies suggested the cellular origins of CaP are terminally differentiated luminal cells (Nagle, Ahmann et al. 1987), evidence still supports the existence of CSCs in CaP (Gu, Yuan et al. 2007). We and others have recently reviewed the literature on CSCs origin, the identification and characterization in CaP as well as their clinical implications and therapeutic challenges (Li, Cozzi et al. 2010, Tu and Lin 2012). There are also several reviews published by other authors elaborating the current status of research on CSCs in CaP, including characteristics of CSCs (Li, Chen et al. 2008), methodologies of assaying CSCs (Li, Jiang et al. 2009) and the relationship of stem cells with therapy resistance (Lang, Frame et al. 2009). In this section, I only summarise putative CSC markers from human CaP cell lines, xenografts and primary tumour tissues.

CSCs appear to express many of the same markers as normal tissue stem cells. Prostate CSCs express a number of the same markers as prostate stem cells, such as CD44, CD133, integrins, breast cancer resistance protein (BCRP) and Sca-1, all of which have been utilised to identify prostate CSCs or prostate stem cells. The most frequently identified potential CSCs markers in CaP are summarised in Table 1-1. These surface markers combined with cell sorting technology have been used to identify and isolate CSC subpopulations in CaP. Collin et al. reported the identification and characterization of a population (CD44+21highCD133+) from human prostate tumours, which possesses a significant capacity for self-renewal and is also able to regenerate the phenotypically mixed populations of non-clonogenic cells such as AR and prostatic acid phosphatase (PAP) positive CaP cells (Collins, Berry et al. 2005). 37

They suggested that this population of CSCs could be used as a therapeutic target for CaP treatment (Collins and Maitland 2006, Maitland and Collins 2008). Later on, using a side population of cells isolated from LAPC-4 and LAPC-9 CaP xenografts, Patrawala et al. found that highly purified CD44+ CaP cells are enriched in tumourigenic and metastatic progenitor cells (Patrawala, Calhoun et al. 2006). After adding other potential CSC markers, they demonstrated that the CD44+21+/high cell population from the LAPC-9 CaP tumour xenografts reveal a hierarchy in tumourigenic potential (Patrawala, Calhoun-Davis et al. 2007). Previous study reported that one population of CD133high/CD44high cells isolated from established aggressive prostate PC-3-MM2 cell line have CSC characteristics and are potentially useful to model and study stem cell behaviour, and their responses to CaP treatment (Rowehl, Crawford et al. 2008). Furthermore, Dubrovska et al. confirmed that the CD133+/CD44+ population of cells enriched in CaP progenitors from PC-3 and DU145 cell lines have tumour- initiating potential and that these progenitors can be expanded under non- adherent, serum-free, sphere-forming conditions (Dubrovska, Kim et al. 2009).

Table 1-1 Putative CSC markers from human CaP cancer cell lines, animal xenografts and primary human CaP tissues

Cell CSC marker Reference line/model/tissue (Collins, Berry et al. CD44+21highCD133+ Primary tumours 2005) LAPC-4 and (Patrawala, Calhoun et CD44+ LAPC-9 models al. 2006) (Patrawala, Calhoun- CD44+/21+/high LAPC-9 model Davis et al. 2007) PC-3-MM2 cell (Rowehl, Crawford et CD133high/CD44high line al. 2008) PC-3 and DU145 (Dubrovska, Kim et CD133+/CD44+ cell lines al. 2009) 38

LNCaP and (Klarmann, Hurt et al. CD44+/CD24- DU145 cell lines 2009) LNCaP and (Hurt, Kawasaki et al. CD44+/CD24- DU145 cell lines 2008) PC-3, VCAP, LNCaP, 22RV1 (Bisson and Prowse CD44+ABCG2+CD133+ and DU145, C4- 2009) 2B cell lines LNCaP, LAPC-4 and LAPC-9 cell PSA-/lo (Qin, Liu et al. 2012) lines; primary CaP tumours (Richardson, Robson CD133+ Primary tumours et al. 2004) LAPC-4, LNCaP (Vander Griend, CD133+ and CWR22RV1 Karthaus et al. 2008) cell lines PC-3M-Pro4 and C4-2B cell lines; (van den Hoogen, van ALDHhigh primary tumours der Horst et al. 2010)

(Doherty, Haywood- ALDHhigh PC-3 cell line Small et al. 2011) PC-3 and LNCaP ALDH1A1+ (Li, Cozzi et al. 2010) cell lines TRA-1- (Rajasekhar, Studer et Primary tumours 60+/CD151+/CD166+ al. 2011) DU145 and PC-3 E-cadherin+ (Bae, Su et al. 2010) cell lines (Liu, Wang et al. D117+/ABCG2+ 22RV1 cell line 2010)

Using flow cytometry, Hurt et al. isolated a population of CD44+/CD24- CaP cells from LNCaP and DU145 cell lines that display stem cell characteristics as well as gene expression patterns that predict overall survival in CaP patients (Hurt, Kawasaki et al. 2008). CD44+/CD24− LNCaP cells could form prostaspheres in vitro (Hurt, Kawasaki et al. 2008). CD44+/CD24− cells form colonies in soft agar and form tumours in non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mice when as few as 100 cells were injected (Hurt, Kawasaki et al. 2008). They concluded that the CD44+/CD24- LNCaP CaP cells offer an attractive model system to explore the biology important to the maintenance and differentiation of prostate CSCs as well as to develop the therapeutics, as the gene expression pattern in these cells is consistent with poor survival in CaP patients. Furthermore, they also demonstrated that the genomic profile of the invasive CaP cells closely resembles that of CD44+/CD24- prostate CSCs and showed evidence for increased Hedgehog signalling (Klarmann, Hurt et al. 2009). Using CaP spheres model, Bisson and Prowse showed that prostate spheres from PC-3, VCAP, LNCaP, 22RV1 DU145 and C4-2B CaP cell lines exhibit heterogeneous expression of proliferation, differentiation and stem cell-associated makers CD44, ABCG2 and CD133, and Wnt signalling regulates self-renewal and differentiation of CaP cells with stem cell characteristics (Bisson and Prowse 2009). Qin et al. recently demonstrated that PSA-/lo CaP cells can initiate robust tumour development and resist androgen ablation in castrated hosts, and they harbor highly tumourigenic castration-resistant CaP cells that can be prospectively enriched using ALDH+/CD44+/α2β1+ phenotype in CaP cell lines (Qin, Liu et al. 2012) .

CD133 has been proposed to be a putative CSC surface marker in a number of tumours. Richardson et al. found a small population (approximately 1%) of human prostate basal cells express the cell surface marker CD133 in primary CaP tissues and are restricted to the α2β1high population, and showed that CD133+ cells exhibit characteristics of stem cells including prostasphere formation and the development of prostatic-like acini in SCID mice (Richardson, Robson et al. 2004). Within a series of AR+ human CaP cell lines including LAPC-4, LNCaP and CWR22RV1 cells, CD133+ cells are present at a low frequency, self-renew, 40

express AR, generate phenotypically heterogeneous progeny negative for CD133, and possess an unlimited proliferative capacity (Vander Griend, Karthaus et al. 2008). However, other investigators found that CD133 was only expressed in DU145 cells but not in DuCaP, LAPC-4, CWR22RV1, LNCaP and PC-3 CaP cells, and that CD133+ cells from the DU145 cell line were not more clonogenic than CD133- cells (Pfeiffer and Schalken 2010). They considered CD133 selection does not enrich stem-like cells in CaP cell lines. The reasons for this variance may be the application of different antibodies to CD133, different passages of tissue culture or experimental methodology.

ALDH is an enzyme involved in the intracellular retinoic acid production (Yoshida, Hsu et al. 1992). In prostate CSCs studies, the high expression of ALDH1A1, a member of ALDH family, was found to be positively correlated with Gleason score and pathologic stage, and inversely associated with overall survival and cancer-specific survival of the CaP patients, indicating ALDH1A1 could be a potential prostate CSC-related marker (Li, Cozzi et al. 2010). In one study, it was reported that ALDHhigh CaP cells from CaP cell lines (PC-3M-Pro4 and C4-2B) and primary CaP tissues not only display strongly elevated clonogenicity and migratory behaviour in vitro, but also show enhanced tumourigenicity and metastatic ability in vivo (van den Hoogen, van der Horst et al. 2010). In another study, Doherty et al. demonstrated that PC-3 cells contain a stem cell hierarchy, and isolation of ALDHhigh PC-3 cells enriches for the most primitive holoclone population (Doherty, Haywood-Small et al. 2011). By ALDEFLUOR assay and fluorescence-activated cell sorting (FACS), Li et al. isolated ALDH1A1+ cells from PC-3 and LNCaP CaP cell lines and the isolated ALDH1A1+ CaP cells demonstrated high clonogenic and tumourigenic capacities in vitro, and serially reinitiated transplantable tumours that resembled histopathologic characteristics and heterogenecity of the parental CaP cells in vivo (Li, Cozzi et al. 2010). Therefore, ALDH and ALDH1A1 activity are promising prostate CSC-related markers for future therapy. Rajasekhar et al. recently performed a thorough investigation on prostate CSCs and identified 2 noteworthy new features of prostate CSCs: expression of TRA-1-60, CD151 and CD166; and elevated NF-κB signalling (Rajasekhar, Studer et al. 2011). This minor subset of 41

TRA-1-60+/CD151+/CD166+ cells do not express AR or PSA, but possess stem cell characteristics and multipotency as demonstrated by in vitro sphere-formation and in vivo tumour-initiation, respectively (Rajasekhar, Studer et al. 2011).

The cell adhesion molecule E-cadherin has an important role in maintaining the undifferentiated stage of embryonic CSCs (Eastham, Spencer et al. 2007). E- cadherin down-regulation is thought to correlate with highly invasive tumours and poor prognosis in CaP patients (Umbas, Schalken et al. 1992, Ikonen, Matikainen et al. 2001). Bae et al. isolated E-cadherin+ cell population from DU145 and PC-3 CaP cell lines by flow cytometry and found that this population of cells show high expression of CD44 and integrin-α2β1, OCT4 and SOX2 and have high tumourigenicity in immunodeficient mice in vivo (Bae, Parker et al. 2011). They further confirmed that this population of cells is also highly invasive and capable of altering its E-cadherin expression during the process of invasion (Bae, Parker et al. 2011). These data support that E-cadherin plays an important role in CaP invasion and promotes the dissemination of cancer cells. Using a magnetic activated cell sorting (MACS) system, Liu et al. found that D117+/ABCG2+ cells from 22RV1 CaP cell line over-express stem cell markers such as Nanog, OCT4, SOX2, estin and CD133, and can readily establish tumours in vivo in a relatively short time (Liu, Xu et al. 2010). In addition, this population of cells is also resistant to treatment with a variety of chemotherapeutics such as casplatin, paclitaxel, adriamycin and methotrexate (Liu, Xu et al. 2010). Kong et al. demonstrated that CaP cells with EMT phenotype displays stem-like cell features characterised by increased expression of SOX2, Nanog, OCT4, Lin28B and/or Notch1, consistent with enhanced clonogenic and sphere (prostasphere)-forming ability in vitro and tumourigenecity in mice in vivo (Kong, Banerjee et al. 2010). Selective elimination of this population of SOX2+/Nanog+/OCT4+/Lin28B+ cancer stem-like cells by reversing the EMT phenotype to MET phenotype using novel agents would be useful for the prevention of CaP recurrence via targeting the "root cause" of tumour development and recurrence.

1.3.4.3 Different responses of CSCs and non-CSCs to RT

The current CSC hypothesis implies that permanent local tumour control or recurrence after treatment depends on the inactivation or survival of CSCs after treatment (Baumann, Krause et al. 2008). There is considerable evidence to suggest that, under certain experimental conditions, CSCs exhibit RR features (Eyler and Rich 2008). Tumour radioresistance leads to recurrence after RT. The RR phenotype has been hypothesised to reside in the CSC component of tumours and is considered to be an inherent property of CSC. In CSCs and radiation research, it is generally suggested that CSC subpopulations are relatively RR compared with non-CSC subpopulations.

Using CD24-/low/CD44+ cancer-initiating cells isolated from MCF-7 and MDA- MB-231 BC cell lines, Phillips et al. demonstrated that surviving fraction at 2 Gy was elevated from 0.2 to 0.5, for monolayer cultures and mammospheres (a clump of mammary epithelial cells that form under specialised suspension culture conditions in vitro) (Phillips, McBride et al. 2006). Furthermore, MCF-7 mammospheres displayed greater survival and less expression of γH2AX than adherent cultures exposed to radiation (Phillips, McBride et al. 2006). These results suggest that CD24-/low/CD44+ cells are more resistant to RT. In one study, radiation induced enrichment of BC cells with stem or progenitor characteristics (measured by Hoechst 33342 dye efflux or LIN-/CD24+/CD29+), γH2AX foci, which are markers of DNA double strand breaks (DSBs), resolved more rapidly in mammospheres derived from LIN-/CD24+/CD29+ cells, suggesting more effective DNA repair in cells with stem cell characteristics after irradiation (Woodward, Chen et al. 2007). In another study, Zhang et al. collected tumour cells from syngeneic p53-null mouse mammary gland tumour models and identified a subpopulation of cells with Lin-/CD29high/CD24high phenotype by limiting dilution transplantation and in vitro mammosphere assay, which possessed tumour- initiation capacity (Zhang, Behbod et al. 2008). After single dose irradiation from 2 Gy to 6 Gy, gene microarray demonstrated an increased DNA damage response and expression of DNA repair genes among Lin-/CD29high/CD24high cells including Nek1, Brca1, Chek1, Hus1, Ung, Xrcc5, Sfpq, and Uhrf1, which was validated by quantitative polymerase chain reaction (PCR) (Zhang, Behbod et al. 2008). These results further confirmed the existence of radiation resistance in 43

tumour-initiating cell-enriched mammospheres in BC cells. Using non-BC stem cells (BCSCs) sorted from patient samples, Lagadec et al. found that IR reprogrammed differentiated BC cells into induced BCSCs (iBCSCs) (Lagadec, Vlashi et al. 2012). iBCSCs showed increased mammosphere formation, increased tumourigenicity, and expressed the same stemness-related genes as BCSCs from non-irradiated samples. However, one recent study found that based on CD44+/CD24-/lin- phenotype and ALDH1, not all breast tumour CSCs are RR but can respond uniquely to RT (Zielske, Spalding et al. 2010). In addition, two studies have also suggested that radioresistance may not be a general property of CSCs (Al-Assar, Muschel et al. 2009, Dittfeld, Dietrich et al. 2009); among CSCs isolated from nine cell lines of brain, breast, colon, and pancreas cancers by FACS, only one BC cell line (MDA-MB-231) showed radioresistance (Al-Assar, Muschel et al. 2009).

RT represents one of the most effective therapies for glioma (Fiveash and Spencer 2003). CD133 has been regarded as the marker for CSCs in malignant glioma in a number of studies (Beier, Hau et al. 2007, Gunther, Schmidt et al. 2008, Annabi, Lachambre et al. 2009, Liu, Nguyen et al. 2009). In vitro and in vivo experiments demonstrated enrichment of CD133+ cells after irradiation with clinically relevant doses, which represented selective survival of CD133+ cells and death of CD133- populations (Bao, Wu et al. 2006). In glioblastoma, CD133+ CSCs are dramatically increased after irradiation, and RR glioblastomas exhibit a higher percentage of CD133 expressing CSCs (Bao, Wu et al. 2006). Brain CSCs preferentially activate the DNA damage checkpoint proteins in response to radiation, and repair radiation-induced DNA damage more effectively than non- CSCs (Bao, Wu et al. 2006, Hambardzumyan, Becher et al. 2008). In atypical teratoid/rhabdoid brain tumours, the number of CD133+ cells is positively correlated with the degree of radioresistance (Chiou, Kao et al. 2008). The relative radioresistance of CD133+ cancer cells in glioma is also demonstrated in a study of clinical patients’ tissue sections after high-dose irradiation (Tamura, Aoyagi et al. 2010). Data yielded from histopathological examination of glima patients who underwent surgical removal of remnant tumours after Gamma Knife Surgery (GKS) and EBRT demonstrated marked accumulation of CD133+ glioma cells, 44

particularly in remnant tumours within the necrotic areas, while CD133+ cells appeared sparse in primary sections prior to GKS and EBRT (Tamura, Aoyagi et al. 2010). These results suggested that CD133+ cells can survive high-dose irradiation and may account for tumour re-growth. Taken together, all the data support the contribution of CD133+ CSC marker in glioma radioresistance, although the mechanisms through which CSCs alter radiosensitivity of glioma remain elusive.

Piao et al. recently demonstrated the CD133+ cells from HCC Huh-7 cell line are associated with radioresistance through the activation of MAPK/ERK survival pathway, and have enhanced proliferating activity compared to CD133- cells following irradiation (Piao, Hur et al. 2012). Therefore, CD133+ cell surface marker has a potential as a therapeutic target to improve the effect of the RT of HCC. Interestingly, the EMT accompanied by E-cadherin loss has been associated with CSCs (Mani, Guo et al. 2008). These cells have also been associated with tumour relapse and resistance to radiation (Baumann, Krause et al. 2008). Whether the effect of E-cadherin loss in radioresistance is direct or indirect as a consequence of deregulation of the DNA repair and cell cycle checkpoints by EMT (Kurrey, Jalgaonkar et al. 2009) or by the acquisition of stem-cell like properties remains to be investigated.

1.3.4.4 Current progress of CSCs in CaP radiation research

As far as we know, data related to the difference of CSC and non-CSCs in CaP are very limited until now. Both CD44 and CD133 are the most frequent CSC markers in CaP used in related research (Collins, Berry et al. 2005, Collins and Maitland 2006, Patrawala, Calhoun et al. 2006, Patrawala, Calhoun-Davis et al. 2007, Tang, Patrawala et al. 2007, Wei, Guomin et al. 2007, Hurt, Kawasaki et al. 2008). The results from our studies indicate that the down-regulation of CD44 using siRNA enhances radiosensitivity in PC-3, PC-3M-luc, and LNCaP CaP cells, and that the delay of DNA DSBs repair in CD44 low-expressing KD CaP cells is correlated with ineffective cell cycle arrest and the delayed phosphorylation of Chk1 and Chk2 (Xiao, Graham et al. 2012). These findings 45

suggest that CD44 may be a valuable biomarker and a predictor of radiosensitivity in CaP treatment. Another aspect to consider in CSCs and CaP radiation research is the existence of splicing variants of CD44 (CD44V or CD44 isoforms). The multiple isoforms of CD44 are involved in cellular functions such as motility and proliferation. Although the value of CD44VCD44 as CSC-dependent cell surface markers has not been sufficiently investigated so far, the targeting of such variants appears to be a promising strategy for combined radiation oncologic treatment approaches. It was reported that anti-CD44V6 directed antibodies that were conjugated with a cytotoxic chemotherapeutic agent significantly improved local tumour control in combination with fractionated irradiation in a head and neck squamous cell carcinoma (HNSCC) model in vivo (Gurtner, Hessel et al. 2012). We have recently demonstrated that CD44V6 is an important cancer stem cell-like marker associated with CaP proliferation, invasion, adhesion, metastasis, chemo- /radioresistance, and KD of CD44V6 using siRNA can enhance radiosensitivity in PC-3M, DU145, and LNCaP cells (Ni et al, 2014), indicating CD44V6 is a potential target for CaP RT.

Cho et al. found that irradiation favours increased survival and showed an increase in CSC properties (CD44, CD133, Nanog and OCT4) with long-term recovery (after 33-35 days of RT treatment) in LNCaP and DU145 CaP cells in vitro (Chiu, Chen et al. 2012). Ni et al, demonstrated that EpCAM plays an important role in CaP proliferation, invasion, metastasis and chemo- /radioresistance associated with the activation of the PI3K/Akt/mTOR signalling pathway and the reduction of EpCAM by siRNA can increase radiosensitivity in PC-3, DU145 and LNCaP-C4-2B cells (Ni, Cozzi et al. 2013). We have recently developed CaP-RR cell lines and found that these CaP-RR (PC-3, DU145 and LNCaP) cells can induce EMT, enrich CSCs such as CD44, CD44V6, CD326, ALDH, Nanog and Snail, easily form more spheres and activate the PI3K/Akt/mTOR signalling pathways (Chang, Graham et al. 2013). Although the mechanisms of CSCs in CaP radioresistance are still unclear, these results indicate that CSCs may be involved in CaP radioresistance and can be useful therapeutic targets to prevent metastasis and recurrence. Investigating the roles of EMT and CSCs in CaP metastasis, chemoresistance and radioresistance is a very interesting 46

research area that is currently under investigation in our laboratory now. Although a lot of controversies still exist in the field of CSCs, future work to validate the importance of CSCs and characterise the mechanisms responsible for CSCs resistance to radiation is quite necessary and will pave the avenue for developing CSCs-specific radiosensitisers.

The main hurdle for investigating CSCs in radioresistance is the limitation of appropriate models available as CSCs are a dynamic process and the expression of CSC markers can be affected by many factors including tumour microenvironment. We have recently developed CaP-RR cell lines using the maximum dose of radiation treatment (Chang, Graham et al. 2013) (see Chapter 3) and CaP-RR xenograft mouse models (see Chapter 6), which are good models to mimic clinical RR conditions and study the roles of CSCs in CaP radioresistance. We believe these models are not only suitable for CaP radioresistance research but also useful for other cancers.

1.4 Improving radiation sensitivity in CaP with different agents

There is now abundant evidence supporting the benefits of high-dose EBRT in patients with clinically localised CaP (Zelefsky, Yamada et al. 2008). However, high-dose RT causes considerable collateral damage to normal cell populations at the treatment site (Probert and Parker 1975). Another challenge in RT is that CaP cells develop radioresistance that results in local relapses (Pollack, Zagars et al. 2002, Zietman, DeSilvio et al. 2005) as localised CaP is sensitive to conventional RT using x-rays and residual disease causes clinical relapse (Zietman, Shipley et al. 1993). Therefore, it is important to find agents that sensitise malignant tumour cells to RT, thus minimizing radiation toxicity to surrounding organs by lowering effective therapeutic doses. The use of different radiosensitisers in combination with low-dose irradiation may increase the overall therapeutic efficacy and overcome radioresistance. In the current section, I focus on radiation combined with radiosensitisers in CaP treatment. The different approaches by using radiosensitisers in combination with RT in preclinical studies are summarised in Table 1-2. 47

Table 1-2 Summary of combination of radiosensitisers with RT for CaP treatment in preclinical studies

Radiosensitiser Investigation Source Reference Small molecular inhibitor (Inayat, Chendil et Didox PC-3 cell line x-ray al. 2002) (Pajonk, van MG-132 PC-3 cell line γ-ray Ophoven et al. 2005) LAPC-4 and (Husbeck, Peehl et SSE γ-ray DU145 cell lines al. 2005) PC-3 and LNCaP (An, Chervin et al. HA14-1 γ-ray cell lines 2007) PC-3 and DU145 (Supiot, Hill et al. Nutlin-3 γ-ray cell lines 2008) (Cao, Subhawong et DCA PC-3 cell line x-ray al. 2006) PC-3 cell line (Diaz, Nguewa et al. P529 and animal x-ray 2009) model PC-3, DU145 (Handrick, Celecoxib and LNCaP cell photons Ganswindt et al. lines 2009) LAPC-4 and PC- (Tian, Ning et al. SSE x-ray 3 animal models 2010) PC-3 and DU145 cell lines , PC-3 (Barreto-Andrade, ABT-888 x-ray and DU145 Efimova et al. 2011) animal models CWR22RV1 cell (Gao, Ishiyama et al. Perifosine x-ray line and animal 2011)

model PC-3 and LNCaP (Bridges, Hirai et al. MK-1775 γ-ray cell lines 2011)

miR-106b LNCaP cell line γ-ray (Li and Tang 2011)

Growth factor inhibitor (Gottschalk, Doan et LY294002 LNCaP cell line γ-ray al. 2005) PC-3, DU145 (Rochester, IGF1R siRNAs and LNCaP cell γ-ray Riedemann et al. lines 2005) PC-3 and DU145 (Huamani, Willey et AEE788 x-ray animal models al. 2008) DU145 cell line (Wagener, Zhang et C225 and animal γ-ray al. 2008) model (Matsubara, FGFR2IIIb PC-3 cell line γ-ray Teishima et al. 2008) SU5416 and PC-3 animal (Timke, Zieher et al. γ-ray SU6668 model 2008) PC-3 and DU145 (Xu, Fang et al. STI571 x-ray cell lines 2010) (Liu, Wang et al. C225 DU145 cell lines γ-ray 2010) PC-3, DU145 (Isebaert, Swinnen et NVP-AEW541 and 22Rv1 cell x-ray al. 2011) lines PC-3, DU145 and LNCaP cell (Brooks, Sheu et al. Sunitinib x-ray lines, PC-3 2012) animal model Gene therapy

PC-3 and LNCaP (Colletier, Ashoori et Adv-p53 x-ray cell lines al. 2000) PC-3 and DU145 (Sasaki, Shirakawa Ad5CMV-p53 x-ray cell lines et al. 2001) PC-3, DU145 (Kaliberov, AdVEGF- and LNCaP cell γ-ray Kaliberova et al. sKDR lines, DU145 2005) animal model PC-3-Bcl2 and (Anai, Goodison et AdPTEN PC-3-Neo animal x-ray al. 2006) models Antisense therapy

(Mu, Hachem et al. AS-MDM2 LNCaP cell line γ-ray 2004) LNCaP, CWR22-Rv1, (Truman, Gueven et Antisense-ATM x-ray PC-3 and DU145 al. 2005) cell lines Antisense (Teimourian, Jalal et DU145 cell line γ-ray Hsp27 cDNA al. 2006) PC-3 cell line (Anai, Goodison et Bcl2ASODN and PC-3 animal γ-ray al. 2007) model LNCaP animal (Stoyanova, Hachem AS-MDM2 x-ray model et al. 2007) AS-MDM2 PC-3 and LNCaP (Udayakumar, x-ray Ad-E2F1 cell lines Hachem et al. 2008) (Udayakumar, PC-3 and LNCaP E2F1 x-ray Stoyanova et al. animal models 2011) HDACI

(Chinnaiyan, SAHA DU145 cell line x-ray Vallabhaneni et al. 2005) PC-3, DU145 and LNCaP cell lines (Konsoula, Cao et al. H6CAHA x-ray PC-3 animal 2011) model PC-3, DU145 and LNCaP cell lines (Chen, Wong et al. VPA x-ray DU145 animal 2011) model Natural product PC-3 cell line and (Xu, Yang et al. (-)-Gossypol PC-3 animal x-ray 2005) model PC-3, DU145 and (Sun, St Clair et al. Parthenolide x-ray LNCaP cell lines 2007) (Romero, Zapata et ET-743 DU145 cell line γ-ray al. 2008) PC-3, LNCaP cell (Kozakai, Kikuchi et DHMEQ lines and PC-3 x-ray al. 2012) animal model PC-3 cell line and (Chiu, Fang et al. MP x-ray animal model 2012) Other novel agent PC-3, LNCaP- LN3 and (Woynarowska, HMAF γ-ray LNCaP-Pro5 cell Roberts et al. 2000) lines photon and (Hillman, Forman et Genistein PC-3 cell line neutron al. 2001) Genistein PC-3 animal x-ray (Hillman, Wang et

model al. 2004) (Algur, Macklis et Zoledronic acid C4-2B cell line γ-ray al. 2005) (Raffoul, Wang et al. Genistein PC-3 cell line photons 2006) (Warren, Grimes et MG-132 PC-3 cell line x-ray al. 2006) (Suzuki, Amano et β-lap DU145 γ-ray al. 2006) PC-3 cell line (Raffoul, Banerjee et Soy isoflavones and animal photons al. 2007) model PC-3 sphere 3D (Stewart, Nanda et NO-sulindac x-ray model al. 2011) PC-3 and LNCaP (Chiu, Chen et al. ATO cell lines and PC- x-ray 2012) 3 animal model

1.4.1 Small molecular inhibitors

Didox (DX, 3,4-Dihydroxybenzohydroxamic acid) is a novel ribonucleotide reductase inhibitor. It was reported that Didox mediated its radiosensitizing effects by abrogating the radiation induced up-regulation of Bcl-2 expression and NF-B activity in PC-3 cells in vitro (Inayat, Chendil et al. 2002). Celecoxibs represent a structural class of non-steroidal anti-inflammatory drugs (NSAIDs) and belong to the most potent specific inhibitors of cyclooxygenase-2 (COX-2). COX-2 plays an important role in CaP progression (Hussain, Gupta et al. 2003). It was demonstrated that COX-2 was up-regulated after IR in PC-3 CaP cells in vitro (Steinauer, Gibbs et al. 2000). Handrick et al. found that Celecoxib can sensitise CaP cell lines to IR via a pro-apoptotic Bax independent death pathway (Handrick, Ganswindt et al. 2009). In a phase I clinical trial, a combination of

Celecoxib with RT was performed in 22 localised CaP patients and was not associated with an increased level of side effects (Ganswindt, Budach et al. 2006). These data indicate that COX-2 inhibitors are promising for Phase II and III trials to overcome CaP radiation resistance.

Pajonk et al. demonstrated the proteasome inhibitor MG-132 sensitised PC-3 CaP cells to IR and induces apoptosis by a DNA-PK-independent mechanism (Pajonk, van Ophoven et al. 2005). An et al. reported that HA14-1 (a small molecular Bcl- 2 inhibitor) potently sensitises RR LNCaP and PC-3 cells to  radiation, regardless of the status of p53, and that combination of HA14-1 and  radiation induces apoptosis through activation of oxidative injury and JNK signals and triggers both caspase-dependent and -independent cell death pathways (An, Chervin et al. 2007). Nutlins are small molecules that inhibit MDM2 binding to p53 (Vassilev, Vu et al. 2004). These compounds bind in the p53-binding pocket of MDM2 to displace p53 from the complex and induce p53 stabilization. P53 then activates downstream targets leading to p21WAF induction, cell cycle arrest and apoptosis. It was reported that Nutlin-3 can act as a radiosensitiser via p53-independent mechanisms under low O2 levels in CaP cell lines in vitro, indicating that Nutlin-3 can be a useful adjunct to target hypoxic cells and improve the efficacy of RT (Supiot, Hill et al. 2008) .

Dichloroacetate (DCA), a known inhibitor of mitochondrial pyruvate dehydrogenase kinase (PDK) and drug utilised for hereditary lactic acidosis disorders, can shift cellular metabolism from glycolysis to glucose oxidation. One study demonstrated that DCA can effectively sensitise Bcl-2wt and Bcl-2high human CaP cells to RT by modulating the expression of key members of the Bcl-2 family (Cao, Yacoub et al. 2008). P529 is an Akt inhibitor that enhances the effect of RT on PC-3 CaP cells in vitro and a s.c animal model in vivo (Diaz, Nguewa et al. 2009).

Sodium selenite (SSE) is an inorganic Se compound and has been reported to radiosensitise both androgen-responsive (LAPC-4) and androgen-nonresponsive (DU145) CaP cells (Husbeck, Peehl et al. 2005). SSE significantly enhances the 53

effect of RT on LAPC-4 and PC-3 s.c xenografts and does not sensitise the intestinal epithelial cells to radiation, suggesting that SSE has a very good therapeutic potential for the treatment of CaP (Tian, Ning et al. 2010). PARP inhibitor ABT-888 (veliparib) can enhance radiosensitivity in PC-3 and DU145 CaP cell lines in vitro and PC-3 s.c animal model in vivo, suggesting that in vitro assays of radiosensitivity may not predict in vivo efficacy of PARP inhibitors with radiation (Barreto-Andrade, Efimova et al. 2011). Perifosine is a membrane- targeted alkylphospholipid developed to inhibit the PI3K/Akt pathway and has been suggested as a favourable candidate for combined use with RT. Perifosine enhances CaP radiosensitivity in a CWR22RV1 cell line in vitro and its s.c animal mode in vivo (Gao, Ishiyama et al. 2011). MK-1775 is a small molecule inhibitor of wee1. Bridges et al. found that MK-1775 radiosensitises p53-defective PC-3 CaP cells but not p53 wild-type LNCaP cells in vitro (Bridges, Hirai et al. 2011).

1.4.2 Growth factor inhibitors

It was reported that PI3K inhibitor LY294002 increased sensitivity of CaP cell line to IR through inactivation of PKB (Gottschalk, Doan et al. 2005). Insulin-like growth factor-type 1 receptor (IGF1R) signalling in the malignant transformation and progression of many tumour types is well established and is ascribed to its pivotal role in cellular proliferation, survival, and differentiation, leading to resistance to RT, chemotherapy, and other targeted therapies. Rochester et al. indicated that the IGF1R transfected with IGF1R small siRNA enhances IR response in PC-3, DU145 and LNCaP CaP cell lines in vitro (Rochester, Riedemann et al. 2005). A small molecule IGF1R kinase inhibitor NVP-AEW541 induced radiosensitisation in the PTEN wild-type DU145 and 22RV1 CaP cell lines but not in the PTEN-deficient PC-3 CaP cell line and NVP-AEW541- induced radiosensitisation coincided with down-regulation of p-Akt levels and high levels of residual DSBs (Isebaert, Swinnen et al. 2011).

AEE788, a dual TKI of both EGFR and vascular endothelial growth factor receptor (VEGFR), provides an avenue to investigate the effect of simultaneous blockade of EGFR and VEGFR in cancer cells (Traxler, Allegrini et al. 2004). It 54

was reported that combination of AEE788 with RT can enhance treatment efficacy in DU145 CaP s.c model but not in PC-3 s.c model (Huamani, Willey et al. 2008). C225 (cetuximab) is a chimeric human-mouse IgG1 MAb and an EGFR inhibitor. Wagner et al. demonstrated that C225 MAb augments the radiation killing of DU145 CaP cells in vitro, and inhibits the growth of implanted DU145 tumours and increases the efficacy of RT in vivo via a combination of cytostatic, necrotic and apoptotic mechanisms (Wagener, Zhang et al. 2008). The C225 MAb was further demonstrated to increase the radiosensitivity of DU145 cells through anti-proliferative effect, inhibition of clonal growth, G0/G1 phase arrest, apoptosis induction, and inhibition of EGFR-signalling pathways by the down-regulation of MAPK activation (Liu, Wang et al. 2010).

Matsubara et al. demonstrated that restoration of fibroblast growth factor receptor 2IIIb (FGFR2IIIb) to PC-3 cells enhanced their sensitivity to irradiation through acceleration of apoptosis and cell cycle arrest (Matsubara, Teishima et al. 2008). Timke et al. showed that the combined VEGF (SU5416) and PDGF (SU6668) receptor tyrosine kinase can improve the RT effect in PC-3 s.c animal model in vivo (Timke, Zieher et al. 2008). Imatinib mesylate (Gleevec, STI571) is a TKI. It was reported that STI571 inhibited IR-induced RelB nuclear translocation, leading to increased radiosensitivity in aggressive androgen-nonresponsive PC-3 and DU145 CaP cells (Xu, Fang et al. 2010). Sunitinib, a potent inhibitor of several TKIs, has demonstrated both anti-tumour and anti-angiogenic activity. Preclinical biochemical and cellular assay studies tested its activity against different kinases and proved it to be a potent inhibitor of all three members of the VEGFR family, both platelet-derived growth factor receptor (PDGFR) α and β, C-KIT, and Fms- like tyrosine kinase-3 (FLT3) (Motzer, Hoosen et al. 2006). Brooks et al. found that Sunitinib modestly enhances the radiosensitivity of androgen-nonresponsive DU145 and PC-3 CaP cells, respectively but does not sensitise the androgen- responsive LNCaP cells (Brooks, Sheu et al. 2012), however Sunitinib and RT do not interact directly to radiosensitise the PC-3 tumour cells in vivo (Brooks, Sheu et al. 2012).

1.4.3 Gene therapies

Several studies have demonstrated that the function of the p53 gene is one of the major determinants of intrinsic cellular sensitivity to the cytotoxic effects of IR. IR can induce p53 protein production, which can then result in either cell cycle arrest or apoptosis (Kastan, Canman et al. 1995). Colletier et al. demonstrated that adenoviral-mediated p53 (adv-p53) transgene expression sensitises human p53 wild-type LNCaP and p53 null PC-3 CaP cells to IR in vitro and the radiosensitisation is independent of p53 status (Colletier, Ashoori et al. 2000). It was reported that the combination of IR and wild-type p53 gene (Ad5CMV-p53) gene therapy resulted in remarkable synergistic effects in human CaP cells in vitro (Sasaki, Shirakawa et al. 2001). Kaliberov et al. reported that the human VEGF promoter element-AdVEGF-sKDR could radiosensitise CaP cells in vitro and in vivo (Kaliberov, Kaliberova et al. 2005). Anai et al. developed PC-3-Bcl2 and PC-3-Neo s.c xenograft modes and found that the combination of adenoviral vector-expressed PTEN (AdPTEN) and RT significantly inhibits xenograft tumour growth by the induction of apoptosis, inhibition of angiogenesis and cellular proliferation (Anai, Goodison et al. 2006). Forced over-expression of PTEN has been shown in vitro and in vivo to down-regulate Bcl-2, increase apoptosis, inhibit angiogenesis, and most importantly sensitise Bcl-2 over- expressing CaP cells to the killing effects of radiation (Anai, Goodison et al. 2006). These data indicate that gene therapy is a useful approach to increase the radiosensitivity in CaP radiation treatment.

1.4.4 Antisense therapies

Antisense (AS) therapy is another option for increasing radiosensitivity. Mu et al. found that AS-MDM2 sensitises CaP cells not only to ADT or RT given individually, but also to combination of ADT and RT in vitro, makes this strategy ideal for the men with high-risk CaP (Mu, Hachem et al. 2004). Stoyanova et al reported that AS-MDM2 sensitised LNCaP CaP cells to ADT or RT, and combination of ADT and RT in vivo (Stoyanova, Hachem et al. 2007). Truman et al. found that treatment of LNCaP, CWR22-RV1, PC-3, and DU145 CaP cells 56

with AS-ataxia telangiectasia mutated (ATM) oligonucleotides can reduce cellular ATM levels, which sensitises human CaP cells to radiation-induced apoptosis (Truman, Gueven et al. 2005). Teimourian et al. demonstrate that AS-Hsp27 cDNA can reduce Hsp27 expression and significantly radiosensitise DU145 CaP cells in vitro (Teimourian, Jalal et al. 2006).

AS-Bcl-2 oligodeoxynucleotide (ASODN) reagents have been shown to be effective in reducing Bcl-2 expression in a number of systems. Anai et al. demonstrated that combination of Bcl2-ASODN with IR sensitises both PC-3- Bcl-2 and PC-3-Neo CaP cells to the killing effects of radiation in vitro and enhances radiation effect in two xenograft models in vivo (Anai, Goodison et al. 2007). E2F1 and MDM2 are two key proteins that promote apoptosis through common and independent apoptotic pathways. Both AS-MDM2 and adenoviral- mediated E2F1 (Ad-E2F1) combined with RT can significantly increase CaP cell death when exposed to RT and that this effect occurs regardless of AR and p53 status (Udayakumar, Hachem et al. 2008). They further demonstrated that Ad- E2F1 over-expression sensitised LNCaP and PC-3 CaP cells to RT in vivo (Udayakumar, Hachem et al. 2008).

1.4.5 Histone deacetylase inhibitors (HDACIs)

HDACIs are promising radiosensitisers. Chinnaiyan et al. demonstrated that the suberoylanilide hydroxamic acid (SAHA) can enhance radiation-induced cytotoxicity in DU145 CaP cells in vitro via inhibiting PI3K/Akt signalling pathway (Chinnaiyan, Vallabhaneni et al. 2005). Konsoula et al. found that that H6CAHA (an adamantyl-hydroxamate histone deacetylase inhibitor) enhances the in vitro and in vivo sensitivity of CaP cells to RT while protecting normal cells from radiation-induced damage through modulating DNA damage repair processes (Konsoula, Cao et al. 2011). Chen et al. showed that valproic acid (VPA) at low concentrations has minimal cytotoxic effects and can significantly increase radiation-induced apoptosis in CaP cell line in vitro and an animal model in vivo via a specific p53 acetylation and its mitochondrial-based pathway (Chen, Wong et al. 2011). 57

LBH589 (panobinostat) is another popular HDACI, a hydroxamic acid derivative and a novel pan-HDACI (Prince, Bishton et al. 2009). Our recently results indicate that LBH589 inhibited PC-3 and LNCaP CaP cell proliferation in a time- and-dose-dependent manner; low-dose of LBH589 (IC20) combined with RT greatly improved efficiency of cell killing in CaP cells; compared to RT alone, the combination treatment of LBH589 and RT induced more apoptosis and led to a steady increase of sub-G1 population and abolishment of RT-induced G2/M arrest, increased and persistent DSBs, less activation of Ku70/Ku80 and a panel of cell cycle related proteins (Xiao, Graham et al. 2012). These data suggest that HDACIs are very promising radiosensitisers for future clinical trials for CaP therapy.

1.4.6 Natural products

(-)-Gossypol, a natural polyphenol product from cotton seed, has recently been identified as a small-molecule inhibitor of both Bcl-2 and Bcl-xL and potently induces apoptosis in several cancer cell lines (Kitada, Leone et al. 2003, Zhang, Liu et al. 2003). Studies indicated that (-)-Gossypol can radiosensitise PC-3 CaP cells in vitro and PC-3 s.c model in vivo without augmenting toxicity, suggesting that (-)-Gossypol combined with RT represents a promising novel anti-cancer regime for molecular targeted therapy of hormone-refractory CaP with Bcl-2/Bcl- xL over-expression (Xu, Yang et al. 2005). Parthenolide is a major active component of the herbal medicine feverfew (Tanacetum parthenium), and has been shown to inhibit growth or induce apoptosis in a number of tumour cell lines (Zhang, Ong et al. 2004, Kim, Liu et al. 2005). It was reported that the radiosensitisation effect of parthenolide in CaP cells was mediated by NF-B inhibition and enhanced by the presence of PTEN (Sun, St Clair et al. 2007). Romero et al. demonstrated that Trabectedin (ET-743), a natural product derived from the marine tunicate Ectenascidia turbinate, has significant in vitro radiosensitizing effect and induces cell cycle changes and apoptosis in several human cancer cell lines including DU145 CaP cell line (Romero, Zapata et al. 2008). 58

A dehydroxymethyl derivative of epoxyquinomicin (DHMEQ) was from a natural product and is a novel and potent NF-kB inhibitor (Matsumoto, Ariga et al. 2000). Kozakai et al. reported that DHMEQ enhanced the therapeutic effect of radiation in CaP cells in vitro and in a s.c PC-3 animal mode in vivo via inhibiting NF-kB binding activity (Kozakai, Kikuchi et al. 2012). Chiu et al. showed that IR combined with MP (isolated from Monascus pilosus M93-fermented rice) increases the therapeutic efficacy compared to individual treatments in PC-3 CaP cells in vitro, and induces autophagy, ER stress and enhanced DNA damage primarily via inhibition of the Akt/mTOR signalling pathways (Chiu, Fang et al. 2012). This combination treatment also demonstrated anti-tumour growth effects in a PC-3 xenograft nude mouse model (Chiu, Fang et al. 2012).

1.4.7 Other novel agents

Hydroxymethylacylfulvene (HMAF, Irofulven, MGI 114) is a novel agent with alkylating activity and a potent inducer of apoptosis. The combination of HMAF with radiation can reduce the radiation dose needed for the same level of clonogenic survival up to 2.5-fold and induce more apoptosis compared with any single treatment alone in CaP cell lines in vitro (Woynarowska, Roberts et al. 2000). Genistein is an isoflavone, a major metabolite of soy produced by the intestinal bacteria, which is believed to be one of the anti-cancer agents found in soybeans (Knight and Eden 1996). Hillman et al. demonstrated that genistein combined with radiation inhibits DNA synthesis, resulting in inhibition of cell division and growth, and potentiates radiation effect on PC-3 CaP cells (Hillman, Forman et al. 2001). In the following study, they found that the mechanism of increased cell death by genistein and radiation is proposed to occur via inhibition of NF-B, leading to altered expression of regulatory cell cycle proteins such as cyclin B and/or p21WAF1/Cip1, thus promoting G2/M arrest and increased radiosensitivity in PC-3 CaP cells (Raffoul, Wang et al. 2006). They also showed that this combination treatment caused a significantly greater inhibition of primary tumour growth (87%) in a PC-3 orthotopic model compared with genistein (30%) or radiation (73%) alone, and prevented lymph node metastasis (Hillman, Wang et 59

al. 2004). However, it was discovered that pure genistein causes increased spontaneous metastasis to lymph nodes when given as a single modality (Hillman, Wang et al. 2004, Wang, Raffoul et al. 2006). These findings indicate that genistein promotes metastatic spread from the primary tumour to regional lymph nodes via the lymphatic system.

Soy isoflavones (genistein, daidzein and glycitein) as soy pills of similar composition are used in human interventions but not pure genistein. One study found that the combination of soy isoflavones with IR potentiates radiation- induced cell killing in PC-3 cells in vitro, enhances control of primary CaP growth and metastasis in vivo (Raffoul, Banerjee et al. 2007). However, treatment with soy isoflavones did not increase lymph node metastasis in CaP orthotopic animal model (Raffoul, Banerjee et al. 2007), suggesting that soy isoflavones is more suitable for future clinical trials and has potential to improve CaP radiosensitivity. They also confirmed that the molecular mechanism of radiosensitizaton by soy isoflavones is through down-regulation of apurinic/apyrimidinic endonuclease 1/redox factor-1 expression using CaP cell line in vitro and a CaP animal model in vivo (Raffoul, Banerjee et al. 2007). Algur et al. reported that the combined use of zoledronic acid and RT shows enhanced in vitro cytotoxicity for C4-2B CaP cell line compared with each treatment alone (Algur, Macklis et al. 2005). It was found that MG-132 enhances radiosensitivity in PC-3 CaP cells in vitro with concomitant NF-B inhibition (Warren, Grimes et al. 2006).

β-lapachone (β-lap) is a bioreductive anti-cancer drug. Suzuki et al. demonstrated the synergistic effects of RT and β-lap in DU145 CaP cells in vitro with two distinct mechanisms: first, radiation sensitises cells to β-lap by up-regulating NAD(P)H:quinone oxidoreductase 1 (NQO1), and second, β-lap sensitises cells to radiation by inhibiting sublethal radiation damage (SLD) repair (Suzuki, Amano et al. 2006). Nitric oxide donating NSAIDs are novel pharmaceutical agents which were developed to allow NSAIDs to be better tolerated due to their associated gastro-protection. Stewart et al. demonstrated that NSAID radiosensitises PC-3 sphere (CaP epithelial cells) but not prostate stromal cells in vitro and possible mechanisms for this effect could be the enhanced formation and 60

reduced repair of radiation-induced DNA strand breaks and inhibition of the RR hypoxia response (Stewart, Nanda et al. 2011). Chiu et al. recently demonstrated that IR combined with arsenic trioxide (ATO) increases the therapeutic efficacy compared to individual treatments in LNCaP and PC-3 CaP cells, induces autophagy and apoptosis in LNCaP cells, and mainly induces autophagy in PC-3 cells through inhibition of the Akt/mTOR signalling pathways (Chiu, Chen et al. 2012). This combination treatment also demonstrated anti-tumour growth effects in a PC-3 xenograft nude mouse model (Chiu, Chen et al. 2012).

1.5 Targeting PI3K/Akt/mTOR pathway to overcome CaP radioresistance

The PI3K/Akt/mTOR pathway regulates cell growth and proliferation and is often dysregulated in cancer due to mutation, amplification, deletion, methylation and post-translational modifications. This pathway is an intracellular signalling pathway important for apoptosis, malignant transformation, tumour progression, metastasis and radioresistance (Chang, Graham et al. 2013, Ni, Cozzi et al. 2013). PTEN is a negative regulator of PI3K/Ak/mTOR pathway (Chang, Graham et al. 2014). Due to the important role of the PI3K/Akt/mTOR pathway in cancer research, many valuable inhibitors targeting one signalling node (single inhibitor) or two nodes at the same time (dual inhibitor) in the pathway have been developed in recent years. In the last decade, significant progress has been made in developing combination therapy with PI3K/Akt/mTOR inhibitor (as radiosensitisers) and RT to overcome CaP radioresistance in preclinical studies.

The PI3K/Akt/mTOR signalling pathway plays an important role in CaP radioresistance. Currently, numerous small molecular drugs that target single PI3K, Akt or mTOR signalling proteins (single inhibitor) or target both PI3K and mTOR signalling proteins at the same time (dual inhibitor) have been developed for preclinical studies and clinical trials for cancer treatments. The ability of molecular targeting the various drivers of PI3K/AKT/mTOR pathway activation allows reversal of resistance to upstream therapy, such as anti-EGFR treatment and other RTK-targeted therapies. In this section, I only focus on combination of a PI3K/Akt/mTOR inhibitor with RT in the treatment of CaP in preclinical 61

studies. The different inhibitors targeting different PI3K/Akt/mTOR pathway proteins are shown in Figure 1-8. The approaches using combination of different pathway inhibitors with RT in preclinical studies are summarised in Table 1-3.

Figure 1-8 Overview of the PI3K/Akt/mTOR pathway inhibitor targets All the listed single or dual pathway inhibitors have been used in preclinical studies as radiosensitisers.

Table 1-3 Pre-clinical studies on combination of RT and PI3K/Akt/mTOR pathway inhibitors in CaP

Agent Target Manufacturer RT Experimental Model Reference Class I (Gottschalk, Doan et LY294002 Cell Signalling 2,4,6 Gy LNCaP PI3K al. 2005) Class I 2,5,10 Gy, single (Rudner, Ruiner et LY294002 Cell Signalling PC-3, DU145, LNCaP PI3K dose al. 2010) Wortmannin Class I Sigma-Aldrich and LC 2,4,6,8 Gy, single (Karve, Werner et al. PC-3 nanoparticles PI3K laboratories dose 2012) Class I (Rosenzweig, Wortmannin Sigma Chemical Co 2Gy PC-3, DU145 PI3K Youmell et al. 1997) Class I PC-3RR, DU145RR, (Chang, Graham et BKM120 Selleck Chemicals 6Gy PI3K LNCaPRR al. 2014) Max Planck Institute of 2,5,10 Gy, single (Rudner, Ruiner et Erufosine Akt PC-3, DU145, LNCaP Biophysical Chemistry dose al. 2010) (Ishiyama, Wang et Perifosine Akt Selleck Chemicals 2,4,6,8 Gy CWR22RV1 al. 2013) 2,4,6,8 Gy CWR22RV1 (Gao, Ishiyama et al. Perifosine Akt Selleck Chemicals 10 Gy in 2 fractions CWR22RV1 s.c. 2011) Palomid 529 Akt Paloma Pharmaceuticals 2,4,8 Gy PC-3 (Diaz, Nguewa et al.

6 Gy, single dose PC-3 s.c. 2009) LNCaP, 22RV1, DU145, 2,4,6 Gy (Gravina, Marampon Palomid 529 Akt Paloma Pharmaceuticals PC-3, LAPC-4, C4-2B 4 Gy, single dose et al. 2014) PC-3, 22RV1, s.c. 177Lu-RM2: 1850kBq 177Lu-RM2: 36, PC-3 (Dumont, Tamma et Rapamycin mTOR Sigma-Aldrich 72,144MBq in 6 PC-3 s.c. al. 2013) fractions PC-3RR, DU145RR, (Chang, Graham et Rapamycin mTOR Selleck Chemicals 6Gy LNCaPRR al. 2014) Rapamycin, (Schiewer, Den et al. mTOR Calbiochem 2,4,6,8 Gy LNCaP, C4-2, LAPC-4 temsirolimus 2012) RAD001 (Cao, Subhawong et mTOR Novartis Pharmaceutical 5 Gy, single dose DU145, PC-3 (Everolimus) al. 2006) PI3K, PC-3-RR, DU145-RR, (Chang, Graham et NVP-BEZ235 Cayman 2 Gy, single dose mTOR LNCaP-RR al. 2013) 2,4,6 Gy, hypoxia (Potiron, PI3K, PC-3, DU145 NVP-BEZ235 Novartis Pharmaceutical 12 Gy in 3 fractions, Abderrhamani et al. mTOR PC-3 s.c. hypoxia 2013)

PI3K, NVP-BEZ235 Novartis Pharmaceutical 2,4,8 Gy PC-3 (Zhu, Fu et al. 2013) mTOR PI3K, PC-3RR, DU145RR, (Chang, Graham et NVP-BEZ235 Cayman Chemical 6Gy mTOR LNCaPRR al. 2014) PI3K, PC-3RR, DU145RR, (Chang, Graham et PI103 Cayman Chemical 6Gy mTOR LNCaPRR al. 2014)

1.5.1 PI3K inhibitors

LY294002 and wortmannin are both well-studied PI3K inhibitors. While LY294002 is a reversible pan-PI3K inhibitor, wortmannin acts irreversibly. LY294002 is the first synthetic molecule known to inhibit PI3α/β/δ and also blocks autophagosome formation. LY294002 resulted in cell-cycle arrest of LNCaP CaP cells and sensitised the cell line to IR through inactivation of PKB (Gottschalk, Doan et al. 2005). It was also reported that the combination of LY294002 and radiation resulted in significant and synergistic reduction in clonogenicity and growth delay, and has a synergistic enhancement effect in bladder cancer cell lines (Gupta, Cerniglia et al. 2003). However, Kim reported that LY294002 did not affect the radiosensitisation in human prostate epithelial 267B1/KRas cells (Kim, Kim et al. 2005), suggesting that the radiosensitisation effect of this inhibitor depends on cell type.

Wortmannin, a microbial product, is another potent irreversible pan-PI3K inhibitor. It displays a similar potency in vitro for the class I, II, and III PI3K members although it can also inhibit other PI3K-related enzymes such as mTOR, DNA-PK, some phosphatidylinositol 4-kinases, myosin light chain kinase (MLCK) and MAPK at high concentrations (Vanhaesebroeck, Leevers et al. 2001). This inhibitor could induce apoptosis and radiosensitise DU145 CaP cells (Lin, Adam et al. 1999, Seol, Lee et al. 2005). Rosenzweig reported that the radiosensitivity was significantly increased in wortmannin-treat PC-3 and DU145 CaP cells due to inhibition of cellular DNA-PK (Rosenzweig, Youmell et al. 1997). Unfortunately, in vivo use of both, LY294002 and wortmannin, has accompanied with adverse effects. LY294002 lacked favorable pharmacological properties and had many off-target effects (Prawettongsopon, Asawakarn et al. 2009). It was reported that LY294002 could cause severe respiratory depression and lethargy in mice (Gupta, Cerniglia et al. 2003), and wortmannin has been ruled out for a viable drug target due to its chemical instability and toxic side effects (Howes, Chiang et al. 2007).

NVP-BKM120 (BKM120), a 2, 6-dimorpholino pyrimidine derivative, is a novel, potent, and highly selective pan-class I PI3K inhibitor. In preclinical studies it has been shown to be active in suppressing proliferation and inducing apoptosis of cancer cell lines and in inhibiting the growth of human tumour xenografts in mice at tolerated doses (Koul, Fu et al. 2012, Maira, Pecchi et al. 2012). Abazeed et al reported that BKM120 both decreased NRF2 protein levels and sensitised NFE2L2 or KEAP1-mutant squamous cell lung cancer cells to radiation and the resulting analysis identified pathways implicated in cell survival, genotoxic stress, detoxification, and innate and adaptive immunity as key correlates of radiation sensitivity (Abazeed, Adams et al. 2013). Our data showed that BKM120 can sensitise CaP-RR cells developed in our lab (Chang, Graham et al. 2014). Phase I clinical trials showed that BKM120 was well tolerated (Rodon, Brana et al. 2014) and showed preliminary activity in patients with advanced tumours while phase II and III clinical trials are still ongoing. BKM120 was completed in phase I clinical trial in metastatic breast cancer now but the study result has not been reported yet (NCT01248494).

Aside from pan-PI3K single inhibitors with relatively high incident of adverse effects, an alternative strategy is targeting specific PI3K p110 isoforms because of the different roles they play in the tumour development, which might lead to improved side effect profile. For example, p110β is necessary for tumourigenesis driven by PTEN loss that is associated with aggressive and RR characteristics of advanced CaP (Lee, Poulogiannis et al. 2010), to this end, a very novel p110β inhibitor GSK2636771 is in Phase I/IIa clinical trial now (NCT01458067). Given the high prevalence of PTEN loss in CaP, isoform-specific inhibitors may be promising in targeting PI3K and treating CaP to overcome radioresistance.

Moreover, to the best of our knowledge, there has been no report about combination therapy of PI3K inhibitors and radiation in CaP management in clinical trials yet. Given our preliminary data that BKM120 sensitises CaP cells in vitro, it also provides us with a guideline for development of new therapeutic strategies.

1.5.2 Akt inhibitors

As a major regulator of the PI3K pathway, Akt is a target for radiosensitisation. P529 is a novel and potent Akt inhibitor without in vivo toxicity (Xue, Hopkins et al. 2008). Diaz et al. reported that P529 combined with RT could increase radiosensitivity in PC-3 CaP cells in vitro compared to RT alone, and retard tumour growth in a PC-3 xenograft animal model (Diaz, Nguewa et al. 2009). It was also demonstrated that P529 combined with RT induced more apoptosis and DNA DSBs resulting in cellular radiosensitisation and growth delay of PC-3 and 22RV1 s.c tumour xenografts. The radiosensitizing properties of P529 were partially linked to delayed DSB repair, partially to GSK-3β, cyclin-D1, and c-myc modulation with associated inhibition of CRM1-mediated nuclear export of survivin. Importantly, autophagy and tumour senescence were also involved (Gravina, Marampon et al. 2014). Moreover, besides Akt, P529 also targeted pathways involving VEGF, Id-1, MMP-9, MMP-2, and Bcl-2/Bax (Gravina, Marampon et al. 2014). The ability to act at different pathway levels makes this compound a promising agent that might limit the possible tumour escaping routes. A new compound erucylphospho-N,N,N-trimethylpropanolamine (erufosine, ErPC3) is an Akt inhibitor with the cytotoxic action and was synthesised by H. Eibl, Max Planck Institute of Biophysical Chemistry (Goettingen, Germany). It was reported that combination of ErPC3 with RT can induce higher levels of radiation-induced apoptotic cell death in PC-3, DU145 and LNCaP CaP cells compared with the individual treatment (Rudner, Ruiner et al. 2010).

Perifosine is an orally applicable alkylphosphocholine analogue which is an effective Akt inhibitor with antitumourigenic activity and radiosensitising properties in preclinical models (Vink, Lagerwerf et al. 2006). There is one completed clinical trial study to investigate perifosine in treating patients with metastatic, androgen-independent CaP but the study result has not reported yet (NCT00060437).

Based on its favourable properties, this drug is considered to be a promising candidate for combination therapy with RT (Belka, Jendrossek et al. 2004). Gao 68

et al reported that perifosine enhances radiosensitivity in CWR22RV1 CaP cell line, as well as in s.c mouse models in vivo, and p-Akt was suppressed in the treatment process (Gao, Ishiyama et al. 2011). These data provided us a strong support for further development of combination therapy in clinical studies. The results of several Phase II clinical trials of perifosine failed to show significant therapeutic response in the management of CaP when used as a single agent (Posadas, Gulley et al. 2005, Chee, Longmate et al. 2007). However, in a Phase I study where one advanced CaP patient was recruited, Vink et al reported that the CaP patient achieved a partial response with a combination therapy of perifosine and fractionated EBRT (Vink, Schellens et al. 2006), and overall it was well tolerated by patients at a dose of up to 150mg/kg orally. Other potential targets of perifosine in radiosensitisation may include stimulation of SAP/JNK pathway and inhibition of the MAPK/ERK pathway (Zhou, Lu et al. 1996). At this time, further studies need to be done to confirm other pathways involved in the antitumour effect of combined perifosine and radiation treatment of CaP. All data present indicate that Akt inhibitors are promising in combination therapies to enhance radiosensitivity in CaP treatment.

1.5.3 mTOR inhibitors

MTOR is an established therapeutic target and proof of principle that PI3K pathway can be successfully targeted for clinical use in CaP has been demonstrated by the development of rapamycin analogs that inhibit mTORC1 kinase (Sun 2013). Rapamycin (sirolimus) is an immunosuppressive macrocylic lactone produced by Streptpmyces hygroscopicus. It was originally used to prevent organ transplant rejection. However, since the important role of mTOR was discovered in the process of tumourigensis and tumour progression, rapamycin has been investigated as a tumour suppressive agent. Rapamycin binds to immunophilin, FKBP-12, to generate an immunosuppressive complex which is able to inhibit mTOR and the G1 to S phase transition (Heavey, O'Byrne et al. 2014). The capability in alteration on cell cycle of rapamycin suggests its potential role in radiosensitivity. Schiewer et al. demonstrated that mTOR is a selective effector of the RT response in AR-positive CaP, and mTOR inhibitors 69

(sirolimus and temsirolimus) exhibit schedule-dependent effects on the RT response in CaP cells and confer significant radiosensitisation effects when used in the adjuvant setting (Schiewer, Den et al. 2012). Dumont et al reported that combination of rapamycin treatment with 37 MBq of 177Lu-RM2 led to significantly longer survival than with either agent alone (Dumont, Tamma et al. 2013), making it a great candidate for improving the efficacy of RT whilst decreasing the dosage to prevent adverse effects of RT.

RAD001, also known as everolimus, is a derivative of sirolimus with a similar mechanism as an mTOR inhibitor, inhibiting mTORC1 while exerting no effect on mTORC2. Cao et al tested the ability of RAD001 to enhance the effects of radiation on two CaP cell lines, PC-3 and DU145, and found that both cell lines became more vulnerable to irradiation after treatment with RAD001, with the PTEN-deficient PC-3 cell line showing greater sensitivity (Cao, Subhawong et al. 2006). A phase I study of RAD001 and docetaxel in patients with castration- resistant CaP showed that five of 12 evaluable patients experienced a PSA reduction more than or equal 50% (Courtney, Manola et al. 2015). Another phase I study using RAD001 in treating patients with progressive metastatic CaP has been completed but the study report has not been posted yet (NCT00085566).

Following the pre-clinical studies and early-stage investigation of these mTOR inhibitors in clinical trials, there was a certain level of disappointment, regarding both drug tolerance and clinical outcomes. Both rapamycin and RAD001, along with other tacrolimus, are associated with severe side effects such as dyslipidemia, lung toxicity, and renal toxicity since they are originally used as immunosuppressant (Zaza, Granata et al. 2014). Ridaforolimus is a novel non- drug analog of rapamycin, and Phase I trial in patients with advanced CaP showed that this drug is generally well-tolerated and has a boasted potent anti-tumour ability (Amato, Wilding et al. 2012), indicating it holds promise for combination therapy with RT in the future.

Our recent observation also indicated that the radiosensitisation effect in single mTOR inhibitor (rapamycin) is less effective than that in the combination with 70

dual PI3K/mTOR inhibitors (BEZ235 or PI103) in CaP in vitro (Chang, Graham et al. 2014). One reason could be that dual PI3K/mTOR inhibitors have a broader efficacy across more genotypes with pro-apoptotic effects identified in a wider range of cell lineages compared with agents targeting only one component of the pathway (Serra, Markman et al. 2008, Wallin, Edgar et al. 2011). Another possible reason for dual PI3K/mTOR inhibitors inducing more radiosensitivity could be that dual inhibitors of PI3K and mTOR target the active sites of both holoenzymes, inhibiting the pathway both upstream and downstream of Akt, thus avoiding the problem of Akt activation following abolition of the mTORC1-S6K- IRS1 negative feedback loop, which is known to occur with single mTOR inhibitors (Serra, Markman et al. 2008).

1.5.4 Dual PI3K/Akt/mTOR inhibitors

With the further investigation of PI3K/Akt/mTOR inhibitors in CaP combination therapy, dual inhibitors, such as BEZ235, PI103 and GDC-0980 are being paid more and more attention by researchers. Here, I only discuss the combination of dual PI3K/mTOR inhibitors with RT in CaP therapy (Table 1-3).

BEZ235 is a novel antitumour drug developed by Novartis Pharma, which functions as a dual PI3K/mTOR inhibitor (Maira, Stauffer et al. 2008). It has been shown to inhibit both PI3K (all four isoforms) and mTORC1/2, with increasing efficacy at halting PI3K pathway. BEZ235 displayed a statistically significant antitumour activity against PC-3M tumour xenografts and could avoid PI3K pathway reactivation (Maira, Stauffer et al. 2008). It was reported that BEZ235 induced cell death in a PTEN-independent manner, and selectively induced apoptotic cell death in the CaP cell line DU145, which harbors wild-type PTEN; however, in the PC-3 cell line, which is PTEN-null, treatment with BEZ235 resulted in autophagic cell death (Hong, Shin et al. 2014). Moreover, BEZ235 can lead to a decrease in the population of CD133+/CD44+ CaP progenitor cells in vivo, suggesting its great potency in suppressing CSC to overcome radioresistance (Dubrovska, Elliott et al. 2010). Potiron et al investigated the radiosensitisation of BEZ235 in in vitro and in vivo using two CaP cell lines, PC-3 (PTEN(-/-)) and 71

DU145 (PTEN(+/+)) under normoxic and hypoxic conditions and found that BEZ235 radiosensitised both cell lines under normoxia and hypoxia in vitro and enhanced the efficacy of RT on PC-3 xenograft tumours in mice without inducing intestinal radiotoxicity (Potiron, Abderrhamani et al. 2013). Zhu et al also demonstrated that BEZ235 prominently improved the radiosensitivity of PC-3 CaP cells and sensitised tumour cells to irradiation via interruption of cell cycle progression and augmentation of cell apoptosis (Zhu, Fu et al. 2013). We have recently tested the combination treatment with BEZ235 and RT in CaP-RR (PC- 3RR, DU145RR and LNCaPRR) cells and found that this combination can reduce the expression of p-Akt, p-mTOR, p-S6K and p-4EBP1 as well as EMT and CSC phenotypes, at the same time, greatly increase radiosensitivity and induce more apoptosis compared with single BEZ235 or RT treatment alone, indicating that BEZ235 could enhance radiosensitivity and overcome radioresistance in CaP-RR cells (Chang, Graham et al. 2013). In our following study, we further confirmed that the mechanisms of radiosensitisation with this combination are associated with altering cell cycle distribution, reducing autophagy, suppressing non- homologous end joining (NHEJ) and homologous recombination (HR) repair pathways (Chang, Graham et al. 2014).

BEZ235 was the first PI3K/mTOR inhibitor to enter clinical trials in 2006, and since then there have been 17 ongoing or completed clinical trials mainly combined with chemotherapy towards advanced solid tumours. From several Phase I studies, the orally administered drug was well tolerated and exerted strong antitumour activities. The preclinical results support that BEZ235 combined with RT holds promise for future clinical trials to overcome CaP radioresistance.

PI103 is another multi-targeted PI3K and mTOR inhibitor which showed anti- proliferation activity against a range of human cancer cell lines in vitro as well as anti-tumour activity against tumour xenografts (Guillard, Clarke et al. 2009). Remko Prevo et al reported that PI103 reduced radiation survival of tumour cells with Akt activation and combination treatment of PI103 with radiation enhances the G2/M delay and increased radiosensitivity (Prevo, Deutsch et al. 2008). PI103 potently inhibited proliferation and invasion of PC-3 CaP cells in vitro and 72

exhibited therapeutic activity at well-tolerated doses (<15% weight loss) in a number of human tumour models including PC-3 prostate model. The recent findings from our team demonstrated that this dual PI3K/mTOR inhibitor has a similar radiosensitivity effect on CaP-RR cells as BEZ235, including altering cell cycle distribution, inducing apoptosis and reducing autophagy (Chang, Graham et al. 2014). Although PI103 has not been evaluated in the clinical trial due to poor ‘drug-like’ properties, it has served as a lead compound for other PI3K and mTOR selective inhibitors such as GDC-0941 (Folkes, Ahmadi et al. 2008). The investigation of the effects of combination of BEZ235 or PI103 with RT in CaP- RR xenograft models is underway in our laboratory.

Currently, the dual PI3K/Akt/mTOR inhibitors have not been extensively used for combination with RT in CaP therapy. The mechanisms of the dual inhibitors as radiosensitisers are still unclear. In the future research, more efforts should be put in understanding how these new developed dual inhibitors improve radiosensitivity and reduce radiation dose to minimise the adverse effects.

Most of combination therapy studies with PI3K/Akt/mTOR inhibitors and RT have been focused on preclinical studies and only very limited clinical trials were reported using such combination approach. Several side effects (including dysgeusia, hypercholesterolemia, hypertriglyceridemia, thrombocytopenia, neutropenia, thrombosis, dyspnea related to pulmonary embolus and fatigue) have been reported in cancer patients when PI3K or mTOR inhibitors (RAD001 or temsirolimus) were combined with radiation therapy (Sarkaria, Galanis et al. 2010, Ma, Galanis et al. 2014). Based on these preliminary observations, better therapeutic effects might be achieved by the optimization of the dosages of the PI3K/Akt/mTOR inhibitors and radiation.

1.6 Proteomic studies of RR biomarkers for CaP RT

Based on my previous discussion, understanding the mechanisms of radioresistance and identification of RR biomarkers are very important for the improvement of RT. A biomarker is a characteristic that is objectively measured 73

and evaluated as an indicator of normal biological processes, pathogenic processes or pharmacological responses (Naylor 2003). The identification of cancer RR biomarkers allows the potential of either selecting alternative treatment modalities or, at least, planning RT in combination with specific radiosensitiser agents to avoid the side-effects. If the biomarkers associated with an individual cancer patient can be identified and potential targets for radio-sensitization are found and further validated, it will achieve more favourable therapeutic outcomes in clinics. Therefore, studying RR biomarker is important for predicting the tumour radiosensitivity, planning the best treatment strategy and developing personalised medicine in cancer RT.

Due to the key roles of protein functions, proteomics has been the principal technology for the study of global expression of proteins (biomarkers) in the post- genomic era. It can be applied to cells, tissues or biological fluids, and offer the opportunity to revolutionise biomarker discovery and the development of future medicine. Although genomic and transcriptomic approaches have been applied to study cancer radioresistance, the results do not best reflect the whole protein profiles which are the major functional substance in cancer cells (Lacombe, Azria et al. 2013). Proteomic approaches have not only enabled the identification of thousands of differentially expressed proteins in the complex mixtures of disease and normal samples but also ushered the capability of discriminating disease subtypes/aggressiveness that are not recognised by traditional methods.

Advances in proteomics, especially in mass spectrometry (MS) have rapidly changed our knowledge of biomarker proteins which have simultaneously led to the identification and quantification of thousands of unique proteins and peptides in a complex biological fluid or cell lysate (Yates, Ruse et al. 2009). In association with liquid chromatography or other fractionation techniques, this technique provides molecular information that cannot be gained from gel-based techniques alone such as analysing proteins with extreme molecular mass/pI, targeting poorly abundant peptides and proteins, addressing post-translational modifications (PTMs) (Wolff, Otto et al. 2006). MS, coupled with technologies for sample fractionation and automated data analysis, provides a platform to 74

identify protein expression differences associated with cancer radioresistance in complex biological samples (Van Riper, de Jong et al. 2013). Proteomic technology presents the benefit that it can develop the whole proteome of RR cancer cells, reflect the functions of proteins, establish biomarker interconnection, and discover predictive therapeutic proteins (Kulasingam and Diamandis 2008). Therefore, proteomic techniques offer an ideal platform for identification and quantification of novel RR proteins in predicting therapeutic outcome, identifying potential therapeutic targets and developing individualised treatment regimen to overcome radioresistance.

In this section, I will focus on MS-based proteomic techniques in RR cancer biomarker discovery, summarise RR cancer biomarkers identified by proteomic techniques and explore their potential values for future clinical trials.

1.6.1 MS-based proteomics techniques in cancer RR biomarker discovery and validation

During the past few years, accumulating number of MS proteomics studies have been applied to identify potential biomarkers associated with cancer radioresistance. These proteomics techniques consist of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS), isobaric tags for relative and absolute quantitation (iTRAQ), LC-MS/MS, multiple reaction monitoring (MRM) as well as Sequential Window Acquisition of all THeoretical Mass Spectra (SWATH-MS). Here, I discuss the five selected MS proteomics techniques in discovery and validation of cancer RR biomarkers.

1.6.1.1 MALDI-TOF-MS

MALDI-TOF-MS is a vaporization and ionization method in a single step, normally applied to analyse relatively simple protein mixtures. The sample is mixed with a solution of an appropriate matrix and allowed to co-crystallise directly on special sample plates (Caprioli, Farmer et al. 1997). This technology is an useful and effective approach for screening peptide masses of tryptic digests 75

because of requiring relatively less intense sample preparation and facilitating data interpretation with showing on peak in spectrum. It is a high throughput technology and can be used to identify protein or peptide profiles. It is very suitable for screening studies.

MALDI-TOF-MS has been used in a number of studies for the diagnosis and treatment of human cancers including prostate (Jeong, Kim et al. 2012, Nakayama, Inoue et al. 2014), breast (Heger, Rodrigo et al. 2014, Yang, Zhu et al. 2014), lung (Chang, Graham et al. 2013) and other cancers (Padoan, Seraglia et al. 2013, Roman, Lunde et al. 2013). Two-dimensional gel electrophoresis (2DE) coupled to MALDI-TOF-MS is frequently applied for comparative proteome analysis in the discovery of biomarkers (Kocevar, Hudler et al. 2013). Zhong et al used 2DE combined with MALDI-TOF-MS to isolate and identify membrane proteins in PANC-1 pancreatic cancer cells (Zhong, Cui et al. 2015). However, only a few studies were reported to utilise the MALDI-TOF-MS approach to identify and verify RR biomarkers in cancers. Liang et al found the interaction sites between 1,2,5-selenadiazole and the model peptide of redox enzyme thioredoxin reductase (TrxR) by MALDI-TOF-MS, clearly demonstrating TrxR as a potential target for therapy of human RR melanoma cancer (Liang, Zheng et al. 2014). Wei et al used 2DE combined with MALDI-TOF-MS to identify differentially expression proteins (DEPs) related to radioresistance or multiple drug resistance (MDR) using human lung adenocarcinoma (HLA) A549 cells and cisplatin-resistant A549/DDP cells after irradiation, in order to evaluate whether the MDR can elevate radioresistance (Wei, Zhang et al. 2012). In this study, 27 DEPs were identified between A549 and A549/DDP cells and functionally divided into 6 categories composed of metabolic enzymes, signal transduction, detoxification or translation, chaperones, cellular structure proteins, calcium-binding proteins (Wei, Zhang et al. 2012). Among these identified proteins, 4 DEPs including HSPB1, Vimentin, Cofilin and Annexin A4 were further validated in A549 and A549/DDP cells and lung adenocarcinoma tissue by western blotting (WB) and IHC, respectively. The results further confirmed that these 4 DEPs were associated with MDR as well as radioresistance and were potential biomarkers for predicting HLA response to MDR and radioresistance. In 76

another study, using 2DE combined with MALDI-TOF-MS approach, Li et al demonstrated that Prx-1 could be used a potential therapeutic target for enhancing the tumour response to radiation (Li, Xie et al. 2015).

The advantages of MALDI-TOF-MS are that it is automated, very fast with high sensitivity and low cost. This technique is multidimensional and gives absolute mass measurements and works well with large polypeptides (>30 kDa). The disadvantages of MALDI-TOF-MS are that sometimes ions may collisionally relax and this is problematic for MALDI analysis along with finding matrices to work with samples. It is sensitive to contaminants such as salts therefore reproducibility of results may be a problem. In addition, the real protein markers cannot be identified using this technique. As modern MS techniques are emerging, this technique is much less used for biomarker discovery in cancers including RR biomarkers.

1.6.1.2 iTRAQ iTRAQ technology is a shotgun based quantitation technique and also referred to as bottom up approach which allows the concurrent identification and relative quantification of hundreds of proteins in up to 8 different biological samples in a single experiment. Digested samples are labeled with the 8-plex iTRAQ reagents (113, 114, 115, 116, 117, 119, 120, 121) and the sample is pooled and prepared for MS/MS (Ross, Huang et al. 2004). iTRAQ based quantitative proteomics is a promising approach for global comparison of protein expression in relatively small amounts of samples. This labeling strategy ensures no loss of information from samples involving PTMs such as the scrutiny of signal transduction pathways that often involve phosphorylation phenomena (Zieske 2006). In addition, the multiplexing capacity of these reagents allows for information replication within certain LC-MS/MS experimental regimes, providing additional statistical validation within any given experiment. Cai et al identified 54 proteins with differential expression in nasopharyngeal carcinoma (NPC) and the adjacent non-tumour tissue by iTRAQ coupled with two-dimensional LC-MS/MS, and these identified proteins were further validated by reverse transcription 77

polymerase chain reaction (RT-PCR) and WB in NPC tissues compared to normal nasopharyngeal tissues (Cai, Zeng et al. 2015). iTRAQ is ideally suited for biomarker discovery as it provides both relative quantification and multiplexing in a single experiment and has been applied to the analysis of clinical samples (Rehman, Evans et al. 2012, Kristjansdottir, Levan et al. 2013) and in vitro study (Abdi, Quinn et al. 2006). In one study, it was used to investigate the RR biomarkers in BC cell lines (MCF7/MCF7RR, MB-231/MDA- MB-231RR, and T47D/T47DRR) where 40 potential biomarkers were identified (Smith, Qutob et al. 2009). One novel protein-26S proteasome was further validated in BC tissues for the prediction of BC radioresistance (Smith, Qutob et al. 2009). Using iTRAQ, another study reported that up-regulation of the NHEJ pathway which is critical for DNA repair of irradiated cells is involved in radioresistance of hypoxic epithelial carcinoma cells A431 cells (Ren, Hao et al. 2013). In addition, iTRAQ coupled with LC-MS/MS was performed to investigate the middle infrared triggered molecular mechanisms in BC cells (Chang, Li et al. 2015). This technique is useful for identifying and quantifying proteins across diverse molecular weight (MW) and pI ranges, functional categories, cellular locations and abundances. However, the disadvantages of this technique are that it is very time consuming, extremely laborious and very expensive.

1.6.1.3 LC-MS/MS

LC-MS/MS (LC-based separation techniques directly coupled to automated MS/MS) strategies offer high-throughput analyses resulting in the acquisition of hundreds of thousands of MS/MS fragmentation spectra in a single experiment (Angel, Aryal et al. 2012). The label-free LC-MS/MS method provides protein quantification by comparing MS measurements of different samples. Label-free quantification through spectral counting is based on the principle that highly abundant peptides will generate a higher number of MS/MS spectra (Abdallah, Dumas-Gaudot et al. 2012). It is a powerful technique that can be sensitively and selectively performed in many applications such as protein profiling in human cancers (He, Hu et al. 2015, Scumaci, Tamme et al. 2015). The LC-MS/MS 78

approach was applied to analyse global proteins present in BC cell lines T47D and T47DRR, and a total of 586 and 652 proteins were identified in T47D and T47DRR cells, respectively (Smith, Qutob et al. 2009). This approach was also performed to investigate the underlying molecular mechanisms for gemcitabine resistance in pancreatic cancer (Kim, Han et al. 2014). In this study, total 1931 proteins were identified and 787 differentially expressed proteins were quantified in the pancreatic cancer cell lines BxPC3, PANC-1, and HPDE (Kim, Han et al. 2014). Zeng et al. performed a global lung cancer serum biomarker discovery study using LC-MS/MS in a set of pooled non-small cell lung carcinoma (NSCLC) sera and matched controls, and identified 49 differentially abundant candidate proteins (Zeng, Hood et al. 2011). Yang et al. showed that using LC- MS/MS method, 265 distinct glycoproteins were confidently identified in urinary samples obtained from bladder cancer patients, providing novel biomarkers for the early detection (Yang, Feng et al. 2011).

The LC-MS/MS approach has been recently applied to investigate human cancer radioresistance (Gorchs, Hellevik et al. 2015). In one study, a total of 36 differentially expressed proteins were identified from RR and radiosensitive (control) astrocytoma patients using two-dimensional (2D)-LC-MS/MS approach and two markers-cofilin-1 and phosphoglycerate kinase 1 were found to be significantly up-regulated in RR astrocytomas (Yan, Yang et al. 2012), indicating these markers are associated with astrocytoma radioresistance and have potential to be used as therapeutic targets. Our results showed that totally 309 signalling pathway proteins were identified to be significantly different between CaP-RR (PC-3RR, DU145RR and LNCaPRR) and parental CaP (PC-3, DU145 and LNCaP) cells using the label-free LC-MS/MS method. Nineteen of them are overlapped among three paired CaP cell lines and associated with CaP metastasis, progression, and radioresistance. The work flow of LC-MS/MS proteomics technique for CaP-RR biomarker discovery and validation of identified potential biomarkers is shown in Figure 1-9.

LC-MS/MS has seen enormous growth in clinical laboratories in last 10-15 years because it offers analytical specificity superior to that of immunoassays or high 79

performance liquid chromatography (HPLC) for low MW analytes. However, as large amounts of information are obtained, it is time consuming to analyse. It may not be suited for routine clinical analysis. LC-MS/MS is not suited for the separation of larger molecules and analytes covering a broad range of size and hydrophobicity.

Figure 1-9 The work flow of LC-MS/MS proteomics technique for CaP-RR biomarker discovery and validation

CaP RR and CaP parental control cells were prepared for protein extraction and analysed by LC-MS/MS. After quantification and filtering, the potential CaP-RR biomarker candidates identified were validated on CaP-RR cell lines and CaP-RR animal xenograft tissues using WB and IHC staining, respectively.

1.6.1.4 MRM

MRM (also called selected reaction monitoring) is a highly specific and sensitive label-free technique for quantifying targeted protein/peptides abundances in complex biological samples. It refers to a tandem MS scan mode that is coupled with triple quadrupole or hybrid quad/trap MS instrumentation; both types of instrumentation work very similar in terms of their ion cycling and singular release of a m/z at any one time point over the entire m/z range, therefore it is able 80

to select predefined ions for analysis. It has commonly been used for the analysis of small molecules. The MRM proteomics technology allows for targeted analysis of proteins of interest while all other proteins are filtered out. It is a promising method used in tandem MS for protein quantitation and validation in a wide variety of clinical samples (Lehtio and De Petris 2010, Picotti and Aebersold 2012).

Guo et al developed MRM-based approach, together with the use of isotope- coded ATP-affinity probes and conducted differential kinome analysis of MCF- 7/WT (wild type) human BC cells and the corresponding RR MCF-7/C6 cells (Xiao, Guo et al. 2014, Guo, Xiao et al. 2015). With this method, 24 and 13 of the quantified kinases were significantly up- and down-regulated in MCF-7/C6 compared to MCF-7/WT cells, respectively. In addition, key kinase modulators involved in ERK (25), Toll-like receptor (TLR) (10), and ErbB (8) pathways were successfully quantified (Guo, Xiao et al. 2015). MRM can test a large number of potential biomarkers and is a suitable method instead of other validation approaches such as WB, IHC, etc. (Schaaij-Visser, Brakenhoff et al. 2010). Ren et al used LC-MS/MS-MRM as well as WB to confirm the up-regulation of Ku70/Ku80 dimer DNA repair, glycolysis, integrin, glycoprotein turnover and STAT1 pathways perturbed by hypoxia in A431 epithelial carcinoma cells (Ren, Hao et al. 2013), demonstrating that the MRM results were consistent with their previous iTRAQ results and that hypoxia induced several biological processes involved in tumour migration and radioresistance.

MRM technology has the potential to supplant enzyme-linked immunosorbent assay (ELISA) and other immunoassays for biomarker verification as the time and cost of designing MRM assays is far less than that for the traditional methods that employ antibodies. MRM also becomes possible to probe for several predicted phosphopeptides from a known protein sequence. This differs significantly from other MS techniques for identifying phosphopeptides (Cox, Zhong et al. 2005). However, MRM also has some limitations. Like many immunoglobulin sequences, the proteins may be too short and variable to produce candidates (Anderson and Hunter 2006). Another disadvantage is that genetic variants in the 81

selected peptide may prevent the determination by MRM (Anderson and Hunter 2006).

1.6.1.5 SWATH-MS

SWATH-MS is an emerging proteomic approach in which data are acquired on a fast, high resolution Q-orbitrap or tripleTOF mass spectrometer by repeatedly cycling through sequential isolation windows over the whole chromatographic elution range (Gillet, Navarro et al. 2012). It provides multiplexed quantitative MS/MS information for all peptides ionising in a sample in an unbiased manner and then uses spectral libraries to interrogate these spectra for identification and quantification of apriori peptides. This approach allows rapid and higher throughput verification and validation of marker candidates from samples, and provides complementary evaluation of the protein profile. In comparison to the data dependent acquisition (DDA) method, SWATH-MS is based on a data independent acquisition (DIA) mode and it outperformed the DDA method in its quantification ability and less signal variation; additionally the number of quantified peptide is markedly increased (Vowinckel, Capuano et al. 2013). SWATH-MS method features both the global screening capabilities of discovery based proteomics, and the sensitivity of SRM by activating all peptides eluting in real time within the predefined windows and multiplexed recording of all fragment ions. This new technique has been successfully applied for the identification of biomarkers for aggressive CaPs using clinical tumour tissues, by searching against established glycoprotein maps (Liu, Chen et al. 2014). In this study, 2 biomarkers out of 220 differentially expressed glycoproteins were discovered and further validated to be associated with aggressive CaP (Liu, Chen et al. 2014). This finding may assist in stratifying CaP and avoiding overtreatment of non-aggressive CaP. In another study, by combining shotgun discovery proteomics-iTRAQ with SWATH-MS, Zhang et al found that over-expression of CD109 is significantly associated with NSCLC (Zhang, Lin et al. 2014). All the findings support this new technique is promising for identification and validation of RR cancer biomarkers in the future study.

1.6.2 RR biomarkers in cancers

Many potential RR cancer biomarkers have been identified by different proteomics approaches. These identified markers encompass a variety of roles including cell cycle, DNA repair, metabolism, signal transduction. In this section, I focus on discussing discovery of RR biomarkers in cancer cell lines by different proteomic approaches and validation of identified potential biomarkers by WB or IHC. The RR biomarkers identified by proteomics in different cancers are summarised in Table 1-4.

Table 1-4 Putative RR biomarkers identified in four cancers by proteomics approaches

Validation Putative biomarker Source Radiation dose Proteomics method References method 14-3-3σ(↓), Maspin (↓), total 11 Gy (single (Feng, Yi et al. NPC cell line CNE2 2DE WB and IHC GRP78 (↑), dose) 2010) Mn-SOD (↑) total 13 Gy (single (Zhang, Qu et al. HSP27(↑) NPC cell line CNE1 2DE/ MALDI-TOF WB dose) 2012) IHC, shRNA ERp29(↑) NPC tissues from assay and (Wu, Zhang et al. total 70 Gy 2DE/ MALDI-TOF patients flow 2012) cytometry Nm23 H1(↑), total 64 Gy (4 Gy/ (Li, Huang et al. NPC cell line CNE2 2DE/ MALDI-TOF WB Annexin A3(↓) 16 times for 1 year) 2013) Gp96(↑), Grp78(↑), Oral epidermoid RT-PCR and HSP60(↑), carcinoma cell line KB, total 60 Gy (2 Gy/ xenografted (Lin, Chang et al. 2DE/ MALDI-TOF Rab40B(↑), tongue squamous cell per time) mouse 2010) GDF-15 (↑), carcinoma cell line SAS, tumour study

annexin V(↓) gingival epidermoid carcinoma cell line OECM1 total 60 Gy (2 Gy Laryngeal cancer cell per fraction, two (Kim, Chang et CLIC1(↓) 2DE/ MALDI-TOF WB and IHC line Hep-2 times per week for al. 2010) 15 wk). total 100 Gy 2-D DIGE/ MALDI- HNSCC cell lines FaDu Rac1(↑) (10 Gy ten times TOF/TOF WB and SCC25 every two weeks) NM23-H1(↑), HNSCC cell lines QLL1, total 60 Gy (2 Gy/ (Lee, Park et al. MALDI-TOF WB PA2G4(↑) SCC15 and SCC25 per time) 2013) total 60 Gy (2 (Wang, Tamae et Peroxiredoxin II(↑) BC cell line MCF-7 Gy/five times per 2DE/MS WB al. 2005) week for 6 weeks) the S26S total 40 Gy (2 Gy/ 2DE/MS , BC cell lines MCF-7, (Smith, Qutob et proteasome(↓), per week for 20 LC-MS-MS and WB and IHC MDA-MB-231and T47D al. 2009) GRP78(↓) weeks) quantitative iTRAQ CTSD (↑), GSN (↑), BC cell line MDA-MB- SILAC-based (Kim, Jung et al. total 10 Gy WB MRC2 (↑) 231 quantitative 2015)

proteomics total 30 Gy (2 Gy/ (Guo, Xiao et al. Chk1(↑), CDK1(↑), LC−MRM BC cell lines MCF-7 five times per week WB 2015) CDK2(↑) for 3 weeks) NME1(↑), HSPA8(↑), (Skvortsova, CaP cell lines PC-3, total 10Gy (2Gy APEX1(↑), PAI- 2DIGE/MALDI-TOF WB Skvortsov et al. DU145 and LNCaP for 5 days) RBP1 (↑) 2008) CaP cell lines PC-3, total 10Gy (2Gy Unpublished ALDOA(↑) LC-MS/MS WB and IHC DU145 and LNCaP for 5 days) results HSPB1 (↑), Annexin A4 (↑), Lung cancer cell line 2-DE/ MALDI-TOF- (Wei, Zhang et total 6Gy WB and IHC Cofilin l (↑), A549 MS al. 2012) Vimentin (↑) (Gorchs, ATP (↑), Lung cancer cells derived single 18Gy or 2Gy WB and LC-MS/MS Hellevik et al. HMGB-1(↑) from patients for 4 times ELISA 2015) a total dose of 62.4 (Huang, Ding et α1-AT (↑) Lung cancer specimen 2DE and LC-MS/MS ELISA to 68.0 Gy al. 2013) Notes: ↑ indicates increased expression. ↓ indicates decreased expression. indicates the samples from human tissues. WB: western blotting; IHC: immunohistochemistry.

1.6.2.1 Head and Neck cancer (HNC)

HNC is a cancer that starts in the lip, oral cavity (mouth), nasal cavity (inside the nose), paranasal sinuses, pharynx, and larynx, 90% of which is HNSCC (Marur and Forastiere 2008). HNSCC is the sixth leading cancer by incidence worldwide and eighth by death (Parfenov, Pedamallu et al. 2014). The five-year survival rate of patients with HNSCC is around 40-50%. Despite RT is the effectively main treatment for HNC, radioresistance causes tumour recurrence and remains an unsolved problem (Bauman, Michel et al. 2012). Thus, identifying specific biomarkers associated with radioresistance will help improve treatment outcome in HNC patients.

Currently, most of reported proteomics-based RR biomarker studies are in HNC. Several proteomics studies related to NPC radioresistance have recently been reported (Feng, Yi et al. 2010, Wu, Zhang et al. 2012). Feng et al first established a RR subclone cell line (CNE2-RR) derived from NPC cell line CNE2 by fractioned radiation treatment and compared the protein expression profiles of CNE2-RR and CNE2 cell lines by 2DE method (Feng, Yi et al. 2010). They found that total 34 differential proteins were identified to have significant differences. Among them, 14-3-3σ and Maspin were down-regulated while GRP78 and Mn-SOD were up-regulated in the CNE2-RR cells compared with CNE2 cells, which was confirmed by WB and IHC performed on 39 RR and 51 radiosensitive human NPC tumour biopsies. In the following functional study, up- regulation of 14-3-3σ restored the radiosensitivity of the CNE2-RR cell line, indicating that down-regulation of 14-3-3σ could play an important role in the development of NPC radioresistance (Feng, Yi et al. 2010). Zhang et al reported the differential proteins in NPC using CNE1-RR and CNE1 cell lines by 2DE/MALDI-TOF-MS approach (Zhang, Qu et al. 2012). They found that 13 differential proteins were detected, and HSP27, as one of up-regulated proteins in CNE1-RR cells, was further investigated by several experiments. It was reported that 88 NPC patients including 42 RR and 46 radiosensitive patients who were treated by curative-intent RT (a total dose of 70 Gy) using a modified linear 87

accelerator were recruited (Wu, Zhang et al. 2012). NPC RR tissues were compared with radiosensitive tissues using 2DE/MALDI-TOF method and 12 differential proteins were identified to be involved in radioresistance. ERp29 was found to be significantly up-regulated in NPC RR tissues and further investigated by IHC, small hairpin RNA (shRNA) assay, and flow cytometry. Li et al also reported that 16 DEPs were identified in NPC CNE2-RR cell line compared to CNE2 cell line by 2DE/MALDI-TOF analysis, demonstrating among the identified proteins, Nm23 H1 was significantly increased while Annexin A3 was significantly down-regulated in CNE2-RR cells (Li, Huang et al. 2013).

Proteomic studies on radioresistance were also reported in other HNCs. Lin et al studied three RR HNC cell lines including KB cell line (an oral epidermoid carcinoma), SAS cell line (tongue squamous cell carcinoma) and OECM1 cell line (gingival epidermoid carcinoma) compared to their parental cell lines by 2DE/MALDI-TOF (Lin, Chang et al. 2010), and found that 64 proteins were identified to be potentially associated with radioresistance which were involved in several cellular pathways including regulation of stimulus response, cell apoptosis, and glycolysis (Lin, Chang et al. 2010). Among the identified proteins, Gp96, Grp78, HSP60, Rab40B, and GDF-15 were up-regulated while annexin V was down-regulated in RR HNC cell lines. Further investigation showed that Gp96-siRNA (small interfering RNA) transfectants displayed a radiation-induced growth delay, reduction in colonogenic survival, increased cellular reactive oxygen species (ROS) levels and proportion of the cells in the G2/M phase (Lin, Chang et al. 2010). Xenograft mice administered with combination of Gp96- siRNA and RT showed significantly enhanced tumour growth suppression in comparison with RT alone (Lin, Chang et al. 2010).

To identify the DEPs in RR laryngeal cancer, HEp-2-RR and HEp-2 cell lines were compared by 2DE/MALDI-TOF and 16 proteins showed significantly altered expression levels (Kim, Chang et al. 2010). Among the identified markers, the potential marker-chloride intracellular channel 1 (CLIC1) was found to be associated with laryngeal cancer radioresistance via inhibition of ROS production in the functional study (Kim, Chang et al. 2010). Skvortsov et al used 2D 88

fluorescence difference gel electrophoresis (2D-DIGE) followed by MALDI- TOF-MS to investigate differential proteins between HNSCC RR cell lines (FaDuRR and SCC25RR) and its parental cell lines (FaDu and SCC25) and found 45 proteins were modulated in FaDuRR and SCC25RR cells compared to parental cells, which were closely related to cell migration regulated by Rac1 protein, indicating that Rac1 protein could be considered as a new therapeutic target using RR HNSCC treatment (Skvortsov, Jimenez et al. 2011). Lee et al identified 51 proteins with commonly altered expression in HNSCC RR cell lines (QLL1, SCC15 and SCC25) using the 2D SDS-PAGE proteomics approach, 18 of which were cancer-related proteins (Lee, Park et al. 2013). Among these identified cancer markers, the NM23-H1 protein was further validated in HNSCC RR cell lines by WB with increased expression, suggesting that this marker is a reliable predictor of RR oral cancer (Lee, Park et al. 2013).

All these studies support that many proteins (biomarkers) are associated with HNC radioresistance and these proteins have potential for predicting RT response and improving HNC response to RT in clinics.

1.6.2.2 Breast cancer

BC is the most prevalent malignancy in women and the second leading cause of cancer-related deaths in developed countries. RT is widely used as a part of a tri- modal treatment with chemotherapy and surgery; however, approximately 50% of BC patients have experienced malignant microfoci scattered throughout the breast tissue that can easily progress to metastatic BC (Holland, Veling et al. 1985). Radioresistance has been identified as a factor that limits the effectiveness of RT in the treatment of BC. Therefore, discovery of RR biomarkers is important for BC RT.

Wang et al first identified 100 DEPs involved in BC radioresistance by comparing RR MCF+FIR3 and radiosensitive MCF+FIS4 BC cell lines using 2DE/MS method (Wang, Tamae et al. 2005). Among the identified potential proteins, peroxiredoxin II (PrxII) which plays an important role in the redox process was 89

found to have 4 fold increase in MCF+FIR3 RR cells compared with MCF+FIS4 radiosensitive cells. KD of PrxII using siRNA could improve radiosensitivity while over-expression of PrxII resulted in BC radioresistance, indicating that ROS is critical for BC radioresistance and that stress-induced over-expression of PrxII increased radioresistance via protection of cancer cells from radiation-induced oxidative damage (Wang, Tamae et al. 2005). Another study also compared three BC RR cell lines (MCF7RR, MDA-MB-231RR and T47DRR) with their parental cell lines using three proteomics methods including 2DE/MS, LC-MS-MS and iTRAQ to identify predictive biomarkers of radioresistance (Smith, Qutob et al. 2009). In 2DE/MS analysis, 50 proteins were identified with significant differences in one or more BC cell lines. LC-MS/MS approach was used as a complementary approach to 2DE/MS for the analysis of all proteins present in T47D and T47DRR cells, showing overall, 242 unique proteins were identified in T47D cells and 310 unique proteins were identified in T47DRR cells. In quantitative iTRAQ, 40 proteins were detected and showed quantitatively different expression levels between these three RR cell lines and parental cell lines. However, there were very few overlapping identified proteins from the data produced through the 2DE/MS, LC–MS/MS and iTRAQ approaches, suggesting different proteomic techniques have different advantages. Among the identified proteins, both 26S and GRP78 markers were found to be down-regulated in all RR cell lines compared with their parental cell lines by WB (Smith, Qutob et al. 2009). Using the stable isotope labelling by amino acids in cell culture (SILAC)- based proteomic analysis, Kim et al investigated the cytosolic proteins produced by irradiated MDA-MB-231 BC cells treated with a single or fractionated 10 Gy dose of 137Cs γ-radiation and found a number of tumour-derived factors (CTSD, GSN, and MRC2) were up-regulated, indicating that these enhanced factors are promising targets for modulation of the immune response during radiation treatment (Kim, Jung et al. 2015). In a recent study, Guo et al assessed the global kinome of RR MCF-7/C6 and their parental MCF-7 BC cell lines by LC-MRM method, and found that 24 and 13 of the quantified kinases were significantly up- and down-regulated in MCF-7/C6 relative to the parental MCF-7 cells, respectively. In addition, the checkpoint kinase (Chk) 1, cyclin-dependent kinases (CDK) 1 and 2 were found to be over-expressed in RR MCF-7/C6 cells, which 90

were further validated by WB (Guo, Xiao et al. 2015), suggesting that DNA repair and cell cycle mechanisms are involved in BC radioresistance.

All findings from BC radioresistance studies may provide new potential targets to sensitise radiation as well as biomarkers to predict radiation sensitivity in human BCs. However, the shortcoming for all three studies is that no identified markers have been validated in human RR BC tissue samples to evaluate their clinical values.

1.6.2.3 CaP

CaP is the most common cancer in men in Western countries. RT is a standard treatment option for both organ-confined and regionally advanced CaP. Despite more and more effective advances in radiation delivery procedures, about 50% CaP patients undergoing RT suffer from relapse (recurrence) within 5 years of treatment (Khuntia, Reddy et al. 2004). Radioresistance is a major challenge for the current CaP RT. A personalised treatment approach is urgently needed allowing patients unlikely to benefit from conventional RT to be directed towards hypofractionated RT (Anwar, Weinberg et al. 2014) or other therapeutic options. The identification of CaP-RR biomarkers allows the potential of either selecting alternative treatment modalities or, at least, planning RT in combination with specific radiosensitising agents, avoiding the side effects.

Using 2D-DIGE/MALDI-TOF approaches, Skvortsova et al compared the protein differences with three CaP-RR cell lines (PC3-RR, DU145-RR and LNCaP-RR) and their parental cells to examine the mechanisms involved in CaP radioresistance (Skvortsova, Skvortsov et al. 2008). In this study, 27 proteins, which were associated with the regulation of intracellular pathways for cell survival, motility, mutagenesis and DNA repair, were found to express differently between three RR and their paretal cell lines. Five proteins including NME1, HSPA8, APEX1, PAI-RBP1 and RAB11A showed the most significantly different expression and were further confirmed in CaP-RR cell lines by WB. Furthermore, as a DNA repair associated enzyme, KD of APEX1 could 91

significantly increase radiosensitivity in CaP. In our recent study, using three established CaP-RR cell lines (PC-3RR, DU145RR and LNCaPRR), we successfully identified 19 protein differences involved in CaP radioresistance using a label-free LC-MS/MS proteomic technique. In addition, one selected important protein Aldolase A, Fructose-Bisphosphate (ALDOA) was further validated in CaP-RR cell lines and PC-3RR s.c xenografts by WB and IHC (see Chapter 4), respectively. Furthermore, the ALDOA was functionally verified in CaP-RR cells using siRNA KD for increasing radiosensitivity. These findings indicate that multiple mechanisms regulate radioresistance and targeting identified potential biomarkers may serve as a tool to overcome CaP radioresistance and improve the prognosis of CaP patients with RT.

1.6.2.4 Lung cancer

Lung cancer is a major globe health problem for men and women. The main primary types of lung cancer are small-cell lung carcinoma (SCLC) and NSCLC. RT is an important adjuvant therapy for curative intent in NSCLC patients who are not eligible for surgery. However, NSCLC commonly develops resistance to radiation. Discovery of potential RR biomarkers for prediction and therapeutic purpose is increasingly important for NSCLC.

It was reported that 2DE combined with MALDI-TOF-MS was used to identify DEPs related to radioresistance or MDR using HLA A549 cells and cisplatin- resistant A549/DDP cells after irradiation, in order to evaluate whether the MDR can elevate the radioresistance (Wei, Zhang et al. 2012). Additionally, proteomic analyses of the secretome by LC-MS/MS identified a total yield of 978 proteins, comparison of irradiated and non-irradiated cancer-associated fibroblasts (CAFs) derived from NSCLC patients, of which 261 had relevant inflammatory or immunomodulatory functions in irradiated CAFs (Gorchs, Hellevik et al. 2015).

To find whether potential serum biomarkers with chemoradiotherapy (CRT) sensitivity can predict clinical outcome upon treatment in NSCLC, Huang et al analysed the proteins in sera (sensitive group vs CRT resistant group) by 2DE and 92

LC-MS/MS, respectively (Huang, Ding et al. 2013) and demonstrated that 6 proteins were identified in CRT resistant group and Alpha-1-antitrypsin (α1-AT), as one of them, was further validated by ELISA, indicating that the potential biomarkers detected by the proteomic approaches can predict the outcome of treatment in NSCLC patients.

1.7 Summary of literature review

Radioresistance affects radiation efficacy, results in metastasis and recurrence, and limits longevity of CaP patients. Therefore, investigation of the mechanisms of CaP radioresistance is very urgent. Several signalling pathways have been identified to berelated to CaP radioresistance and among them, the PI3K/Ak/mTOR pathway is mostly investigated. I have reviewed the mechanisms of PI3K/Akt/mTOR pathway involved in CaP radioresistance as well as metastasis. I have also discussed the roles of autophagy, EMT as well as CSCs in CaP radioresistance. To improve radiation sensitization, different agents have been examined in CaP radioresistance and I have summarised these radiosensitisers. During my research, I found the activation of the PI3K/Akt/mTOR pathway plays an important role in CaP radioresistance, and I discussed the inhibitors targeting PI3K/Akt/mTOR pathway that could overcome radioresistance in CaP. Meawhile, as the novel proteomic methods can be used to identify the potential biomarkers, proteomics approaches that have been applied to investigate different RR cancers and the identified RR biomarkers have also been summarised.

1.8 Thesis aims

Investigating the mechanisms of CaP radioresistance and discovery of potential novel radiosensitisers or predicative biomarkers are critically important for overcoming CaP radioresiantance. As discussed in the literature review (Section 1.3, 1.5 and 1.6), the PI3K/Akt/mTOR pathway plays a pivotal role in CaP radioresistance and inhibiting this pathway may provide a promising modality for the treatment of CaP to overcome radioresistance. Thus, the studies in this thesis 93

aimed to: 1) investigate the role and association of EMT, CSCs and the PI3K/Akt/mTOR signalling pathway in CaP radioresistace (Chapter 3); 2) identify candidate proteins and the main signalling pathways involved in CaP radioresistance using LC-MS/MS technique, validate the identified potential proteins in CaP-RR cell lines and CaP-RR animal xenografts, and perform functional study for one selected potential marker (Chapter 4); 3) investigate the therapeutic potential of the combination therapy with dual PI3K/mTOR inhibitors (BEZ235 or PI103) or single PI3K/mTOR inhibitors (Rapamycin or BKM120) and RT in CaP-RR cell lines (Chapter 5); 4) investigate the therapeutic potential of the combination therapy with dual PI3K/mTOR inhibitor BEZ235 and RT in CaP-RR xenograft mouse models (Chapter 6).

2. General materials and methods

2.1 Ethical approval

All animal experiments were approved by the Animal Care and Ethics Committee (ACEC), University of New South Wales (UNSW) (13/118B).

2.2 Materials

2.2.1 Preparation of media and buffers

All water used in this project to prepare media and buffers was deionised and filtered using the Milli-RO 12 Plus water purification system (Merck-Millipore, VIC, Australia).

Dulbecco’s phosphate buffered saline (DPBS) was prepared according to manufacturer’s instructions (Invitrogen Australia Pty Ltd, VIC, Australia), followed by filtration by Stericup® & SteritopTM vacuum-driven filtration systems (0.22µm) (Millipore Co, MA, USA) and storage at 4°C for use.

All cell cultural media, fetal bovine serum (FBS) and penicillin-streptomycin were purchased from Invitrogen Australia Pty Ltd (VIC, Australia) unless otherwise stated.

Cell culture media RPMI 1640 used in this project were supplemented with 10% (v/v) heat-inactivated FBS, 50 U/mL of penicillin and 50 µg/mL of streptomycin. Keratinocyte Serum Free Medium (K-SFM) medium was supplemented with 0.05 mg/mL bovine pituitary extract and 5ng/mL human recombinant epidermal growth factor (EGF).

10 x Tris Buffer Saline (TBS) stock was prepared as follows: 30.2 g Tris was dissolved in 500 mL Milli Q water, and pH was adjusted to 7.6 with concentrated HCl and the prepared buffer was stored at 4°C.

Cell freezing media consist of 20% (v/v) FBS and 20% dimethyl sulfoxide (DMSO) (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia) and was prepared in the appropriate media for each cell line using an aseptic technique.

Protein extraction buffer consist of 50 mmol/L Tris-HCl (pH 8.0), 150 mmol/L

NaCl, 0.1% SDS, 10 mmol/L NaF, 1 mmol/L Na3VO4, 0.5% sodium deoxycholate and 1% Triton X-100.

2.2.2 Cell lines

In the current studies, androgen responsive (LNCaP) and androgen nonresponsive (PC-3 and DU145) metastatic CaP cell lines derived from different origins as well as human normal prostate cell line RWPE-1 were used. PC-3RR, DU145RR, LNCaPRR and PC-3RR-luc cell lines were generated from parental PC-3, DU145, LNCaP and PC-3-luc cell lines using fractioned radiation, respectively (see Chapter 2.3.4). PC-3-luc cell line was generated from PC-3 by transduction (Tiffen, Bailey et al. 2010) and kindly provided by Centenary Institute of Cancer, University of Sydney. Detailed information of each cell line is listed in Table 2-1.

PC-3: an androgen-non-responsive CaP cell line, derived from bone metastasis of a 62-year-old Caucasian male prostate adenocarcinoma patient, was purchased from American Type Culture Collection (ATCC) (ATCC® CRL-1435™) and maintained in RPMI-1640 medium supplemented with 10% (volume per volume (v/v)) heat-inactivated FBS, 50 U/mL of penicillin and 50 µg/mL of streptomycin;

DU145: an androgen-non-responsive CaP cell line, derived from brain metastasis of a 69-year-old Caucasian male prostate adenocarcinoma patient, was purchased from ATCC (ATCC® HTB-81™) and maintained in RPMI-1640 medium supplemented with 10% (v/v) heat-inactivated FBS, 50 U/mL of penicillin and 50 µg/mL of streptomycin;

LNCaP: an androgen-responsive CaP cell line, derived from left supraclavicular lymph node metastasis of a 50-year-old Caucasian male prostate adenocarcinoma patient, was purchased from ATCC (ATCC® CRL-1740™) and maintained in RPMI-1640 medium supplemented with 10% (v/v) heat-inactivated FBS, 50 U/mL of penicillin and 50 µg/mL of streptomycin;

RWPE-1: an immortalised normal prostate epithelial cell line. It was purchased from ATCC (ATCC® CRL-11609™), and was cultured in K-SFM supplemented with 0.05 mg/mL bovine pituitary extract and 5 ng/mL human recombinant EGF.

Table 2-1 Characteristics of all cell lines used in this thesis

Androgen Cell lins Site of origin Source Culture media responsiveness PC-3 Bone (human) ATCC N RPMI1640 DU145 Brain (human) ATCC N RPMI1640 LNCaP Lymph node ATCC R RPMI1640 K-SFM plus 0.05 mg/mL Normal adult human RWPE-1 ATCC N/A bovine pituitary extract and 5 prostate ng/mL human EGF. PC-3 subline PC-3RR Developed by our group N RPMI1640 (radiation resistance) DU145 subline DU145RR Developed by our group N RPMI1640 (radiation resistance) LNCaP subline LNCaPRR Developed by our group R RPMI1640 (radiation resistance) Kindly provided by Centenary PC-3-luc PC-3 subline Institute of Cancer, University of N RPMI1640 Sydney PC-3RR-luc PC-3 subline Developed by our group N RPMI1640 Notes: N: androgen non-responsive; R: androgen responsive; N/A: not applicable 99

2.2.3 Antibodies

Antibodies were obtained from different sources and the detailsfor all antibodies are listed below:

Mouse anti-human CD44 antibody (MAb, Santa Cruz Biotechnology, Catalogue Number (Cat No.) sc-7297)

Mouse anti-human CD44V6 antibody (MAb, Abcam, Cat No. ab78960)

Rabbit anti-human CD326 antibody (polyclonal antibody (PAb), Abcam, Cat No. ab71916)

Rabbit anti-human Akt antibody (PAb, Abcam, Cat No. ab8805)

Rabbit anti-human p-Akt antibody (PAb, Abcam, Cat No. ab ab38449)

Rabbit anti-human mTOR antibody (MAb, Cell Signaling Technologies, Cat No. 2983)

Rabbit anti-human p-mTOR antibody (MAb, Cell Signaling Technologies, Cat No. 2971)

Rabbit anti-human 4EBP1 antibody (MAb, Cell Signaling Technologies, Cat No. 9452)

Rabbit anti-human p-4EBP1 antibody (MAb, Cell Signaling Technologies, Cat No. 2855)

Rabbit anti-human S6K antibody (MAb, Abcam, Cat No. ab32359)

Rabbit anti-human p-S6K antibody (MAb, Abcam, Cat No. ab32525) 100

Rabbit anti-human E-cadherin antibody (MAb, Abcam, Cat No. ab40772)

Rabbit anti-human N-cadherin antibody (MAb, Abcam, Cat No. ab18203)

Rabbit anti-human Vimentin antibody (MAb, Abcam, Cat No. ab92547)

Rabbit anti-human OCT 4 antibody (polyclonal, Abcam, Cat No. ab200834)

Rabbit anti-human Snail antibody (polyclonal, Abcam, Cat No. ab180714)

Rabbit anti-human SOX2 antibody (polyclonal, Abcam, Cat No. ab97959)

Rabbit anti-human α smooth muscle action (αSMA) antibody (polyclonal, Abcam, Cat No. ab5694)

Goat anti-human ALDH1 antibody (polyclonal, Santa Cruz Biotechnology, Cat No. sc-22589)

Rabbit anti-human Nanog antibody (polyclonal, Abcam, Cat No. ab70482)

Rabbit anti-human p-ERK antibody (polyclonal, Abcam, Cat No. ab76165)

Rabbit anti-human MCT1 antibody (polyclonal, Santa Cruz Biotechnology, Cat No. sc-50324)

Rabbit anti-human MCT4 antibody (polyclonal, Santa Cruz Biotechnology, Cat No. sc-50329)

Rabbit anti-human CD147 antibody (polyclonal, Invitrogen, Cat No. sc-50329)

Mouse anti-human VEGF VG-1 antibody (MAb, Abcam, Cat No. ab1316)

101

Rabbit anti-human VEGF Receptor 2 (R-2) antibody (PAb, Abcam, Cat No. ab39256)

Rabbit anti-human ALDOA antibody (PAb, Abcam, Cat No. ab133729)

Rabbit anti-human Ki67 antibody (PAb, Abcam, Cat No. ab15580)

Mouse anti-human p53 antibody (MAb, Abcam, Cat No. ab28)

Mouse anti-human p-p53 antibody (MAb, Abcam, Cat No. ab122898)

Rabbit anti-human p21 antibody (PAb, Abcam, Cat No. ab18209)

Rabbit anti-human CDK1 antibody (MAb, Abcam, Cat No. ab32384)

Rabbit anti-human p-CDK1 antibody (PAb, Abcam, Cat No. ab58509)

Rabbit anti-human Chk1 antibody (PAb, Abcam, Cat No. ab47574)

Rabbit anti-human p-Chk1 antibody (PAb, Abcam, Cat No. ab47318)

Rabbit anti-human Chk2 antibody (PAb, Abcam, Cat No. ab8108)

Rabbit anti-human p-Chk 2 antibody (PAb, Abcam, Cat No. ab59408)

Rabbit anti-human Rb antibody (PAb, Abcam, Cat No. ab6075)

Rabbit anti-human p-Rb antibody (MAb, Cell Signaling, Cat No. 8516)

Rabbit anti-human Caspase-3 (Active) antibody (PAb, Abcam, Cat No. ab2302)

Rabbit anti-human Caspase-7 (Active) antibody (PAb, Abcam, Cat No. ab55427)

102

Rabbit anti-human PARP-1 (Cleaved) antibody (MAb, Abcam, Cat No. ab32064)

Mouse anti-human Bcl-2 antibody (MAb, Abcam, Cat No. ab117115)

Rabbit anti-human Bcl-xL antibody (MAb, Abcam, Cat No. ab32370)

Rabbit anti-human Bax antibody (MAb, Abcam, Cat No. ab32503)

Rabbit anti-human Becline-1 antibody (PAb, Cell Signaling, Cat No. ab62557)

Rabbit anti-human LC3 A/B antibody (PAb, Abcam, Cat No. ab128025)

Mouse anti-human γH2AX antibody (MAb, Abcam, Cat No. ab26350)

Rabbit anti-human Ku70 antibody (MAb, Abcam, Cat No. ab92450)

Rabbit anti-human Ku80 antibody (MAb, Abcam, Cat No. ab80592)

Mouse anti-human BRCA1 antibody (MAb, Abcam, Cat No. ab16780)

Rabbit anti-human BRCA2 antibody (PAb, Abcam, Cat No. ab27976)

Mouse anti-human Rad51 antibody (PAb, Abcam, Cat No. ab88572)

Mouse anti-human GAPDH antibody (MAb, EDM Millipore, Cat No. MAB374)

Mouse anti-human β-tubulin antibody (MAb, Sigma-Aldrich, Cat No. T4026)

Alexa Fluor® 488 Goat anti-mouse IgG (H+L) (Life technologies, Cat No. A11001)

Alexa Fluor® 488 Goat anti-rabbit IgG (H+L) (Life technologies, Cat No. A11008) 103

Alexa Fluor® 488 Donkey anti-goat IgG (H+L) (Life technologies, Cat No. A11055)

Goat anti-mouse IgG-HRP (Santa Cruz Biotechnology, Cat No. sc-2005)

Goat anti-rabbit IgG-HRP (Santa Cruz Biotechnology, Cat No. sc-2004)

Donkey anti-goat IgG-HRP (Santa Cruz Biotechnology, Cat No. sc-2020)

Swine anti-goat, mouse, rabbit IgG/Biotinylated (Dako, Cat No. E0453)

Goat anti-rabbit immunoglobulins/HRP (Dako, Cat No. P0448)

Goat anti-mouse immunoglobulins/HRP (Dako, Cat No. P0447)

Rabbit IgG1 (Dako, Cat No. X0903)

Mouse IgG1 (Dako, Cat No. X0931)

2.2.4 Chemicals and reagents

B27 (Life technologies, Cat No. 10889-038)

Bovine serum albumin (BSA) (Sigma-Aldrich, Cat No. A4503)

EGF (Life technologies, Cat No. 10450-013)

Fibroblast growth factor (Sapphire Bioscience, Cat No. A50111-5039)

FBS (Life technologies, Cat No. 26140-079)

Goat serum (Sigma-Aldrich, Cat No. G9023) 104

Insulin (Sigma-Aldrich, Cat No. 19278)

Lipofectamine 2000 (Life technologies, Cat No. 11668-030)

OPTI-MEM (Life technologies, Cat No. 31985-070)

Penicillin/Streptomycin (Invitrogen, Cat No. 15070-063)

Protease inhibitor cocktails (Sigma-Aldrich, Cat No. P8340)

RPMI-1640 medium (Miltenyi Biotech, Cat No. 130-091-439)

Trypsin-EDTA (Life technologies, Cat No. 15400-054)

MOPS SDS Running Buffer (20X) (Life technologies, Cat No. NP0001-02)

Transfer Buffer (20X) (Life technologies, Cat No. NP0006-1)

Sample Reducing Agent (10X) (Life technologies, Cat No. NP0009)

LDS Sample Buffer (4X) (Life technologies, Cat No. NP0007)

Streptavidin/HRP (Dako, Cat No. P0397)

K-SFM medium (Life technologies, Cat No.10724-011)

DMEM/F12K (Life technologies, Cat: No.11330-057)

Bovine Pituitary Extract (Life technologies, Cat No. 13028-014) autoMACS Running Buffer (Miltenyi Biotech, Cat No. 130-091-221)

105

BCA Protein Assay Kit (Thermo-Fisher, Cat No. PIE23227)

SuperSignal West Pico Chemiluminescent Substrate (Thermo-Fisher, Cat No. PIE34080)

FxCycleTMViolet (Life technologies, Cat No. F-10347)

2.2.5 Inhibitors preparation for stock and treatment

2.2.5.1 In vitro study

For in vitro study, BEZ235, PI103, BKM120 and Rapamycin were used. The details for four PI3K/mTOR inhibitors are summarised in Table 2-2.

2.2.5.2 In vivo study

For in vivo study, BEZ235 was purchased from Selleck Chemicals, USA and dissolved in NMP/polyethylene glycol 300 (10/90, v/v). Solutions (5 mg/mL) of BEZ235 were freshly prepared for injections.

106

Table 2-2 The details of four PI3K/mTOR inhibitors

Type of Final Inhibitor targeting Alias Solvent concent Source protein(s) ration PI3K and NVP- 1 Cayman BEZ235 Chloroform mTOR BEZ235 mg/mL Chemical PI3K and 0.25 Cayman PI103 N/A Chloroform mTOR mg/mL Chemical NVP- 82 BKM120 PI3K BKM120 DMSO Selleckchem mg/mL /Buparlisib Sirolimus /AY22989 20 Rapamycin mTOR DMSO Selleckchem /WY- mg/mL 090217 Notes: N/A: not applicable.

2.2.6 siRNA

ALDOA siRNA-122362 (Life technologies, Cat No. AM51331)

ALDOA siRNA-122368 (Life technologies, Cat No. AM51331)

ALDOA siRNA-S71 (Life technologies, Cat No. 4390824)

(Please see the sequence for each siRNA in Appendix 9)

2.3 Methods

2.3.1 Cell culture

107

After thawing frozen cells in a waterbath (Labec, NSW, Australia) at 37 C within 1 min, the cells were centrifuged in 5 mL RPMI-1640 with 10% heat-inactivated FBS at 180 × g for 5 min. After discarding the supernatants, cell pellets were resuspended with fresh media and then transferred to an appropriate flask. All CaP cell lines used in this study were cultured in RPMI-1640, supplemented with 10% (v/v) heated-inactivated FBS, 50 U/mL of penicillin, and 50 µg/mL of streptomycin. RWPE-1 cell line was cultured in K-SFM supplemented with 0.05 mg/mL bovine pituitary extract and 5 ng/mL human recombinant EGF. All cell lines were maintained in a humidified incubator at 37°C and 5% CO2. Subconfluent cells grown for 48 h were harvested as follows-after gently rinsing the flasks twice with DPBS, cells were detached with 0.25% trypsin-EDTA at 37°C for 5 minutes. The cells were collected and centrifuged at 180 g for 5 min at room temperature (rt), followed by resuspension in the appropriate buffers or media. All tissue culture supplements were from Invitrogen Australia Pty Ltd (Melbourne, VIC, Australia), unless otherwise stated.

2.3.2 Cell viability

Haemocytometer counting using 0.4% trypan blue was used to assess cell viability. Based on the principle that cell membranes of non-viable cells will not exclude vital dyes, cells with blue cytoplasm represent non-viable cells, and cells with clear cytoplasm represent live or viable cells. Briefly, adherent cells were trypsinised and detached from the flask, pelleted with centrifugation (180 g for 5 min) and resuspended in tissue culture media. Counts of both live cells and dead cells were made, and the percentage viability was calculated. Cell density was calculated (average number of cells x dilution x104cells/mL).

2.3.3 Cell preservation/cell thawing

Subconfluent cells were harvested, pelleted by centrifugation and counted using a haemocytometer and trypan blue. Cells were resuspended in freezing medium to create a suspension of approximately 1-2 x 106 cells per mL. Following pipetting, the cell suspension was aliquoted in 1 mL pre-labelled cryo-vials. The vials were 108

then immediately transferred to the Nalgene® Cryo 1°C Freezing Container (Thermo Scientific, MA, USA) which allows a -1 ºC /minute cooling rate required for successful cell cryopreservation and recovery. The Nalgene® Cryo 1°C Freezing Container was then placed in the -80 °C freezer for at least 48 h before the vials were transferred to the liquid nitrogen tank for long-term storage.

2.3.4 Radiation treatment for developing CaP-RR cell lines

75 cm2 flasks with 60% confluent cells were laid with a 1 cm thick compensation above and 100 cm source surface distance (SSD) below and the field size was 30×30 cm.

To develop CaP-RR cell lines, 4×106 cells were irradiated at the therapeutic radiation dosage of approximately 2 Gy (226 mu) with 6 MV photons (Elekta, Stockholm, Sweden) for 5 consecutive days (Cancer Care Centre, St George Hospital, Sydney, Australia) as a published method with some modifications (Smith, Qutob et al. 2009). Following the final radiation, the CaP cell lines were maintained as the above culture method in a humidified incubator at 37°C and 5%

CO2 for approximately 35 days for recovery. Sham-irradiated controls were handled identically to the irradiate cells.

For radiation therapy on CaP cell lines, the single dose irradiation (6 Gy) was performed using a linear accelerator (Elekta, Stockholm, Sweden) at a dose rate of 2.7 Gy/min with 6 MV photons (Cancer Care Centre, St George Hospital, Sydney, Australia)..

2.3.5 Clonogenic survival assay

Radioresistance from the established CaP-RR cell lines was confirmed by a clonogenic survival assay following exposure to irradiation. 1,500 cells were seeded in 10 cm dishes and were exposed to a range of radiation doses (2-10 Gy). The media were replaced regularly and all cultures were incubated for 14 days until the colonies were large enough to be clearly discerned. The positive 109

colonies, defined as groups of >50 cells, were scored manually with the aid of an Olympus INT-2 inverted microscope (Tokyo, Japan). The survival fraction was calculated as the numbers of colonies divided by the numbers of cells seeded times plating efficiency. The average number of colonies were plotted (Mean ± standard deviation (SD), n= 3).

2.3.6 Sphere formation assay

Briefly, CaP-RR and CaP (control) cells were trypsinised, dissociated into single cells and then plated into ultra-low attachment round-bottom 96 well plates (Sigma-Aldrich Pty Ltd, Australia). Five cells in 100 µL serum-free DMEM/F12K media supplemented with 4 μg/mL insulin, B27 and 20 ng/mL EGF and 20 ng/mL basic fibroblast growth factor (bFGF) were added into each well. Spheres that arose in 1 week were counted. The diameters of each sphere were observed and measured by an inverted phase microscope (CK-2, Olympus, Tokyo, Japan) fitted with an ocular eyepiece after 5 days. Sphere formation capacity was assessed as the number of spheres with the diameter of >50 µm.

2.3.7 Matrigel invasion assay

The invasive ability of CaP cells was determined using commercial matrigel and control transwell chambers (BD Bioscience, NSW, Australia). Briefly, 2 x 104 CaP and CaP-RR cells in 500 μL serum-free medium were added to each transwell insert and 750 μL complete medium was added to the outer well to provide chemoattractant and prevent dehydration. Cells were incubated at 37°C in 5% CO2 for 24 h and then stained with a Diff-Quik staining kit (Allegiance Healthcare Corp, McGraw Park, Illinois, USA). Excess dye was washed away with tap water and the number of stained cells that invaded through matrigel and control inserts was counted in five high power field (hpf)s by light microscopy (Leica microscope, Nussloch, Germany). The invasive potential was calculated as follows: % Invasion = [(Mean cells invading through matrigel insert membrane) / (Mean cells migrating through control insert membrane)] x 100%. Cell invasion rates were plotted, with mean and SD (n=3). 110

2.3.8 Colony assay

In the current studies, the colony forming ability of CaP and CaP-RR cells with or without treatment was assessed. CaP cells (1500 cells/dish) were seeded in 10 cm dishes for 48 h at 37°C, 5% CO2 and then treated with inhibitors, RT or the same volume of vehicle control. After 24 h treatment, the media was replaced with fresh media and all cultures were incubated for an additional 13 days until colonies were large enough to be clearly discerned. The colonies were stained with filtered 0.5% crystal violet for 20 min, followed by washing with tap water and drying overnight (o/n). The colonies, defined as groups of >50 cells, were counted manually with the aid of an Olympus INT-2 inverted microscope (Tokyo, Japan). The average number of colonies were plotted [mean ± SD, n=3].

2.3.9 Immunofluorescence (IF) staining

To examine expression of markers in CaP cell lines, cells were grown on glass coverslips for 48 h prior to immunolabelling. Sub-confluent cells were fixed with 100% methanol for 5-10 min and then rinsed in TBS (pH 7.6). The coverslips were blocked in 10% serum from the species which is the same as the secondary antibodies. Cells were then incubated o/n at 4°C in primary antibodies. After washing with TBS, cells were incubated in Alexa-Fluor conjugated secondary antibodies for 1 h at rt, and rinsed in TBS. Negative controls were treated identically using non-specific immunoglobulins (mouse, goat or rabbit Ig) or with primary antibody omitted. Sections were examined using an FV300/FV500 Olympus laser scanning confocal microscope (Olympus, Tokyo, Japan). Multichannel excitation bleedthrough was minimised by using fluorochromes separated in peak excitation (488 nm and 594 nm respectively). Multitracking and sequential image capture was used to correct signal emission crosstalk between neighbouring channels, and the images were combined.

111

2.3.10 Protein extraction

Adherent cells were washed with PBS for 2 times and then lysed in a protein extraction buffer and 1/12 (v/v) protease inhibitor cocktail (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia). After a brief incubation for 5 min on ice, the lysates were collected and centrifuged at 14,000 rpm for 10 min at 4˚C and the supernatants were collected and stored at -80 C.

2.3.11 Protein quantification

A BCA assay kit (Thermo Scientific, USA) was used to quantify protein concentrations following the manufacturer’s instructions. The optical density was measured with a BIO-TEC micro-plate reader (BIO-RAD, Hercules, CA, USA).

2.3.12 WB analysis

Protein expression levels were semi-quantified using WB analysis. Equal amounts of total protein were loaded and separated by NuPAGE® 4-12% Bis-Tris gel (Invitrogen Australia Pty Ltd, Australia) electrophoresis at 200V for 50 min and then transferred to a polyvinyl difluoride (PVDF) membrane in NuPAGE® transfer buffer at 30 V for 1.5 h. The membrane was blotted with 5% skim milk in TBS/0.05% Tween 20 buffer. Blots were hybridised with specific antibodies (see the following chapters) at appropriate concentrations o/n at 4C. After washing 3×10 min in TBS/0.05% Tween 20 buffer, the blots were then incubated for another 1 h with a HRP-conjugated IgG secondary antibody (Santa Cruz, TX, USA). After washing 3×10 min in TBS/0.05% Tween 20 buffer, immunoreactive bands were detected using enhanced chemiluminescence (ECL) WB substrate (SuperSignal West Pico Substrate, Thermo Scientific, USA), and imaged using the ImageQuant LAS4000 system (GE Health care, USA). To confirm equal loading of protein lysates, membranes were stripped (Restore Western Blot Stripping Buffer, Thermo Scientific, USA) and re-probed using β-tubulin or GAPDH antibodies (Sigma-Aldrich Pty Ltd, Australia), then processed as above.

112

The protein bands on films were scanned and processed in Adobe Photoshop (San Jose, CA, USA).

2.3.13 Quantitative real time-PCR (qRT-PCR)

Primers were synthesised from QIAGEN (Chadstone Centre, VIC, Australia). Total RNA was isolated using the RNAeasy kit (QIAGEN, Chadstone Centre, VIC, Australia) according to the manufactures instructions. RNA yields were quantified spectrophotometrically using the Nanodrop ND-1000 (Isogen Life Science, IJsselstein, Netherlands) device, thereafter set to a 250 ng/L concentration. All measurements indicated intact and good quality RNA. Then, 1 µg of each total RNA sample was reverse transcribed to cDNA using the SuperScriptTM III Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen Australia Pty Ltd, Melbourne, VIC, Australia) following the manufacturer’s instructions. After synthesis, samples were subjected to qRT-PCR. The results were normalised to internal control GAPDH. The fold change in all samples was calculated using software REST 2009 (Corbett Research Pty Ltd, USA).

2.3.14 MTT assay

MTT [3-(4,5-dimethylthlthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] assay was performed to examine the responsiveness to the different inhibitors in different cell lines. Briefly, 2,000 cells were seeded in 96-well plates incubated in culture media for 24 h. Cells were then treated with a range of concentrations of each inhibitor or the same volume of chloroform or DMSO control in fresh media for another 24, 48 and 72 h, respectively. The optical density (OD) was read at 560 nm on a BIO-TEC micro-plate reader (BIO-TEC, Hercules, CA, USA). Each experiment was repeated at least three times. Results are represented as the OD ratio of the treated and vehicle control cells. The IC50 (50% inhibitory concentrations) of each inhibitor in each cell line at 24 h were calculated and chosen for the following experiments.

113

2.3.15 Detection of apoptosis

2.3.15.1 Acridine Orange (AO)/Ethidium Bromide (EB) assay

AO/EB staining was used to confirm apoptotic cells. Briefly, cells (5 x 105) were cultured in 25 cm2 flasks for 24 h and exposed to different treatments. The cells were stained with 1 mL 100 mg/mL the DNA-binding agents AO/EB (Sigma- Aldrich Pty Ltd., Castle Hill, NSW, Australia) in PBS; 10 µL of stained cells were placed onto a glass slide, coverslipped and then examined immediately with a confocal microscope (FV 300/FV500 Olympus, Tokyo, Japan). Apoptotic cells were characterised by morphology including nuclear condensation and fragmentation.

2.3.15.2 TUNEL assay

Apoptosis was assessed on CaP cell lines and CaP xenograft tissues using the TUNEL method with the TdT-fragEL in situ apoptotic detection kit (Calbiochem, San Diego, CA, USA) according to the manufacturer’s instructions.

1) For cell lines, 2×105 of the cultured cells in 24 well plates were treated with different inhibitors at the respective ½ IC50 concentrations for 24 h and then treated with 6 Gy RT, or treated with 6 Gy RT alone or sham treatment as a control. The treated cells were collected and cytospins made with a Shando Cyto- Centrifuge (Shando, Pittsburgh, PA, USA). The cells were fixed in 4% paraformaldehyde at rt for 30 min. The specificity of TUNEL reactivity was confirmed by undertaking parallel appropriate negative (omitting TdT from the labeling mix) and positive (treated HL-60 slides provided by company) control. The results were expressed as a percentage of total cells staining positive for apoptosis. Three hundred to five hundred cells were counted in each of 10–15 randomly chosen fields. 114

2) For tumour tissues, paraffin sections of tumour xenografts were deparaffinised in xylene as described for immunohistochemistry, washed in TBS and then incubated with 20 mg/mL Proteinase K in 10 mM Tris–HCl, pH 7.4 for 5 min at rt. Following rinsing in TBS, endogenous peroxidase was quenched in 3% hydrogen peroxide for 5 min. After rinsing in TBS, slides were incubated with terminal deoxynucleotidyl transferase Equilibration Buffer for 30 min at rt and then incubated with 100 μL of the TUNEL reaction mixture for 1.5 h at 37°C in a humidified atmosphere. Following rinsing in TBS, slides were incubated with 100 μL stop solution at rt for 5 min, pre-diluted 1:50 in blocking buffer and incubated for a further 30 min at rt. After rinsing in TBS, the slides were incubated with 1 mg/mL DAB substrate and incubated for 10-15 min at rt. Slides were subsequently washed, counterstained with methylgreen counterstain solution and mounted. The specificity of TUNEL reactivity was confirmed with appropriate negative (TdT omitted from the labeling mix) and positive (treated HL-60 slides provided by the company) controls. Slides were examined using a Leica light microscope (Nussloch, Germany) at 40 × magnification. In vitro treatment was performed in triplicate with three experiments (n=3).

2.3.16 Flow cytometric analysis for cell cycle distribution

Flow cytometry assay was performed for comparison of cell cycle distributions between CaP-RR and CaP cells or for comparison of the difference after different treatments in CaP-RR cells.

1). For comparison of cell cycles between CaP-RR and CaP cells, cells (1×106) were seeded in a 75 cm2 flask for 48 h. Trypsinised adherent and floating cells were pooled and fixed in a cold 70% (v/v) ethanol at 4°C o/n and then resuspended in PBS before staining with FxCycleTMViolet (Life technologies, VIC, Australia) for 30 min at rt. Each sample contained 1mL cell suspension with 1×106 cells and 1μL FxCycleTMViolet stain. Analysis was performed at 405 nm excitation with a 450/50 bandpass filter by a FACSCanto ll Flow Cytometer (Becton, Dickinson and Company, BD Biosciences, San Jose, USA). Histograms 115

of DNA content were analysed using the FlowJo software (V.7.6.1, Tree Star, Inc., Oregon, USA) to determine cell cycle distribution (G0/G1, S and G2/M)

2). For comparison of cell cycles difference after different treatments, CaP-RR cells (1×106) were cultured for 48 h as above, treated with dual or single

PI3K/mTOR inhibitors at the respective ½ IC50 concentrations for 24 h and then treated with 6 Gy RT, or treated with 6 Gy RT alone as a control. The treated cells were prepared as above for analysis.

2.3.17 LC-MS/MS proteomics study

2.3.17.1 Acetone precipitation

The protein samples from different cell lines were added to 4 times sample volume of ice-cold (-20C) acetone in acetone-compatible tubes, mixed, incubated for 60 min at -20C and then centrifuged (11,000 × g) at 4C for 10 min. The supernatants were decanted and properly disposed of and the acetone was evaporated from the uncapped tube at rt for 30 min. The pellets were resuspended in the TruSep buffer ready for Tris/Glycine SDS-PAGE and mixed in 50 mM Ammonium bi-carbonate, 10 nM DL-dithiothreitol and 2M Urea (PH8.5) ready for digestion, respectively. The protein concentrations were determined by a BCA assay kit (Thermo Scientific, USA).

2.3.17.2 Tris/glycine SDS-PAGE

Each protein sample (30 µg) and the same volume of TruSep SDS buffer (NuSep) were mixed, boiled for 5 min, added to 12% Tris/glycine gel and run at 180V, 30 mA for 1 h in Tris/glycine SDS running buffer (25 mM Tris, 192 mM Glycine, and 0.1% SDS in Milli-Q water). The gel was then shaken in a staining solution (CoomassieTM Blue R-250 0.1% w/v in 10% methanol) for 1 h. The staining gel image was acquired by EPSON scanjet-5100 scanner and imported into image analysis software, PDQuest Ver 7.3.1 (Bio-Rad, Hercules, CA, USA).

116

2.3.17.3 Protein clean up and digestion

Each protein sample (100 µg) was added with trypsin (12.5ng/µL trypsin proteomic grade, Sigma-Aldrich, St Louis, MO, USA) in an enzyme protein ratio of 1:100 (weight per weight (w/w)) and incubated at 30 C o/n. 5µL formic acid (Fluka) was mixed with each sample and spined at 5000 rpm for 10 min. The supernatants were removed to another tube, made a hole in the surface of cap and placed in the speedVac concentration drying machine (Speed Vac Pluc) for 30 min to dry down. Then, the pellets were added with 20 µL 0.5% formic acid and loaded into a C18 Stage Tip prepared as the manufacturer’s instructions. The tips were washed with 0.5% formic acid before being eluted using 10 µL 80% ACN and 0.1% formic and dried in a speedVac for 10 min. Samples were resuspended in 10 µL 0.1% formic acid ready for LC-MS.

2.3.17.4 LC-MS/MS analysis

LC-MS/MS analysis was carried out for CaP and CaP-RR cell lines. Digested peptides were reconstituted in 10 µL 0.1% formic acid and separated by nano-LC using an Ultimate 3000 HPLC and autosampler (Dionex, Amsterdam, Netherlands). The sample (0.2 µL) was loaded onto a micro C18 pre-column (500 µm×2mm,Michrom bioresources, Auburn, CA, USA) with Buffer A (98% H2O, 2% CH3CN, 0.1% TFA) at 10 µL/min. After washing, the pre-column was switched (Valco 10 port valve, Dionex) into line with a fritless nano column (75 µm i.d × 10cm) containing reverse phase C18 media (5 µm, 200 Å Magic, Michrom Bioresoures). Peptides were eluted using a linear gradient of Buffer A to Buffer B (98% CH3CH, 2% H2O, 0.1% formic acid) at 0.25 µL/min over 60 min. High voltage (2000V) was applied to low volume tee (Upchurch Scientific, Oak Harbor, WA, USA) and the column tip positioned 0.5 cm from the heated capillary (T=280C) of an Orbitrap Velos (Thermo Electron, Bremen, Germany) mass spectrometer. Positive ions were generated by electrospray and the Orbitrap was operated in a DDA mode. A survey scan 350-1750 m/z was acquired in the Orbitrap (Resolution=30000 at 400 m/z, with an accumulation target value of 1,000,000 ions) with lockmass enabled. Up to the 10 most abundant ions (>5000 117

counts ) with charge states +2 to +4 were sequentially isolated and fragmented within the linear ion trap using collisionally induced dissociation with an activation q=0.25 and activation time of 30 ms at a target value of 30,000 ions. The m/z ratios selected for MS/MS were dynamically excluded for 30s.

2.3.17.5 Progenesis analysis

MS peak intensities were analysed using Progenesis LC-MS data analysis software v4 (Nonlinear Dynamics, Newcastle upon Tyne, UK). Ion intensity maps from each run were aligned to a reference sample and ion feature matching was achieved by aligning consistent ion m/z and retention times. The peptide intensities were normalised against total intensity (sample specific log-scale abundance ratio scaling factor) and compared between groups by one-way analysis of variance (ANOVA, p≤0.05 for statistical significance) and post hoc multiple comparison procedures. Type I errors were controlled for by false discovery rate (FDR) with q value significance set at 0.01. Results are reported as mean ± SD (normalised ion intensity score).

2.3.17.6 Protein dataset

Peak lists of proteins were generated using Mascot Daemon/extract_msn (Matrix Science, Thermo, London, UK) using the default parameters, and submitted to Mascot 2.1 (Matrix Science). All MS/MS spectra of differentiating peptides were searched against human non-redundant NCBInr database using the Mascot search program (Matrix Science, London, UK, www.matrixscience.com) for protein identification with the following criteria: (1) species, Homo sapiens; (2) allowed one missed cleavage; (3) variable modifications, Oxidation (M), Phospho (ST) and Phospho(Y); (4) peptide tolerance, ±6 ppm; (5) MS/MS tolerance, ± 0.6Da; (6) peptide +2, +3 and +4; and (7) enzyme specificity, none. The results were imported into Progenesis LC-MS software and peptides were considered to be confidently identified when matches had a high ion score >20 and peptides were assigned to a protein.

118

2.3.17.7 Ingenuity pathways

Ingenuity Pathways Analysis (IPA) (Ingenuity Systems http://www.ingenuity.com) is a web-based software application tool which is designed to extract biological information from large protein lists, gain a high- level overview of the general biology and construct possible protein networks that are associated with proteomics data. IPA Canonical Pathways Analysis tool was used to identify the signalling and metabolic pathways associated with the database. The significance of the association between the dataset and the canonical pathway was measured in two ways, the fold-enrichment and the significance (P value).

2.3.18 siRNA transfection

Silencer® select siRNAs (-KD) and Silencer Negative Control siRNA (-scr) were purchased from Ambion (Invitrogen Australia Pty Ltd, VIC, Australia). Transfection was performed by using Lipofectamine® RNAiMAX Reagent (Invitrogen Australia Pty Ltd, VIC, Australia), as recommended by the manufacturer. Briefly, in a 24-well plate, 6 pmol siRNA was diluted in 100 uL of Opti-MEM® (Invitrogen Australia Pty Ltd, VIC, Australia) medium without serum or antibiotics in each well to be used for transfection. 1uL Lipofectamine® RNAiMAX reagent was then added to the mix. After incubation at rt for 20 min, 500 uL cell suspension containing 3 x104 cells was added in the well. The final siRNA concentration is 10 nM in a total volume of 600 uL. The cells were then incubated at 37 ºC in a CO2 incubator for 48 h before subjected to knockdown test and additional assays.

2.3.19 Animal model development

Seven weeks male NOD/SCID mice (Animal Resources Centre, Western Australia) were housed under specific pathogen-free conditions in facilities approved by UNSW ACEC and manipulations were performed in laminar flow cabinets. Mice were kept at least 1 week before experimental manipulation. All 119

mice remained healthy and active during the experiment. The ACEC specifically approved this study (approval ID: 13/118B).

2.3.19.1 S.c CaP xenograft model development

For s.c CaP models , cultured PC-3-luc and PC-3RR-luc cells (2 x 106/injection) in 100 mL DPBS were implanted subcutaneously in the right rear flank region of mice (n=10 mice/per group). The injection method is shown in Figure 2-1. Tumour progression was documented once weekly by measurements using callipers as well as bioluminescence (BLI). Tumour volumes were calculated as follows: length × width × height × 0.52 (in millimetres).

Figure 2-1 The demonstration of s.c injection procedure

2.3.19.2 Orthotopic CaP xenograft model development

The mice were anesthesised with inhalation isoflurane delivered by a Sleep Easy anaesthetic machine. A small incision was made on the lower abdomen first through the skin and then through the abdominal muscle. The bladder was grasped with forcep and withdrawn through the incision. The prostate lied at the base of the bladder surrounding the urethra. Viable PC-3-luc or PC-3RR-luc cells (1x106/injection) in 50 µL of DBPS were injected into the prostatic lobe at the base of the seminal vesicles after exposure through a lower midline laparotomy incision. The formation of a bulla (blister) indicates a satisfactory injection. The

120

injection method is shown in Figure 2-2. After the prostate was returned to the abdominal cavity, peritoneum (the internal layer) was closed by absorbable sutures and the external layer was closed by wound clips. Tumour progression was documented once weekly by BLI.

Figure 2-2 The series of images showing intra-prostatic orthotopic implantation procedure 121

2.3.20 Toxicity studies in NOD/SCID mice without tumour

Toxicity studies were performed to determine the maximum tolerance dose (MTD) of BEZ235 or RT in mice. For BEZ235, The dose-tolerance study was examined in NOD/SCID mice without tumour for a single ip administration of BEZ235 compared with equal volume of vehicle control treatment. Each group of mice (n=5) received a single injection with the dosage of 20, 30, 50 mg/kg of BEZ235, respectively. For RT, The lower body of mice in each group (n=5) received fractioned radiation treatment for every other day for 3 times, 4, 6, 8 Gy each day, respectively. Mouse weights were compared with those at day 0 (the first day of treatment) to determine percentage weight change. The dose-limiting toxicity was defined as end points: 20% loss of body weight or distressed behaviour (i.e., loss of appetite and activity, hunched posture, etc.). The MTD was defined as the highest dose at which one third of the cohort reached dose-limiting toxicity end points. After 13 weeks, healthy mice were euthanised. The following animal experiments were performed by using ½ MTD from the toxicity studies. For toxicity studies, relevant mouse organs such as kidney, liver, and heart were collected, formalin-fixed and sent for pathologic examination (IDEXX Laboratories, Sydney, Australia).

Hematological toxicity and renal function were examined. To determine hematologic toxicity, 200 µL of blood in each mouse were collected into K3EDTA and Z serum gel minicollect tubes (Greiner Bio-one) via saphenous vein by Microvette before treatment and at 2 and 3 week post-treatment injection. Hematologic analyses of white blood cell, red blood cell, and platelet counts were done. Blood was obtained at the end of the experiment for biochemical analysis of serum for renal function examination.

122

2.3.21 Pharmacokinetics study in NOD/SCID mice with PC-3RR-luc s.c tumours

The ultra-high performance liquid chromatography/tandem mass spectrometer (UHPLC/MS/MS) system with an ACQUITY UPLC module (Waters Corporation, Mildford, MA, USA) and a TQD triple quadrupole detector (Waters Corporation, Mildford, MA, USA) equipped with an electrospray ionization (ESI) interface were used to analyze the concentration of BEZ235 in tumour tissue and plasma at different time points after inhibitor injection. The time points with the highest concentrations of BEZ235 were selected use in combination with RT in animal models.

Briefly, to prepare tissue samples, an amount of 70 mg of each prostate tumour xenograft tissue was homogenised using the homogeniser with 250 µL BBD130 (2µg/mL in methanol) as internal standard (IS) and 680 µL ultra-pure water, achieving a final concentration of 70 mg/mL, followed by sonication 3 times. The mixture of 100 µL tissue homogenates and 900 µL acetonitrile was centrifuged at 13,000×g for 20 min at rt after received 5 min vortex and all supernatants were taken out to dry down. Finally, the residue from tissue samples was eluted in 25% methanol and 75% ultra-pure water with 0.1% heptafluorobutyric acid (HFBA) up to 100 µL for UHPLC study.

For plasma preparation, 50 µL plasma sample was added in 12.5 µL IS, followed by the addition of 450 µL acetonitrile. The samples were mixed for 5 min and centrifuged at 13,000×g for 20 min at rt. The supernatants were taken out and dried down in a vacuum instrument. Then dried samples were dissolved in 25% methanol and 75% ultra-pure water with 0.1% HFBA up to 60 µL for UHPLC study.

For calibration solution preparation, BEZ235 stock solution was prepared in DMSO at a concentration of 2mg/mL. BEZ235 (2mg/mL) was diluted to 2 µg/mL using 100% methanol. BBD130 as the IS also was prepared as a concentration of 2µg/mL. Different centrations of BEZ235 solution were added to 250 µL IS and 123

further diluted with methanol as the following concentrations: 0, 0.7, 2.5, 5, 10, 30, 50, 100, 300, 500, 1000 ng/mL. In order to obtain calibration standard, 10 µL of calibration solution was spiked to 100 µL blank tumour tissue or plasma. Quality control (QC) samples at low, middle and high concentrations (5, 10 and 30 ng/mL) were prepared separately under the same condition.

2.3.22 Radiation treatment on animal models

When tumour volumes reached to approximately 60±10 mm3, mice were anaesthetised with a mixture of 45 mg/kg Ketamine and 4.5 mg/kg Xylazine and restricted in a lead container. After being appropriately shielded using a lead cover, the lower body of mice was exposed to 6 Gy fractionated radiation (2 Gy every other day for 3 times) by RT instrument (X-RAD 320 biological irradiator, CT, USA) in Biological Resources Imaging Laboratory, UNSW. The radiation dose was chosen based on our cytoxicity study

2.3.23 Non-invasive BLI tumour imaging

Non-invasive BLI was performed to monitor tumour progression from the first week post cell inoculation. Briefly, mice were intraperitoneally (ip) injected 10 min before imaging with 150 mg D-Luciferin per kg body weight (Gold biotechnology, St. Louis, MO, USA) according to the manufacturer’s instructions. The radiance efficiency was assessed and images were taken during the follow-up observation in primary tumour site by xenogen IVIS instrument (Caliper Life Sciences, CA, USA). The total flux in photons/second (p/s) within each defined region of interest was regarded as a representative of tumour size.

2.3.24 Efficacy study in two CaP animal models

When tumour volumes reached to approximately 60±10 mm3, mice were randomly assigned to four groups (10 mice/per group) treated with vehicle control, BEZ235 (10 mg/kg), RT and BEZ235 (10 mg/kg) +RT (2 Gy every other day for 3 times) in s.c and prostate orthotopic models, respectively. BEZ235 was 124

given to mice 10 min before RT (The dose was besed on my pharmacokinetics study results).The 10 mg/kg of BEZ235 and RT dose were chosen based on the cytoxicity study. After 8 weeks, all mice were euthanased.

2.3.25 Paraffin sections

Paraffin sections were used to investigate the expression of markers in animal xenograft tissues. Paraffin blocks were prepared as follows. Briefly, fresh tissues from animal tumour xenografts were fixed in 10% neutral buffered formalin for 24-48 h at rt. Following rinsing in PBS and dehydration through alcohols and xylene, the tissue was immersed in 3 changes of paraffin and finally embedded in a paraffin block on a warm platform. Paraffin sections were cut at 5-8 μm thick, flattened on a waterbath at 40 °C, then collected onto Superfrost slides (Thermo Fisher Scientific, NSW, Australia). After drying o/n, one slide was used for hematoxylin and eosin (HE) staining to examine tissue histology while other slides were stored at rt for future use.

2.3.26 Cryosections

Cryosections were needed to investigate CD31 and CD44 expression in mouse tumour xenografts. After the fresh tissue was removed from the animals, it was placed in cold DPBS to remove any blood, excess DPBS was absorbed off and the tissue was placed in a mold filled with Tissue-Tek® OCT™ compound (Sakura Finetek, South Holland, Netherlands). The mold was then immersed in dry ice or liquid nitrogen briefly until the tissue/OCT was frozen. The frozen blocks were stored at -20 °C prior to sectioning. Frozen sections were cut at 5-10 μm thick, collected onto slides and dried at rt till adhered firmly. After drying, one slide was used for H&E staining to identify tissue histology; the remaining slides were stored at -20 °C for future use.

125

2.3.27 IHC assay

To examine expression of various molecular markers, standard immunoperoxidase procedures were used in CaP animal xenograft tissues. Briefly, paraffin sections were deparaffinised in xylene twice, followed by a graded series of alcohol (100%, 95%, and 75%) and rehydrated in water then TBS (pH 7.5). Slides were subsequently immersed in 0.01 M citrate buffer (pH 6.0) for 15 min at 100°C to enhance antigen retrieval, rinsed in TBS, and then treated with 3% hydrogen peroxidase for 10 min, and rinsed in TBS. After blocking in 10% goat serum for 20 min and washing by TBS, sections were incubated in primary antibodies o/n at 4°C. In a second day, after washing with TBS, slides were incubated with goat anti-rabbit or goat anti-mouse immunoglobulins/HRP (1:200 dilution) for 45 min at rt. After rinsing in TBS, immunoreactivity was developed with DAB substrate (Sigma-Aldrich, Pty Ltd, Castle Hills, NSW, Australia) and counterstained with hematoxylin. Negative controls were treated identically but incubated in control MAbs or PAbs (non-specific Ig) or the primary antibody was omitted. Positive cells appear brown.

Some molecular markers only work on frozen sections such as CD31 and CD44 in animal xenograft tissues. The frozen sections were thawed, air-dried for 3 h and fixed in cold acetone for 10 min at rt. After washing with TBS, slides were treated with 3% hydrogen peroxidase for 10 min. After washing with TBS, slides were blocked in 10% serum of the secondary antibody species for 10 min and washing by TBS.

For CD44 staining, the staining steps were exactly same as the above standard immunoperoxidase procedure. For CD31 staining, sections were incubated with rat anti-mouse CD31 MAb (1:20 dilution) o/n at 4°C. After rinsing with TBS, sections were incubated with rabbit anti-rat biotinylated IgG (1:200 dilution) for 45 min at rt, and then with conjugated streptavidin/HRP (1:200 dilution) for another 30 min at rt. Sections were developed by using DAB solution and counterstained with hematoxylin. Control slides were treated in an identical manner, and stained with the isotype MAb or the primary antibody was omitted. 126

2.3.28 Assessment of immunostaining results

Staining intensity (Grade 0-3) was assessed for immunostaining results in human CaP cell lines and animal tumour xenografts using confocal microscopy and light microscopy (Leica microscope, Nussloch, Germany). The criteria for assessment were as follows: 0 (negative, <25%); 1 (weak, 25–50%); 2 (moderate, 50–70%); 3 (strong, >75%) of the tumour cells stained. Evaluation of cell or tissue staining was performed independently by three experienced observers (LC, JLH and YL). All specimens were scored blind and an average of grades was taken.

2.3.29 Statistical analysis

All experiments were performed at least three times (n=3). All numerical data were expressed as the average of the values (Mean), and the SD was calculated. For irradiation experiments, survival fractions were calculated as mean plating efficiency of radiation treated cells/mean plating efficiency of control cells ×100%. RT survival curves were fitted according to the linear-quadratic model using GraphPad Prism 6.0 software (GraphPad, San Diego CA): . All significant differences (P<0.05) were evaluated using the two-tail student’s t-test with the GraphPad Prism 6.00 (GraphPad, San Diego, CA, USA). One way ANOVA, followed by the Dunnett’s post hoc test was performed to determine the significance of differences between the growth curves in animal model of tumour volume changes. P<0.05 was considered significant.

127

3. Acquisition of EMT and CSC phenotype is associated with activation of the PI3K/Akt/mTOR pathway in CaP radioresistance

The work in this Chapter has been published in:

Chang L, Graham PH, Hao JL, Ni J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. "Acquisition of epithelial–mesenchymal transition and cancer stem cell phenotypes is associated with activation of the PI3K/Akt/mTOR pathway in prostate cancer radioresistance." Cell Death and Disease (2013) 4(10): e875-e875.

128

3.1 Introduction

Although the primary therapies such as RP and RT are associated with high cancer control rates for localised CaP, up to a third of patients undergoing these therapies will have a BCR after local therapy (Khan, Walsh et al. 2003). Efforts to improve the outcome after EBRT for CaP patients have focused on delivering a higher dose to tumour. Eade et al recommend doses of ≥ 80 Gy for most men with CaP due to significant benefit for treatment outcome (Hu, Yang et al. 2007). However, further dose escalation to 82 Gy in American College of Radiology 03- 12 phase II trial yielded significant acute and late morbidity (Coen, Bae et al. 2011). Radiation sensitivity has the large potential to influence the efficacy of RT and CaP is the leading RR malignancy currently (Leith 1994). Investigating the mechanisms of radioresistance is urgent and important for the effect of RT in CaP.

Emerging evidence suggests that EMT plays a crucial role in the cancer radiation resistance (Zhou, Liu et al. 2011). EMT is characterised by loss of adhesion, negative expression of E-cadherin and enhanced cell motility as well as the acquisition of mesenchyma characteristics, such as expression of vimentin and myosin and invasive motility (Hay 2005). EMT was first recognised as a feature of embryogenesis and important for morphogenesis during embryonic development (Kong, Li et al. 2011). In addition, inducing EMT in tumour cells not only encourages tumour cell invasion and metastasis but also results in chemo-/radioresistance (Josson, Sharp et al. 2010, Sarkar, Li et al. 2010, Singh and Settleman 2010). Although the relationship of EMT with cancer metastasis has been recently reviewed (Tiwari, Gheldof et al. 2012), the role of EMT in CaP radioresistance is still elusive.

Recently, the CSC theory has offered a potential explanation for the relapse and resistance that occur in many tumours after therapy. The theory hypothesises that tumours contain heterogeneous cell populations and that tumour growth is driven by a discrete subpopulation of cells (CSCs). CSCs may produce tumours through the stem cell processes of self-renewal and differentiation into multiple cell types. 129

These CSCs could provide a reservoir of cells that cause tumour recurrence even after therapy (Kong, Li et al. 2011). The CSC model has gained increasing attention and CSCs have potential to resist to RT and chemotherapy, reducing effectivity of therapy (Yu, Shiozawa et al. 2012). Bao et al showed that CD133+ glioblastomas CSCs are more resistant to RT than non-CSCs (Bao, Wu et al. 2006). In a recent study, we also demonstrated that CD44 as a CSC biomarker associated with radioresistance in CaP cells (Xiao, Graham et al. 2012). Investigation of the relationship between the radioresistance of cancer and CSCs is useful for predicting radioresistance of cancer and developing more effective and specific radiosensitisers. However, the role of CSCs, their relationship with EMT and the regulation of signalling pathways in CaP radiatioresistance are still unclear.

In this study, we hypothesised that EMT and CSCs are involved in CaP radiation resistance and correlated with the PI3K/Akt/mTOR singalling pathway; specifically blocking PI3K/Akt/mTOR signalling pathway proteins may affect EMT/CSC phenotypes and improve CaP radiosensitivity. I found that the EMT and enhanced CSC phenotypes are associated with CaP radioresistance via the activation of the PI3K/Akt/mTOR signalling pathway; and a dual PI3K/mTOR inhibitor BEZ235 (targeting both PI3K and mTOR) combined with RT markedly reduced EMT/CSC phenotypes, increased CaP radiosensitivity as well as induced increased apoptosis in CaP-RR cells. We suggest that this combination approach (BEZ235 and RT) holds promise for future CaP radiotherapy.

3.2 Materials and methods

3.2.1 Antibodies and reagents

Antibodies were obtained from different sources. The detailed information and conditions for all antibodies are listed in Table 3-1. The detail of BEZ235 is described in Chapter 2.2.5.1.

130

Table 3-1 Antibodies used for WB and IF in this Chapter Dilution for Incubation time Antibody Source Type Temperature Application WB & IF (min) Rabbit anti-human 1:2000 (WB) Abcam MAb o/n 4℃ WB, IF E-cadherin 1:500(IF) Rabbit anti-human 1:200 (WB) Abcam PAb o/n 4℃ WB, IF N-cadherin 1:200(IF) 1:2000 (WB) Rabbit anti-human Vimentin Abcam MAb o/n 4℃ WB, IF 1:100(IF) 1:1000 (WB) Rabbit anti-human OCT4 Abcam PAb o/n 4℃ WB, IF 1:100(IF,IHC) 1:1000 (WB) Rabbit anti-human SOX2 Abcam PAb o/n 4℃ WB, IF 1:100(IF) 1:1000 (WB) Rabbit anti-human αSMA Abcam PAb o/n 4℃ WB, IF 1:100(IF) Mouse anti-human CD44 Santa Cruz 1:200 (WB) MAb o/n 4℃ WB, IF (DF1485) Biotechnology 1:200 (IF) 1:1000 (WB) Mouse anti-human CD44V6 Abcam MAb o/n 4℃ WB, IF 1:100(IF) Rabbit anti-human CD326 Abcam PAb 1:1000 (WB) o/n 4℃ WB, IF

131

1:100(IF) Santa Cruz 1:200 (WB) Goat anti-human ALDH1 PAb o/n 4℃ WB, IF Biotechnology 1:200 (WB) 1:1000 (WB) Rabbit anti-human Nanog Abcam PAb o/n 4℃ WB, IF 1:1000(IF) 1:500 (WB) Rabbit anti-human Snail Abcam PAb o/n 4℃ WB, IF 1:100(IF) 1:1000 (WB) Rabbit anti-human Akt Abcam PAb o/n 4℃ WB 1:200(IF) 1:1000 (WB) Rabbit anti-human p-Akt Abcam PAb o/n 4℃ WB 1:200(IF) 1:1000 (WB) Rabbit anti-human mTOR Cell Signaling MAb o/n 4℃ WB 1:200(IF) Rabbit anti-human 1:1000 (WB) Cell Signaling o/n 4℃ WB p-mTOR MAb 1:200(IF) 1:1000 (WB) Rabbit anti-human S6K Abcam MAb o/n 4℃ WB 1:200(IF) 1:1000 (WB) Rabbit anti-human p-S6K Abcam PAb o/n 4℃ WB 1:200(IF) Rabbit anti-human 4EBP1 Cell Signaling MAb 1:1000 (WB) o/n 4℃ WB

132

1:1600(IF) Rabbit anti-human 1:1000 (WB) Cell Signaling MAb o/n 4℃ WB p-4EBP1 1:200(IF) Mouse anti-human β-tubulin Sigma MAb 1:5000 (WB) o/n 4℃ WB Merck Mouse anti-GAPDH MAb 1:2000 (WB) o/n 4℃ WB

Millipore Santa Cruz Goat anti-rabbit IgG-HRP IgG 1:5000 (WB) 45 rt WB Biotechnology Santa Cruz Goat anti-mouse IgG-HRP IgG 1:5000 (WB) 45 rt WB Biotechnology Santa Cruz Donkey anti-Goat IgG-HRP IgG 1:5000 (WB) 45 rt WB Biotechnology Goat anti-mouse Alexa Invitrogen IgG 1:1000 (IF) 45 rt IF Fluor® 488 Dye Conjugate Goat anti-rabbit Alexa Invitrogen IgG 1:1000 (IF) 45 rt IF Fluor® 488 Dye Conjugate Donkey anti- Goat Alexa Invitrogen IgG 1:1000 (IF) 45 rt IF Fluor® 488 Dye Conjugate Notes: MAb: monoclonal antibody; PAb: polyclonal antibody; o/n: overnight; rt: room temperature; WB: western blotting; IF: immunofluorescence

133

3.2.2 Cell lines and cell culture

In this Chapter, PC-3, DU145 and LNCaP and RWPE-1 cell lines were used and the details for all cell lines are listed in Chapter 2.2.2. Cell culture was performed as previous described in Chapter 2.3.1.

3.2.3 Radiation for CaP cell lines

CaP cell lines were irradiated following the method described in Chapter 2.3.4.

3.2.4 Clonogenic survival assay

Radioresistance was measured by a clonogenic survival assay (see Chapter 2.3.5)

3.2.5 Sphere assay

Sphere assay was performed to assess growth ability of stem cells (see Chapter 2.3.6)

3.2.6 Matrigel invasion assay

Invasive ability of CaP-RR and CaP cells was determined using commercial matrigel and control transwell chambers (see Chapter 2.3.7).

3.2.7 IF staining

IF staining was performed as previously described in Chapter 2.3.9. Primary antibodies used in this Chapter are listed in Table 3-1.

134

3.2.8 WB analysis

Protein expression levels were determined by WB analysis (see details in Chapter 2.3.12). Primary antibodies used in this Chapter are listed in Table 3-1.

3.2.9 qRT-PCR

Primers for EMT, CSCs and GAPDH (control) were synthesised and used for qRT-PCR (see details in Chapter 2.3.13).

3.2.10 MTT assay

Cell cytotoxicity was evaluated in CaP-RR and CaP cell lines as well as the normal prostate RWPE-1 cell line after BEZ235 treatment using MTT assay (see details in Chapter 2.3.14). The ½ IC50 values of BEZ235 in CaP-RR cell lines at 24 h were calculated and chosen for the following experiments.

3.2.11 Radiosensitivity assay

To examine the effect of radiosensitivity by BEZ235, colony assay was performed following method in Chapter 2.3.8. CaP-RR cells were treated with vehicle control or ½ IC50 dose of BEZ235 for 24 h, or RT (6 Gy) for 12 h, or combination treatment (½ IC50 dose of BEZ235 and 6 Gy radiation) for 24 h. For the combination treatment, the cultured cells were first treated with BEZ235 (½ IC50) and after 12 h treatment, the treated cells were exposed to 6 Gy radiation and then combination of BEZ235 and RT for another 12 h.

3.2.12 AO/EB assay

PC-3RR, DU145RR and LNCaPRR cells were treated with vehicle control, ½

IC50 BEZ235, single RT (6 Gy), or combination treatment with ½ IC50 BEZ235 and RT (6 Gy). Cells exposed to different treatments were then stained with the DNA-binding agents AO/EB as previous described in Chapter 2.3.15.1 and 135

examined with confocal microscopy. Apoptotic cells were characterised by morphology including nuclear condensation and fragmentation.

3.2.13 Assessment of immunostaining results

The criteria used for assessment is detailed in Chapter 2.3.29.

3.2.14 Statistical Analysis

Statistical analysis details are described in Chapter 2.3.30.

3.3 Results

3.3.1 Establishment of CaP-RR cell lines

To generate CaP-RR cell lines, PC-3, DU145 and LNCaP CaP cell lines were treated with different dosages (2, 4, 6 and 8 Gy) of radiation for five consecutive days; cell viability was then determined at the appropriate exposure dose. Nearly, all CaP cells were killed after 5 days of irradiation using 4 Gy, 6 Gy, or 8 Gy and no viable cells were recovered at doses > 4 Gy (total 20 Gy). Only 2 Gy radiation- treated cell lines survived and proliferated. Our results indicated that the 2Gy/per day for five consecutive days was the MTD for all three CaP cell lines. The obviously morphological changes in RT-treated cells include loss of glandular pattern, vacuolated cell plasma, pleomorphic nuclei and enlarged size when compared to CaP cells (Figure 3-1).

3.3.2 Validation of radioresistance in three CaP-RR cell lines To confirm radioresistance in three radiation-treated CaP cell lines, CaP-RR and CaP cells were exposed to a range of singe radiation doses (2-10 Gy) and were examined by clonogenic survival assay. The survival fractions in CaP-RR cells were significantly higher along with increasing dosage compared to CaP cells (Figure 3-2). Colony formation was increased for CaP-RR cells (Figure 3-3). The colony numbers in CaP-RR cells had 2- to 42- fold increase compared to those in 136

CaP cells (P<0.05) (Figure 3-3). The typical images for colony formation in different doses of RT in CaP-RR and CaP cells are shown in Figure 3-2. These data suggest that CaP-RR cell lines produced in this study are RR cells which can be used in the following functional studies.

Figure 3-1 Morphological changes in CaP-RR cells after radiation treatment RT-treated CaP cells (PC-3, DU145 and LNCaP) demonstrated dynamic changes in morphology. After a single RT (2 Gy) for 5 days, CaP cells showed a loss of glandular pattern, vacuolated cell cytoplasm, pleomorphic nuclei and enlarged cell size compared to untreated CaP cells (normal morphology). After 3 weeks, the RT-treated CaP cells showed edema and swelling with irregular size and shape (round, ellipse and fusiform). After recovery from RT treatment for 5-6 weeks, the CaP-RR cells became polygonal in shape with relatively regular dimensions. Magnification x 400 in all images.

137

Figure 3-2 Different radiosensitivity to RT in CaP-RR and CaP cells CaP-RR and CaP cells were seeded in 10 cm dishes and treated with 2-10 Gy radiation. The colonies that formed after 10-12 days incubation were counted to calculate the survival fractions. Survival fractions in CaP-RR cells (PC-3RR, DU145RR and LNCaPRR) were significantly increased compared with those in CaP cells (P<0.01) (upper). Typical images are shown for colony growth in CaP- RR and CaP cells after exposure to different radiation doses (lower). Images were taken using a Sony camera (Tokyo, Japan). All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All results were from three independent experiments (Mean ± SD, n=3).

138

Figure 3-3 Validation of radioresistance in CaP-RR cell lines by colony formation assay Colony formation ability at each dose of radiation (2-10 Gy) was increased in CaP-RR cells compared with CaP (P<0.01). All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All results were from three independent experiments (Mean ± SD, n=3).

139

3.3.3 CaP-RR cells increase cell invasion and sphere formation capability

Cell invasion ability was found to be much higher in three CaP-RR cell lines compared to three CaP cell lines (P<0.05) (Figure 3-4). The average percentage of invasion rate for PC-3RR, DU145RR and LNCaPRR was 75%, 62%, 85%, respectively, whereas the average percentage of invasion rate for PC-3, DU145 and LNCaP was 35%, 35%, 42%, respectively. Among three CaP cell lines, the most significant difference in invasion ability was found between LNCaP-RR and LNCaP cells (P<0.0001) (Figure 3-4). Representative images for the invasion ability from each cell line are shown in Figure 3-4. Sphere formation abilitywas also increased in three CaP-RR cell lines compared with three CaP cell lines (P<0.01) (Figure 3-5). The highest sphere formation among three CaP-RR cell lines was DU145RR cells (P<0.001). Typical images for the comparison of the sphere formation between CaP-RR cells and CaP cells are shown in Figure 3-5.

Figure 3-4 Matrigel invasion in CaP-RR and CaP cells The cells were incubated 12 h for the invasion assay. The invasive potential in CaP-RR cells was significantly increased in PC-3RR, DU145RR and LNCaPRR cells compared to CaP cells (P<0.01). Representative images for CaP cell invasion and migration in CaP-RR and CaP cells are shown. Magnification: x 200 in all images. 140

Figure 3-5 Sphere formation in CaP-RR and CaP cells The sphere formation ability in CaP-RR cells was significantly enhanced compared to CaP cells (P<0.01) after 5 days culture. Representative images for spheroid formation in CaP-RR cells and CaP cells are shown. The upper images are from CaP cells (spheres with the diameter <50 µm) while the lower images were from CaP-RR cells (spheres with the diameter >50 µm). All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All results were from three independent experiments (Mean ± SD, n=3).

141

3.3.4 EMT phenotypic expression in CaP-RR cells

Three CaP-RR cell lines consistently showed the down-regulation of epithelial marker E-cadherin and up-regulation of mesemchymal markers including N- cadherin, Vimentin, OCT4, SOX2 and alpha smooth muscle actin (αSMA) compared to CaP cells by confocal microscope (Figure 3-6). The binding sites of these EMT markers are both membrane and cytoplasm. No detectable staining was seen in the cells incubated with negative controls. The IF staining results for EMT markers in different CaP cell lines are summarised in Table 3-2. The results from WB were consistent with those from the IF for the expression of EMT markers in CaP cell lines (Figure 3-7). The phenotypic changes of EMT in CaP- RR cell lines were also confirmed by qRT-PCR in mRNA levels (Figure 3-8). These results indicate that EMT is involved in CaP radioresistance.

3.3.5 Enhanced CSC phenotypes in CaP-RR cells

To determine whether a population of CSCs is involved in CaP radioresistance, we measured the expression of several putative CSC markers including CD44, CD44V6, CD326 and ALDH1 as well as the stem-related transcription factors- Nanog and Snail. Three CaP-RR cell lines also demonstrated enhanced expression of these CSC markers compared with three CaP cell lines by confocal microscope (Figure 3-9). The binding sites of these CSC markers are either membrane or cytoplasm or both. No detectable staining was seen in the cells in negative controls. The IF staining results for these CSC markers in different CaP cell lines are summarised in Table 3-3. The results from WB (Figure 3-10) and qRT-PCR in mRNA levels (Figure 3-11) were consistent with the results from IF.

142

Figure 3-6 EMT phenotypic expression in CaP-RR and CaP cells by IF staining. Reduced expression of membranous E-cadherin and increased membranous or cytoplasmic expression of N-cadherin, Vimentin, OCT3/4, SOX2 and αSMA were found in CaP-RR cells. Representative IF images of E-cadherin, N-cadherin, Vimentin, OCT3/4, SOX2 and αSMA (green) are shown for CaP-RR and CaP cells. Nuclei are stained with PI (red). Magnification: all images x 600. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment.

143

Figure 3-7 EMT phenotypic protein expression in CaP-RR and CaP cells using WB WB results were consistent with IF staining results. β-tubulin was used as a loading control. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment.

Figure 3-8 EMT phenotypic RNA expression in CaP-RR and CaP cells using qRT-PCR Phenotypic changes of EMT markers in CaP-RR cells using IF and WB were further confirmed by qRT-PCR (P<0.01). All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. Results are shown mean ± SD, n=3. 144

Table 3-2 Intensity of expression of EMT markers in CaP-RR and CaP cells by IF staining

Cell line Immunostaining

E-cadherin N-cadherin Vimentin OCT4 SOX2 αSMA

PC-3 1 1 2 1 1 0

PC-3RR 0 3 3 3 2 2

DU145 1 1 1 2 1 1

DU145RR 0 3 3 3 2 2

LNCaP 2 1 1 1 1 0

LNCaPRR 0 3 3 3 2 1

Note: The criteria for assessment were as follows: 0 (negative, <25%); 1 (weak, 25–50%); 2 (moderate, 50–70%); 3 (strong, >75%) of the tumour cells stained. (n=3).

145

Figure 3-9 CSC phenotypic expression in CaP-RR and CaP cells by IF staining The enhanced CSC phenotypes were seen in CaP-RR (PC-3RR, DU145RR and LNCaPRR) cells. Representative IF images of membranous or cytoplasmic expression of CD44, CD44V6, CD326, ALDH1, Nanog and Snail are shown in CaP-RR and CaP cells. Nuclei were stained with PI (red). Magnification x 600 in all images. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All results were from three independent experiments (n=3).

146

Figure 3-10 CSC protein expression in CaP-RR and CaP cells using WB WB results were consistent with the IF staining results. β-tubulin was used as a loading control. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All results were from three independent experiments, n=3.

Figure 3-11 CSC RNA expression in CaP-RR and CaP cells using qRT-PCR The phenotypic changes of CSC in CaP-RR cells were further confirmed by qRT- PCR (P<0.01). All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All results were from three independent experiments (Mean ± SD, n=3). 147

Table 3-3 Intensity of expression of CSC markers in CaP-RR and CaP cells by IF

Cell line Immunostaining CD44 CD44V6 CD326 ALDH1 Nanog Snail PC-3 2 1 1 2 1 1 PC-3RR 3 2 3 3 3 3 DU145 1 1 1 1 1 1 DU145 3 2 3 3 3 3 RR LNCaP 2 1 2 1 1 2

LNCaPRR 3 3 3 3 3 3

Note: The criteria for assessment were as follows: 0 (negative, <25%); 1 (weak, 25–50%); 2 (moderate, 50–70%); 3 (strong, >75%) of the tumour cells stained.

3.3.6 Activation of checkpoint proteins in CaP-RR cells

To examine whether checkpoint proteins are involved in CaP radioresistance, checkpoint proteins Chk1/p-Chk1, Chk2/p-Chk2 were examined by WB. Our results showed that the expression of p-Chk1 and p-Chk2 was increased in CaP- RR (PC-3RR, DU145RR and LNCaPRR) cells compared to that in CaP cells whereas no change was found in Chk1 and Chk2 expression between CaP-RR and CaP cells (Figure 3-12), which indicated that checkpoint proteins (p-Chk1 and p- Chk2) are activated in CaP-RR cells and associated with CaP radioresistance.

3.3.7 Activation of the PI3K/Akt/mTOR signalling pathway in CaP-RR cells

To investigate whether this signalling pathway is involved in CaP radioresistance, we examined the expression of Akt/p-Akt, mTOR/p-mTOR, p70S6K/p-p70S6K and 4EBP1/p-4EBP1 using WB analysis. Our results indicated that increased levels of p-Akt, p-mTOR, p-p70S6K and p-4EBP1 were found in CaP-RR (PC- 148

3RR, DU145RR and LNCaPRR) cells while no change was found in t-Akt, t- mTOR, t-p70S6K and t-4EBP1 (Figure 3-12), suggesting that the PI3K/Akt/mTOR signalling pathway is activated in CaP resistance.

Figure 3-12 Activation of checkpoint proteins and PI3K/Akt/mTOR pathway in CaP-RR cells Two markers (Chk1 and Chk2) involved in radiation checkpoint and eight signal transduction molecules (mTOR, p-mTOR, Akt, p-Akt, 4EBP1, p-4EBP1, S6K, p- S6K) were assessed to investigate the roles of checkpoint proteins or PI3K/Akt/mTOR signalling proteins in CaP radioresistance. The levels of p-Chk1 and p-Chk2, p-Akt, p-mTOR, p-S6K and p-4EBP1 were increased in CaP-RR cells compared to CaP cells while no change was found in total of Chk1, Chk2, Akt, mTOR, S6K and 4EBP1 proteins in both CaP-RR and control cells. Representative results are shown. β-tubulin was used as a loading control. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All data were from three independent experiments, n=3.

149

3.3.8 A dual PI3K/mTOR inhibitor BEZ235 on the expression EMT/CSC phenotypes

The IC50 values of BEZ235 on three CaP-RR and CaP cell lines as well as normal prostate RWPE-1 cell line (control) were evaluated using MTT assay for the

combination treatment with radiation. We found all IC50 values from CaP-RR cells were higher than those from CaP cells at all time points (Table 3-4), further

comfirming the resistant property after RT. Interestingly, we also found that IC50 values in RWPE-1 cell line were much higher than in CaP-RR and CaP cell lines (3- to 16-fold) at all time points (Table 3-4), suggesting that normal prostate cells are not sensitive to BEZ235 treatment, and BEZ235 is promising in vivo study and

clinical trials in the future. The IC50 values for BEZ235 in CaP-RR, CaP and normal prostate RWPE-1 cells cells are summarised in Table 3-4. At 48 h incubation, the most sensitive CaP-RR cell line is DU145RR cell line (72.6 nM).

We chose ½ IC50 value for our combination study, which is based on our previous similar study (Chao, Wang et al. 2013).

Table 3-4 IC50 values for BEZ235 by MTT assay in CaP-RR and CaP cells

Cell PC- DU145 LNCaP PC-3 DU145 LNCaP RWPE-1 line 3RR RR RR

IC50 (nM) 24 h 80.1 160.2 70.3 135.5 80.6 100.8 507.5 48 h 45.0 100.2 32.3 72.6 60.3 80.4 389.1 72 h 20.6 80.3 16.6 43.5 30.0 50.3 321.7

The expression of p-Akt, p-mTOR, p-S6K, p-4EBP1 and t-4EBP1 in CaP-RR

cells treated by combining ½ IC50 dose BEZ235 and 6 Gy RT was downregulated compared to that in RT alone, whereas no change was seen for the expression of t- Akt, t-mTOR, t-S6K in all CaP-RR cell lines (Figure 3-13). Compared with the RT and combination treatment (BEZ235+RT), RR cells without any treatments showed the highest expression of p-Akt, p-mTOR, p-S6K and p-4EBP1. To

150

further investigate the association of PI3K/Akt/mTOR signalling pathway with EMT and CSC phenotype, the levels of EMT and CSC marker expression were also examined after single RT and combination treatment with ½ IC50 dose BEZ235 and 6 Gy radiation. Our results indicated that for EMT markers, E- cadherin expression was increased and the levels of N-cadherin, Vimentin, OCT4, SOX2 and αSMA expression were reduced in CaP-RR cells in combination treatment whereas for CSC markers, the expression of CD44, CD44V6, CD326, ALDH1, Nanog and Snail was all reduced in CaP-RR cells in combination treatment compared to that in 6 Gy RT alone (Figure 3-14). The RR cells without treatments showed the lowest expression of E-cadherin, and the highest expression of N-cadherin, Vimentin, OCT4, SOX2, αSMA CD44, CD44V6, CD326, ALDH1, Nanog and Snail. These data indicate that dual PI3K/mTOR inhibitor BEZ235 affected PI3K/Akt/mTOR pathway and concomitantly reduced both EMT and CSC phenotypic expression.

3.3.9 Combination therapy with BEZ235 and RT increases radiosensitivity and induces more apoptosis in CaP-RR cells

To investigate the radiosensitivity effect of BEZ235 on three CaP-RR cell lines, single treatment with BEZ235 or RT alone and combination treatment with BEZ235 and RT were performed and compared. After combination treatment by

½ IC50 dose BEZ235 and 6 Gy irradiation, three CaP-RR cells consistently showed significantly reduction in colony formation, when compared to the treatment with ½ IC50 dose BEZ235 or 6 Gy radiation alone as well as the untreated CaP-RR cells (P<0.05) (Figure 3-15). Although single BEZ235 or 6 Gy radiation treatment caused the reduction of colony formation in CaP-RR cells compared with the untreated CaP-RR cells, no significant difference was found between these two single treatments (P>0.05). Among the three combination- treated CaP-RR cell lines, PC-3RR cells are the most radiosensitive cell line and the reduction of colony formation is 86.7%. These findings indicate that the dual PI3K/mTOR inhibitor BEZ235 could increase radiosensitivity of CaP-RR (PC- 3RR, DU145RR and LNCaPRR) cells. The typical images for colony formation from different treatments are shown in Figure 3-15. In addition, compared to 151

untrearted control, BEZ235 or RT alone, combination treatment with BEZ235 and RT induced more apoptotic cells (Figure 3-16).

Figure 3-13 Effect of RT and BEZ235 on the expression of PI3K/Akt/mTOR pathway proteins After 12 h treatment by 6 Gy RT alone or combination treatment with RT and BEZ235 (BEZ235 was used for 12 h prior RT and then 6 Gy was applied). Cell lysate was extracted after RT applied for 12 h. Reduced levels of p-Akt, p-mTOR, p-S6K and p-4EBP1 were detected in CaP-RR cells in combination treatment compared to single 6 Gy treatment. β-tubulin was used as a loading control. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All data were from three independent experiments, n=3.

152

Figure 3-14 Effect of RT and BEZ235 on the expression of EMT/CSCs in CaP-RR cells Combination treatment with RT and BEZ235 reversed EMT expression and reduced the levels of CSC marker expression in CaP-RR cells compared with the RT alone. CaP-RR cells were treated with single RT (6 Gy) for 12 h or combination (BEZ235 was used for 12 h prior RT and then 6 Gy was applied). Cell lysate was extracted after RT applied for 12 h). Typical results for EMT/CSC phenotypic changes after different treatments are shown. β-tubulin was used as a loading control. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All data were from three independent experiments (n=3).

153

Figure 3-15 Effect of RT and BEZ235 on radiosensitivity in CaP-RR cells by colony assay Colony formation was significantly reduced in combination treatment with BEZ235 and RT compared to that single BEZ236, 6 Gy RT alone or vehicle control in CaP-RR cells (P<0.01). Typical images of colony growth for the different treatments are shown. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All data were from three independent experiments (Mean ± SD, n=3). 154

Control BEZ235 6 Gy RT BEZ235 +6 Gy RT

PC-3RR

DU145RR

LNCaPRR

Figure 3-16 Effect of RT and BEZ235 on radiosensitivity in CaP-RR cells by apoptosis assay Combination treatment induced more apoptotic cells in CaP-RR cells compared to single BEZ235 or RT. All data used in RR cell lines were based on cells between 5 to 6 weeks post radiation treatment. All data were from three independent experiments (n=3).

3.4 Discussion

Radioresistance continues to be a major problem in the treatment of CaP. The molecular mechanisms underlying CaP radioresistance remain unclear. Identification of the mechanisms and signalling pathways that impact the radiosensitivity will be helpful in finding useful therapeutic targets, developing novel treatment approaches and overcoming recurrence after RT in CaP patients. Using CaP-RR cells and molecular and cell biology approaches, I present novel insight into the mechanisms associated with EMT and enhanced CSC phenotypes and the activation of PI3K/Akt/mTOR signalling pathway in CaP radioresistance. My findings are summarised in the model presented in Figure 3-17.

155

Figure 3-17 Diagram showing the model proposed for the association of EMT, CSCs and the PI3K/Akt/mTOR signalling pathway in CaP radioresistance and the effect of possible action of BEZ235 on radiosensitivity RT can induce CaP-RR cells with EMT and enhanced CSC phenotypes, and activation of PI3K/Akt/mTOR signalling pathway, resulting in CaP metastasis and recurrence after RT. A dual PI3K/mTOR inhibitor BEZ235 combined with RT can inactivate PI3K/Akt/mTOR signalling pathway, reducing EMT and CSC phenotypes and leading to increased radiosensitivity.

156

In this study, I developed three novel CaP-RR (PC-3RR, DU145RR and LNCaPRR) cell lines derived from clones that had survived after irradiation, which represent androgen-responsive (LNCaP) and androgen-nonresponsive (PC- 3 and DU145) stages during CaP progression and can appropriately mimic clinical RR condition and metastasis (recurrence) after RT. I examined the newly established cell lines with respect to growth and sensitivity to a range of IR exposure and found that the growth rate was reduced and clonogenic survival was significantly increased in CaP-RR cells after 5 weeks radiation treatment compared to untreated CaP cells. My observations clearly indicated that all three CaP-RR cells are RR and can be used as excellent in vitro models to study mechanisms leading to CaP recurrence after radiation treatment.

The matrigel invasion assay mimics the extracellular matrix microenvironment by providing growth factors and creating a matrix scaffold for tumour cells to invade through. To further investigate the functions of these CaP-RR cells, I conducted invasion and migration studies and found that the invasion/migration ability in CaP-RR cells was increased compared to that in CaP cells, suggesting that these CaP-RR cells have more potential to metastasise, which is the main reason for clinical cancer recurrence after RT. CSCs play very important roles in cancer metastasis and radioresistance (Marie-Egyptienne, Lohse et al. 2013, Ogawa, Yoshioka et al. 2013). Targeting CSCs is promising and can overcome chemo- /radioresistance and lead to cure of cancers (Yu, Yao et al. 2012). However, the main hurdle for investigating CSC is the limitation of appropriate models available as CSCs are a dynamic process and the expression of CSC markers can be affected by many factors including tumour microenvironment (Boral and Nie 2012, Magee, Piskounova et al. 2012).

The sphere culture assay has been proposed as a valuable method for isolating cancer cells with conserved stemness determinants that are able to propagate in defined media (Jung, Sato et al. 2011). Sphere formation assay best mimics the process of enriching and proliferating of CSCs and is currently considered as a golden in vitro model for CSC research. Recent studies revealed that the sphere formation is essential for cancer-initiating ability of CSCs (Mani, Guo et al. 2008, 157

Cicalese, Bonizzi et al. 2009). The anchorage-independent sphere culture of stem cells was instrumental in the study of adult stem cells including the CaP (Shi, Gipp et al. 2007). In the current study, I found that all three CaP-RR cell lines can significantly form more spheres in an appropriate cell number compared to the CaP cells, indicating that CSCs are closely associated with radioresistance and could be enriched in CaP-RR cells. The remaining RR cells after RT can be a subpopulation of intrinsic resistant cells with CSC characteristics. These enriched CSCs can provide a very good model to mimic clinical condition and study the roles of CSCs in CaP radioresistance.

Emerging data suggest that EMT is associated with CaP aggressiveness, including increased migration and invasion ability, and increased CSC populations (Byles, Zhu et al. 2012, Mulholland, Kobayashi et al. 2012). Until recently, only a few studies have examined the underlying mechanism between EMT and radioresistence (Escriva, Peiro et al. 2008, Kurrey, Jalgaonkar et al. 2009, Creighton, Chang et al. 2010). Recent studies in BC demonstrated that EMT might affect therapeutic resistance (Fillmore and Kuperwasser 2008), however, in CaP, such studies are far fewer in number, especially in RR field. Here, I firstly demonstrated that downregulation of E-cadherin and up-regulation of N-cadherin, Vimentin, OCT4, SOX2 and αSMA were found in CaP-RR cells in both protein level (immunofluencense and western blotting) and molecular level (qRT-PCR) compared to untreated CaP cells, indicating that EMT is correlated with CaP radioresistance. The EMT expression is also consistent with the increased invasion/migration in CaP-RR cells, further confirming that EMT is involved in CaP radioresistance and metastasis.

Accumulated data indicate that the induction of EMT enhances self-renewal and the acquisition of CSC characteristics (Ansieau, Bastid et al. 2008, Mani, Guo et al. 2008) and that CSCs and EMT related cells share same markers and properties (Mani, Guo et al. 2008), illustrating a relation between EMT and CSCs. There is considerable evidence to suggest that, under certain experimental conditions, CSCs exhibit RR features (Eyler and Rich 2008). Phillips et al demonstrated that CD24-/low/CD44+ cells from MCF-7 and MDA-MB-231 BC cell lines are more 158

resistant to RT (Phillips, McBride et al. 2006). Bao et al reported that RR glioblastomas exhibit a higher percentage of CD133 expressing CSCs (Bao, Wu et al. 2006). As far as we know, data related with the CSCs and CaP radioresistance are very limited until now. Both CD44 and CD133 are the most frequently observed putative CSC markers in CaP. Cho et al also showed an increase in CSC markers (CD44, CD133, Nanog and OCT4) with long-term recovery (after 33-35 days of RT treatment) of LNCaP and DU145 CaP cells in vitro (Barentsz, Richenberg et al. 2012). However, the link between CSCs/EMT and CaP radioresistance is still unclear. CD44, CD44V6, CD326 and ALDH1 are putative CaP CSC markers expressed on the cell surface (Ni, Cozzi et al. 2012, Nishida, Hirohashi et al. 2012, Hao JL 2013). Nanog and snail are self renewal proteins as transcription factor in the regulation of CSCs (Noh, Kim et al. 2012, Zhu, Hu et al. 2012). Nanog has been reported to promote CSC characteristics and CaP resistance to androgen deprivation (Jeter, Liu et al. 2011). To the best of our knowledge, the direct link between Snail as a CSC marker in CaP has not been reported so far. In the current study, I first demonstrated that the enhanced expression of CSC related markers (CD44, CD44V6, CD326, ALDH1, Nanog, and Snail) was found in CaP-RR cells compared to untreated CaP cells, suggesting that CSCs are associated with CaP radioresistance. Our recent report also indicated that the down-regulation of CD44 using siRNA enhances radiosensitivity in CaP cells, further confirming that targeting CSCs may overcome CaP radioresistance and prevent recurrence after RT. My findings suggest that combination of RT with a CSC-targeted therapeutic strategy hold promise in the future CaP treatment.

Chk1 is a kinase that phosphorylates cdc25, an important phosphatase in cell cycle control, particularly for entry into mitosis. Cdc25, when phosphorylated on serine 216 by Chk1 becomes bound by an adaptor protein in the cytoplasm. Therefore it is inhibited from removing the inhibiting phosphate from mitotic/maturation promoting factor (MPF) added by Wee1. Consequently, a cell is prevented from entering mitosis. It was reported that Chk1 KD confers radiosensitisation in CaP stem cells, suggesting that Chk1 plays import role in CaP radioresistance and is associated with CSCs (Wang, Ma et al. 2012). Chk2 is 159

a protein kinase that is activated in response to DNA damage and is involved in cell cycle arrest (Matsuoka, Huang et al. 1998). Checkpoints in the cell cycle regulate the progression or arrest of the cell cycle in response to DNA damage and allow time for DNA repair. My results indicate that Chk1 and Chk2 were activated in CaP-RR cells compared to CaP cells, suggesting that the activated Chk1/2 may be responsible for affecting cell cycle and DNA repair to provide time for cells to repair sublethal DNA damage which ensures cell survival (Gogineni, Nalla et al. 2011, Xiao, Graham et al. 2012). The activation of Chk1 and Chk2 may be one of mechanisms for CaP radioresistance after RT.

It is increasingly clear that a dynamic and multifactorial process is involved in the response of CaP cells to radiation. Emerging evidence suggests that PI3K/Akt/mTOR signalling pathways, EMT and CSCs play important roles in CaP metastasis and progression (Li and Tang 2011, Peng, Guo et al. 2011, Bitting and Armstrong 2013) and are related with radioresistance (Schuurbiers, Kaanders et al. 2009, Marie-Egyptienne, Lohse et al. 2013). As a major regulator of the PI3K/Akt/mTOR pathway, Akt is a serine/threonine protein kinase that plays a critical role in suppressing apoptosis by regulating its downstream pathway and a target for radiosensitisation. The mTOR acts as a downstream effector for Akt, and regulates key processes such as cell growth and proliferation, cell cycle progression and protein translation through two distinct pathways: one involving the ribosomal p70S6K, and the other one involving 4E-BPs In the current study, I found the phosphorylated-Akt, mTOR, S6K and 4EBP1 proteins (PI3K/Akt/mTOR signalling proteins) were significantly enhancesd while the total Akt, mTOR, S6K and 4EBP1 proteins were unchanged in CaP-RR cells compared to the CaP cells, suggesting that the PI3K/Akt/mTOR signalling pathway is activated in CaP-RR cells and that this pathway may play an important role in CaP radioresistance and be associated with the EMT and enhanced CSC phenotypes.

To further investigate the link between the activation of the PI3K/Akt/mTOR signalling pathway and EMT/CSC phenotypic change in CaP radioresistance, it needs to block this pathway to see how to affect the phenotypic expression of 160

EMT/CSCs. Single PI3K/Akt/mTOR inhibitors (PI3K/Akt or mTOR inhibitors) combined with RT have been studied in several cancers. The single PI3K inhibitor LY294002 can increase sensitivity of CaP cells to IR through inactivation of PKB (Gottschalk, Doan et al. 2005). Cao et al. demonstrated that the mTOR inhibitor RAD001 (everolimus) can enhance the radiosensitivity on CaP cell lines in vitro (Cao, Subhawong et al. 2006). Another study also showed that the mTOR inhibitors (sirolimus and temsirolimus) confer significant radiosensitisation effects in AR-positive CaP cells when used in the adjuvant setting (Schiewer, Den et al. 2012). These data indicate both PI3K and mTOR are promising targets for CaP RT. In this study, I chose a dual PI3K/mTOR inhibitor BEZ235 to investigate its effect on EMT/CSC phenotypes and radiosensitivity in CaP-RR cells. The reasons to use this dual inhibitor are that 1). Dual PI3K/mTOR inhibitors such as BEZ235 have many advantages over single inhibitors in cancer treatment (Chen 2013) ; 2). BEZ235 is a potent dual pan class I PI3K and mTOR inhibitor that inhibits the growth of CaP (PC-3) and other malignant cells in mouse xenograft models (Maira, Stauffer et al. 2008) ; 3). BEZ235 has been used in a Phase I/II clinical trial for advanced BC patients (NCT00620594) and is promising for future translational research in CaP clinical trials. After treatment with RT alone or combination with a low dose of BEZ235 and RT, I found that the combination treatment can reduce expression of p-Akt, p-mTOR, p-S6K and p-4EBP1 as well as EMT/CSC phenotypes, at the same time, greatly increase radiosensitivity and induce more apoptosis compared to single RT or BEZ235 treatment or untreated control in CaP-RR cells. These results indicate that BEZ325 can greatly improve radiosensitivity and overcome radioresistance in CaP-RR cells through inhibiting PI3K/Akt/mTOR signalling pathway associated with the down-regulation of EMT/CSC expression. My findings further confirm that CaP radioresistance is associated with the EMT and enhanced CSCs phenotypes, activation of the PI3K/Akt/mTOR. My results indicate that targeting EMT, CSCs or PI3K/Akt/mTOR signalling pathway proteins hold promise in CaP RT.

In summary, I demonstrate for the first time that CaP radiosresistance is associated with several mechanisms including EMT, CSCs, activation of the PI3K/Akt/mTOR signalling pathway and checkpoint proteins which result in 161

cancer cell growth, survival, invasion, DNA repair, and metastasis. Combination of a dual PI3K/Akt/mTOR pathway inhibitor (BEZ235) with RT can overcome CaP radioresistance and holds promise for future CaP treatment.

162

4. Identification of protein biomarkers and main signalling pathways involved in CaP radioresistance using label-free LC-MS/MS proteomics approach

163

4.1 Introduction

Based on my literature review in Chapter 1 and findings in Chapter 3, it is critical to identify CaP-RR biomarkers and signalling pathways to predict an individual radiation response, identify therapeutic targets and develop novel adjuvant treatments to overcome radioresistance. The development of proteomic techniques has sparked new searches for novel protein markers for many diseases including CaP. Proteomic techniques allow for a high-throughput analysis of samples with the visualization and quantification of thousands of potential protein and peptide markers. Advances in proteomics, especially in MS have rapidly changed our knowledge of biomarker proteins which have simultaneously led to the identification and quantification of thousands of unique proteins and peptides in a complex biological fluid or cell lysate (Yates, Ruse et al. 2009). Therefore, proteomic techniques can be used for identification of protein biomarkers involved in CaP radioresistance.

Proteomic technology offers a platform for the quantification and the identification of novel RR proteins for developing new therapeutic targets to overcome radioresistance. MS-based technology is one of the most powerful tools for analyzing the proteome. This technique provides molecular information that cannot be gained from gel-based techniques alone such as analyzing proteins with extreme molecular mass/pI, and is complementary to them (Wolff, Otto et al. 2006). Label- free LC-MS/MS is a proteomic technology that combines chromatographic techniques with MS to enhance separation of very complex biological samples by fractionating peptides into discretely eluting ions that the scan rate of mass spectrometers can manage. This allows reproducible, in depth coverage of 1000’s of peptides within very complex samples. It is multidimensional and highly sensitive, and can be used to detect large MW molecules after tryptic digestion (Ocak, Chaurand et al. 2009).

LC-MS/MS has been used to identify biomarkers from serum (Bondar, Barnidge et al. 2007) and tissue samples (Chen, Fang et al. 2011) in CaP patients as well as CaP cell lines (Glen, Gan et al. 2008) for diagnosis and monitoring progression, as 164

well as in lung (Ren, Hao et al. 2013) and brain (Yan, Yang et al. 2012) cancer cell lines for RR markers. To the best of our knowledge, no report has been found in CaP-RR cell lines using this approach.

In Chapter 3, using a low dose fractionated radiation treatment, I have developed three CaP-RR cell lines with increased colony formation, invasion ability, sphere formation capability and enhanced EMT and CSC phenotypes and the activation of the PI3K/Akt/mTOR signalling pathway (Chang, Graham et al. 2013). These CaP- RR cells, representative of the source of CaP metastasis and recurrence after RT, may provide a very good model to mimic a clinical RR condition and to investigate biomarkers and signalling pathway nets for developing novel approaches for CaP treatment.

In this study, I employed LC-MS/MS technique to identify the protein difference between CaP-RR and CaP cells and the main signalling pathways involved in CaP radioresistance. In addition, I validated the potential biomarkers identified in CaP- RR cell lines and CaP-RR s.c xenograft tumours. Furthermore, I used siRNA silencing technique to explore functions of ALDOA protein in radiosensitivity using CaP-RR cells. My results indicate that different proteins and signalling pathways are involved CaP radioresistance and targeting these proteins or pathways holds promise to improve CaP radiosensitivity.

4.2 Material and methods

4.2.1 Antibodies

Antibodies were obtained from different sources. The detailed information and conditions for all antibodies are listed in Table 4-1.

165

Table 4-1 Antibodies used for WB and IHC in this Chapter

Incubation time Antibody Source Type Dilution for WB and IHC Temperature (min) 1:1000 (WB) Rabbit anti-human p-Akt Abcam PAb o/n 4℃ 1:100 (IHC) 1:1000 (WB) Rabbit anti-human p-mTOR Cell Signaling MAb o/n 4℃ 1:50 (IHC) 1:1000 (WB) Rabbit anti-human p-4EBP1 Cell Signaling MAb o/n 4℃ 1:1200 (IHC) Rabbit anti-human p-ERK Abcam PAb 1:1000 (WB) o/n 4℃ Santa Cruz 1:1000 (WB) Rabbit anti-human MCT1 PAb o/n 4℃ Biotechnology 1:50 (IHC) Santa Cruz 1:1000 (WB) Rabbit anti-human MCT4 PAb o/n 4℃ Biotechnology 1:50 (IHC) 1:1000 (WB) Rabbit anti-human CD147 Invitrogen PAb o/n 4℃ 1:25 (IHC) 1:1000 (WB) Mouse anti-human VEGF VG-1 Abcam MAb o/n 4℃ 1:50 (IHC)

166

1:1000 (WB) Rabbit anti-human VEGF R2 Abcam PAb o/n 4℃ 1:250 (IHC) 1:1000 (WB) Rabbit anti-human p-Chk 1 Abcam PAb o/n 4℃ 1:200 (IHC) 1:1000 (WB) Rabbit anti-human p-Chk 2 Abcam PAb o/n 4℃ 1:100 (IHC) 1:500 (WB) Rabbit anti-human ALDOA Abcam PAb o/n 4℃ 1: 50 (IHC) Merck Mouse anti-GAPDH MAb 1:600 (WB) o/n 4℃ Millipore Santa Cruz Goat anti-rabbit lgG-HRP lgG 1:5000(WB) 45 rt Biotechnology Santa Cruz Goat anti-mouse lgG-HRP lgG 1:5000(WB) 45 rt Biotechnology Goat anti-rabbit immunoglobulins/HRP Dako PAb 1:100 (IHC) 45 rt Rabbit anti-mouse Dako PAb 1:100 (IHC) 45 rt immunoglobulins/HRP Notes: MAb: monoclonal antibody; PAb: polyclonal antibody; o/n: overnight; WB: western blotting; IHC: immunohistochemistry.

167

4.2.2 Cell line and cell culture

Three CaP-RR cell lines (PC-3RR, DU145RR and LNCaPRR) were developed and confirmed in Chapter 3 (Chang, Graham et al. 2013). All cell lines used were cultured following the method in Chapter 2.3.1.

4.2.3 LC-MS/MS proteomics study

LC-MS/MS analysis was performed to compare the differences between CaP and CaP-RR cell lines and identify the protein with significant differences. All the procedures in LC-MS/MS study are detailed in Chapter 2.3.18.

4.2.4 WB analysis

Protein expression levels in CaP and CaP-RR cells were determined by WB as previously described in Chapter 2.3.12. Different primary antibodies are listed in Table 4-1.

4.2.5 S.c CaP xenograft model development

The s.c CaP models were established following the previous method in Chapter 2.3.20.1. At the end of experiments (8 weeks post cell inoculation), CaP xenografts were removed and formalin fixed for IHC.

4.2.6 Radiation treatment on animal models

Radiation treatment procedure is detailed in Chapter 2.3.23.

4.2.7 IHC assay

Standard immunoperoxidase procedures were used in CaP animal xenograft tissues using the previous described method (see details in Chapter 2.3.28). 168

4.2.8 SiRNA transfection

PC-3RR (androgen non-responsive) and LNCaPRR (androgen responsive) cells were KD by 30 µM ALDOA-siRNA or scrambled (scr)-siRNA, respectively, using LipofactAMINE 2000 (Invitrogen, VIC, Australia) following the previous described method (Chapter 2.3.19). The optimised incubation time for each cell line with ALDOA-siRNA or scr-siRNA was 72 h, which was determined by WB.

4.2.9 Colony assay

The clonogenic assay was performed as the previously described method (Chapter 2.3.8). PC-3RR and LNCaPRR were treated with scr-siRNA, ALDOA-siRNA, 6 Gy RT or combination with ALDOA-siRNA and 6 Gy RT.

4.2.10 AO/EB assay

PC-3RR and LNCaPRR CaP cells were treated with scr-siRNA, ALDOA-siRNA, 6 Gy RT or combination of ALDOA-siRNA and 6 Gy RT, followed by staining with the DNA-binding agents AO/EB (Sigma-Aldrich Pty Ltd) as the previously described method (Chapter 2.3.15.1) .

4.2.11 Assessment of immunostaining

Staining intensity (0-3) in CaP cell lines and animal xenografts were assessed and the criteria used for assessment were as previously described in Chapter 2.3.29.

4.2.12 Statistical analysis

Statistical analysis details are described in Chapter 2.3.30.

169

4.3 Results

4.3.1 Proteomic analysis of differences between CaP and CaP-RR cells The differentially expressed proteins between CaP and CaP-RR cell lines were identified and quantitated by a Progenesis software. The entire process of LC- MS/MS is briefly summarised and shown in Figure 4-1. CaP and CaP-RR cells were obviously separated in the principal component analysis (PCA) (upper) (Figure 4-2) and the separation of identified proteins in CaP-RR cells is demonstrated in the hierarchical cluster analysis with over-expression and under- expression (lower) (Figure 4-2). For proteomic protein profile analysis, a total of 302 significant proteins abundance changes (P<0.05) were identified between PC- 3 and PC-3RR cells, 394 proteins between DU145 and DU145RR cells and 361 proteins between LNCaP and LNCaPRR cells. Each protein was assigned a GI number from Progenesis software, identified by Mascot. For signalling pathway analysis, a total of 309 pathway proteins identified were mapped to be statistically significant between CaP (PC-3, DU145 and LNCaP) and CaP-RR (PC-3RR, DU145RR and LNCaPRR) cells (P≤ 0.05, fold differences>1.5, sort using >80% power) by Ingenuity Software. Of the 309 proteins, 19 proteins were found to be overlapped among three paired cell lines such as ALDOA, Alpha-2-HS- glycoprotein precursor (AHSG), Vimentin, Tyrosine 3- monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon (YWHAE), Peroxiredoxin 6 (PRDX6) (Figure 4-3 and Table 4-2).

Figure 4-1 A schematic diagram showing the brief procedure of LC-MS/MS from protein preparation to data analysis 170

171

Figure 4-2 Identification of protein differences between CaP and CaP-RR cells A typical graph is shown for the separation of CaP cells (PC-3, DU145 and LNCaP, gray dots) and CaP-RR cells (PC-3RR, DU145RR and LNCaPRR, blue dots) from each other in the Progenesis LC-MS principal component analysis (A). A typical graph is shown for the separation of proteins in CaP cells (PC-3, DU145 and LNCaP) with under-expression (dark blue) and in CaP-RR (PC-3RR, DU145RR and LNCaPRR) cells with over-expression (soft blue) (B).

Figure 4-3 Distribution of identified proteins in each pair CaP cell lines A venn diagram shows the proteins identified from CaP and CaP-RR cells by LC- MS/MS, and the overlapped proteins among three pairs of cells (PC-3 and PC- 3RR, DU145 and DU145RR, LNCaP and LNCaPRR).

172

Table 4-2 19 proteins overlapped among three paired cell lines and involved in CaP metastasis, progression, signalling pathways and radioresistance

Gene Symbol Gene Title ALDOA aldolase A, fructose-bisphosphate AHNAK AHNAK nucleoprotein AHSG alpha-2-HS-glycoprotein precursor ATP synthase, H+ transporting, mitochondrial Fo ATP5H complex, subunit d EIF4B eukaryotic translation initiation factor 4B EIF4H eukaryotic translation initiation factor 4H FABP5 fatty acid binding protein 5 (psoriasis-associated) HINT1 histidine triad nucleotide binding protein 1 HSPD1 heat shock 60kDa protein 1 (chaperonin) LGALS3 lectin, galactoside-binding, soluble, 3 LRRC59 leucine rich repeat containing 59 PLIN3 perilipin 3 proteasome (prosome, macropain) subunit, alpha PMSB8 type, 8 PRDX6 peroxiredoxin 6 RCN2 reticulocalbin 2, EF-hand calcium binding domain RPL3 ribosomal protein L3 RPS21 ribosomal protein S21 Vimentin Vimentin tyrosine 3-monooxygenase/tryptophan 5- YWHAE monooxygenase activation protein, epsilon

173

4.3.2 Important signalling pathways in CaP-RR cells

In order to determine the pathways altered in CaP-RR cells in different paired cell lines, the differentially expressed proteins were entered into IPA for analysis to find which protein is associated with signalling pathways. Of 302 profile proteins identified from PC-3 and PC-3RR paired cell lines, only 151 proteins were mapped and found to be associated with pathways by Ingenuity software, which included 68 up-regulated proteins (45%) and 83 down-regulated proteins (55%) (Figure 4-4). The main protein locations of these 151 proteins identified included 85 cytoplasm (56%) and 33 nucleus (22%), 14 plasma membrane (9%) and 6 extracellular space (4%) (Figure 4-5). The cellular molecular function analysis revealed that there were 33 enzymes (22%), 15 transporters (10%), 14 transcription regular (9%) and 7 kinase/peptidase/ phosphatases (4%) (Figure 4- 6). Similarity, there were 180 mapped proteins out of 394 proteins in DU145 and DU145RR paired cell lines including 89 up-regulated proteins (49%) and 91 down-regulated proteins (51%)( Figure 4-4). The main protein locations of those 180 mapped proteins were 105 cytoplasm (59%), 33 nucleus (21%), 11 plasma membrane (6%) and 13 extracellular space (7%) (Figure 4-5), and the cellular molecular functions were comprised of 42 regular enzymes (23%), 13 kinase/peptidase (7%), 11 transporters (6%) and 9 transcription regular (5%) (Figure 4-6). Meanwhile, of 361 profile proteins identified from LNCaP and LNCaPRR paired cell lines, 163 proteins were mapped and contained 93 up- regulated proteins (57%) and 70 down-regulated proteins (43%) (Figure 4-4). The main protein locations of 163 mapped proteins were 94 cytoplasm (58%), 35 nucleus (21%), 11 plasma membrane (7%) and 12 extracellular space (7%) (Figure 4-5), and the cellular molecular functions comprised 38 regular enzymes (23%), 11 kinase/peptidase/ phosphatases (6%), 11 transporters (7%) and 9 transcription regular (6%) (Figure 4-6).

174

Figure 4-4 Expression profiles of the identified proteins between CaP and CaP-RR cell lines

Figure 4-5 Subcellular distribution of the identified proteins between CaP and CaP-RR cell lines

175

176

Figure 4-6 Functional categories of the identified proteins between CaP and CaP-RR cell lines (PC-3 VS PC-3RR (A), DU145 VS DU145RR (B), LNCaP VS LNCaPRR (C))

IPA analysis revealed that many important cancer-related signalling pathways were involved in each paired cell lines. We displayed the P-value and ratio of our interested top five pathways associated with CaP radioresistance including PI3K/Akt/mTOR, VEGF, glycolysis, cell cycle, ERK pathways (Figure 4-7). The diagram demonstrating the association of these five pathways with radioresistance is shown in Figure 4-8. The heatmaps for each paired cell lines are shown in Figure 4-9. The heatmaps demonstrate that radioresistance may affect small molecular biology, cell to cell signalling, cell morphology in CaP.

177

Figure 4-7 Identification of the top five potential pathways associated with CaP radioresistance The P value and ratio of the identified top five potential pathways are displayed by IPA core analysis between CaP (PC-3, DU145 and LNCaP) cells and CaP-RR (PC-3RR, DU145RR and LNCaPRR) cells. The identified top five signalling pathways include PI3K/Akt, VEGF, glycolysis, cell cycle and ERK.

178

Figure 4-8 Diagram showing that radiotherapy associated signalling pathways in CaP-RR cells The PI3K/Akt/mTOR, VEGF, glycolysis, cell cycle, ERK pathways are involved in CaP radioresistance.

179

Figure 4-9 The heatmaps show the disease and function pathways between CaP and CaP-RR cell lines The map demonstrates that radioresistance is associated with some small molecules, cell to cell signalling, cell morphology in CaP.

4.3.3 Establishment of s.c CaP xenograft models and confirmation of radioresistance

S.c animal models were established using PC-3-luc and PC-3RR-luc cell lines. When tumours reached around 60±10 mm3 at 5 weeks post cell inoculation, mice were treated with 6 Gy fractioned radiation and observed up to 8 weeks. During observation, there was no significant difference of tumour growth found post 5 weeks cell inoculation in both PC-3-luc and PC-3RR-luc xenograft tumours (4.0x109±5.6x108 p/s in PC-3-luc tumours vs 5.61x109±7.6x108 p/s in PC-3RR- luc tumours, P>0.05) while after fractionated radiation treatment in week 5, tumour growth in PC-3-luc tumours was found to be significantly regressed 180

compared with that in PC-3RR-luc tumours at the end of experiment (week 8, P<0.05). Representative BLI images, tumour growth and tumour weight changes showing tumour development in s.c model are shown in Figure 4-10.

181

Figure 4-10 Comparison of PC-3-luc and PC-3RR-luc tumour development post cell inoculation in s.c animal xenograft models

(A) Representative BLI images showing PC-3-luc and PC-3RR-luc tumour development in s.c model from week 1 to week 8 post cell inoculation. Mice were exposure to radiation in week 5. (B) S.c tumour growth for each cell line is represented by total bioluminescent photons/second. (C) Representative images for mice bearing tumour from PC-3-luc and PC-3RR-luc s.c cell inoculation are shown. (D) Representative images showing tumour sizes from PC-3-luc and PC- 3RR-luc s.c cell inoculation. (E) At the end of experiments, tumour weight from PC-3RR-luc cell inoculation was obviously increased compared to that from PC- 3-luc cell inoculation in s.c models. * indicates P<0.05. n=10 mice in each group (PC-3-luc and PC-3RR-luc). All results were from three independent experiments (Mean ± SD, n=3).

182

4.3.4 Validation of key signalling pathway proteins in CaP cell lines and animal xenografts

To confirm the link between the main proteins from PI3K/Akt/mTOR, VEGF, glycolysis, cell cycle and ERK signalling pathways identified and CaP radioresistance, the expression of representative proteins from each pathway was examined in CaP and CaP-RR cell lines by WB, and in PC-3-luc and PC-3RR-luc s.c. animal xenografts by IHC, respectively. The expression of p-Akt, p-mTOR, p- 4EBP1, VEGF (VG-1), VEGF(R-2), MCT1, MCT4, CD147, p-Chk1, p-Chk2 and p-ERK was found to be significantly increased in CaP-RR cells compared to CaP (control) cells (Figure 4-11). In addition, the increased expression of p-Akt, p- mTOR, p-4EBP1, VEGF (VG-1), VEGF(R-2), MCT1, MCT4, CD147, p-Chk1, p-Chk2 and p-ERK was also found in PC-3-RR-luc s.c animal xenografts compared to PC-3-luc s.c animal xenografts using IHC (Figure 4-12). The IHC staining results are summarised in Table 4-3. These findings indicate the identified signalling pathways play important roles in CaP radioresistance.

4.3.5 Verification of potential marker ALDOA in CaP cell lines and animal xenografts

ALDOA protein was identified to be associated with radioresistance in three paired CaP cell lines (Table 4-2) (P<0.05) as well as in glycolysis signalling pathway (Figure 4-7). Therefore, I chose ALDOA marker for further validation in CaP and CaP-RR cells as well as in PC-3-luc and PC-3RR-luc s.c xenografts to find whether it is suitable as a therapeutic target to improve CaP radiosensitivity. As shown in Figure 4-13, the increased expression of ALDOA was found in CaP- RR cells compared to CaP cells, which is consistent with my proteomic analysis results (Figure 4-14). To examine the relevance of this finding in animal study, I detected the expression of ALDOA in PC-3-luc and PC-3-RR-luc s.c xenografts and found the expression of ALDOA was obviously increased in PC-3RR-luc s.c tumour xenografts compared with that in PC-3-luc xenografts (Figure 4-15). The immunostaining results on two s.c animal xenograft tumours are summarised in 183

Table 4-4. All data from proteomics analysis, WB and IHC support that ALDOA is associated with CaP radioresistance.

Figure 4-11 Validation of key pathway proteins from top five pathways identified from CaP-RR cell lines The expression of p-Akt, p-mTOR, p-4EBP1, VEGF (VG-1), VEGF(R-2), MCT1, MCT4, CD147, p-Chk1, p-Chk2 and p-ERK (pathway associated proteins) was increased in CaP-RR (PC-3RR, DU145RR and LNCaPRR) cells compared with CaP (PC-3, DU145 and LNCaP) cells. β-tubulin was used as a loading control. All data were from three independent experiments (n=3).

184

185

Figure 4-12 Validation of key pathway proteins from top five pathways identified from PC-3RR-luc s.c xenograft tumours Representative images showed increased expression of p-Akt, p-mTOR, p- 4EBP1, VEGF VG-1, VEGF R-2, MCT1, MCT4, CD147, p-Chk1, p-Chk2 and p- ERK (pathway associated proteins) in PC-3 and PC-3RR s.c xenografts using IHC. Brown indicates positive staining while blue indicates nuclear staining. Magnification in all images x 400. All data were from three independent experiments (n=3). 186

Table 4-3 Intensity of the representative proteins from top four interested pathways in PC-3-luc and PC-3RR-luc animal xenografts by IHC

Tumour IHC

VEGF p-Akt p-mTOR p-4EBP1 VEGF VG-1 MCT1 MCT4 CD147 p-Chk1 p-Chk2 p-ERK R-2

PC-3-luc tumour 2 2 1 1 1 0 1 0 1 1 0 1

PC-3RR 3 3 2 3 3 2 2 3 3 3 3 2 -luc tumour Note: The criteria for assessment were as follows: 0 (negative, <25%); 1 (weak, 25–50%); 2 (moderate, 50–70%); 3 (strong, >75%) of the tumour cells stained.

187

Figure 4-13 Validation of ALDOA in CaP-RR cell lines The expression of ALDOA (potential marker) was increased in CaP-RR (PC- 3RR, DU145RR and LNCaPRR) cells compared with CaP (PC-3, DU145 and LNCaP) cells. β-tubulin was used as a loading control.

Figure 4-14 The comparison of ALDOA protein in CaP (PC-3, DU145 and LNCaP) and CaP-RR (PC-3RR, DU145RR and LNCaPRR) cells using LC- MS/MS

188

Figure 4-15 Validation of ALDOA in PC-3RR-luc s.c xenograft tumours The expression of ALDOA in PC-3 and PC-3RR s.c xenografts using IHC. Brown indicates positive staining while blue indicates nuclear staining. Magnifications in all images x 400.

Table 4-4 Expression of ALDOA in PC-3-luc and PC-3RR-luc animal xenografts by IHC

Tumour IHC

ALDOA

PC-3-luc tumour 1

PC-3RR-luc tumour 3

Note: The criteria for assessment were as follows: 0 (negative, <25%); 1 (weak, 25–50%); 2 (moderate, 50–70%); 3 (strong, >75%) of the tumour cells stained.

189

4.3.6 Combination therapy with suppression of ALDOA and RT increases radiosensitivity and induces more apoptosis in CaP-RR cells

To investigate whether KD of ALDOA sensitised CaP-RR cells, colony assay was performed in CaP-RR cells (PC-3RR and LNCaPRR) with the treatment of either scr-siRNA, ALDOA-siRNA alone, 6 Gy RT alone or combination with ALDOA- siRNA and 6 Gy RT. The number of colonies with combination treatment of KD of ALDOA and 6 Gy RT consistently showed significant reduction in two CaP- RR cells compared to the treatment with KD of ALDOA or 6 Gy RT alone as well as the untreated CaP-RR control cells (P<0.05) (Figure 4-16). Although KD of ALDOA or 6 Gy RT alone treatment caused the reduction of colony assay in PC- 3RR and LNCaPRR cells compared with the untreated PC-3 and LNCaP control cells, no significant difference was found between these two single treatments (P>0.05). The typical images for colony formation from different treatments are shown in Figure 4-16. In addition, combination of KD of ALDOA and 6 Gy RT induced more apoptotic cells, when compared to KD of ALDOA alone, 6 Gy RT alone as well as untreated control (Figure 4-17). The staining results are summarised in Table 4-5. These findings indicate that suppression of ALDOA could increase radiosensitivity of CaP-RR (PC-3RR and LNCaPRR) cells.

190

Figure 4-16 The effect of ALDOA suppression on radiosensitivity of CaP-RR cells by colony assay Colony formation was significantly reduced in combination treatment with KD of ALDOA and RT (6 Gy) compared with KD of ALDOA, 6 Gy RT alone or untreated control in CaP-RR (PC-3RR and LNCaPRR) cells (*, P<0.05). Typical images of colony growth for the different treatments are shown. All data were from three independent experiments (Mean±S.D, n=3).

191

Figure 4-17 The effect of ALDOA suppression on radiosensitivity of CaP-RR cells by apoptosis assay Combination of KD of ALDOA with RT (6 Gy) induced more apoptotic cells in CaP-RR cells compared with KD of ALDOA or RT alone or control. Red indicates apoptotic cells while green indicates non-apoptotic cells. Magnification in all images x 400. Representative results are shown. All data were from three independent experiments (Mean±S.D, n=3).

Table 4-5 Expression of PC-3RR and LNCaPRR cell lines after different treatments in CaP-RR cells by IF staining

Cell line IF

ALDOA-KD SCR 6 Gy RT ALDOA-KD +6 Gy RT

PC-3RR 1 2 2 3

LNCaPRR 0 2 2 3

Note: The criteria for assessment were as follows: 0 (negative, <25%); 1 (weak, 25–50%); 2 (moderate, 50–70%); 3 (strong, >75%) of the tumour cells stained.

192

4.4 Discussion

Radioresistance is a main challenge for the current CaP radiotherapy. Identifying protein changes and signalling pathways related to CaP radioresistance is critically important to find therapeutic targets, predict radiation response, develop novel treatment approaches and overcome recurrence after RT. The establishment of RR cancer cell lines is an important step in providing an in vitro model for understanding the mechanism of radioresistance and for identifying new therapeutic targets. In the current study, in comparision of three established CaP- RR cell lines with CaP parental cell lines, I successfully identified 19 protein differences and 5 significant signalling pathways involved in CaP radioresistance using a label-free LC-MS/MS proteomic technique. In addition, the identified main pathways proteins and one selected important protein ALDOA were further validated in CaP-RR cell lines and PC-3RR xenografts by WB and IHC, respectively. Furthermore, the ALDOA was functionally verified in CaP-RR cells for increasing radiosensitivity. These findings indicate that targeting these pathways or ALDOA can overcome CaP radioresistance, and improve the prognosis of CaP patients with RT.

Proteomic-based approaches have the potential to provide more insight into the underlying molecular mechanisms of the disease and also hold great promise for biomarker discovery in CaP. Several proteomic technologies have recently been applied to investigate CaP biomarker discovery. 2D-DIGE was used to analyze protein expression in serum samples from CaP patients (Byrne, Downes et al. 2009, Qingyi, Lin et al. 2009) and to compare the differences between CaP and RR cell lines (Skvortsova, Skvortsov et al. 2008). 2D chromatography and MS/MS was carried out to proteomically characterise the conditioned media from CaP cell lines and identify novel candidates which may be useful as diagnostic, prognostic or predictive serological markers for CaP (Sardana, Jung et al. 2008). Label-free LC-MS/MS is a quantification method that can identify and quantify peptides and proteins in complex biological samples for none targeted analysis research. It can be used to discover the global profiling of proteins of CaP patient serum samples (Morrissey, O'Shea et al. 2013). Thus, I performed this study by 193

label-free LC-MS/MS technology.

After comparing three paired CaP cell lines and CaP-RR cell lines, I identified protein difference varying from 302 to 394. To investigate the association of identified protein profiles with signalling pathway proteins, I found 151/302, 180/394, 163/361 proteins were mapped with pathway proteins in paired PC3/PC- 3RR, DU145/DU145RR and LNCaP/LNCaPRR cell lines, respectively, indicating the link of the identified proteins with signalling pathways. These mapped proteins were found to be up-regulated or down-regulated, with different locations in CaP cells including cytoplasm, nucleus, plasma membrane, extracellular space, kinase/peptidase/ phosphatases, transporters and transcription regular. My results indicate that the proteins differentially expressed in CaP and CaP-RR cells are associated with signalling pathways which demonstrate multiple functions in CaP radioresistance, suggesting it is important to investigate these functions in the future studies.

In this study, 19 proteins identified were overlapped among three paired cell lines, which were involved in different functions including glycolysis, EMT, signal transaction and redox. ALDOA was reported to affect glycolysis pathway in PC-3 cells (Teiten, Gaigneaux et al. 2012) and AHSG is a tumour antigen found in glioblastoma, breast cancer and pancreas cancer (Mintz, Rietz et al. 2015). As glycolytic proteins, ALDOA and AHSG were both up-regulated in CaP-RR cell lines analysised by LC-MS/MS, indicating glycolysis is up-regulated in CaP radioresistance. Recent studies demonstrated that EMT affects therapeutic resistance (Fillmore and Kuperwasser 2008). Vimentin is a symbol of the acquisition of mesenchymal characteristics. In this study, fold changes (2, 6. and 7) of Vimentin were found to be increased in CaP-RR (PC-3RR, DU145RR, LNCaPRR) cells compared with CaP (PC-3, DU145 and LNCaP) cells, respectively, indicating that EMT is correlated with CaP radioresistance. This result is also in line with our previous report (Chang, Graham et al. 2013). YWHAE gene belongs to the 14-3-3 family that is involved in metabolism, protein trafficking, signal transduction, evasion of apoptosis, cell cycle regulation, cell death and mitogenesis (Aitken 1995, Zha, Harada et al. 1996). PRDX6 is 194

located in the cytosol and functions as antioxidant and regulator of hydrogen peroxide-mediated signalling (Kim, Jo et al. 2008). Li et al demonstrated that YWHAE and PRDX6 were found to be up-regulated in highly metastatic BC cells by WB and IF (Li, Wang et al. 2006, Fillmore and Kuperwasser 2008). In addition, over-expression of PRDX6 was reported to be significantly correlated with the presence of lymph node metastasis in BC (Chang, Li et al. 2007). In this study, high levels of YWHAE and PRDX6 expression were identified in CaP-RR cell lines compared with CaP cells, indicating both markers are associated with CaP radioresistance. All in all, my findings suggest that the identified common proteins from three paired cell line are associated with CaP metastasis, progression, signalling pathways and radioresistance (Li, Wang et al. 2006).

Accumulating evidence from human CaP tissues and preclinical studies demonstrates that the important signalling pathways play a critical role in CaP progression, metastasis and chemo-/radio-resistance via the activation of the pathway proteins or mutation, deletion, epigenetically silence of some pathway genes (Singh-Gupta, Zhang et al. 2009, Chang, Graham et al. 2013). PI3K/Akt/mTOR pathway regulates cell growth and proliferation and is often dysregulated in cancer due to mutation, amplification, deletion, methylation and post-translational modifications. This pathway is an intracellular signalling pathway important for apoptosis, malignant transformation, tumour progression, metastasis and radioresistance (Chang, Graham et al. 2013, Ni, Cozzi et al. 2013). In the study, I found PI3K/Akt/mTOR signalling pathway is one of top 5 pathways associated with CaP radioresistance. This finding is consistent with our previous results in CaP-RR cell lines with WB analysis (Chang, Graham et al. 2013). In addition, I also demonstrated that combination of dual PI3K/mTOR inhibitors with RT could overcome CaP radioresistance in vitro (Chang, Graham et al. 2014). My results here further confirmed that this pathway could be used as therapeutic targets for CaP radiotherapy.

VEGF signalling pathway which is stimulated by upstream activators including environmental cues, growth factors, oncogenes, cytokines and hormones is a critically important growth factor pathway stimulates vasculogenesis and 195

angiogenesis. Over-expression of VEGF contributes to the growth and metastasis of solid cancers and inhibition of VEGF pathway offers potential clinical treatment for patients (Giles 2001). It was reported that radioresistance is linked with VEGF-VEGFR-2 (KDR) interplay in glioblastoma cells (Knizetova, Ehrmann et al. 2008). Miyasaka et al demonstrated that PI3K/mTOR pathway inhibition could overcome radioresistance via suppression of the HIF1-α/VEGF pathway in endometrial cancer and targeting the PI3K/mTOR or HIF-1α pathways could improve radiosensitivity (Miyasaka, Oda et al. 2015). The radiation- enhanced VEGF secretion with an increased angiogenic potential of the tumour may be a factor in radioresistance (Hovinga, Stalpers et al. 2005). Blocking radiation-induced VEGF pathway in CaP could interfere with tumour growth (Singh-Gupta, Zhang et al. 2009). Several similar evidence was also demonstrated in HNSCC (Affolter, Fruth et al. 2011, Drigotas, Affolter et al. 2013). My current study further confirmed that VEGF pathway is involved with CaP radioresistance.

Glycolysis pathway, located in the cytoplasm of eukaryotic cells, is the metabolic pathway which is responsible for the production of adenosine triphosphate (ATP) through the degradation of glucose. Tumour process could be caused by energy metabolism resulted from the increased glycolytic pathway (Seyfried and Shelton 2010). Meng et al recently reported that targeting pyruvate kinase M2 (a key regulator of glycolysis) contributes to radiosensitivity of non-small cell lung cancer cells in vitro and in vivo (Meng, Wang et al. 2015). Shimura et al found that AKT-mediated enhanced aerobic glycolysis causes acquired radioresistance by human tumour cells (Shimura, Noma et al. 2014). Lactate dehydrogenase 5 isoenzyme, a marker of tumour anaerobic metabolism, is significantly linked to highly proliferating CaP and with biochemical failure and local relapse following RT (Koukourakis, Giatromanolaki et al. 2014). Meijer et al demonstrated that targeting HIF-1 and tumour glucose metabolism at several levels reduced the antioxidant capacity of tumours, affected the tumour microenvironment, and sensitised various solid tumours to irradiation (Meijer, Kaanders et al. 2012). Bing et al also found that glycolysis might impede radiation treatment in RR cancer cell lines (Bing, Yang et al. 2014). In my study, glycolysis pathway was found to be upregulated in CaP-RR cell lines and further confirmed in xenograft tumour 196

tissues and cell lines (see discussion below). These results indicate that glycolysis pathway could be involved in radioresistance in CaP. Thus, targeting glycolysis pathway is likely to have broad therapeutic applications for cancer radioresistance.

Cells in different phases of the cell cycle exhibit differential radiation sensitivity. In general, cells are most sensitive to radiation-induced DNA damage in G2/M phase and most resistant to IR in late S-phase (Pawlik and Keyomarsi 2004). Hoppe et al found that cells were most radiosensitive in G2 and M phases but most RR in S phase, whereas for cells with the long cycle, it also showed radioresistance in early G1(Hoppe, Phillips et al. 2010). Tell et al reported that S phase cells are highly increased in lymphocytes patients showing no response to RT compared with lymphocytes of partial and complete responders (Tell, Heiden et al. 1998). It was reported that Chk1 KD conferred radiosensitisation in CD133+CD44+ prostate CSCs (Wang, Ma et al. 2012). My recent study demonstrated that combination of PI3K/mTOR inhibitors and RT could significantly change cell cycle distribution and increase radiosensitivity in CaP- RR cells (Chang, Graham et al. 2014), indicating the important role of cell cycle in CaP radioresistance. Here, I further confirm that cell cycle is an important pathway associated with CaP radioresistance. These results suggest that management of cell cycle is promising in CaP radiation treatment. ERK pathway is a major player in the response to DNA-damage. Increasing evidence indicates that this pathway is associated with the cellular response to IR, suggesting its role in radioresistance (de la Cruz-Morcillo, Garcia-Cano et al. 2013). ERK pathway was found to be involved in radioresistance in HER2-over- expressing BC cells (Candas, Lu et al. 2014). It was also reported that this pathway was activated in HNSCS radioresistance (Affolter, Fruth et al. 2011) and the expression of p-ERK was found to be decreased using combination treatment of U0126 (the specific ERK1/2 inhibitor) and RT (Drigotas, Affolter et al. 2013). Marampon et al recently demonstrated that a MEK/ERK/Aurora-B axis plays an important role in radioresistance of gynecological cancer cell lines (Marampon, Gravina et al. 2014). Furthermore, It was reported that the inhibition of mitochondrial ATP-sensitive potassium channels suppressed glioma radioresistance by inhibiting ERK activation both in vitro and in vivo (Huang, Li 197

et al. 2014). My current study further confirms that ERK pathway is activated in CaP-RR cell lines by label free LC-MS/MS, indicating that this pathway also plays important role in CaP radioresistance.

To verify the potential biomarkers identified from CaP-RR cell lines, I further validated the selected pathway proteins from the top five signalling pathways associated with CaP radioresistance in three CaP-RR cell lines (PC-3RR, DU145RR and LNCaPRR) and PC-3RR s.c xenograft tumours. The reasons for choosing the s.c RR animal model are that mouse model can be conducted under stringent genetic and environmental control, which has proven beneficial when investigating the fundamentals of cancer biology and biomarker verification (Frese and Tuveson 2007, Whiteaker, Zhang et al. 2007) and that mouse model can mimic human cancers to an ever greater extent. In addition, I confirmed the radioresistance in PC-3RR xenografts by fractioned RT, suggesting that this model is suitable for studying CaP radioresistance and validation of identified CaP-RR biomarkers. In this study, I found significant increase of key pathway proteins including p-Akt, p-mTOR and p-4EBP1 (PI3K/Akt/mTOR); VEGF-VG1 and VEGF R-2 (VEGF); MCT1, MCT4 and CD147 (glycolysis); P- Chk1 and P- Chk2 (Cell cycle), p-ERK (ERK) in CaP-RR cells and PC-3RR-luc xenograft tumours compared to CaP (control) cells and PC-3-luc xenograft tumours, further confirming these 5 signalling pathways play important roles in CaP radioresistance. These findings indicate targeting these signalling pathways combined with RT could improve CaP radiotherapy.

Tumour cell metabolic pathway is an attractive target to eliminate RR cells and improve RT efficacy (Shimura, Noma et al. 2014). Glycolysis is a main catabolic pathway of glucose metabolism, accompanied by ATP synthesis and most cancer cells exhibit increased glycolysis process. More than 30 enzymes are involved in glycolysis. However, the metabolic alterations in CaP radioresistance remain unknown. ALDOA is a glycolytic enzyme and catalyzing the reversible reaction of fructose-1, 6-bisphosphate to glyceraldehydes-3-phosphate and dihydroxyacetone phosphate which is an important part of glycolysis process (Du, Guan et al. 2014). Quantitative analysis of ALDOA in mRNA level was 198

demonstrated in planocellular lung cancer (Oparina, Snezhkina et al. 2013). ALDOA was found to be higher in metastatic lung squamous cell carcinoma (LSCC) compared with primary tumours and the depletion of its expression could reduce the capabilities of cell motility and tumourigenesis (Du, Guan et al. 2014). It was also observed to be up-regulated in oral squamous cell carcinomas and this result was further confirmed by qRT-PCR (Lessa, Campos et al. 2013). Peng et al reported that ALDOA could be a new prognosis biomarker to provide good survival prediction for colorectal cancer patients (Peng, Li et al. 2012). Chen et al showed that the expression of ALDOA was significantly higher in patients with worse survival time than patients with better survival time in human osteosarcoma (Chen, Yang et al. 2014). In addition, over-expression of ALDOA was found in CaP PC-3 docetaxel resistant cell line using the label-free LC-MS method (O'Connell, Prencipe et al. 2012). However, until now, no research has been performed to analyse ALDOA in CaP radioresistance. In the current study, I found over-expression of ALDOA in three CaP-RR cell lines compared with CaP by LC-MS/MS analysis (see Figure 4-14) and confirmed the high level expression of ALDOA in CaP-RR cell lines and PC-3RR xenograft tumours, respectively. To further investigate the value of the ALDOA for future clinical significance, ALDOA was selected for functional studies as a proof of concept. I found that KD of ALDOA combined with 6 Gy RT resulted in significant reduction in colony formation capability and induction more apoptosis, suggesting that ALDOA is a potential marker for CaP radioresistance and could be a potential therapeutic target for clinical treatment of CaP radioresisitance. More work in investigating the role of ALDOA in CaP radioresistance will be performed in our future study.

In conclusion, I have identified a number of differentially expressed proteins and five significant signalling pathways associated with CaP radioresistance using label-free LC-MS/MS proteomic technology. In addition, the key pathway proteins identified and one selected potential protein ALDOA were validated in CaP-RR cell lines and PC-3RR xenografts. Furthermore, targeting ALDOA combined with radiation could increase radiosensitivity in Ca-RR cells. My findings indicate that inhibiting one of these pathways or targeting the identified 199

potential protein biomarkers might greatly improve radiosensitivity and become novel therapeutic treatments.

200

5. PI3K/Akt/mTOR pathway inhibitors enhance radiosensitivity in CaP-RR cells through inducing apoptosis, reducing autophagy, suppressing NHEJ and HR repair pathways

The work in this Chapter has been published in:

Chang L, Graham PH, Hao J, Ni J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. "PI3K/Akt/mTOR pathway inhibitors enhance radiosensitivity in radioresistant prostate cancer cells through inducing apoptosis, reducing autophagy, suppressing NHEJ and HR repair pathways." Cell Death and Disease (2014) 5: e1437.

201

5.1 Introduction

In my previous in vitro study (Chapter 3) and proteomics study (Chapter 4), I found that the activation of PI3K/Akt/mTOR pathway is closely correlated with CaP radioresistance and dual PI3K/mTOR inhibitor BEZ235 could increase raiosensitivity. In addition, due to the important role of the PI3K/Akt/mTOR pathway in cancer research, many valuable inhibitors targeting one protein (single inhibitor) or two proteins at the same time (dual inhibitor) in this pathway have been developed in recent years. Therefore, it is importat to evaluate the importance of these inhibitors and find which inhibitor is the best one as radiosensitiser for future in vivo study snd cliniocal trials. In this chapter, I selected four PI3k/mTOR inhibitors (BEZ235, PI103, BKM120 and Rapamycin) for my in vitro studies.

BEZ235 is a potent dual pan class I PI3K and mTOR inhibitor that inhibits PI3K and mTOR kinase activity and has been used in preclinical studies in many cancers to demonstrate excellent anti-cancer effects (Courtney, Corcoran et al. 2010). In addition, this inhibitor was the first PI3K/mTOR dual inhibitor to enter clinical trials in 2006 (Maira, Stauffer et al. 2009). PI103 is another potent dual pan class I PI3K and mTOR inhibitor and selectively targets DNA-PK, PI3K (p110α), and mTOR (Raynaud, Eccles et al. 2007). BKM120 is a single PI3K inhibitor by inhibiting p110α/β/δ/γ and often results in tumour suppression (Amrein, Shawi et al. 2013) and Rapamycin is a single mTOR inhibitor and has been used in clinical trials against various cancers (Populo, Lopes et al. 2012). No reports have been published to test them in CaP RR cells as radiosensitisers to improve radiosensitivity so far. The mechanisms of these inhibitors in combination with RT in the treatment of CaP are unclear.

Under a low dose radiation treatment, I developed three CaP-RR cell lines with increased colony formation, invasion ability, sphere formation capability and enhanced EMT and CSC phenotypes and the activation of the PI3K/Akt/mTOR signalling pathway (see Chapter 2) (Chang, Graham et al. 2013). In addition, I 202

also found the PI3K/Akt/mTOR pathway is closely linked with EMT and CSCs (Chang, Graham et al. 2013). Therefore, these CaP-RR cells, representative of the source of CaP recurrence after RT, could provide a very good model to mimic a clinical radioresistance condition as well as to examine the efficacy of these single and dual PI3K /mTOR inhibitors for their radiosensitisation effects.

In this Chapter I investigated 1) whether cell cycle distribution, cell cycle checkpoint proteins, apoptosis, autophagy and DNA repair pathways are involved in CaP radioresistance; 2) the link between radiosensitisation effects and cell cycle distribution after treatment with a combination of dual inhibitors (BEZ235 and PI103) and single inhibitors (BKM120 and Rapamycin) with RT in CaP-RR cells in vitro; 3) whether cell death pathways (apoptosis and autophagy), DNA repair pathways (NHEJ and HR) are associated with CaP radiosensitivity after treatment with combination of dual or single inhibitors with RT.

5.2 Material and methods

5.2.1 Antibodies and reagents

Antibodies were obtained from different sources. The detailed information and conditions for all antibodies are listed in Table 5-1. The details for four PI3K/mTOR inhibitors are summarised in Chapter 2.2.5.1.

5.2.2 Cell lines and cell culture

CaP cell lines (PC-3, DU145 and LNCaP), CaP-RR cell lines (PC-3RR, DU145RR and LNCaPRR) and human prostate epithelial cell line (RWPE-1) were used in this study. The information of all cell lines are summarised in Chapter 2.2.2. The cell lines were cultured as previously descripted conditions (Chapter 2.3.1).

203

5.2.3 MTT assay

Cell cytotoxicity was evaluated in CaP (PC-3, DU145 and LNCaP) and CaP-RR (PC-3RR, DU145-RR and LNCaP-RR) cell lines after treatment with inhibitors (BEZ235, PI103, BKM120 and Rapamycin) using MTT assay (Chapter 2.3.14).

The IC50 of each inhibitor in CaP-RR cell lines were calculated.

5.2.4 Flow cytometric analysis for cell cycle distribution

Flow cytometry assay was performed for comparison of cell cycle distribution between CaP cells and CaP-RR or for comparison of the difference after different treatments in CaP-RR cells. The details are described in Charpter 2.3.16.

5.2.5 Colony assay

CaP-RR cells were used for colony forming assays following the method in Chapter 2.3.8. CaP-RR cells were treated with dual or single PI3K/mTOR inhibitors at the respective ½ IC50 concentrations for 24 h and then treated with 6 Gy RT, or treated with 6 Gy RT alone as a control.

5.2.6 Detection of apoptosis

CaP-RR cells were treated with combination treatment with ½ IC50 inhibitor and RT (6 Gy) or single RT (6 Gy) or vehicle control (Chloroform and DMSO). The treated cells were performed for AO/EB staining and TUNEL assay to evaluate apoptosis (see details in Chapter 2.3.15).

5.2.7 WB analysis

Cultured CaP and CaP-RR cells or CaP-RR cells with different treatments as mentioned above in flow cytometry analysis (Chapter 5.2.4) were prepared. Protein expression levels were determined by WB as previously described (Chapter 2.3.12). Different primary antibodies used are shown in Table 5-1. 204

5.2.8 Statistical analysis

Statistical analysis details are described in Chapter 2.3.30.

Table 5-1 Antibodies used for WB in this Chapter.

Incubation Antibody Source Type Dilution Temperature time (min) Rabbit anti- Abcam PAb o/n 4℃ human Ki67 1:1000 Mouse anti- Abcam MAb o/n 4℃ human p53 1:1000 Mouse anti- Abcam MAb o/n 4℃ human p53 1:1000 Rabbit anti- Abcam PAb o/n 4℃ human p21 1:2000 Rabbit anti- Abcam MAb o/n 4℃ human CDK1 1:1000 Rabbit anti- Abcam PAb o/n 4℃ human p-CDK1 1:1000 Rabbit anti- Abcam PAb o/n 4℃ human Chk1 1:500 Rabbit anti- Abcam PAb o/n 4℃ human p-Chk1 1:1000 Rabbit anti- Abcam PAb o/n 4℃ human Chk2 1:500 Rabbit anti- Abcam PAb o/n 4℃ human p-Chk2 1:1000 Rabbit anti- Abcam PAb o/n 4℃ human Rb 1:1000 Rabbit anti- Cell Signaling MAb o/n 4℃ human p-Rb 1:1000 Rabbit anti- human Caspase-3 Abcam PAb 1:500 o/n 4℃ (Active) Rabbit anti- human Caspase-7 Abcam PAb 1:2000 o/n 4℃ (Active)

205

Rabbit anti- human Cleaved Abcam MAb 1:1000 o/n 4℃ PARP-1 Mouse anti- Abcam MAb o/n 4℃ human Bcl-2 1:1000 Rabbit anti- Abcam MAb o/n 4℃ human Bcl-xl 1:1000 Rabbit anti- Abcam MAb o/n 4℃ human Bax 1:1000 Rabbit anti- Cell Signaling PAb o/n 4℃ human Beclin-1 1:1000 Rabbit anti- Abcam PAb o/n 4℃ human LC3A/B 1:400 Mouse anti- Abcam MAb o/n 4℃ human H2AX 1:1000 Rabbit anti- Abcam MAb o/n 4℃ human Ku70 1:1000 Rabbit anti- Abcam MAb o/n 4℃ human Ku80 1:1000 Mouse anti- Abcam MAb o/n 4℃ human BRCA1 1:50 Rabbit anti- Abcam PAb o/n 4℃ human BRCA2 1:1000 Mouse anti- Abcam PAb o/n 4℃ human Rad51 1:1000 Mouse anti- Sigma MAb o/n 4℃ human β-tubulin 1:10000 Mouse anti- Merck MAb o/n 4℃ human GAPDH Millipore 1:600 Goat anti-rabbit Santa Cruz lgG 1:5000(WB) 45 rt lgG-HRP Biotechnology Goat anti-mouse Santa Cruz lgG 1:5000(WB) 45 rt lgG-HRP Biotechnology Notes: MAb: monoclonal antibody; PAb: polyclonal antibody; o/n: overnight;rt: room temperature.

206

5.3 Results

5.3.1 Cell cycle distribution and checkpoint protein changes in CaP-RR cells

The percentage of G0/G1 and S cell populations was significantly increased while the percentage of G2/M cell population was obviously reduced in CaP-RR cells compared to CaP cells in three CaP cell lines (PC-3, DU145 and LNCaP) (P<0.05) (Figure 5-1) but the degree of the cell increase in S population was much less than that in G0/G1 population, suggesting that more CaP-RR cells were arrested in G0/G1 and S phases, and that radioresistance triggered a significant reduction of G2/M arrest accompanied with an increase of G0/G1 and S portions (Figure 5-1). The details of the difference of cell cycle distributions in CaP-RR and CaP cell lines are summarised in Table 5-3.

P53 is negative in PC-3 cells and the expression of both phosphor-p53 (p-p53) and p21 was found to be increased while no difference was found in the expression of p53 in CaP-RR cells compared to CaP cells (Figure 5-2), indicating the p53-p21 axis is activated in CaP-RR cells. The expression of p-CDK1, p- Chk1, p-Chk2 and p-Rb proteins was found to be increased in CaP-RR cells compared with that in CaP cells, whereas no change was found in the expression of CDK-1, Chk1, Chk2 and Rb between CaP-RR and CaP cells (Figure 5-2 and Table 5-4), indicating that cell cycle checkpoint proteins (p-CDK1, p-Chk1, p- Chk2 and p-Rb ) are activated in CaP-RR cells (Figure 5-2).

5.3.2 CaP radioresistance inhibits apoptosis pathway, activates autophagy and both NHEJ and HR DNA repair pathways

The expression of the Caspase-3 (Active), Caspase-7 (Active), Cleaved PARP-1, and Bax proteins was obviously reduced, whereas the expression of Bcl-2 and Bcl-xl proteins was increased in CaP-RR cells compared with CaP cells (Figure 5-3). In addition, the expression of Beclin-1 and LC3A/B, Ku70 and Ku80 as well as BRCA-1, BRCA-2 and Rad-51 was found to be increased in CaP-RR cells 207

compared to CaP cells (Figure 5-3). In the meantime, the H2AX levels (DSB marker) were significantly reduced in CaP-RR cells compared to CaP cells (Figure 5-3). All quantitative results and P values are summarised in Figure 5-4 and Table 5-4.

Figure 5-1 CaP-RR cells induce cell cycle redistribution Cell cycle distributions were analysed by flow cytometry and significant difference was found in G0/G1, S and G2/M phases between CaP-RR and CaP cells ( indicates P<0.05). All data were from three independent experiments (Mean±S.D, n=3).

208

Table 5-2 Difference of cell cycle distribution between CaP and CaP-RR cell lines

Phase

Cell line Condition G0/G1 S G2/M Mean (%) SD Mean (%) SD Mean (%) SD RR 60.1 5.1 29.2 4.0 10.7 2.3 PC-3 control 48.1 3.2 20.4 2.0 31.5 0.3 RR 62.5 6.8 31.1 3.1 6.4 4.1 DU145 control 51.2 5.1 19.2 1.6 29.6 3.2 RR 63.8 3.5 27.1 4.1 9.1 5.2 LNCaP control 52.3 2.2 17.2 2.1 30.5 1.9 Notes: indicates a significant difference was found between CaP and CaP-RR cell lines.

Figure 5-2 CaP-RR cells induce cell cycle pathway proteins Cell cycle related proteins (p53, p-p53, p21, CDK1, p-CDK1, p-Chk1, Chk2, p- Chk2, Rb, p-Rb) were determined by WB and phosphosed proteins (p-p53, p-p21, CDK1, p-Chk1, p-Chk2 and p-Rb) were increased (activated) in CaP-RR cells. GAPDH was used as a loading control. Typical images are shown from three independent experiments (n=3).

209

Table 5-3 Summary of P values for protein fold variation of CaP-RR cells in relative to CaP cells

P value PC-3 VS DU145 VS LNCaP VS Antibodies PC-3RR DU145RR LNCaPRR p53 N/A 0.95 0.99 p-p53 N/A 0.49×10-2 0.77×10-1 p21 2.72×10-6 1.63×10-5 0.23×10-1 CDK1 0.14 0.75 0.97 -5 -3 -3 p-CDK1 1.59×10 0.1×10 0.26×10 Chk1 0.29 0.38 0.49 p-Chk1 2.35×10-5 0.16×10-2 0.14×10-3 Chk2 0.59 0.36 0.53 p-Chk2 1.15×10-8 4.99×10-7 0.51×10-3 Rb 0.79 0.33 0.49 p-Rb 1.07×10-8 1.51×10-11 4.56×10-8 -5 -3 -5 Caspase-3 (Active) 8.12×10 0.18×10 3.64×10 -5 -5 -5 Caspase-7 (Active) 6.08×10 1.54×10 5.93×10 Cleaved PARP-1 0.18×10-3 0.19×10-3 0.69×10-3

Bcl-2 0.44×10-2 5.53×10-5 0.43×10-2 Bcl-xl 0.12×10-2 0.13×10-3 0.2×10-2 Bax 0.11×10-2 0.17×10-2 0.88×10-3 Beclin-1 0.19×10-3 7.78×10-5 8.11×10-5 LC3A/B 0.11×10-2 0.55×10-3 0.86×10-3 -5 -1 -1 H2AX 7.31×10 0.42×10 0.45×10 -2 -5 -5 Ku70 0.22×10 3.62×10 1.9×10 Ku80 0.19×10-3 0.23×10-3 3.56×10-5

BRCA1 2.1×10-5 0.26×10-3 0.12×10-1 BRCA2 0.14×10-3 0.19×10-3 0.46×10-3 RAD51 0.12×10-2 3.97×10-5 5.48×10-5

Note: N/A means “not applicable”.

210

Figure 5-3 CaP-RR cells reduce apoptosis pathway proteins, increase autophagy, NHEJ, and HR pathway proteins Apoptosis proteins Caspase-3 (Active), Caspase-7 (Active), Cleaved PARP-1 and Bax) and DSB marker (H2AX) were reduced, and anti-apoptosis (Bcl-2 and Bcl- xl), autophagy (Beclin-1 and LC3A/B), NHEJ (Ku70 and Ku80) pathway, HR pathway (BRCA1, BRCA2 and RAD51) related proteins were increased (activated) in CaP-RR cells. GAPDH was used as a loading control. Typical images are shown from three independent experiments (n=3).

211

Figure 5-4 Quantification of WB results from CaP and CaP-RR cells The protein expression of p53, P-p53, p21, CDK1, P-CDK1, Chk1, p-Chk1, Chk2, p-Chk2, Rb and p-Rb in CaP and CaP-RR cell lines was normalised by the level of GAPDH (upper image). The protein expression of Caspase-3 (Active), Caspase-7 (Active), Cleaved PARP-1, Bcl-2, Bcl-xl, Bax, Beclin-1,LC3A/B, H2AX, Ku70, Ku80, BRCA1, BRCA2 and RAD51 in CaP and CaP-RR cell lines was normalised by the level of GAPDH (lower image). Results are expressed as mean ± SD (n=3).  indicates the difference between PC-3 and PC- 3RR(P<0.05).  indicates the difference between DU145 and DU145RR(P<0.05).  indicates the difference between LNCaP and LNCaPRR(P<0.05).

212

5.3.3 Cytotoxicity of dual or single inhibitors on CaP and CaP-RR cells in vitro

Each cell line displayed a variable response to four inhibitors after 24–72 h treatments by MTT assay and no cytotoxic effect was found for vehicle control (Chloroform or DMSO) in all cell lines tested. Dose-dependent cell proliferation inhibition by four inhibitors respectively treated for 48 h was observed in each cell lines (Figure 5-5). The IC50 values at 24 h for CaP and CaP-RR cell lines are summarised in Table 5-5. I found that both CaP and CaP-RR cells are more sensitive to four PI3K and mTOR inhibitors than to normal RWPE-1 prostate cells (P<0.05), and that CaP-RR cells are less sensitive to four inhibitors than CaP cells in all CaP cell lines (1.5-2.5 fold) (P<0.05) (Table 5-5). Based on our previously 1 similar studies (Chao, Wang et al. 2013, Xiao, Graham et al. 2013), I chose the /2

IC50 values at 24 h for our following experiments in the current study.

Figure 5-5 Effects of PI3K/mTOR inhibitors by MTT assay Cell growth inhibition for two PI3K/mTOR dual or two single inhibitors was assessed by MTT assay, respectively. Representative survival curves for dual and single inhibitors at 24 h are shown. The results were from three independent experiments (n=3).

213

Table 5-4 IC50 values for dual inhibitors (BEZ235 and PI103) and single inhibitor (BKM120 and Rapamycin) tested by MTT assay in CaP-RR and CaP cell lines for 24 h treatment

Cell line PC-3RR PC-3 DU145RR DU145 LNCaPRR LNCaP RW PE-1

BEZ235 160.2±3.1 80.1±2.3 135.5±5.6 70.3±1.2 100.8±7.2 80.6±0.3 507.5±3.5 (nM)

PI103 273.1±2.8 195.2±0.6 521.2±3.1 230.4±0.3 337.4±4.9 210.7±1.9 742.0±2.4 (nM)

BKM120 48.8±0.5 36.2±0.3 107.3±0.5 87.3±0.8 90.4±2.1 60.3±0.12 112.3±7.0 (µM)

Rapamycin(nM) 61.3±3.5 39.0±1.2 30.1±0.4 12.0±0.01 20.1±0.4 15.8±0.06 95.6±1.6

Notes: IC50 value indicates when a range of inhibitor concentrations were used, the concentration of inhibitor was calculated for 50% cell killing. The results (mean of IC50) are from three independent experiments (n=3).  indicates that a significant difference is found between CaP-RR and CaP cell lines using 4 different inhibitors (P<0.05). indicates that a significant difference is found between prostate normal cell RWPE-1 and CaP cells using 4 different inhibitors (P<0.05).

214

5.3.4 Effect of combination treatment with dual or single PI3K/mTOR inhibitors on colony formation in CaP-RR cells

My results indicate that combination treatment with each dual inhibitor (BEZ235 or PI103) and 6 Gy RT consistently showed significant reduction in colony formation, when compared with the CaP-RR cells treated with combination of each single inhibitor (BKM120 or Rapamycin) and 6 Gy RT or 6 Gy RT alone (P<0.05), and no significant difference was found between two dual inhibitors combination treatments (P>0.05) although the colony number of combination with BEZ235 and RT is slightly lower than that of PI103 with RT (Figure 5-6). No significant difference for colony formation was found between two single inhibitor combination treatments (Figure 5-6) (P>0.05). The typical images for colony formation from different treatments are shown in Figure 5-6.

I found that the colony growth ability of cells with combination of each inhibitor and RT was significantly lower than that with each inhibitor treatment alone (P<0.05). I also compared the plating efficiency of combination of inhibitors and RT to the sum of plating efficiency of inhibitors alone and 6 Gy RT alone, and found the plating efficiency of combination therapy is lower than the sum of the plating efficiency of inhibitors alone and RT alone (P<0.05), indicating that the growth inhibiting effect of the inhibitors is not only due to the direct inhibition but also because of the radiosensitisation effect of the inhibitors. The typical images and data for colony formation from different treatments are shown in Figure 5-7.

215

Figure 5-6 Effects of combination treatment with inhibitors and RT or RT alone on colony formation in CaP-RR cells Colony formation capability was significantly reduced in combination treatment with a dual PI3K/mTOR inhibitor (BEZ235 or PI103) and RT compared with combination of single inhibitor (BKM120 or Rapamycin) and RT or RT alone in CaP-RR cells.  indicates the difference between combination of BEZ235 with RT and combination of single inhibitor (BKM120 or Rapamycin) with RT or RT alone in CaP-RR cells (P<0.05).  indicates the difference between combination of PI103 with RT and combination of single inhibitor (BKM120 or Rapamycin) with RT or RT alone in CaP-RR cells (P<0.05). All data were from three independent experiments (Mean±S.D, n=3).

216

217

Figure 5-7 Effects of combination treatment with inhibitors and RT, RT alone, or inhibitor alone on colony formation of CaP-RR cells (A) Typical images of colony growth for the different treatments are shown. (B) Comparision of colony growth rates after different treatments.  indicates the difference between combination of BEZ235 with RT and BEZ235 alone in CaP- RR cells (P<0.05).  indicates the difference between combination of PI103 with RT and PI103 alone in CaP-RR cells (P<0.05).  indicates the difference between combination of BKM120 with RT and BKM120 alone in CaP-RR cells (P<0.05).  indicates the difference between combination of Rapamycin with RT and Rapamycin alone in CaP-RR cells (P<0.05). All data were from three independent experiments (Mean±S.D, n=3). 218

5.3.5 Comparison of the effect of combination treatment with dual or single PI3K/mTOR inhibitors on apoptosis in CaP-RR cells

The characteristic morphological changes in the treated CaP-RR cells were found by AO/EB staining, which showed typical features of apoptosis in the combination treatment with dual inhibitors and RT including nuclear condensation and fragmentation compared to combination treatment with single inhibitors and RT, and these changes are not shown in 6 Gy RT alone treated CaP- RR cells (Figure 5-8A). The apoptosis detected in AO/EB staining was further confirmed by TUNEL assay (Figure 5-8B). In TUNEL assay, CaP-RR cells treated by dual inhibitors (BEZ235 or PI103) combined with RT displayed significantly characteristic apoptotic morphology with nuclear chromatin condensation and fragmentation while those treated by single inhibitors (BKM120 or Rapamycin) combined with RT showed less apoptotic cells and almost no apoptotic cells were found in CaP-RR cells exposed to 6 Gy RT alone (Figure 5- 8B). The significant differences for TUNEL-positive cells were observed between combination treatment of dual inhibitors (BEZ235 or PI103) with 6 Gy RT and combination treatment of single inhibitors (BKM120 or Rapamycin) with 6 Gy RT or 6 Gy RT alone in CaP-RR cell lines (P<0.05) (Figure 5-8C).

Compared to combination treatment with single inhibitors and RT, combination treatment with dual inhibitors and RT can induce high levels of active capase-3, active caspase-7, and cleaved PARP-1 in three CaP-RR cell lines although all combination treatments including dual inhibitors and single inhibitors with RT increased the expression of the active capase-3, active caspase-7, and cleaved PARP-1 compared to RT alone (Figure 5-9). I also found the increased trend for Bcl-2 and Bcl-xl, and reduced trend for Bax from combination treatment with dual inhibitors and RT, combination treatment with single inhibitors and RT to 6 Gy RT alone in all three CaP-RR cell lines (Figure 5-9).

219

220

Figure 5-8 Effects of combination treatment with inhibitors and RT or RT alone on apoptosis in CaP-RR cells (A)Combination treatment with dual PI3K/mTOR inhibitors and RT induced more apoptotic cells with condensed nuclei (red colour) compared with combination with single PI3K/mTOR inhibitors and RT or RT alone in CaP-RR cells while living cells show green. Typical images for AO/EB staining are shown. Magnification × 60 in all images. (B) Condensed and fragmented nuclear chromatin characteristic of apoptosis was further confirmed by TUNEL assay in combination treatment with dual PI3K/mTOR inhibitors and RT in CaP-RR cells. Arrows indicate nuclei (brown). Cells with brown staining are TUNEL positive cells while blue color indicates normal cancer nuclei. Typical images of TUNEL staining for the different treatments are shown. Magnification × 60 in all images. (C) TUNEL positive cells were significantly reduced in combination treatment with dual PI3K/mTOR inhibitors (BEZ235 or PI103) and RT compared with combination of single inhibitor (BKM120 or Rapamycin) and RT or RT alone in CaP-RR cells (lower image).  indicates the difference between combination of BEZ235 with RT and combination of single inhibitor (BKM120 or Rapamycin) with RT or RT alone in CaP-RR cells (P<0.05).  indicates the difference between combination of PI103 with RT and combination of single inhibitor (BKM120 or Rapamycin) with RT or RT alone in CaP-RR cells (P<0.05). All data were from three independent experiments (Mean±S.D, n=3).

221

Figure 5-9 Effects of combination treatment with inhibitors and RT or RT alone on cell cycle checkpoint, apoptosis, autophagy, DSB, NHEJ and HR pathway related proteins in CaP-RR cells Dual inhibitors (BEZ235 and PI103) combined with 6 Gy RT effectively induced cell cycle redistribution and high levels of apoptosis and DSB proteins, and reduced autophagy and HR pathway proteins in CaP-RR cells compared with the combination of single inhibitors (BKM120 or Rapamycin) with 6 Gy RT. Cell cycle related proteins (p-p53, p21, p-CDK1, p-Chk1, p-Chk2 and p-Rb), anti- apoptosis proteins (Bcl-2 and Bcl-xl), autophagy proteins (Beclin-1 and LC3A/B), DSB marker (H2AX), NHEJ proteins (Ku70 and Ku80) and HR pathway related proteins (BRCA1, BRCA2 and RAD51) were significantly reduced while no change was found in p53, CDK1, Chk1, Chk2 and Rb proteins. Apoptosis pathway proteins (Caspase-3 (Active), Caspase-7 (Active), Cleaved PARP-1, and Bax) were significantly increased in combination with dual inhibitors and RT compared with combination with single inhibitors and RT or RT alone. All protein expression was determined by WB. GAPDH was used as a loading control. Typical images are shown from three independent experiments (n=3).

222

5.3.6 Combination treatment affects cell cycle distribution and inactivates cell cycle checkpoint proteins in CaP-RR cells

I found that the significant reduction in G0/G1 and S phases and obvious increase in G2/M phase were found in combination treatment with dual inhibitors and RT compared to combination treatment with single inhibitors and RT or RT alone in all three CaP-RR cells (P<0.05), that statistical difference was also found between combination treatment with single inhibitors and RT and RT alone for cell cycle distribution in all three CaP-RR cells (P<0.05), and that no difference was seen between two dual inhibitors (or two single inhibitors) with RT (P>0.05) (Figure 5-10). The details of cell cycle redistributions after combination treatments are summarised in Table 5-6.

To investigate the role of checkpoint proteins in cell cycle redistribution in the combination treatment, I found the expression of p-p53 was obviously reduced while no significant change was seen in the expression of p53 in DU145RR and LNCaPRR cell lines after treatment by dual inhibitors with RT as p53 is negative in PC-3 cells. P21 was also found to be reduced in PC-3RR, DU145RR and LNCaPRR after treatment by dual inhibitors and RT (Figure 5-9).

The expression levels of CDK1, Chk1 and Chk2 (two important checkpoint kinases in cell cycle control upon DNA damage) and Rb did not obviously alter in each treatment but combination treatment with dual inhibitors and RT led to markedly diminished level of p-CDK1, p-Chk1, p-Chk2 and p-Rb compared to other treatments in CaP-RR cells (Figure 5-9). The findings from cell checkpoint proteins are consistent with those from cell cycle redistribution after combination treatment.

5.3.7 Effect of combination treatment with dual or single PI3K/mTOR inhibitors on autophagy and DNA repair pathways in CaP-RR cells

223

The expression of Beclin-1 and LC3A/B proteins (autophagy markers) was found to be significantly reduced, whereas H2AX level (DSB marker) was found to be significantly increased in combination treatment with dual inhibitors and RT compared to combination treatment with single inhibitors and RT or RT alone in three CaP-RR cell lines (Figure 5-9). Accordingly, the expression of NHEJ (K70 and Ku80) and HR (BRCA-1, BRCA-2 and Rad-51) repair pathway proteins in combination treatment with dual inhibitors and RT was markedly reduced in CaP- RR cells (Figure 5-9).

Figure 5-10 Effects of combination treatment with inhibitors and RT or RT alone on cell cycle distribution in CaP-RR cells CaP-RR cells were treated with a dual or single inhibitor for 24 h and then treated with 6 Gy RT or directly treated with 6 Gy RT alone and cell cycle distributions were analysed by flow cytometry. Obvious cell cycle arrest in G2/M phase and reduction in G0/G1 and S phases were observed in CaP-RR cells treated with combination with dual inhibitors and RT. In all experiments,  indicates the difference between combination of BEZ235 with RT and combination of single inhibitor (BKM120 or Rapamycin) with RT or RT alone in CaP-RR cells (P<0.05).  indicates the difference between combination of PI103 with RT and combination of single inhibitor (BKM120 or Rapamycin) with RT or RT alone in CaP-RR cells (P<0.05). All data were from three independent experiments (Mean±S.D, n=3).

224

Table 5-5 Cell cycle redistribution after combination with dual or single PI3K/mTOR inhibitors with RT or RT alone in CaP-RR cells

Phase G0/G1 S G2/M Cell line Treatment Mean Mean Mean SD SD SD (%) (%) (%) BEZ235+6 Gy RT 18.8 3.1 11.2 2.2 70.0 0.4 PI103+6 Gy RT 21.7 5.6 13.0 4.0 65.3 2.1 PC-3RR BKM120+6 Gy RT 41.5 3.0 18.0 4.6 38.5 5.0 Rapamycin+6 Gy RT 43.0 3.3 18.8 4.6 38.2 1.6 6 Gy RT 53.1 4.6 23.9 6.7 23 7.8 BEZ235+6 Gy RT 24.0 3.2 13.4 2.1 62.6 8.0 PI103+6 Gy RT 22.9 5.0 14.9 4.0 52.2 9.0 DU145RR BKM120+6 Gy RT 40.5 3.6 22.6 4.2 35.9 9.2 Rapamycin+6 Gy RT 38.0 3.9 23.1 6.3 38.9 6.9 6 Gy RT 45.3 4.4 31.9 7.4 22.8 4.9 BEZ235+6 Gy RT 17.9 2.1 10.1 0.7 72.0 2.6 PI103+6 Gy RT 22.6 9.1 9.5 7.3 67.9 2.7 LNCaPRR BKM120+6 Gy RT 39.1 4.2 18.8 3.4 41.1 6.6 Rapamycin+6 Gy RT 45.1 2.3 17.0 7.6 37.9 5.0 6 Gy RT 62.1 9.5 22.9 6.1 15.0 3.5 Notes:  indicates that a significant difference is found in G0/G1, S and G2/M phases in CaP cells with different treatments using flow cytometry analysis (P<0.05).

5.4 Discussion

In the current study, using CaP-RR model and cancer cell biology techniques, I present novel insight into the effects of a combination treatment with PI3K/mTOR inhibitors and RT as well as the putative mechanisms. In the first step, I demonstrate the association of CaP-RR cells with cell cycle distribution, cell cycle checkpoint proteins, apoptosis and autophagy proteins, DNA repair pathway proteins as shown in Figure 4-11. My findings from the treatment of CaP-RR cells with a combination of two dual PI3K/mTOR inhibitors (BEZ235 and PI103) and RT are summarised in the model presented in Figure 4-12.

225

226

227

Cells in the different phases of the cell cycle exhibit differential radiation sensitivity. In general, cells are most sensitive to radiation-induced DNA damage during G2/M, and cells in late S-phase are the most resistant to ionizing radiation (Pawlik and Keyomarsi 2004). According to Hoppe’ report, cells are most radiosensitive in G2 and M phases but most RR in S phase, while for cells with the long cycle, it also shows radioresistance in early G1(Hoppe, Phillips et al. 2010). Tell et al reported that S-phase cells are highly increased in lymphocytes patients showing no response to RT compared with lymphocytes of partial and complete responders (Tell, Heiden et al. 1998). My current data in cell cycle analysis are consistent with these previous reports and also in line with our previous proliferation study and enhanced CSC phenotypes in these CaP-RR cells (Chang, Graham et al. 2013), as CSCs are quiescent cells with a very lower proliferation rate (Ghaffari 2011).

In our previous study, we demonstrated the p53-p21 axis plays a predominant role in the regulation of cell cycle in CaP RT (Xiao, Graham et al. 2013). P21 protein regulates each cyclin-CDK (such as CDK1) complex at G1 and S phase (Li, Jenkins et al. 1994), inhibiting CDK1 phosphorylation, thereby leading to a G2/M cell cycle arrest (Fukasawa 2008). Chk1/2 activation mediated by p53 phosphorylation leads to G1 arrest (Bartek and Lukas 2001). My current study indicated that the increase of p-p53, p21 and p-Chk1/2 in CaP-RR cells may be in accordance with cell cycle G1 arrest while the enhancement of p-CDK1 in CaP- RR cells could be associated with the reduction of G2/M phases. However, it was reported that p21 activation inhibits p-CDK1 and results in G2/M arrest (Fukasawa 2008), suggesting that p-CDK1 may be regulated by alternative pathway mechanisms and different cancers may be regulated by different pathways. In addition, p-Rb, as an important cell cycle checkpoint protein, was also increased (activated) in CaP-RR cells, indicating this protein is also involved in CaP radioresistance. Rb protein is essential in the G1 phase of the cell cycle and a crucial checkpoint responsible for G2/M arrest of cancer cells to radioresistance (Lohrer 1996). The activation of Rb can also explain the G0/G1 arrest and G2/M reduction. All the findings suggest that a panel of cell cycle checkpoint proteins are responsible for CaP radioresistance. 228

Apoptosis plays a crucial role in cell death after RT, and autophagy is called as “the second apoptosis”. In cancer therapy, the role of autophagy is paradoxical, in which this cellular process may serve as a pro-survival or pro-death mechanism to counteract or mediate the cytotoxic effect of anticancer agents (Zhou, Zhao et al. 2012). My current data support that CaP radioresistance is associated with apoptosis and autophagy pathways and that autophagy promotes CaP-RR cell survival. The schematic diagrams of the correlations between radiotherapy and apoptosis or autophagy in CaP-RR cells are shown in Figure 4-13 and Figure 4- 14, respectively.

229

Figure 5-14 Diagram showing that radiotherapy is associated with induction of autophagy pathway by activation of Becline-1 and LC3A/B in CaP-RR cells

230

The DNA DSB is the principle cytotoxic lesion for ionizing radiation. Two main pathways are responsible for DNA DSB repair which are NHEJ and HR (Jackson 2002). I found that the key proteins including Ku70 and Ku80 (NHEJ pathway) as well as BRCA1, BRCA2 and Rad51 (HR pathway) are activated while the H2AX was reduced in CaP-RR cells, which implies that the NHEJ and HR repair pathways play an important role in the regulation of CaP radioresistance after exposure to RT.

PI3K/Akt/mTOR signalling pathway is important for cancer metastasis and radioresistance. Using a label-free quantitative LC-MS/MS proteomic approach, I identified the PI3K/Akt/mTOR signalling pathway proteins as the main pathway associated with radioresistance in three CaP-RR cell lines (PC-3RR, DU145RR and LNCaPRR) developed in our lab (See Chapter 3), further confirming the importance of this pathway in CaP radioresistance. In the current study, I chose two dual PI3K/mTOR inhibitors (BEZ235 and PI103) and two single inhibitors (BKM120 and Rapamycin) as radiosensitisers to compare their effects in the treatment of CaP-RR cells. The reasons are 1) it was reported that the use of dual inhibitors of PI3K and mTOR is a promising approach and can more efficiently inhibit the PI3K/Akt/mTOR pathway than single PI3K or mTOR inhibitor and produce better treatment outcome;(Chen, Crawford et al. 2013); 2) as 3 out of 4 inhibitors selected in this study have been used in clinical trials, if successful, the combination of these inhibitors and RT can be easily developed in in vivo animal study and clinical trials; 3) we were interested to know whether a combination of a dual inhibitor with RT is more effective than a combination of a single inhibitor with RT for the treatment of CaP-RR cells.

In the current study, I found that both CaP-RR and CaP cells are more sensitive to 4 inhibitors than the normal prostate RWPE-1 cells, and that CaP cells are more sensitive than CaP-RR cells (Table 5-4), suggesting that PI3K/mTOR inhibitors more selectively target cancer cells but not normal cells and that CaP-RR cells are more resistant to these inhibitors. In the next step, I found that combination with dual inhibitors (BEZ235 and PI103) and 6 Gy RT can greatly repress tumour colony growth, induce more apoptosis and improve radiosensitivity compared 231

with combination with dual inhibitors (BMK120 and Rapamycin) and 6 Gy RT (P<0.05). The finding from the reduced colony growth in the combination of dual inhibitors and RT is consistent with the activation of more apoptosis pathway proteins. One possible reason for dual PI3K/mTOR inhibitors inducing more radiosensitivity could be that dual PI3K/mTOR inhibitors have a broader efficacy across more genotypes with proapoptotic effects identified in a wider range of cell lineages compared with agents targeting only one component of the pathway (Serra, Markman et al. 2008, Wallin, Edgar et al. 2011). Another possible reason could be that dual inhibitors of PI3K and mTOR target the active sites of both holoenzymes, inhibiting the pathway both upstream and downstream of Akt, thus avoiding the problem of Akt activation following abolition of the mTORC1-S6K- IRS1 negative feedback loop, which is known to occur with single mTOR inhibitors (Serra, Markman et al. 2008).

Combined together with the reduced colony growth and increased apoptosis, I also found that combination of dual inhibitors (BEZ235 and PI103) with RT greatly changed cell cycle distribution and caused higher cell arrest in G2/M phase (the most sensitive phase to radiation) and reduction of cells in G0/G1 and S phases (the most resistant phases to radiation) compared with combination of single inhibitors (BKM120 and Rapamycin) with RT. The results in cell cycle redistribution were further confirmed by cell cycle checkpoint protein alteration. I found that the levels of p-p53, p21, p-CDK1, p-Chk1, p-Chk2 and p-Rb proteins were much lower in combination of BEZ235 or PI103 and RT compared to combination of BKM120 or Rapamycin with RT or RT alone, which is consistent with G2/M arrest in cell cycle arrest. As p53-p21 axis is important in the regulation of CaP radiosensitivity, the deficiency of p53 in PC-3 cells suggests that p21 may be regulated by alternative mechanisms in this cell line (Xiao, Graham et al. 2013). These results indicate that combination treatment with dual inhibitor and RT can obviously change cell cycle distribution in G0/G1, S and G2/M phases, and greatly affect cell cycle checkpoint proteins, which is consistent with the observations in colony growth and apoptosis.

232

The role of autophagy in RT remains controversial. Chang et al found that induction of autophagy by BEZ235 may be a survival mechanism that counteracts its anticancer effects (Chang, Shi et al. 2013). Using RR pancreatic cancer cell lines, Wang et al showed that reduced levels of the miR-23b increase levels of ATG12 and autophagy to promote radioresistance (Wang, Zhang et al. 2013). In this study, obviously reduced expression of Beclin-1 and LC3A/B in combination of BEZ235 or PI103 with RT compared with single inhibitor combined with RT or RT alone further confirms that autophagy is involved in CaP radioresistance and that reduced autophagy proteins are associated with increased radiosensitivity in CaP-RR cells after combination treatment.

In this study, H2AX was used as a biomarker to measure DNA DSB because H2AX is a highly specific and sensitive molecular marker for monitoring both DSB initiation and resolution (Sak and Stuschke 2010). I found that phosphorylation of histone H2AX was enhanced by combination treatment with dual or single inhibitors and RT, that combination of dual inhibitors with RT induced more DNA breaks and concomitantly greatly reduced the NHEJ and HR repair pathway proteins compared to a single inhibitor combined with RT or RT alone, suggesting that both NHEJ and HR repair pathways are the main DNA repair pathways involved in radiosensitisation effect induced by dual or single inhibitors and RT in CaP-RR cells.

CSCs are becoming recognised as being responsible for metastasis and radioresistance, and thought to be in a relatively quiescent state, therefore evading radiotherapeutic challenges and ‘protecting’ the continuity of the tumour. The CSC model has clinical implications, in that CSCs have been known to contribute to radioresistance predominantly through enhanced levels of DNA repair activity and slow cell cycle kinetics. In this study, our CaP-RR cells with induced EMT and enriched CSCs (Chang, Graham et al. 2013) could be successfully treated with combination of dual PI3K/mTOR inhibitors and RT, suggesting that this combination therapy may target CSCs (“root” of cancer recurrence) to overcome radioresistance and prevent metastasis. Therefore, my current findings may have

233

clinical significance in CaP RT. Studying effects of the combination of dual PI3K/mTOR inhibitor with RT in CaP-RR xenograft animal models are discussed in the following Chapter.

In conclusion, my study demonstrates for the first time that CaP-RR cells are associated with cell cycle arrest in G0/G1 and S phases, inactivation of apoptosis pathway proteins, activation of cell cycle checkpoint, autophagy, NHEJ and HR repair pathway proteins; that combination of the dual PI3K/mTOR inhibitors with RT can greatly repress tumour colony growth, induce more apoptosis and improve radiosensitivity. The putative mechanisms of the radiosensitisation effect in CaP- RR cells in the combination treatment include cell cycle redistribution to a more radiosensitive phase (G2/M) and abolishment of RR cell cycle arrest phase (G0/G1 and S), activation of apoptosis death pathway and inhibition of autophagy survival pathway, induction of more DNA damage and inhibition of repair of RT- induced DNA DSBs through diminishing NHEJ and HR pathways. My findings suggest combination with a dual PI3K/mTOR inhibitor (BEZ235 or PI103) is a promising treatment modality for future CaP radiotherapy.

234

6. PI3K/mTOR dual inhibitor BEZ235 sensitises radiation response in CaP RR animal models through repression of CSCs

235

6.1 Introduction

My recent findings in Chapter 3 indicate that the activation of the PI3K/Akt/mTOR pathway was associated with CaP radioresistance, EMT, CSC phenotypes, invasion and tumour sphere formation (Chang, Graham et al. 2013). In the Chapter 5, I compared the combination treatment efficacy using dual PI3K/mTOR inhibitors (BEZ235 and PI103) with RT to using single inhibitor (BKM120 or Rapamycin) with RT and found that combination of dual PI3K/mTOR inhibitors with RT had more prominent effect to increase radiosensitivity than single inhibitor (BKM120 or Rapamycin) in CaP-RR cells in vitro (Chang, Graham et al. 2014), suggesting dual PI3K/mTOR inhibitors have advantages over single PI3K or mTOR inhibitors in CaP radiation therapy.

In this chapter, I have for the first time used PC-3-luc and PC-3RR-luc cell lines to establish s.c and orthotopic CaP mouse models and investigated the efficacy of BEZ235 combined with RT in PC-3RR-luc animal xenograft models in vivo.

6.2 Material and methods

6.2.1 Antibodies and reagents

Antibodies were obtained from different sources. The detailed information and conditions for all antibodies are listed in Table 6-1. BEZ235 was purchased from Selleck Chemicals, USA and dissolved formulated in NMP/polyethylene glycol 300 (10/90, v/v). Solutions (5 mg/mL) of BEZ235 were freshly prepared for injections.

236

Table 6-1 Antibodies used for IHC in this Chapter

Dilution Incubation Antibody Souce Type Temperature Application for IHC time (min) Rabbit anti-human OCT4 Abcam PAb 1:100 o/n 4oC IHC Rabbit anti-human Snail Abcam PAb 1:200 o/n 4oC IHC Rabbit anti-human Nanog Abcam PAb 1:200 o/n 4oC IHC Rabbit anti-human CD326 Abcam PAb 1:200 o/n 4oC IHC Santa Cruz Mouse anti-human CD44 (DF1485) MAb 1:200 o/n 4oC IHC Biotechmology Mouse anti-human CD44V6 Abcam MAb 1:200 o/n 4oC IHC Rabbit anti-human LC3A/B Abcam PAb 1:100 o/n 4oC IHC Rabbit anti-human Becline-1 Cell Signaling PAb 1:200 o/n 4oC IHC Rabbit anti-human Caspase-3(Active) Abcam PAb 1:100 o/n 4oC IHC Rabbit anti-human Capase-7(Active) Abcam PAb 1:200 o/n 4oC IHC Rabbit anti-human Cleaved PARP-1 Abcam PAb 1:100 o/n 4oC IHC Rat anti-mouse CD31(PECAM1) BD Pharmingen MAb 1:20 o/n 4oC IHC Rabbit anti-human Ki67 Abcam PAb 1:200 o/n 4oC IHC Mouse anti-human γH2AX Abcam MAb 1:100 o/n 4oC IHC Rabbit anti-human p-Akt Abcam PAb 1:200 o/n 4oC IHC Rabbit anti-human p-mTOR Cell Signaling MAb 1:200 o/n 4oC IHC Goat anti-rabbit Immunoglobulins/HRP Dako PAb 1:100 45 RT IHC Rabbit anti-mouse Immunoglobulins/HRP Dako PAb 1:100 45 RT IHC Rabbit anti-rat immunoglobulins, Dako PAb 1:200 45 RT IHC biotinylated Notes: MAb: monoclonal antibody; PAb: polyclonal antibody; o/n: overnight; IHC: immunohistochemistry.

237

6.2.2 Cell lines and cell culture

PC-3-luc and PC-3RR-luc cell lines were used in this Chapter. The information of cell lines and cell culture method were described in Chapter 2.2.2 and 2.3.1, respectively.

6.2.3 Pharmacokinetics study in NOD/SCID mice with PC-3RR-luc s.c tumours

Pharmacokinetics study was performed to select the time point with the highest concentrations of BEZ235 to RT in PC-3RR-luc s.c model. The method details are described in Chapter 2.3.20.

6.2.4 Animal model development

PC-3-luc and PC-3RR-luc s.c and orthotopic xenograft models were developed following the methods described in Chapter 2.3.19. Tumour progression was documented once weekly by BLI for up to 8 week. Upon sacrifice, primary tumour xenografts were removed for histologic examination.

6.2.5 Non-invasive BLI tumour imaging

Non-invasive BLI was performed to monitor tumour progression from the first week post cell inoculation using the described method (Chapter 2.3.23).

6.2.6 Toxicity studies in NOD/SCID mice without tumours

Toxicity studies were performed to determine MTD of BEZ235 or RT in mice (see details in Chapter 2.3.21).

238

6.2.7 Radiation treatment on animal models

Animal models were irradiated 2 Gy every other day for 3 times according to the method in Chapter 2.3.22. The radiation dose was chosen based on our cytotoxicity study

6.2.8 Efficacy study in two CaP-RR animal models

The different treatments on each group are described in Chapter 2.3.24. BEZ235 was given to mice 10 min before RT (depending on our pharmacokinetics study result). The dose (10 mg/kg of BEZ235) and injection time with RT were chosen based on our cytotoxicity study and pharmacokinetics study. After 8 weeks, all mice were euthanised. Tumours were assessed for histologic change and analysis of different markers.

6.2.9 Mouse xenograft tumour tissues and histology

The tumour tissues from animals for model development or different treatments were either immediately snap frozen for frozen sections or fixed in 10% formalin for 24 h, embedded in paraffin block for H&E staining and IHC (see details in Chapter 2.3.25 and 2.3.26)

6.2.10 IHC

Standard immunoperoxidase procedures for paraffin and frozen sections were used in CaP animal xenograft tissues using the method in Chapter 2.3.27. The details of the primary antibodies used are summarised in Table 6-1.

6.2.11 TUNEL assay

Apoptosis on tumour xenografts tissues was assessed using the TUNEL method as previously described method (Chapter 2.3.15.2). 239

6.2.12 Assessment of immunostaining

The criteria used for assessment is detailed in Chapter 2.3.29.

6.2.13 Statistical analysis

Statistical analysis details are described in Chapter 2.3.30.

6.3 Results

6.3.1 Toxicologic evaluation and pharmacokinetics of BEZ235

Single dose administration of BEZ235 at 20, 30, 50 mg/kg and fractioned dose of radiation at 4, 6, 8 Gy each day (every other day for 3 times), respectively, were given to NOD/SCID mice without tumour and the average percentage weight changes with each treatment in every week were compared with day 0 (the day of treatment) up to 13 weeks. Mice in the control groups or receiving BEZ235 20 mg/kg and radiation 4 Gy groups were monitored 13 weeks post-treatment with no signs of delayed toxicity being observed (Figure 6-1). There were no microscopic signs of chronic toxicity to major organs from these mice. Single dose injection of BEZ235 at 20 mg/kg did not reach toxicity end points, but the dose at 30 and 50 mg/kg reached toxicity end points. After administration, a small acute weight loss of 8-12% from day 0 was observed in the group with BEZ235 20 mg/kg injection, while there was quick recovery with weight increase by day 7 in all mice. A dose of BEZ235 30 mg/kg cause 3 of 5 mice suffering 20% weight loss and mice treated with BEZ235 at 50 mg/kg were euthanised 1 week post treatment because of 20% weight loss, signs of distress and severely diarrhea. For radiation toxicity study, radiation with 4 Gy each day (every other day for 3 times) did not reach toxicity end points, wherease radiation with 6 and 8 Gy each day (every other day for 3 times) reached toxicity end points. After fractioned 4 Gy radiation, small acute weight loss of 4-7% from day 0 was observed and weights also increased by day 7 in all mice. Radiation with 6 Gy each day (every 240

other day for 3 times) caused 4 of 5 mice losing 20% weight and mice treated with 8 Gy radiation each day (every other day for 3 times) were euthanised 3 weeks post treatment because of 20% weight loss and skin dehydration. These results suggest the MTD for a single injection of BEZ235 lies 20 mg/kg and radiation dose lies 4 Gy each day (every other day for 3 times). To ensure efficacy studies, I chose 10 mg/kg of BEZ235 and 2 Gy radiation every other day for 3 times for the treatment of xenografted mice bearing tumours.

Figure 6-1 The effect of single dose administration of BEZ235 and fractioned doses of radiation on weight changes in NOD/SCID mice without tumours Average percentage weight changes performed to compare with day 0 (the first day of treatment). Dose-tolerance relationship in mice by BEZ235 and control (upper). ●, control; ■, BEZ235 (20 mg/kg); ▲, BEZ235 (30 mg/kg) ;▼, BEZ235 (50 mg/kg). Dose-tolerance relationship in mice by RT and control (lower). ●, control; ■, RT 4Gy; ▲, RT 6Gy ;▼, RT 8Gy. (n=5 in each group). All data were from three independent experiments (Mean±S.D, n=3).

241

For pharmacokinetics study, a linear rang was obtained for all types of samples from 0, 0.7, 2.5, 5, 10, 30, 50, 100, 300, 500, 1000 ng/mL. According to standard calibration equations of BEZ235/BBD130 in tumour and plasma in Figure 6-2, the concentrations versus time in tumour and plasma following 10 mg/kg BEZ235 i.p to male NOD/SCID mice were calculated and shown in Figure 6-3. It depicted that BEZ235 reached the highest concentrations of 160 and 67 ng/mL in tumour and plasma, repectively at around 10 min after BEZ235 i.p injection. And then BEZ235 cleared gradually in following 24 h. Thus, BEZ235 was given to mice 10 min before RT in the following study. The correlation coefficients (R2) for calibration curves being better than 0.99 suggested a good linear regression within the tested ranges (Figure 6-2).

A S ta n d a r d c a lib r a tio n c u r v e o f B E Z 2 3 5 in tu m o u r

2 .5

) r

u 2 .0

o m

u 1 .5

(

o R a tio (tu m o u r)

i 1 .0 t a R 0 .5

0 .0 0 2 0 0 4 0 0 6 0 0 8 0 0 1 0 0 0 1 2 0 0 C o n c e n tr a tio n o f B E Z 2 3 5 in tu m o u r (n g /m l)

B S ta n d a r d c a lib r a tio n c u r v e o f B E Z 2 3 5 in p la sm a

0 .4

) a

m 0 .3

s a

p (

0 .2

o R a tio (p la sm a )

t a

R 0 .1

0 .0 0 2 0 0 4 0 0 6 0 0 8 0 0 1 0 0 0 1 2 0 0 C o n c e n tr a tio n o f B E Z 2 3 5 in p la sm a (n g /m l) 242

Figure 6-2 Standard curves of BEZ235 determination in tumour (A) and plasma (B) calculated by the UHPLC method

Standard formulas were determined by linear regression as Y=aX+b) where Y is the ratio of BEZ235/BBD130 and X is the serial of BEZ235 concentrations (ng/mL). All data were from three independent experiments (Mean±S.D, n=3).

Figure 6-3 Tumour concentration to time profile after the administration of BEZ235 with an intraperitoneal dose of 10 mg/kg to mice BEZ235 reached the highest concentrations of 160 and 67 ng/mL in tumour and plasma, repectively at around 10 min after BEZ235 i.p injection. Error bars represent SD, n = 5.

6.3.2 Establishment of PC-3RR-luc s.c and orthotopic mouse models

To explore the role of radioresistance in CaP mouse models, I firstly established CaP s.c and orthotopic xenograft models using PC-3-luc and PC-3RR-luc cells. As no significant difference was observed in tumour growth with PC-3-luc and PC-3RR-luc animal models post 8 weeks cell inoculation, I then focused on studying tumour growth in these two models with fractioned radiation treatment. In s.c models, after fractionated radiation treatment in week 5 post cell inoculation, tumour growth in PC-3-luc tumours was found to be significantly

243

regressed compared with that in PC-3RR-luc tumours at the end of experiment (8 weeks post cell inoculation), which is displayed in Figure 4-10. In prostate orthotopic model, there was no significant difference in tumour growth of PC-3- luc (2.9x109±1.9x108 p/s) and PC-3RR-luc (1.1x1010±9.07x109 p/s) tumours post 4 week cell injection (P>0.05) while after fractionated radiation treatment in week 4, tumour growth in PC-3-luc tumours (6.9x1010±1.9x109 p/s) was found to be significantly regressed compared with that in PC-3RR-luc (2.1x1011±3.8x1010 p/s) tumours at the end of experiment (week 8, P<0.05). Representative BLI images and tumour growth showing tumour development in prostate orthotopic model are shown in Figure 6-4. I also evaluated tumour weight changes in PC-3-luc and PC- 3RR-luc orthotopic xenograft tumours at the end of experiments and found the significant difference exists between two models (P<0.05), which are shown in Figure 6-4. These results confirmed the tumour xenografts in PC-3RR-luc s.c and orthotopic mouse models are radioresistant, indicating that they are suitable for CaP-RR study.

244

Figure 6-4 Comparison of PC-3-luc and PC-3RR-luc tumour development in orthotopic animal xenograft models (A) Representative BLI images showing PC-3-luc and PC-3RR-luc tumour development in orthotopic model from week 1 to week 8 post cell inoculation. Mice were exposure to radiation in week 4. (B) Orthotopic tumour growth for each cell line was represented by total bioluminescent photons/second. (C) Representative images for tumour sizes from PC-3-luc and PC-3RR-luc cell inoculation in orthotopic model are shown. (D) At the end of experiments, tumour weight from PC-3RR-luc cell inoculation was obviously increased compared to that from PC-3-luc cell inoculation both in orthotopic models. * indicates P<0.05.

245

6.3.3 Activation of the PI3K/Akt/mTOR pathway in CaP-RR models

To investigate whether the PI3K/Akt/mTOR signalling pathway is involved in CaP radioresistance in vivo, the expression of p-Akt and p-mTOR was examined on s.c and orthotopic xenograft tumours inoculated with PC-3-luc and PC-3RR- luc cell lines using IHC. My results showed that higher level expression of p-Akt and p-mTOR was found in PC-3RR-luc xenografts compared with those in PC-3- luc tumour xenografts in s.c and orthotopic models after RT, respectively. Typical images for p-Akt and p-mTOR expression in s.c models are shown in Figure 4- 12. Typical images for p-Akt and p-mTOR expression in orthotopic models are shown in Figure 6-5. The staining results are summarised in Table 6-2. These data indicate that activation of the PI3K/Akt/mTOR pathway is associated with CaP radioresistance in vivo, suggesting this pathway proteins are good targets for improving radiosensitivity.

Figure 6-5 The expression of p-Akt and p-mTOR in orthotopic xenografts The higher level expression of p-Akt and p-mTOR was found in PC-3RR-luc xenografts compared with that in PC-3-luc tumour xenografts in orthotopic models after RT. Brown color staining indicates positive. Magnification × 400 in all images. 246

6.3.4 Enhanced CSC phenotypes, cell proliferation, angiogenesis, as well as autophagy and reduced DNA repair and apoptosis pathways in CaP- RR models

To investigate whether CaP radioresistance affects CSC expression, cell proliferation, angiogenesis, autophagy and apoptosis pathways in mouse xenografts, CSC markers (OCT4, Snail, Nanog, CD326, CD44 and CD44V6), Ki67, CD31, autophagy proteins (Beclin-1 and LC3 A/B) and DNA repair protein (γH2AX), apoptosis pathway proteins (Caspase-3 (Active), Caspase-7 (Active) and PARP-1 (Cleaved)) were examined by IHC in two PC-3-luc and PC-3RR-luc xenograft models after RT. PC-3RR-luc xenografts showed increased expression of OCT4, Snail, Nanog, CD326, CD44 and CD44V6 in s.c and orthotopic models. On the other hand, a lower level expression of those CSC proteins was observed in PC-3-luc xenograft models (Figure 6-6). The expression of Ki67 was significantly increased in PC-3RR-luc s.c and orthotopic xenografts compared to PC-3-luc xenografts (Figure 6-7). Frozen sections from different xenograft tumours were stained with CD31 MAb and microvascular density (MVD) was measured by the number of positive cells per hpf. MVD of CD31 was found to be higher in PC-3RR-luc s.c (50-70/hpf) and orthotopic (30-40/hpf) models than that in PC-3-luc s.c (10-15/hpf) and orthotopic (12-17/hpf) models (Figure 6-7). The expression levels of autophagy proteins including Becline-1 and LC3 A/B were obviously increased in PC-3RR-luc xenografts compared to those in two PC-3-luc xenograft models (Figure 6-7).

I also evaluated the apoptosis pathway markers including Caspase-3 (Active), Caspase-7 (Active) and PARP-1 (Cleaved) as well as DNA repair protein (γH2AX) by IHC. The levels of Caspase-3 (Active), Caspase-7 (Active), PARP-1 (Cleaved) and γH2AX in PC-3RR-luc xenografts were lower than those in PC-3- luc xenografts in s.c and orthotopic models (Figure 6-8). TUNEL assay was also used to evaluate apoptosis involved in radioresistance in vivo. Tumour cells from PC-3-luc xenografts showed few apoptotic cells while almost no apoptotic cells were found in PC-3RR-luc xenografts (Figure 6-8).

247

Overall, in RR s.c and orthotopic tumours, I found over-expression of CSC markers (OCT4, Snail, Nanog, CD326, CD44, CD44V6), enhanced Ki67 (cell proliferation) and CD31 expression (angiogenesis), increased autophagy proteins, and reduced apoptotic proteins (Caspase-3 (Active), Caspase-7 (Active), PARP-1 (Cleaved)), DNA repair protein (γH2AX) as well as TUNEL-positive lesions. The staining results from these markers are summarised in Table 6-2.

248

Figure 6-6 The expression of CSC markers-OCT4, Snail, Nanog, CD326, CD44 and CD44V6 in s.c and orthotopic xenografts PC-3RR-luc xenografts showed significant higher expression of OCT4, Snail, Nanog, CD326, CD44 and CD44V6 in s.c and orthotopic models, compared to PC-3-luc xenograft models. Brown color staining indicates positive. Magnification x 400 in all images.

Figure 6-7 The expression of Ki67, CD31, Becline-1, LC3 A/B in s.c and orthotopic xenografts The expression of Ki67 and CD31 was significantly increased in PC-3RR-luc s.c and orthotopic xenografts compared to PC-3-luc xenografts. The expression levels of Becline-1 and LC3 A/B were obviously increased in PC-3RR-luc xenografts compared to those in PC-3-luc xenografts in two models. Brown color staining indicates positive. Magnification × 400 in all images. 249

Figure 6-8 The expression of Caspase-3 (Active), Caspase-7 (Active), PARP-1 (Cleaved), γH2AX, TUNEL in s.c and orthotopic xenografts The levels of Caspase-3 (Active), Caspase-7 (Active), PARP-1 (Cleaved) and γH2AX in PC-3RR-luc xenografts were lower than those in PC-3-luc xenografts in s.c and orthotopic models. TUNEL assay showed that few apoptotic cells were observed in tumour cells from PC-3-luc xenografts while almost no apoptotic cells were found in PC-3RR-luc xenografts. Brown color staining indicates positive. Magnification × 400 in all images. 250

Antibodies S.c Orthotopic PC-3-luc PC-3RR-luc PC-3-luc PC-3RR-luc p-Akt ▼ ▼ 2 3 p-mTOR ▼ ▼ 1 3 OCT4 1 3 1 3 Snail 2 3 2 3 Nanog 2 3 2 3 CD326 1 2 1 3 CD44 1 3 1 3 CD44V6 1 2 1 3 Ki67 1 2 1 3 CD31 10-15 hpf 50-70 hpf 12-17 hpf 30-40 hpf Becline-1 1 2 2 3 LC3A/B 2 3 1 2

Caspase-3 2 1 2 1 (Active)

Caspase-7 1 0 2 0 (Active)

PARP-1 2 1 1 0 (Cleaved)

γH2AX 1 0 1 0 TUNEL 1 0 1 0 Note: ▼indicates data in Table 4-3. hpf: High power field. The criteria for assessment were as follows: 0 (negative, <25%); 1 (weak, 25–50%); 2 (moderate, 50–70%); 3 (strong, >75%) of the tumour cells stained.

251

6.3.5 Combination therapy with BEZ235 and fractioned RT significantly regresses tumour growth in PC-3RR-luc xenograft models

To determine whether BEZ235 could sensitise radio-response and overcome radioresistance, NOD/SCID mice bearing PC-3RR-luc tumours were treated with vehicle control, BEZ235 (10 mg/kg), RT (2 Gy every other day for 3 times) or BEZ235+RT (10 mg/kg+2 Gy every other day for 3 times) when tumour volumes reached 60±10 mm3 5 weeks post cell injection in PC-3RR-lus s.c and 4 weeks post cell injection in orthotopic mouse models, respectively. Representative BLI images show tumour development in PC-3RR-luc s.c model by different treatments (Figure 6-9A). In s.c model, no significant difference was found in tumour growth before week 5 post cell injection in all four groups (P>0.05). From week 5 to week 6 post cell inoculation, there was an escalating trend in tumour growth in each treatment. However, after week 5, a significantly reduced tumour growth was measured in combination of BEZ235 and RT compared with vehicle control, BEZ235 or RT alone (P<0.05). A slight tumour growth regression was seen in BEZ235 or RT alone treatment compared to control group but there were no significant difference (P>0.05), while no obvious difference was found between BEZ235 alone and RT alone, either (P>0.05) (Figure 6-9B). The significant tumour weight reduction was observed in combination treated mice compared with control or BEZ235 or RT alone (P<0.05), but no significant difference was found between control and BEZ235 or RT alone at the end of the experiments (8 weeks post cell inoculation) (Figure 6-9C and D). There was also no obvious difference between BEZ235 alone and RT alone (Figure 6-9D). Typical images from different groups of tumours are shown in Figure 6-9C.

To mimic the real state of CaP development, I also performed the same treatments as s.c model did in PC-3RR-luc orthotopic model and evaluated the antitumour effect of those treatments over 8 weeks. The pattern of tumour growth in orthotopic model was similar to that observed in s.c model i.e tumour growth was slower in different treatments before week 3 post cell injection and then increased (Figure 6-10A and B). From week 4 to week 5, the plateau phase that tumours 252

continued growing was observed in the treatment of BEZ235 or RT alone or BEZ235 combined with RT whereas tumours in control group still maintained growing tendency (Figure 6-10A and B). Since week 5, tumour growth was significantly inhibited by combination with BEZ235 and RT compared with other single treatments or vehicle control (P<0.05) (Figure 6-10A and B). In contrast, tumour growth resumed the fast upward trend in BEZ235 or RT alone treatment group and no significant difference was found between two single treatments or single treatments and vehicle control (P>0.05) (Figure 6-10A and B). Mean tumour weights were also measured and compared in different treatments. Mean tumour weights were significantly lower in combination treatment than other treatments but no significant difference was seen among BEZ235, RT alone or control groups at the end of experiments (Figure 6-10C and D). These results suggest that combination treatment with BEZ235 and RT can significantly repress tumour development in PC-3RR-luc s.c and orthotopic xenograft mouse models.

253

254

D C o n tr o l 1 .5

R T

) g

( B E Z 2 3 5

h B E Z 2 3 5 + R T

g 1 .0

e w

r  u 0 .5

o m

u T 0 .0 C o ntro l R T B E Z2 3 5 B E Z2 3 5 + R T

Figure 6-9 BEZ235 and RT regressed tumour growth in PC-3RR-luc s.c model (A) Representative BLI images are displayed for PC-3RR-luc s.c tumour development from week 1 to week 8 post cell inoculation in different treatments. Mice were exposure to BEZ235 and/or radiation in week 5 post cell inoculation. (B) The tumour growth rate in s.c model treated with different treatments was represented by total BLI p/s. (C) At the completion of experiment, representative images for PC-3RR-luc s.c tumour sizes are shown. (D) Tumour weight in combination treatment of BEZ235 and RT were higher than that in BEZ235 or RT alone or control group. * indicates P<0.05. All data were from three independent experiments (Mean±S.D, n=3).

255

256

Figure 6-10 BEZ235 and RT inhibited tumour growth in PC-3RR-luc orthotopic model (A) Representative BLI images are shown for PC-3RR-luc orthotopic tumour development from week 1 to week 8 post cell inoculation in different treatments. Mice were exposure to BEZ235 and/or radiation in week 4 post cell inoculation. (B) The tumour growth rate in orthotopic model treated with different treatments was represented by total bioluminescent p/s. Tumour growth rate in combination treatment was significantly slower than that in BEZ235 or RT alone or control group. (C) At the completion of experiments, representative images for PC-3RR- luc orthotopic tumour sizes are shown. (D) Tumour weights in combination treatment of BEZ235 and RT were higher than those in BEZ235 or RT alone or control group. * indicates P<0.05. All data were from three independent experiments (Mean±S.D, n=3). 257

6.3.6 Combination therapy with BEZ235 and RT reduces CSC expression and cell proliferation, blocks angiogenesis and autophagy, and induces DNA repair and apoptosis pathway in CaP-RR tumour xenograft models

To find the radiosensitisation mechanisms of BEZ235 on PC-3RR-luc tumour xenografts, I evaluated the changes of PI3K/Akt/mTOR pathway proteins, CSC phenotypes, proliferation, vasculature formation, apoptosis and autophagy proteins and DNA repair marker by IHC. Expression of PI3K/Akt/mTOR pathway proteins (p-Akt and p-mTOR), CSC phenotypes (OCT4, Snail, Nanog, CD326, CD44 and CD44V6), proliferation marker (Ki67), vasculature formation (CD31) as well as autophagy proteins (Beclin-1 and LC3 A/B) was found to be significantly reduced in combination therapy compared with single therapies and vehicle control and there was slightly decreased in BEZ235 or RT alone group compared to control group in two models (Figure 6-11, 6-12 and 6-13).

Expression of apoptotic proteins (Caspase-3 (Active), Caspase-7 (Active) and PARP-1 (Cleaved)), and DNA repair protein (γH2AX) was found to be significantly increased in combination therapy compared with single therapies and vehicle control and there was no obvious difference among BEZ235 or RT alone or control groups in two animal xenograft models (Figure 6-14). High numbers of TUNEL positive areas were found in tumours with combination therapy compared to those with other single treatments and vehicle control (Figure 6-14). The immunostaining results in animal xenografts after different treatments are summarised in Table 6-3.

These results suggest that the antitumour efficacy of the combination therapy was significant because BEZ235 could increase radiosensitivity and overcome radioresistance through inhibition of the PI3K/Akt/mTOR pathway, thereby reducing cell proliferation and CSC expression, blocking angiogenesis and autophagy, inducing more DNA damage and apoptosis.

258

Figure 6-11 The expression of p-Akt and p-mTOR in s.c (A) and orthotopic (B) xenografts after different treatments at the end of experiments Expression of p-Akt and p-mTOR was found to be significantly reduced in combination therapy compared with single therapies and vehicle control in s.c (A) and orthotopic (B) models. Brown color staining indicates positive. Magnification x 400 in all images.

259

260

Figure 6-12 The expression of CSC markers OCT4, Snail, Nanog, CD326, CD44 and CD44V6 in s.c (A) and orthotopic (B) xenografts after different treatments at the end of experiments (Expression of OCT4, Snail, Nanog, CD326, CD44 and CD44V6 was found to be significantly reduced in combination therapy compared with single therapies and vehicle control in s.c (A) and orthotopic (B) models. Brown color staining indicates positive. Magnification x 400 in all images.)

261

262

Figure 6-13 The expression of Ki67, CD31, Becline-1 and LC3 A/B in s.c and orthotopic xenografts after different treatments at the end of experiments Expression of Ki67, CD31 as well as autophagy proteins (Beclin-1 and LC3 A/B) was found to be significantly reduced in combination therapy compared with single therapies and vehicle control in two s.c (A) and othotopic (B) models. Brown color staining indicates positive. Magnification x 400 in all images.

263

264

Figure 6-14 The expression of Caspase-3 (Active), Caspase-7 (Active) and PARP-1 (Cleaved), γH2AX, and TUNEL in s.c and orthotopic xenografts after different treatments at the end of experiments Expression of apoptotic proteins (Caspase-3 (Active), Caspase-7 (Active) and PARP-1 (Cleaved)), and DNA repair protein (γH2AX) was found to be significantly increased in combination therapy compared with single therapies and vehicle control both in s.c (A) and orthotopic (B) models. High numbers of TUNEL positive areas were found in tumours with combination therapy compared to those with other single treatments and vehicle control in s.c (A) and orthotopic (B) models. Brown color staining indicates positive. Magnification x 400 in all images. 265

Table 6-3 The intensity of expression of PI3K/Akt/mTOR pathway proteins, CSC markers, Ki67, CD31, autophagy proteins, apoptosis pathway proteins, γH2AX and TUNEL in tumour xenografts from BEZ235 with RT or BEZ235 or RT alone or vehicle control treatment by IHC

Antibodies S.c Orthotopic BEZ235 BEZ235 Control RT BEZ235 Control RT BEZ235 +RT +RT p-Akt 3 3 2 0 3 2 2 0 p-mTOR 3 2 2 1 2 2 2 1 OCT4 3 3 2 1 3 2 2 1 Snail 2 2 1 0 3 2 1 0 Nanog 3 3 3 1 3 3 2 0 CD326 2 2 1 0 3 2 2 0 CD44 3 3 2 1 3 3 1 0 CD44V6 3 3 2 1 3 2 2 1 Ki67 3 3 2 1 3 2 2 1 12- 17- 50-70 30-40 CD31 15 7-12 hpf 2-5 hpf 22 9-12 hpf 4-6 hpf hpf hpf hpf hpf Becline-1 3 3 2 1 3 2 1 0 LC3A/B 3 2 2 1 3 2 2 1 Caspase-3 1 1 2 3 2 1 2 3 (Active)

Caspase-7 0 1 2 3 0 2 2 3 (Active)

PARP-1 1 1 2 3 1 1 1 3 (Cleaved) γH2AX 0 1 1 3 1 1 2 3 TUNEL 0 2 2 3 0 1 2 3 Notes: hpf: High power field. The criteria for assessment were as follows: 0 (negative, <25%); 1 (weak, 25–50%); 2 (moderate, 50–70%); 3 (strong, >75%) of the tumour cells stained.

266

6.4 Discussion

Radioresistance and recurrence are major obstacles for the long-term survival of patients undergoing RT (Begg, Stewart et al. 2011, Ogawa, Yoshioka et al. 2013). Understanding the mechanisms of radioresistance and developing innovative combination approaches are important for the improvement of RT. Establishment of appropriate RR cell lines and animal models is the first step to investigate the mechanisms of radioresistance and test novel combination therapies. In the recent studies, we developed CaP RR cell lines with fractioned RT (Chang, Graham et al. 2013) and demonstrated the therapeutic effects with combined BEZ235 and RT in these cell lines (Chang, Graham et al. 2014). In the current study, I further developed CaP-RR xenograft mouse models with PC-3RR and PC-3 cells transfected with luciferase and tested this combination approach in PC-3RR-luc xenograft models.

To the best of our knowledge, CaP-RR animal models have not been reported so far. In this chapter, I firstly demonstrated the growth advantage of PC-3RR-luc models over PC-3-luc models after fractioned RT. Currently, only one report showed that RR lung cancer s.c animal model was developed using A549RR cells (You, Li et al. 2014). I also found the activation of the PI3K/Akt/mTOR signalling pathways, enhanced CSC phenotypes, angiogenesis, autophagy, and reduced apoptosis from PC-3RR-luc xenografts compared with PC-3-luc xenografts, which is consistent with our previous findings in vitro (Chang, Graham et al. 2013, Chang, Graham et al. 2014), suggesting these two models are suitable for testing PI3K/mTOR inhibitor BEZ235 with RT for the treatment of CaP radioresistance.

PI3K/Akt/mTOR pathway plays an important role in cell growth and proliferation, and is often dysregulated in cancer due to mutation, amplification, deletion, methylation and PTMs. This pathway is an intracellular signalling pathway important for apoptosis, malignant transformation, tumour progression, metastasis and radioresistance (Chang, Graham et al. 2014, Ni, Cozzi et al. 2014, Chang, 267

Graham et al. 2015). Activation of the PI3K/Akt/mTOR pathway is associated with radioresistance in multiple human cancers including glioblastoma, cervical, colorectal and non-small cell lung cancers (Xia, Zhao et al. 2010, Heavey, O'Byrne et al. 2014, Palumbo, Tini et al. 2014, Chen, Wei et al. 2015). Skvortsova et al reported that radioresistance in CaP cells is accompanied by the activation of PI3K/Akt/mTOR pathway (Skvortsova, Skvortsov et al. 2008). Similarly, our recent study also found the PI3K/Akt/mTOR signalling pathway is associated with CaP radioresistance in CaP-RR cell lines (Chang, Graham et al. 2013). All these data indicate the importance of this signalling pathway in cancer radioresistance. Here, I observed the activation of this pathway in PC-3RR-luc s.c and orthotopic models, further confirming its importance and indicating targeting this pathway may overcome CaP radioresistance.

Increasing evidence indicates that CSCs contribute to radioresistance which could result in radiation treatment failure (Rycaj and Tang 2014). There is considerable evidence to suggest that, under certain experimental conditions, CSCs exhibit RR features (Eyler and Rich 2008). One underlying reason for locoregional recurrence or metastatic spread after RT or combined treatments might be a low efficacy of current treatments on the eradication of CSCs. Therefore, targeting CSCs is very critical for cancer recurrence after RT. Cho et al. showed an increase in CSC markers (CD44, CD133, Nanog and OCT3/4) with long-term recovery RT in CaP in vitro, indicating that CSCs may contribute to treatment failure following RT (Barentsz, Richenberg et al. 2012). In this study, in addition to activation of the PI3k/Akt/mTOR pathway, an interesting finding is that increased CSC phenotypes (OCT4, Snail, Nanog, CD326, CD44 and CD44V6) were found in PC-3RR-luc animal xenografts compared to PC-3-luc control xenografts, suggesting that CSCs are involved in CaP radioresistance and may link with activation of the PI3K/Akt/mTOR pathway, which is in line with our in vitro findings (Chang, Graham et al. 2013). Martelli et al recently reviewed the evidence which links the signals deriving from the PI3K/Akt/mTOR network with CSC biology and highlighted how therapeutic targeting of PI3K/Akt/mTOR signalling with small molecule inhibitors could improve cancer patient outcome, by eliminating CSCs (Martelli, Evangelisti et al. 2011). 268

BEZ235, as a PI3K/mTOR dual inhibitor and an effective radiosensitiser, combined with RT has been used to synergistically improve radiosensitivity and overcome radioresistance in a variety of cancers including colorectal cancer, glioblastoma cancer, non-small cell lung cancer (Kuger, Graus et al. 2013, Kim, Myers et al. 2014, Chen, Wei et al. 2015). It also showed significant efficacy with docetaxel, suggesting that BEZ235 can effectively overcome docetaxel resistance in human castration resistant CaP (Yasumizu, Miyajima et al. 2014). BEZ235 was demonstrated prominent enhancement of radiosensitivity in CaP cell lines (Potiron, Abderrahmani et al. 2013, Zhu, Fu et al. 2013). Dubrovska et al demonstrated that the PTEN/PI3K/Akt/mTOR pathway is critical for the in vitro maintenance of CD133+/CD44+ CaP progenitors and that the combination of the PI3K/mTOR modulator BEZ235 targeting CaP progenitor populations and the chemotherapeutic drug Taxotere can more effectively eradicate tumours in a CaP xenograft model than monotherapy (Dubrovska, Elliott et al. 2010), indicating the importance of CSC and PI3K/Akt/mTOR pathway in the CaP treatment.

Based on the PC-3RR-luc tumour models with enhanced CSCs and the characteristics of BEZ235, we hypothesised that combination of BEZ235 and RT could regress PC-3RR-luc tumour growth and improve the survival of treated mice through targeting CSCs. In this study, I investigated the synergic effect of combination of BEZ235 and RT in vivo when tumour size reached 60±10 mm3, which represented an advanced stage of CaP. I found although single BEZ235 or RT therapy slightly shrank tumour growth, combined therapy with BEZ235 and RT had significant antitumour efficacy against tumour growth. In our previous in vitro study, I demonstrated that inhibiting PI3K/Akt/mTOR pathway by combination therapy of BEZ235 with RT could significantly reduce cell colony number and increase apoptotic cells, compared to BEZ235 or RT alone or control (Chang, Graham et al. 2013). My current in vivo study further confirmed this combination approach could obviously reduce tumour growth in PC-3RR-luc s.c and orthotopic animal models in comparison to BEZ235 or RT alone or control, which is consistent with in vitro study (Chang, Graham et al. 2014). These findings suggest that combination of BEZ235 and RT could regress RR CaP 269

tumours in vivo and increase radiosensitivity through inhibiting the PI3K/Akt/mTOR pathway.

Mechanisms of radiosensitivity induced by BEZ235 as a radiosensitiser are still unclear. However, I found the reduced CSC phenotype expression in PC-3RR-luc animal tissues with combination of BEZ235 and RT treatment compared to BEZ235 or RT alone or vehicle control, implicating that, BEZ235, by suppression of the PI3K/Akt/mTOR pathway may increase radiosensitivity through affecting CSCs and limit tumour growth and prevent cancer metastasis. In addition, I also found reduced proliferation, angiogenesis and autophagy as well as increased apoptosis and DNA repair in PC-3RR-luc tumours after combination therapy with BEZ235 and RT compare to BEZ235 or RT alone or vehicle control, indicating these mechanisms are also involved in CaP radioresistance.

Activation of autophagy has been also been shown to contribute to many RR cancer cells and inhibition of autophagy could enhance radioresistance induced apoptosis (Gewirtz 2007, Shingu, Fujiwara et al. 2009, Liang, Kong et al. 2012, Han, Lee et al. 2014). Up-regulation of cancer cell angiogenic markers such as CD31 plays crucial roles in radioresistance through hypoxia stimulation (Harada, Kizaka-Kondoh et al. 2007). DNA repair alteration and ROS activation in response to radiation might result in RR in CSC (Rycaj and Tang 2014). Here, I demonstrated that radioresistance enhanced cell proliferation, activated angiogenesis, autophagy and HR DNA repair pathway, inhibited the apoptosis pathway in vivo which was consistent with our preliminary in vitro results and these abnormal changes, in turn, could impulse CaP more resistance to radiation. Furthermore, the mechanisms that might illustrate why combination treatment could attenuate radioresistance were investigated. Combination of BEZ235 and RT yielded reduction of Caspase-3 activity, cell proliferation and vascular density in lung cancer (Kim, Myers et al. 2014). Inhibition of the PI3K/Akt pathway by BEZ235 leads to a decrease in the population of CSC proteins (CD133/CD44) CaP in vivo (Bonkhoff 2012). BEZ235 combined with RT significantly decreased the expression of CSC markers in vitro (Chang, Graham et al. 2013). BEZ235 combined with RT has been examined to confer radiosensitivity in glioblastoma 270

cell line (Mukherjee, Tomimatsu et al. 2012). Wang et al reported BEZ235 increased the radiosensitivity of glioma stem cells in vitro by activating autophagy that is associated with synergistic increase of apoptosis and cell-cycle arrest and decrease of DNA repair capacity (Wang, Long et al. 2013). These results further support our findings that, in CaP-RR animal models, BEZ235 can overcome radioresistance through inhibition of the PI3K/Akt/mTOR pathway, thereby reducing cell proliferation and CSC, blocking angiogenesis and autophagy, inducing the DNA repair and apoptosis pathway.

In conclusion, I firstly established s.c and orthotopic CaP-RR models in NOD/SCID mice using PC-3RR-luc cell line and their RR capabilities were further confirmed in these two CaP models. Radioresistance is closely correlated with the activation of PI3K/Akt/mTOR pathway, increased cell proliferation, angiogenesis, autophagy and CSC phenotypes, and inhibition of apoptosis pathways in CaP-RR models. Furthermore, combination therapy with BEZ235 and RT can reduce tumour growth and greatly increase radiosensitivity in CaP-RR tumour xenograft models, through inhibition of PI3K/Akt/mTOR pathway via reduction of CSC proteins expression, blocking angiogenesis and autophagy as well as inducing DNA repair and apoptosis. Beyond the scope of this in vivo study, this combination approach is a very promising treatment option for future clinical trial in CaP-RR patients and other cancer patients with radioresistance.

271

7. General discussion and future perspectives

272

7.1 General discussion

Radiation remains an important modality for organ-confined or locally advanced CaP treatment with ongoing efforts towards designing new radiation treatment modalities and techniques, which continue to improve the survival and quality of life of CaP patients. With the improved clinical outcomes of CaP treatment, minimizing RT related toxicities has become a priority. RT has curative potential in treating CaP. However, tumour recurrences still frequently occur, requiring stratification of patients into different groups with distinct recurrence risk and further improvement of treatment approaches to reduce the recurrence rate. If the biomarkers for predicting the treatment response of individual CaP patient and potential targets for radiosensitisation are identified and further validated, it will achieve a more favourable therapeutic ratio in clinics. The future of radiation oncology is a close combination of modern treatment techniques, biomarker- guided personalized treatments, and metabolic/molecular imaging.

The PI3K/Akt/mTOR pathway is implicated in all major mechanisms of cancer therapeutic resistance including CaP. Emerging evidence suggests that PI3K/Akt/mTOR signalling pathway is associated with CSC, autophagy and glucose metabolisms in many cancers including CaP, contributing to cancer radioresistance. Further understanding the association of this pathway with CSC, autophagy, hypoxia response and glucose metabolisms will be very helpful in aiding to design innovative approaches to improve CaP radiosensitivity. My in vitro and in vivo studies demonstrate that the PI3K/Akt/mTOR pathway as well as autophagy, EMT and CSCs play a critical role in CaP progression and radioresistance in preclinical studies. Inhibition of PI3K/Akt/mTOR pathway is a very promising idea to increase radiosensitivity and has been confirmed in my studies. CSCs are the “roots” of recurrence after RT, responsible for the CaP radioresistnace and closed linked with the PI3K/Akt/mTOR pathway. Therefore, targeting the PI3K/Akt/mTOR pathway combined with RT could be useful in overcoming CaP radioresistance and improving radiosensitivity for CaP patients in the future. 273

Using the LC-MS/MS proteomics approach, the PI3K/Akt/mTOR pathway was investgatied to be linked with other signalling pathways such as Ras/Raf/Mek pathway, AR pathway or VEGF pathway in promoting CaP radioresistance. The Ras/Raf/Mek pathway is involved in extensive cross-talk with the PI3K/Akt/mTOR pathway. ERK and RSK are two effector kinases downstream of Ras that can promote mTORC1 activity by phosphorylating TSC2 on residues that are distinct from Akt phosphor-acceptor sites, and activation of this pathway has been associated with decreased sensitivity to PI3K/Akt/mTOR pathway inhibitors. AR pathway plays a critical role in the development of CaP. There is significant cross-talk between PI3K/Akt/mTOR pathway and AR pathway which appears to impact on CaP through complex mutual communication mechanisms. In addition, activation of EGFR family members via PI3K/Akt/mTOR pathway is also associated with radioresistance by regulating HIF-1α and VEGF expression. Moreover, radiation can enhance EGFR activation which in turn increases radioresistance in cancer. As EGFR up-regulation is closely related to high Gleason score CaP, it may play an important role in CaP radioresistance. Therefore, future investigating the link between these associated signalling pathways and PI3K/Akt/mTOR pathway, and targeting these two pathways in the meantime may obtain more effective treatment than targeting either one pathway in CaP radiareisistance which may hold promise to increase CaP radiosensitivity.

A variety of different PI3K/Akt/mTOR inhibitor classes have been developed over the last decades. Single PI3K/Akt/mTOR pathway inhibitors displayed many own demerits such as instability and toxic effect. More recently, dual PI3K/mTOR inhibitors have revealed potent anti-tumour effect in RT. Our study showed that these dual inhibitors can more effectively improve radiosensitivity and hold promise for future clinical trials as a dual PI3K/mTOR inhibitor can target more active pathway proteins than a single inhibitor. Animal study with combination of PI3K/Akt/mTOR inhibitor BEZ235 with RT has demonstrated the enhanced radiosensitivity in CaP-RR animal models. However, currently, only BEZ235 is widely studied in preclinical investigations, with very limited reports

274

in CaP radiation studies. Thus, more effective new PI3K/Akt/mTOR signalling pathway inhibitors are required in the future.

7.2 Future perspectives

The PI3K/Akt/mTOR pathway is implicated in all major mechanisms of radioresistance including CaP. Targeting this pathway is very promising for improving CaP radiosensitivity. Apart from the efforts put into developing new drugs with improved tolerability and efficacy, more attention should also be paid to alternative components in PI3K/Akt/mTOR rather than merely targeting PI3K, Akt or mTOR. For example, eukaryotic translation initiation factor 4E (eIF4E) and S6K, downstream effectors of mTORC1, could be useful targets for overcoming radioresistance. Furthermore, a better understanding of biology of targets, crosstalk and feedback will grant a passage for novel and effective PI3K/Akt/mTOR inhibitor development and investigation to overcome CaP radioresistance. In the future, using multiple inhibitors to target the signalling proteins in this pathway could improve the survival of CaP patients.

The study of autophagy is a very exciting and highly promising area of cancer research. There has been much recent progress in our understanding the pathways that control autophagy. Further exploration of these pathways holds great potential for improving the treatment efficacy of IR in CaP (Bibault, Fumagalli et al. 2013). However, despite this potential, one of the most difficult questions remains to be answered: whether autophagy should be inhibited or stimulated to improve clinical outcomes? Thus, autophagy seems to play a pivotal role between survival and death processes: these processes, in fact, might be cell and tissue specific and highly dependent on the expression profile of genes and proteins regulating apoptosis. The interplay between apoptosis and autophagy is a very interesting area and needs to be further exploited in the future.

Since CSCs and EMT have both been implicated in tumourigenesis and radioresistance, it is critical to examine both populations and determine their expression of phenotypes in order to develop strategies to target these populations 275

using targeting therapy. The rapid progress in EMT research and the various facets of innovative insights into the molecular mechanisms underlying EMT and metastasis will open novel avenues for the establishment of appropriate surrogate markers for improved diagnosis and prognosis, and, most importantly, for the design of specific anti-metastasis therapies. Tanaka and colleagues have recently developed novel anti-N-cadherin MAbs, which are active in preclinical models of CRPC (Tanaka, Kono et al. 2010). These MAbs could be also promising in improving CaP radiosensitivity. Yet, while we have made substantial progress in the understanding of the molecular mechanisms underlying EMT, we still lack sufficient insights into the functional contribution of EMT in cancer patients, especially in CaP radiation research.

The recent advances in CSCs have unlocked a new avenue for radiosensitivity research. Elucidating the role of CSCs in the cancer cells’ response to radiation will enhance our understanding of CaP recurrence after RT, and may direct research towards novel and specific radiosensitiztion agents that target CSCs. We expect that there will be increasing understanding of the intrinsic and extrinsic factors that control the plasticity and maintenance of the CSC state (e.g., expression factors, miRNA expression, PTMs of molecules that control stem cell fate and niche factors that control stem cell renewal). It needs to be recognised that the complex mixture of radiosensitivity determining factors is probably highly dynamic during fractionated RT. Thus, the development of future therapeutic strategies based on targeting potential CSC radioresistance mechanisms must take into account these complex and dynamic processes, whereby different radioresistance pathways may be better targeted at different stages of therapy. In addition, if tumour and normal tissue stem cell regulatory pathways can be selectively targeted, then not only could CSCs be radiosensitised, but normal tissue stem cells could also be radioprotected to improve the therapeutic ratio. Furthermore, it may differ between tumour types, as well as between different individuals' tumours within a tumour type. Therefore, any therapeutic strategy in the long term will need to take into account the biological features that control CSC behaviour in each individual tumour (i.e., personalization of therapy). With the advent of novel imaging technologies for 276

CSCs (Vlashi, Kim et al. 2009), biology-guided RT planning may offer ways for specifically delivering high radiation doses to areas with high CSCs numbers. CSCs also offer novel targets to enhance the efficacy of RT (Diehn and Clarke 2006) and future targeted therapies should have this aim in CaP radiation research. Targeting CSCs with radiation holds enormous potentials for eventual cure for CaP patients.

Biomarker research continues to be a developing field. Identification of RR potential biomarkers is very imperative for predicting cancer raioresistance and developing biomarker-guided targeted therapy or combination therapy with the aim of sensitising RT on which new treatments and prevention methods can be developed. MS technologies, which can detect thousands of proteins at nanomolar concentrations, have led to the expansion of work in the field of finding markers to diagnose diseases, disease progression during treatment or responsiveness to RT, holding great promise for the detection of RR candidate protein biomarkers for clinical application to improve cancer patients’ outcome. In the future, complementary proteomic techniques should be used to cover low and high MW proteins, over a wide dynamic range to achieve the maximum chance for differential proteins predicting for radioresistance and identifying potential therapeutic targets for innovative therapies. In addition, discovering and verifying cancer biomarkers directly in human samples is tremendously difficult due to considerable genetic, behavioural, and environmental heterogeneity. RR mouse models or other contemporary models such as patients-derived xenografts (PDX) or explanted human tissues from RR cancer patients should be considered for radioresistance biomarker study in the future. Furthermore, standardised protocols for sample processing, data normalisation and clinical result interpretation require further investigation. The success in identifying cancer RR biomarkers can guide clinicians in predicting treatment outcome of RT and develop a tailored individual therapeutic regimen to magnify the benefit of RT to cancer patients. Strategies directed to early prediction of RR cancer may be more effective to extend survival of cancer patients rather than attempt to improve the outcome of patients with clinically proven RT failure. Studying the biological functions of these cancer RR biomarkers may reveal the mechanisms of radioresistance and develop biomarker- 277

guided targeted therapy or combination therapy with the aim of sensitising RT on which new treatments and prevention methods can be developed.

278

8. References

279

Abazeed ME, Adams DJ, Hurov KE, Tamayo P, Creighton CJ, Sonkin D, Giacomelli AO, Du C, Fries DF, Wong KK, Mesirov JP, Loeffler JS, Schreiber SL, Hammerman PS and Meyerson M. "Integrative radiogenomic profiling of squamous cell lung cancer." Cancer Res (2013) 73(20): 6289-6298.

Abdallah C, Dumas-Gaudot E, Renaut J and Sergeant K. "Gel-based and gel-free quantitative proteomics approaches at a glance." Int J Plant Genomics (2012) 2012: 494572.

Abdi F, Quinn JF, Jankovic J, McIntosh M, Leverenz JB, Peskind E, Nixon R, Nutt J, Chung K, Zabetian C, Samii A, Lin M, Hattan S, Pan C, Wang Y, Jin J, Zhu D, Li GJ, Liu Y, Waichunas D, Montine TJ and Zhang J. "Detection of biomarkers with a multiplex quantitative proteomic platform in cerebrospinal fluid of patients with neurodegenerative disorders." J Alzheimers Dis (2006) 9(3): 293-348.

Abraham RT. "mTOR as a positive regulator of tumor cell responses to hypoxia." Curr Top Microbiol Immunol (2004) 279: 299-319.

Acevedo VD, Gangula RD, Freeman KW, Li R, Zhang Y, Wang F, Ayala GE, Peterson LE, Ittmann M and Spencer DM. "Inducible FGFR-1 activation leads to irreversible prostate adenocarcinoma and an epithelial-to-mesenchymal transition." Cancer Cell (2007) 12(6): 559-571.

Affolter A, Fruth K, Brochhausen C, Schmidtmann I, Mann WJ and Brieger J. "Activation of mitogen-activated protein kinase extracellular signal-related kinase in head and neck squamous cell carcinomas after irradiation as part of a rescue mechanism." Head Neck (2011) 33(10): 1448-1457.

Ahmad I, Singh LB, Yang ZH, Kalna G, Fleming J, Fisher G, Cooper C, Cuzick J, Berney DM, Moller H, Scardino P and Leung HY. "Mir143 expression inversely correlates with nuclear ERK5 immunoreactivity in clinical prostate cancer." Br J Cancer (2013) 108(1): 149-154.

Aitken A. "14-3-3 proteins on the MAP." Trends Biochem Sci (1995) 20(3): 95- 97.

Al-Assar O, Muschel RJ, Mantoni TS, McKenna WG and Brunner TB. "Radiation response of cancer stem-like cells from established human cell lines after sorting for surface markers." Int J Radiat Oncol Biol Phys (2009) 75(4): 1216-1225.

280

Alessi DR, Deak M, Casamayor A, Caudwell FB, Morrice N, Norman DG, Gaffney P, Reese CB, MacDougall CN, Harbison D, Ashworth A and Bownes M. "3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural and functional homology with the Drosophila DSTPK61 kinase." Curr Biol (1997) 7(10): 776- 789.

Alexander NR, Tran NL, Rekapally H, Summers CE, Glackin C and Heimark RL. "N-cadherin gene expression in prostate carcinoma is modulated by integrin- dependent nuclear translocation of Twist1." Cancer Res (2006) 66(7): 3365-3369.

Algur E, Macklis RM and Hafeli UO. "Synergistic cytotoxic effects of zoledronic acid and radiation in human prostate cancer and myeloma cell lines." Int J Radiat Oncol Biol Phys (2005) 61(2): 535-542.

Amato RJ, Wilding G, Bubley G, Loewy J, Haluska F and Gross ME. "Safety and preliminary efficacy analysis of the mTOR inhibitor ridaforolimus in patients with taxane-treated, castration-resistant prostate cancer." Clin Genitourin Cancer (2012) 10(4): 232-238.

Amin N and Konski AA. "Intensity-modulated radiation therapy for prostate cancer is cost effective and improves therapeutic ratio." Expert Rev Pharmacoecon Outcomes Res (2012) 12(4): 447-450.

An J, Chervin AS, Nie A, Ducoff HS and Huang Z. "Overcoming the radioresistance of prostate cancer cells with a novel Bcl-2 inhibitor." Oncogene (2007) 26(5): 652-661.

Anai S, Goodison S, Shiverick K, Hirao Y, Brown BD and Rosser CJ. "Knock- down of Bcl-2 by antisense oligodeoxynucleotides induces radiosensitisation and inhibition of angiogenesis in human PC-3 prostate tumor xenografts." Mol Cancer Ther (2007) 6(1): 101-111.

Anai S, Goodison S, Shiverick K, Iczkowski K, Tanaka M and Rosser CJ. "Combination of PTEN gene therapy and radiation inhibits the growth of human prostate cancer xenografts." Hum Gene Ther (2006) 17(10): 975-984.

Andarawewa KL, Erickson AC, Chou WS, Costes SV, Gascard P, Mott JD, Bissell MJ and Barcellos-Hoff MH. "Ionizing radiation predisposes nonmalignant human mammary epithelial cells to undergo transforming growth factor beta induced epithelial to mesenchymal transition." Cancer Res (2007) 67(18): 8662- 8670.

281

Anderson L and Hunter CL. "Quantitative mass spectrometric multiple reaction monitoring assays for major plasma proteins." Mol Cell Proteomics (2006) 5(4): 573-588.

Angel TE, Aryal UK, Hengel SM, Baker ES, Kelly RT, Robinson EW and Smith RD. "Mass spectrometry-based proteomics: existing capabilities and future directions." Chem Soc Rev (2012) 41(10): 3912-3928.

Annabi B, Lachambre MP, Plouffe K, Sartelet H and Beliveau R. "Modulation of invasive properties of CD133+ glioblastoma stem cells: a role for MT1-MMP in bioactive lysophospholipid signaling." Mol Carcinog (2009) 48(10): 910-919.

Ansieau S, Bastid J, Doreau A, Morel AP, Bouchet BP, Thomas C, Fauvet F, Puisieux I, Doglioni C, Piccinin S, Maestro R, Voeltzel T, Selmi A, Valsesia- Wittmann S, Caron de Fromentel C and Puisieux A. "Induction of EMT by twist proteins as a collateral effect of tumor-promoting inactivation of premature senescence." Cancer Cell (2008) 14(1): 79-89.

Anwar M, Weinberg V, Chang AJ, Hsu IC, Roach M, 3rd and Gottschalk A. "Hypofractionated SBRT versus conventionally fractionated EBRT for prostate cancer: comparison of PSA slope and nadir." Radiat Oncol (2014) 9: 42.

Apel A, Herr I, Schwarz H, Rodemann HP and Mayer A. "Blocked autophagy sensitizes resistant carcinoma cells to radiation therapy." Cancer Res (2008) 68(5): 1485-1494.

Arico S, Petiot A, Bauvy C, Dubbelhuis PF, Meijer AJ, Codogno P and Ogier- Denis E. "The tumor suppressor PTEN positively regulates macroautophagy by inhibiting the phosphatidylinositol 3-kinase/protein kinase B pathway." J Biol Chem (2001) 276(38): 35243-35246.

Armstrong AJ, Marengo MS, Oltean S, Kemeny G, Bitting RL, Turnbull JD, Herold CI, Marcom PK, George DJ and Garcia-Blanco MA. "Circulating tumor cells from patients with advanced prostate and breast cancer display both epithelial and mesenchymal markers." Mol Cancer Res (2011) 9(8): 997-1007.

Aumüller G (1979). Seminal Vesicles. Prostate Gland and Seminal Vesicles, Springer Berlin Heidelberg. 7 (6): 183-267.

Bae KM, Parker NN, Dai Y, Vieweg J and Siemann DW. "E-cadherin plasticity in prostate cancer stem cell invasion." Am J Cancer Res (2011) 1(1): 71-84.

282

Bae KM, Su Z, Frye C, McClellan S, Allan RW, Andrejewski JT, Kelley V, Jorgensen M, Steindler DA, Vieweg J and Siemann DW. "Expression of pluripotent stem cell reprogramming factors by prostate tumor initiating cells." J Urol (2010) 183(5): 2045-2053.

Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, Dewhirst MW, Bigner DD and Rich JN. "Glioma stem cells promote radioresistance by preferential activation of the DNA damage response." Nature (2006) 444(7120): 756-760.

Barcellos-Hoff MH, Park C and Wright EG. "Radiation and the microenvironment - tumorigenesis and therapy." Nat Rev Cancer (2005) 5(11): 867-875.

Barentsz JO, Richenberg J, Clements R, Choyke P, Verma S, Villeirs G, Rouviere O, Logager V and Futterer JJ. "ESUR prostate MR guidelines 2012." Eur Radiol (2012) 22(4): 746-757.

Barreto-Andrade JC, Efimova EV, Mauceri HJ, Beckett MA, Sutton HG, Darga TE, Vokes EE, Posner MC, Kron SJ and Weichselbaum RR. "Response of human prostate cancer cells and tumors to combining PARP inhibition with ionizing radiation." Mol Cancer Ther (2011) 10(7): 1185-1193.

Bartek J and Lukas J. "Pathways governing G1/S transition and their response to DNA damage." FEBS Lett (2001) 490(3): 117-122.

Bauman JE, Michel LS and Chung CH. "New promising molecular targets in head and neck squamous cell carcinoma." Curr Opin Oncol (2012) 24(3): 235-242.

Baumann M, Krause M and Hill R. "Exploring the role of cancer stem cells in radioresistance." Nat Rev Cancer (2008) 8(7): 545-554.

Begg AC, Stewart FA and Vens C. "Strategies to improve radiotherapy with targeted drugs." Nat Rev Cancer (2011) 11(4): 239-253.

Behnsawy HM, Miyake H, Harada K and Fujisawa M. "Expression patterns of epithelial-mesenchymal transition markers in localized prostate cancer: significance in clinicopathological outcomes following radical prostatectomy." BJU Int (2013) 111(1): 30-37.

Beier D, Hau P, Proescholdt M, Lohmeier A, Wischhusen J, Oefner PJ, Aigner L, Brawanski A, Bogdahn U and Beier CP. "CD133(+) and CD133(-) glioblastoma-

283

derived cancer stem cells show differential growth characteristics and molecular profiles." Cancer Res (2007) 67(9): 4010-4015.

Belka C, Jendrossek V, Pruschy M, Vink S, Verheij M and Budach W. "Apoptosis-modulating agents in combination with radiotherapy-current status and outlook." Int J Radiat Oncol Biol Phys (2004) 58(2): 542-554.

Betz C and Hall MN. "Where is mTOR and what is it doing there?" J Cell Biol (2013) 203(4): 563-574.

Betz C, Stracka D, Prescianotto-Baschong C, Frieden M, Demaurex N and Hall MN. "Feature Article: mTOR complex 2-Akt signaling at mitochondria-associated endoplasmic reticulum membranes (MAM) regulates mitochondrial physiology." Proc Natl Acad Sci U S A (2013) 110(31): 12526-12534.

Biagioli MC and Hoffe SE. "Emerging technologies in prostate cancer radiation therapy: improving the therapeutic window." Cancer Control (2010) 17(4): 223- 232.

Bibault JE, Fumagalli I, Ferte C, Chargari C, Soria JC and Deutsch E. "Personalized radiation therapy and biomarker-driven treatment strategies: a systematic review." Cancer Metastasis Rev (2013) 32(3-4): 479-492.

Bing Z, Yang G, Zhang Y, Wang F, Ye C, Sun J, Zhou G and Yang L. "Proteomic analysis of effects by x-rays and heavy ion in HeLa cells." Radiol Oncol (2014) 48(2): 142-154.

Birck A, Ahrenkiel V, Zeuthen J, Hou-Jensen K and Guldberg P. "Mutation and allelic loss of the PTEN/MMAC1 gene in primary and metastatic melanoma biopsies." J Invest Dermatol (2000) 114(2): 277-280.

Bisson I and Prowse DM. "WNT signaling regulates self-renewal and differentiation of prostate cancer cells with stem cell characteristics." Cell Res (2009) 19(6): 683-697.

Bitting RL and Armstrong AJ. "Targeting the PI3K/Akt/mTOR pathway in castration-resistant prostate cancer." Endocr Relat Cancer (2013) 20(3): R83-99.

Bjerke GA, Yang CS, Frierson HF, Paschal BM and Wotton D. "Activation of Akt signaling in prostate induces a TGFbeta-mediated restraint on cancer progression and metastasis." Oncogene (2014) 33(28): 3660-3667.

284

Bjornsti MA and Houghton PJ. "The TOR pathway: a target for cancer therapy." Nat Rev Cancer (2004) 4(5): 335-348.

Bonaccorsi L, Muratori M, Carloni V, Marchiani S, Formigli L, Forti G and Baldi E. "The androgen receptor associates with the epidermal growth factor receptor in androgen-sensitive prostate cancer cells." Steroids (2004) 69(8-9): 549-552.

Bondar OP, Barnidge DR, Klee EW, Davis BJ and Klee GG. "LC-MS/MS quantification of Zn-alpha2 glycoprotein: a potential serum biomarker for prostate cancer." Clin Chem (2007) 53(4): 673-678.

Bonekamp D, Jacobs MA, El-Khouli R, Stoianovici D and Macura KJ. "Advancements in MR imaging of the prostate: from diagnosis to interventions." Radiographics (2011) 31(3): 677-703.

Bonkhoff H. "Factors implicated in radiation therapy failure and radiosensitisation of prostate cancer." Prostate Cancer (2012) 2012: 593241.

Boral D and Nie D. "Cancer stem cells and niche mircoenvironments." Front Biosci (Elite Ed) (2012) 4: 2502-2514.

Brabletz T, Jung A, Spaderna S, Hlubek F and Kirchner T. "Opinion: migrating cancer stem cells - an integrated concept of malignant tumour progression." Nat Rev Cancer (2005) 5(9): 744-749.

Bridges KA, Hirai H, Buser CA, Brooks C, Liu H, Buchholz TA, Molkentine JM, Mason KA and Meyn RE. "MK-1775, a novel Wee1 kinase inhibitor, radiosensitizes p53-defective human tumor cells." Clin Cancer Res (2011) 17(17): 5638-5648.

Brognard J, Clark AS, Ni Y and Dennis PA. "Akt/protein kinase B is constitutively active in non-small cell lung cancer cells and promotes cellular survival and resistance to chemotherapy and radiation." Cancer Res (2001) 61(10): 3986-3997.

Brooks C, Sheu T, Bridges K, Mason K, Kuban D, Mathew P and Meyn R. "Preclinical evaluation of sunitinib, a multi-tyrosine kinase inhibitor, as a radiosensitizer for human prostate cancer." Radiat Oncol (2012) 7: 154.

285

Bubendorf L, Schopfer A, Wagner U, Sauter G, Moch H, Willi N, Gasser TC and Mihatsch MJ. "Metastatic patterns of prostate cancer: an autopsy study of 1,589 patients." Hum Pathol (2000) 31(5): 578-583.

Burgio SL, Fabbri F, Seymour IJ, Zoli W, Amadori D and De Giorgi U. "Perspectives on mTOR Inhibitors for Castration-Refractory Prostate Cancer." Curr Cancer Drug Targets (2012) 12(8): 940-949.

Bussink J, van der Kogel AJ and Kaanders JH. "Activation of the PI3-K/AKT pathway and implications for radioresistance mechanisms in head and neck cancer." Lancet Oncol (2008) 9(3): 288-296.

Byles V, Zhu L, Lovaas JD, Chmilewski LK, Wang J, Faller DV and Dai Y. "SIRT1 induces EMT by cooperating with EMT transcription factors and enhances prostate cancer cell migration and metastasis." Oncogene (2012) 31(43): 4619-4629.

Byrne JC, Downes MR, O'Donoghue N, O'Keane C, O'Neill A, Fan Y, Fitzpatrick JM, Dunn M and Watson RW. "2D-DIGE as a strategy to identify serum markers for the progression of prostate cancer." J Proteome Res (2009) 8(2): 942-957.

Byun DS, Cho K, Ryu BK, Lee MG, Park JI, Chae KS, Kim HJ and Chi SG. "Frequent monoallelic deletion of PTEN and its reciprocal associatioin with PIK3CA amplification in gastric carcinoma." Int J Cancer (2003) 104(3): 318- 327.

Cadeddu JA. "Re: A Multinational, Multi-Institutional Study Comparing Positive Surgical Margin Rates among 22393 Open, Laparoscopic, and Robot-Assisted Radical Prostatectomy Patients." J Urol (2015) 193(6): 1984-1985.

Cai XZ, Zeng WQ, Xiang Y, Liu Y, Zhang HM, Li H, She S, Yang M, Xia K and Peng SF. "iTRAQ-Based Quantitative Proteomic Analysis of Nasopharyngeal Carcinoma." J Cell Biochem (2015) 116(7): 1431-1441.

Candas D, Lu CL, Fan M, Chuang FY, Sweeney C, Borowsky AD and Li JJ. "Mitochondrial MKP1 is a target for therapy-resistant HER2-positive breast cancer cells." Cancer Res (2014) 74(24): 7498-7509.

Cantley LC. "The phosphoinositide 3-kinase pathway." Science (2002) 296(5573): 1655-1657.

286

Canto EI, Singh H, Shariat SF, Lamb DJ, Mikolajczyk SD, Linton HJ, Rittenhouse HG, Kadmon D, Miles BJ and Slawin KM. "Serum BPSA outperforms both total PSA and free PSA as a predictor of prostatic enlargement in men without prostate cancer." Urology (2004) 63(5): 905-910; discussion 910- 901.

Cao C, Subhawong T, Albert JM, Kim KW, Geng L, Sekhar KR, Gi YJ and Lu B. "Inhibition of mammalian target of rapamycin or apoptotic pathway induces autophagy and radiosensitizes PTEN null prostate cancer cells." Cancer Res (2006) 66(20): 10040-10047.

Cao W, Yacoub S, Shiverick KT, Namiki K, Sakai Y, Porvasnik S, Urbanek C and Rosser CJ. "Dichloroacetate (DCA) sensitizes both wild-type and over expressing Bcl-2 prostate cancer cells in vitro to radiation." Prostate (2008) 68(11): 1223-1231.

Caprioli RM, Farmer TB and Gile J. "Molecular imaging of biological samples: localization of peptides and proteins using MALDI-TOF MS." Anal Chem (1997) 69(23): 4751-4760.

Catton C, Milosevic M, Warde P, Bayley A, Crook J, Bristow R and Gospodarowicz M. "Recurrent prostate cancer following external beam radiotherapy: follow-up strategies and management." Urol Clin North Am (2003) 30(4): 751-763.

Chaachouay H, Ohneseit P, Toulany M, Kehlbach R, Multhoff G and Rodemann HP. "Autophagy contributes to resistance of tumor cells to ionizing radiation." Radiother Oncol (2011) 99(3): 287-292.

Chakravarti A, Zhai G, Suzuki Y, Sarkesh S, Black PM, Muzikansky A and Loeffler JS. "The prognostic significance of phosphatidylinositol 3-kinase pathway activation in human gliomas." J Clin Oncol (2004) 22(10): 1926-1933.

Chang HY, Li MH, Huang TC, Hsu CL, Tsai SR, Lee SC, Huang HC and Juan HF. "Quantitative proteomics reveals middle infrared radiation-interfered networks in breast cancer cells." J Proteome Res (2015) 14(2): 1250-1262.

Chang L, Graham PH, Hao J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. "Emerging roles of radioresistance in prostate cancer metastasis and radiation therapy." Cancer Metastasis Rev (2014) 33(2-3): 469-496.

287

Chang L, Graham PH, Hao J, Ni J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. "Acquisition of epithelial-mesenchymal transition and cancer stem cell phenotypes is associated with activation of the PI3K/Akt/mTOR pathway in prostate cancer radioresistance." Cell Death Dis (2013) 4: e875.

Chang L, Graham PH, Hao J, Ni J, Bucci J, Cozzi PJ, Kearsley JH and Li Y. " Targeting PI3K/Akt/mTOR signalling pathway in the treatment of prostate cancer radioresistance." Critical reviews in Hematology/Oncology. 2015 [Epub ahead of print]

Chang XZ, Li DQ, Hou YF, Wu J, Lu JS, Di GH, Jin W, Ou ZL, Shen ZZ and Shao ZM. "Identification of the functional role of peroxiredoxin 6 in the progression of breast cancer." Breast Cancer Res (2007) 9(6): R76.

Chang Z, Shi G, Jin J, Guo H, Guo X, Luo F, Song Y and Jia X. "Dual PI3K/mTOR inhibitor NVP-BEZ235-induced apoptosis of hepatocellular carcinoma cell lines is enhanced by inhibitors of autophagy." Int J Mol Med (2013) 31(6): 1449-1456.

Chao H, Wang L, Hao J, Ni J, Chang L, Graham PH, Kearsley JH and Li Y. "Low dose histone deacetylase inhibitor, LBH589, potentiates anticancer effect of docetaxel in epithelial ovarian cancer via PI3K/Akt pathway in vitro." Cancer Lett (2013) 329(1): 17-26.

Chee KG, Longmate J, Quinn DI, Chatta G, Pinski J, Twardowski P, Pan CX, Cambio A, Evans CP, Gandara DR and Lara PN, Jr. "The AKT inhibitor perifosine in biochemically recurrent prostate cancer: a phase II California/Pittsburgh cancer consortium trial." Clin Genitourin Cancer (2007) 5(7): 433-437.

Chen J. "Potential value and limitation of dual inhibitors of PI3K and mTOR in the treatment of cancer." Curr Cancer Drug Targets (2013) 13(2): 117-120.

Chen J, Crawford R and Xiao Y. "Vertical inhibition of the PI3K/Akt/mTOR pathway for the treatment of osteoarthritis." J Cell Biochem (2013) 114(2): 245- 249.

288

Chen L, Fang B, Giorgianni F, Gingrich JR and Beranova-Giorgianni S. "Investigation of phosphoprotein signatures of archived prostate cancer tissue specimens via proteomic analysis." Electrophoresis (2011) 32(15): 1984-1991.

Chen N and Karantza-Wadsworth V. "Role and regulation of autophagy in cancer." Biochim Biophys Acta (2009) 1793(9): 1516-1523.

Chen N and Karantza V. "Autophagy as a therapeutic target in cancer." Cancer Biol Ther (2011) 11(2): 157-168.

Chen X, Thakkar H, Tyan F, Gim S, Robinson H, Lee C, Pandey SK, Nwokorie C, Onwudiwe N and Srivastava RK. "Constitutively active Akt is an important regulator of TRAIL sensitivity in prostate cancer." Oncogene (2001) 20(42): 6073-6083.

Chen X, Wong JY, Wong P and Radany EH. "Low-dose valproic acid enhances radiosensitivity of prostate cancer through acetylated p53-dependent modulation of mitochondrial membrane potential and apoptosis." Mol Cancer Res (2011) 9(4): 448-461.

Chen X, Yang TT, Zhou Y, Wang W, Qiu XC, Gao J, Li CX, Long H, Ma BA, Ma Q, Zhang XZ, Yang LJ and Fan QY. "Proteomic profiling of osteosarcoma cells identifies ALDOA and SULT1A3 as negative survival markers of human osteosarcoma." Mol Carcinog (2014) 53(2): 138-144.

Chen YH, Wei MF, Wang CW, Lee HW, Pan SL, Gao M, Kuo SH, Cheng AL and Teng CM. "Dual phosphoinositide 3-kinase/mammalian target of rapamycin inhibitor is an effective radiosensitizer for colorectal cancer." Cancer Lett (2015) 357(2): 582-590.

Cheng JC, Chou CH, Kuo ML and Hsieh CY. "Radiation-enhanced hepatocellular carcinoma cell invasion with MMP-9 expression through PI3K/Akt/NF-kappaB signal transduction pathway." Oncogene (2006) 25(53): 7009-7018.

Chinnaiyan P, Vallabhaneni G, Armstrong E, Huang SM and Harari PM. "Modulation of radiation response by histone deacetylase inhibition." Int J Radiat Oncol Biol Phys (2005) 62(1): 223-229.

Chiou SH, Kao CL, Chen YW, Chien CS, Hung SC, Lo JF, Chen YJ, Ku HH, Hsu MT and Wong TT. "Identification of CD133-positive radioresistant cells in atypical teratoid/rhabdoid tumor." PLoS One (2008) 3(5): e2090.

289

Chiu HW, Chen YA, Ho SY and Wang YJ. "Arsenic trioxide enhances the radiation sensitivity of androgen-dependent and -independent human prostate cancer cells." PLoS One (2012) 7(2): e31579.

Chiu HW, Fang WH, Chen YL, Wu MD, Yuan GF, Ho SY and Wang YJ. "Monascuspiloin enhances the radiation sensitivity of human prostate cancer cells by stimulating endoplasmic reticulum stress and inducing autophagy." PLoS One (2012) 7(7): e40462.

Chuang AY, DeMarzo AM, Veltri RW, Sharma RB, Bieberich CJ and Epstein JI. "Immunohistochemical differentiation of high-grade prostate carcinoma from urothelial carcinoma." Am J Surg Pathol (2007) 31(8): 1246-1255.

Cicalese A, Bonizzi G, Pasi CE, Faretta M, Ronzoni S, Giulini B, Brisken C, Minucci S, Di Fiore PP and Pelicci PG. "The tumor suppressor p53 regulates polarity of self-renewing divisions in mammary stem cells." Cell (2009) 138(6): 1083-1095.

Coen JJ, Bae K, Zietman AL, Patel B, Shipley WU, Slater JD and Rossi CJ. "Acute and late toxicity after dose escalation to 82 GyE using conformal proton radiation for localized prostate cancer: initial report of American College of Radiology Phase II study 03-12." Int J Radiat Oncol Biol Phys (2011) 81(4): 1005-1009.

Cohen RJ, Shannon BA, Phillips M, Moorin RE, Wheeler TM and Garrett KL. "Central zone carcinoma of the prostate gland: a distinct tumor type with poor prognostic features." J Urol (2008) 179(5): 1762-1767; discussion 1767.

Cojoc M, Peitzsch C, Kurth I, Trautmann F, Kunz-Schughart LA, Telegeev GD, Stakhovsky EA, Walker JR, Simin K, Lyle S, Fuessel S, Erdmann K, Wirth MP, Krause M, Baumann M and Dubrovska A. "Aldehyde Dehydrogenase Is Regulated by beta-Catenin/TCF and Promotes Radioresistance in Prostate Cancer Progenitor Cells." Cancer Res (2015) 75(7): 1482-1494.

Colletier PJ, Ashoori F, Cowen D, Meyn RE, Tofilon P, Meistrich ME and Pollack A. "Adenoviral-mediated p53 transgene expression sensitizes both wild- type and null p53 prostate cancer cells in vitro to radiation." Int J Radiat Oncol Biol Phys (2000) 48(5): 1507-1512.

Collins AT, Berry PA, Hyde C, Stower MJ and Maitland NJ. "Prospective identification of tumorigenic prostate cancer stem cells." Cancer Res (2005) 65(23): 10946-10951.

290

Collins AT and Maitland NJ. "Prostate cancer stem cells." Eur J Cancer (2006) 42(9): 1213-1218.

Comploj E and Pycha A. "Experience with radical perineal prostatectomy in the treatment of localized prostate cancer." Ther Adv Urol (2012) 4(3): 125-131.

Contreras HR, Ledezma RA, Vergara J, Cifuentes F, Barra C, Cabello P, Gallegos I, Morales B, Huidobro C and Castellon EA. "The expression of syndecan-1 and - 2 is associated with Gleason score and epithelial-mesenchymal transition markers, E-cadherin and beta-catenin, in prostate cancer." Urol Oncol (2010) 28(5): 534- 540.

Courtney KD, Corcoran RB and Engelman JA. "The PI3K pathway as drug target in human cancer." J Clin Oncol (2010) 28(6): 1075-1083.

Courtney KD, Manola JB, Elfiky AA, Ross R, Oh WK, Yap JT, Van den Abbeele AD, Ryan CW, Beer TM, Loda M, Priolo C, Kantoff P and Taplin ME. "A phase I study of everolimus and docetaxel in patients with castration-resistant prostate cancer." Clin Genitourin Cancer (2015) 13(2): 113-123.

Cox DM, Zhong F, Du M, Duchoslav E, Sakuma T and McDermott JC. "Multiple reaction monitoring as a method for identifying protein posttranslational modifications." J Biomol Tech (2005) 16(2): 83-90.

Creighton CJ, Chang JC and Rosen JM. "Epithelial-mesenchymal transition (EMT) in tumor-initiating cells and its clinical implications in breast cancer." J Mammary Gland Biol Neoplasia (2010) 15(2): 253-260. de la Cruz-Morcillo MA, Garcia-Cano J, Arias-Gonzalez L, Garcia-Gil E, Artacho-Cordon F, Rios-Arrabal S, Valero ML, Cimas FJ, Serrano-Oviedo L, Villas MV, Romero-Fernandez J, Nunez MI and Sanchez-Prieto R. "Abrogation of the p38 MAPK alpha signaling pathway does not promote radioresistance but its activity is required for 5-Fluorouracil-associated radiosensitivity." Cancer Lett (2013) 335(1): 66-74.

De Luca A, Maiello MR, D'Alessio A, Pergameno M and Normanno N. "The RAS/RAF/MEK/ERK and the PI3K/AKT signalling pathways: role in cancer pathogenesis and implications for therapeutic approaches." Expert Opin Ther Targets (2012) 16 Suppl 2: S17-27. de Muga S, Hernandez S, Agell L, Salido M, Juanpere N, Lorenzo M, Lorente JA, Serrano S and Lloreta J. "Molecular alterations of EGFR and PTEN in prostate 291

cancer: association with high-grade and advanced-stage carcinomas." Mod Pathol (2010) 23(5): 703-712.

Diaz R, Nguewa PA, Diaz-Gonzalez JA, Hamel E, Gonzalez-Moreno O, Catena R, Serrano D, Redrado M, Sherris D and Calvo A. "The novel Akt inhibitor Palomid 529 (P529) enhances the effect of radiotherapy in prostate cancer." Br J Cancer (2009) 100(6): 932-940.

Diehn M and Clarke MF. "Cancer stem cells and radiotherapy: new insights into tumor radioresistance." J Natl Cancer Inst (2006) 98(24): 1755-1757.

Dittfeld C, Dietrich A, Peickert S, Hering S, Baumann M, Grade M, Ried T and Kunz-Schughart LA. "CD133 expression is not selective for tumor-initiating or radioresistant cell populations in the CRC cell lines HCT-116." Radiother Oncol (2009) 92(3): 353-361.

Djavan B, Moul JW, Zlotta A, Remzi M and Ravery V. "PSA progression following radical prostatectomy and radiation therapy: new standards in the new Millennium." Eur Urol (2003) 43(1): 12-27.

Djavan B, Remzi M, Zlotta AR, Ravery V, Hammerer P, Reissigl A, Dobronski P, Kaisary A and Marberger M. "Complexed prostate-specific antigen, complexed prostate-specific antigen density of total and transition zone, complexed/total prostate-specific antigen ratio, free-to-total prostate-specific antigen ratio, density of total and transition zone prostate-specific antigen: results of the prospective multicenter European trial." Urology (2002) 60(4 Suppl 1): 4-9.

Doherty RE, Haywood-Small SL, Sisley K and Cross NA. "Aldehyde dehydrogenase activity selects for the holoclone phenotype in prostate cancer cells." Biochem Biophys Res Commun (2011) 414(4): 801-807.

Drake JM, Barnes JM, Madsen JM, Domann FE, Stipp CS and Henry MD. "ZEB1 coordinately regulates laminin-332 and {beta}4 integrin expression altering the invasive phenotype of prostate cancer cells." J Biol Chem (2010) 285(44): 33940- 33948.

Dreher T, Zentgraf H, Abel U, Kappeler A, Michel MS, Bleyl U and Grobholz R. "Reduction of PTEN and p27kip1 expression correlates with tumor grade in prostate cancer. Analysis in radical prostatectomy specimens and needle biopsies." Virchows Arch (2004) 444(6): 509-517.

292

Drigotas M, Affolter A, Mann WJ and Brieger J. "Reactive oxygen species activation of MAPK pathway results in VEGF upregulation as an undesired irradiation response." J Oral Pathol Med (2013) 42(8): 612-619.

Du S, Guan Z, Hao L, Song Y, Wang L, Gong L, Liu L, Qi X, Hou Z and Shao S. "Fructose-bisphosphate aldolase a is a potential metastasis-associated marker of lung squamous cell carcinoma and promotes lung cell tumorigenesis and migration." PLoS One (2014) 9(1): e85804.

Dubrovska A, Elliott J, Salamone RJ, Kim S, Aimone LJ, Walker JR, Watson J, Sauveur-Michel M, Garcia-Echeverria C, Cho CY, Reddy VA and Schultz PG. "Combination therapy targeting both tumor-initiating and differentiated cell populations in prostate carcinoma." Clin Cancer Res (2010) 16(23): 5692-5702.

Dubrovska A, Kim S, Salamone RJ, Walker JR, Maira SM, Garcia-Echeverria C, Schultz PG and Reddy VA. "The role of PTEN/Akt/PI3K signaling in the maintenance and viability of prostate cancer stem-like cell populations." Proc Natl Acad Sci U S A (2009) 106(1): 268-273.

Dumont RA, Tamma M, Braun F, Borkowski S, Reubi JC, Maecke H, Weber WA and Mansi R. "Targeted radiotherapy of prostate cancer with a gastrin-releasing peptide receptor antagonist is effective as monotherapy and in combination with rapamycin." J Nucl Med (2013) 54(5): 762-769.

Eade TN, Guo L, Forde E, Vaux K, Vass J, Hunt P and Kneebone A. "Image- guided dose-escalated intensity-modulated radiation therapy for prostate cancer: treating to doses beyond 78 Gy." BJU Int (2012) 109(11): 1655-1660.

Eastham AM, Spencer H, Soncin F, Ritson S, Merry CL, Stern PL and Ward CM. "Epithelial-mesenchymal transition events during human embryonic stem cell differentiation." Cancer Res (2007) 67(23): 11254-11262.

Escriva M, Peiro S, Herranz N, Villagrasa P, Dave N, Montserrat-Sentis B, Murray SA, Franci C, Gridley T, Virtanen I and Garcia de Herreros A. "Repression of PTEN phosphatase by Snail1 transcriptional factor during gamma radiation-induced apoptosis." Mol Cell Biol (2008) 28(5): 1528-1540.

Eyler CE and Rich JN. "Survival of the fittest: cancer stem cells in therapeutic resistance and angiogenesis." J Clin Oncol (2008) 26(17): 2839-2845.

Fang J, Ding M, Yang L, Liu LZ and Jiang BH. "PI3K/PTEN/AKT signaling regulates prostate tumor angiogenesis." Cell Signal (2007) 19(12): 2487-2497. 293

Fang Y, Vilella-Bach M, Bachmann R, Flanigan A and Chen J. "Phosphatidic acid-mediated mitogenic activation of mTOR signaling." Science (2001) 294(5548): 1942-1945.

Faratian D, Goltsov A, Lebedeva G, Sorokin A, Moodie S, Mullen P, Kay C, Um IH, Langdon S, Goryanin I and Harrison DJ. "Systems biology reveals new strategies for personalizing cancer medicine and confirms the role of PTEN in resistance to trastuzumab." Cancer Res (2009) 69(16): 6713-6720.

Feng XP, Yi H, Li MY, Li XH, Yi B, Zhang PF, Li C, Peng F, Tang CE, Li JL, Chen ZC and Xiao ZQ. "Identification of biomarkers for predicting nasopharyngeal carcinoma response to radiotherapy by proteomics." Cancer Res (2010) 70(9): 3450-3462.

Fillmore CM and Kuperwasser C. "Human breast cancer cell lines contain stem- like cells that self-renew, give rise to phenotypically diverse progeny and survive chemotherapy." Breast Cancer Res (2008) 10(2): R25.

Filson CP, Boer B, Curry J, Linsell S, Ye Z, Montie JE and Miller DC. "Improvement in clinical TNM staging documentation within a prostate cancer quality improvement collaborative." Urology (2014) 83(4): 781-786.

Fimia GM and Piacentini M. "Regulation of autophagy in mammals and its interplay with apoptosis." Cell Mol Life Sci (2010) 67(10): 1581-1588.

Fiveash JB and Spencer SA. "Role of radiation therapy and radiosurgery in glioblastoma multiforme." Cancer J (2003) 9(3): 222-229.

Floc'h N and Abate-Shen C. "The promise of dual targeting Akt/mTOR signaling in lethal prostate cancer." Oncotarget (2012) 3(12): 1483-1484.

Folkes AJ, Ahmadi K, Alderton WK, Alix S, Baker SJ, Box G, Chuckowree IS, Clarke PA, Depledge P, Eccles SA, Friedman LS, Hayes A, Hancox TC, Kugendradas A, Lensun L, Moore P, Olivero AG, Pang J, Patel S, Pergl-Wilson GH, Raynaud FI, Robson A, Saghir N, Salphati L, Sohal S, Ultsch MH, Valenti M, Wallweber HJ, Wan NC, Wiesmann C, Workman P, Zhyvoloup A, Zvelebil MJ and Shuttleworth SJ. "The identification of 2-(1H-indazol-4-yl)-6-(4- methanesulfonyl-piperazin-1-ylmethyl)-4-morpholin-4-yl-t hieno[3,2- d]pyrimidine (GDC-0941) as a potent, selective, orally bioavailable inhibitor of class I PI3 kinase for the treatment of cancer." J Med Chem (2008) 51(18): 5522- 5532.

294

Forman JD, Yudelev M, Bolton S, Tekyi-Mensah S and Maughan R. "Fast neutron irradiation for prostate cancer." Cancer Metastasis Rev (2002) 21(2): 131- 135.

Frese KK and Tuveson DA. "Maximizing mouse cancer models." Nat Rev Cancer (2007) 7(9): 645-658.

Fresno Vara JA, Casado E, de Castro J, Cejas P, Belda-Iniesta C and Gonzalez- Baron M. "PI3K/Akt signalling pathway and cancer." Cancer Treat Rev (2004) 30(2): 193-204.

Fruman DA, Meyers RE and Cantley LC. "Phosphoinositide kinases." Annu Rev Biochem (1998) 67: 481-507.

Fukasawa K. "P53, cyclin-dependent kinase and abnormal amplification of centrosomes." Biochim Biophys Acta (2008) 1786(1): 15-23.

Ganley IG, Lam du H, Wang J, Ding X, Chen S and Jiang X. "ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential for autophagy." J Biol Chem (2009) 284(18): 12297-12305.

Ganswindt U, Budach W, Jendrossek V, Becker G, Bamberg M and Belka C. "Combination of celecoxib with percutaneous radiotherapy in patients with localised prostate cancer - a phase I study." Radiat Oncol (2006) 1: 9.

Gao Y, Ishiyama H, Sun M, Brinkman KL, Wang X, Zhu J, Mai W, Huang Y, Floryk D, Ittmann M, Thompson TC, Butler EB, Xu B and Teh BS. "The alkylphospholipid, perifosine, radiosensitizes prostate cancer cells both in vitro and in vivo." Radiat Oncol (2011) 6: 39.

Geng L, Tan J, Himmelfarb E, Schueneman A, Niermann K, Brousal J, Fu A, Cuneo K, Kesicki EA, Treiberg J, Hayflick JS and Hallahan DE. "A specific antagonist of the p110delta catalytic component of phosphatidylinositol 3'-kinase, IC486068, enhances radiation-induced tumor vascular destruction." Cancer Res (2004) 64(14): 4893-4899.

Gewirtz DA. "Autophagy as a mechanism of radiation sensitization in breast tumor cells." Autophagy (2007) 3(3): 249-250.

295

Gewirtz DA, Hilliker ML and Wilson EN. "Promotion of autophagy as a mechanism for radiation sensitization of breast tumor cells." Radiother Oncol (2009) 92(3): 323-328.

Ghaffari S. "Cancer, stem cells and cancer stem cells: old ideas, new developments." F1000 Med Rep (2011) 3: 23.

Giles FJ. "The vascular endothelial growth factor (VEGF) signaling pathway: a therapeutic target in patients with hematologic malignancies." Oncologist (2001) 6 Suppl 5: 32-39.

Gill S, Thomas J, Fox C, Kron T, Rolfo A, Leahy M, Chander S, Williams S, Tai KH, Duchesne GM and Foroudi F. "Acute toxicity in prostate cancer patients treated with and without image-guided radiotherapy." Radiat Oncol (2011) 6: 145.

Gillet LC, Navarro P, Tate S, Rost H, Selevsek N, Reiter L, Bonner R and Aebersold R. "Targeted data extraction of the MS/MS spectra generated by data- independent acquisition: a new concept for consistent and accurate proteome analysis." Mol Cell Proteomics (2012) 11(6): O111 016717.

Glen A, Gan CS, Hamdy FC, Eaton CL, Cross SS, Catto JW, Wright PC and Rehman I. "iTRAQ-facilitated proteomic analysis of human prostate cancer cells identifies proteins associated with progression." J Proteome Res (2008) 7(3): 897- 907.

Gogineni VR, Nalla AK, Gupta R, Dinh DH, Klopfenstein JD and Rao JS. "Chk2- mediated G2/M cell cycle arrest maintains radiation resistance in malignant meningioma cells." Cancer Lett (2011) 313(1): 64-75.

Gorchs L, Hellevik T, Bruun JA, Camilio KA, Al-Saad S, Stuge TB and Martinez-Zubiaurre I. "Cancer-associated fibroblasts from lung tumors maintain their immunosuppressive abilities after high-dose irradiation." Front Oncol (2015) 5: 87.

Gottschalk AR, Doan A, Nakamura JL, Stokoe D and Haas-Kogan DA. "Inhibition of phosphatidylinositol-3-kinase causes increased sensitivity to radiation through a PKB-dependent mechanism." Int J Radiat Oncol Biol Phys (2005) 63(4): 1221-1227.

Gozuacik D and Kimchi A. "Autophagy as a cell death and tumor suppressor mechanism." Oncogene (2004) 23(16): 2891-2906.

296

Graham TR, Zhau HE, Odero-Marah VA, Osunkoya AO, Kimbro KS, Tighiouart M, Liu T, Simons JW and O'Regan RM. "Insulin-like growth factor-I-dependent up-regulation of ZEB1 drives epithelial-to-mesenchymal transition in human prostate cancer cells." Cancer Res (2008) 68(7): 2479-2488.

Gravina GL, Marampon F, Sherris D, Vittorini F, Di Cesare E, Tombolini V, Lenzi A, Jannini EA and Festuccia C. "Torc1/Torc2 inhibitor, Palomid 529, enhances radiation response modulating CRM1-mediated survivin function and delaying DNA repair in prostate cancer models." Prostate (2014) 74(8): 852-868.

Gray IC, Stewart LM, Phillips SM, Hamilton JA, Gray NE, Watson GJ, Spurr NK and Snary D. "Mutation and expression analysis of the putative prostate tumour- suppressor gene PTEN." Br J Cancer (1998) 78(10): 1296-1300.

Grewe M, Gansauge F, Schmid RM, Adler G and Seufferlein T. "Regulation of cell growth and cyclin D1 expression by the constitutively active FRAP-p70s6K pathway in human pancreatic cancer cells." Cancer Res (1999) 59(15): 3581- 3587.

Griffin C, McNulty J and Pandey S. "Pancratistatin induces apoptosis and autophagy in metastatic prostate cancer cells." Int J Oncol (2011) 38(6): 1549- 1556.

Grover PL and Martin FL. "The initiation of breast and prostate cancer." Carcinogenesis (2002) 23(7): 1095-1102.

Gu G, Yuan J, Wills M and Kasper S. "Prostate cancer cells with stem cell characteristics reconstitute the original human tumor in vivo." Cancer Res (2007) 67(10): 4807-4815.

Guertin DA and Sabatini DM. "Defining the role of mTOR in cancer." Cancer Cell (2007) 12(1): 9-22.

Guillard S, Clarke PA, Te Poele R, Mohri Z, Bjerke L, Valenti M, Raynaud F, Eccles SA and Workman P. "Molecular pharmacology of phosphatidylinositol 3- kinase inhibition in human glioma." Cell Cycle (2009) 8(3): 443-453.

Gunther HS, Schmidt NO, Phillips HS, Kemming D, Kharbanda S, Soriano R, Modrusan Z, Meissner H, Westphal M and Lamszus K. "Glioblastoma-derived stem cell-enriched cultures form distinct subgroups according to molecular and phenotypic criteria." Oncogene (2008) 27(20): 2897-2909.

297

Guo L, Xiao Y, Fan M, Li JJ and Wang Y. "Profiling global kinome signatures of the radioresistant MCF-7/C6 breast cancer cells using MRM-based targeted proteomics." J Proteome Res (2015) 14(1): 193-201.

Gupta AK, Cerniglia GJ, Mick R, Ahmed MS, Bakanauskas VJ, Muschel RJ and McKenna WG. "Radiation sensitization of human cancer cells in vivo by inhibiting the activity of PI3K using LY294002." Int J Radiat Oncol Biol Phys (2003) 56(3): 846-853.

Gupta AK, McKenna WG, Weber CN, Feldman MD, Goldsmith JD, Mick R, Machtay M, Rosenthal DI, Bakanauskas VJ, Cerniglia GJ, Bernhard EJ, Weber RS and Muschel RJ. "Local recurrence in head and neck cancer: relationship to radiation resistance and signal transduction." Clin Cancer Res (2002) 8(3): 885- 892.

Gupta AK, Soto DE, Feldman MD, Goldsmith JD, Mick R, Hahn SM, Machtay M, Muschel RJ and McKenna WG. "Signaling pathways in NSCLC as a predictor of outcome and response to therapy." Lung (2004) 182(3): 151-162.

Gurtner K, Hessel F, Eicheler W, Dorfler A, Zips D, Heider KH, Krause M and Baumann M. "Combined treatment of the immunoconjugate bivatuzumab mertansine and fractionated irradiation improves local tumour control in vivo." Radiother Oncol (2012) 102(3): 444-449.

Gwak HS, Kim TH, Jo GH, Kim YJ, Kwak HJ, Kim JH, Yin J, Yoo H, Lee SH and Park JB. "Silencing of MicroRNA-21 Confers Radio-Sensitivity through Inhibition of the PI3K/AKT Pathway and Enhancing Autophagy in Malignant Glioma Cell Lines." PLoS One (2012) 7(10): e47449.

Hait WN, Jin S and Yang JM. "A matter of life or death (or both): understanding autophagy in cancer." Clin Cancer Res (2006) 12(7 Pt 1): 1961-1965.

Hambardzumyan D, Becher OJ, Rosenblum MK, Pandolfi PP, Manova-Todorova K and Holland EC. "PI3K pathway regulates survival of cancer stem cells residing in the perivascular niche following radiation in medulloblastoma in vivo." Genes Dev (2008) 22(4): 436-448.

Han MW, Lee JC, Choi JY, Kim GC, Chang HW, Nam HY, Kim SW and Kim SY. "Autophagy inhibition can overcome radioresistance in breast cancer cells through suppression of TAK1 activation." Anticancer Res (2014) 34(3): 1449- 1455.

298

Handrick R, Ganswindt U, Faltin H, Goecke B, Daniel PT, Budach W, Belka C and Jendrossek V. "Combined action of celecoxib and ionizing radiation in prostate cancer cells is independent of pro-apoptotic Bax." Radiother Oncol (2009) 90(3): 413-421.

Hao JL NJ, Graham P, Cozzi PJ, Bucci J, Kearsley J et al. "The CD44 Isoforms in Prostate Cancer Metastasis and Progression." World J.Cancer Res (2013) 1: 3-14.

Harada H, Kizaka-Kondoh S, Li G, Itasaka S, Shibuya K, Inoue M and Hiraoka M. "Significance of HIF-1-active cells in angiogenesis and radioresistance." Oncogene (2007) 26(54): 7508-7516.

Harima Y, Sawada S, Nagata K, Sougawa M, Ostapenko V and Ohnishi T. "Mutation of the PTEN gene in advanced cervical cancer correlated with tumor progression and poor outcome after radiotherapy." Int J Oncol (2001) 18(3): 493- 497.

Hay ED. "The mesenchymal cell, its role in the embryo, and the remarkable signaling mechanisms that create it." Dev Dyn (2005) 233(3): 706-720.

Hay N and Sonenberg N. "Upstream and downstream of mTOR." Genes Dev (2004) 18(16): 1926-1945.

He Z, Hu B, Tang L, Zheng S, Sun Y, Sheng Z, Yao Y and Lin F. "The overexpression of MRP4 is related to multidrug resistance in osteosarcoma cells." J Cancer Res Ther (2015) 11(1): 18-23.

He Z, Mangala LS, Theriot CA, Rohde LH, Wu H and Zhang Y. "Cell killing and radiosensitizing effects of atorvastatin in PC3 prostate cancer cells." J Radiat Res (2012) 53(2): 225-233.

Heavey S, O'Byrne KJ and Gately K. "Strategies for co-targeting the PI3K/AKT/mTOR pathway in NSCLC." Cancer Treat Rev (2014) 40(3): 445-456.

Heger Z, Rodrigo MA, Krizkova S, Zitka O, Beklova M, Kizek R and Adam V. "Identification of estrogen receptor proteins in breast cancer cells using matrix- assisted laser desorption/ionization time of flight mass spectrometry (Review)." Oncol Lett (2014) 7(5): 1341-1344.

299

Heinlein CA and Chang C. "The Roles of Androgen Receptors and Androgen- Binding Proteins in Nongenomic Androgen Actions." Molecular Endocrinology (2002) 16(10): 2181-2187.

Hennessey D, Martin LM, Atzberger A, Lynch TH, Hollywood D and Marignol L. "Exposure to hypoxia following irradiation increases radioresistance in prostate cancer cells." Urol Oncol (2013) 31(7): 1106-1116.

Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW, Guba M, Bruns CJ and Heeschen C. "Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer." Cell Stem Cell (2007) 1(3): 313-323.

Hillman GG, Forman JD, Kucuk O, Yudelev M, Maughan RL, Rubio J, Layer A, Tekyi-Mensah S, Abrams J and Sarkar FH. "Genistein potentiates the radiation effect on prostate carcinoma cells." Clin Cancer Res (2001) 7(2): 382-390.

Hillman GG, Wang Y, Kucuk O, Che M, Doerge DR, Yudelev M, Joiner MC, Marples B, Forman JD and Sarkar FH. "Genistein potentiates inhibition of tumor growth by radiation in a prostate cancer orthotopic model." Mol Cancer Ther (2004) 3(10): 1271-1279.

Holland R, Veling SH, Mravunac M and Hendriks JH. "Histologic multifocality of Tis, T1-2 breast carcinomas. Implications for clinical trials of breast-conserving surgery." Cancer (1985) 56(5): 979-990.

Hong SW, Shin JS, Moon JH, Kim YS, Lee J, Choi EK, Ha SH, Lee DH, Chung HN, Kim JE, Kim KP, Hong YS, Lee JL, Lee WJ, Choi EK, Lee JS, Jin DH and Kim TW. "NVP-BEZ235, a dual PI3K/mTOR inhibitor, induces cell death through alternate routes in prostate cancer cells depending on the PTEN genotype." Apoptosis (2014) 19(5): 895-904.

Hoppe R, Phillips TL and Roach III M (2010). Leibel and Phillips Textbook of Radiation Oncology: Expert Consult. Califernia, CA, Elsevier Health Sciences.

Hovinga KE, Stalpers LJ, van Bree C, Donker M, Verhoeff JJ, Rodermond HM, Bosch DA and van Furth WR. "Radiation-enhanced vascular endothelial growth factor (VEGF) secretion in glioblastoma multiforme cell lines--a clue to radioresistance?" J Neurooncol (2005) 74(2): 99-103.

Howes AL, Chiang GG, Lang ES, Ho CB, Powis G, Vuori K and Abraham RT. "The phosphatidylinositol 3-kinase inhibitor, PX-866, is a potent inhibitor of 300

cancer cell motility and growth in three-dimensional cultures." Mol Cancer Ther (2007) 6(9): 2505-2514.

Hu H, Yang Y, Eade A, Xiong Y and Qi Y. "Breaches of the pial basement membrane and disappearance of the glia limitans during development underlie the cortical lamination defect in the mouse model of muscle-eye-brain disease." J Comp Neurol (2007) 501(1): 168-183.

Huamani J, Willey C, Thotala D, Niermann KJ, Reyzer M, Leavitt L, Jones C, Fleishcher A, Caprioli R, Hallahan DE and Kim DW. "Differential efficacy of combined therapy with radiation and AEE788 in high and low EGFR-expressing androgen-independent prostate tumor models." Int J Radiat Oncol Biol Phys (2008) 71(1): 237-246.

Huang L, Li B, Tang S, Guo H, Li W, Huang X, Yan W and Zou F. "Mitochondrial K Channels Control Glioma Radioresistance by Regulating ROS- Induced ERK Activation." Mol Neurobiol (2014) 52(1):626-637.

Huang W, Ding X, Li B, Fan M, Zhou T, Sun H, Yi Y and Zhang J. "Serum biomarkers analyzed by LC-MS/MS as predictors for short outcome of non-small cell lung cancer patients treated with chemoradiotherapy." Neoplasma (2013) 60(1): 11-18.

Hugo H, Ackland ML, Blick T, Lawrence MG, Clements JA, Williams ED and Thompson EW. "Epithelial--mesenchymal and mesenchymal--epithelial transitions in carcinoma progression." J Cell Physiol (2007) 213(2): 374-383.

Hurt EM, Kawasaki BT, Klarmann GJ, Thomas SB and Farrar WL. "CD44+ CD24(-) prostate cells are early cancer progenitor/stem cells that provide a model for patients with poor prognosis." Br J Cancer (2008) 98(4): 756-765.

Husbeck B, Peehl DM and Knox SJ. "Redox modulation of human prostate carcinoma cells by selenite increases radiation-induced cell killing." Free Radic Biol Med (2005) 38(1): 50-57.

Hussain T, Gupta S and Mukhtar H. "Cyclooxygenase-2 and prostate carcinogenesis." Cancer Lett (2003) 191(2): 125-135.

Ikonen T, Matikainen M, Mononen N, Hyytinen ER, Helin HJ, Tommola S, Tammela TL, Pukkala E, Schleutker J, Kallioniemi OP and Koivisto PA. "Association of E-cadherin germ-line alterations with prostate cancer." Clin Cancer Res (2001) 7(11): 3465-3471. 301

Inayat MS, Chendil D, Mohiuddin M, Elford HL, Gallicchio VS and Ahmed MM. "Didox (a novel ribonucleotide reductase inhibitor) overcomes Bcl-2 mediated radiation resistance in prostate cancer cell line PC-3." Cancer Biol Ther (2002) 1(5): 539-545.

Isebaert SF, Swinnen JV, McBride WH and Haustermans KM. "Insulin-like growth factor-type 1 receptor inhibitor NVP-AEW541 enhances radiosensitivity of PTEN wild-type but not PTEN-deficient human prostate cancer cells." Int J Radiat Oncol Biol Phys (2011) 81(1): 239-247.

Ishiyama H, Wang H, Butler EB and Teh BS. "Schedule-dependent interactions between perifosine and radiotherapy in prostate cancer." Journal of Radiation Oncology (2013) 2(2): 209-216.

Ito H, Daido S, Kanzawa T, Kondo S and Kondo Y. "Radiation-induced autophagy is associated with LC3 and its inhibition sensitizes malignant glioma cells." Int J Oncol (2005) 26(5): 1401-1410.

Iwamaru A, Kondo Y, Iwado E, Aoki H, Fujiwara K, Yokoyama T, Mills GB and Kondo S. "Silencing mammalian target of rapamycin signaling by small interfering RNA enhances rapamycin-induced autophagy in malignant glioma cells." Oncogene (2007) 26(13): 1840-1851.

Jackson SP. "Sensing and repairing DNA double-strand breaks." Carcinogenesis (2002) 23(5): 687-696.

Janmaat ML, Kruyt FA, Rodriguez JA and Giaccone G. "Response to epidermal growth factor receptor inhibitors in non-small cell lung cancer cells: limited antiproliferative effects and absence of apoptosis associated with persistent activity of extracellular signal-regulated kinase or Akt kinase pathways." Clin Cancer Res (2003) 9(6): 2316-2326.

Janowski E, Chen LN, Kim JS, Lei S, Suy S, Collins B, Lynch J, Dritschilo A and Collins S. "Stereotactic body radiation therapy (SBRT) for prostate cancer in men with large prostates (>/=50 cm(3))." Radiat Oncol (2014) 9: 241.

Jendrossek V, Henkel M, Hennenlotter J, Vogel U, Ganswindt U, Muller I, Handrick R, Anastasiadis AG, Kuczyk M, Stenzl A and Belka C. "Analysis of complex protein kinase B signalling pathways in human prostate cancer samples." BJU Int (2008) 102(3): 371-382.

302

Jeong HJ, Kim YG, Yang YH and Kim BG. "High-throughput quantitative analysis of total N-glycans by matrix-assisted laser desorption/ionization time-of- flight mass spectrometry." Anal Chem (2012) 84(7): 3453-3460.

Jeter CR, Liu B, Liu X, Chen X, Liu C, Calhoun-Davis T, Repass J, Zaehres H, Shen JJ and Tang DG. "NANOG promotes cancer stem cell characteristics and prostate cancer resistance to androgen deprivation." Oncogene (2011) 30(36): 3833-3845.

Jiang BH, Aoki M, Zheng JZ, Li J and Vogt PK. "Myogenic signaling of phosphatidylinositol 3-kinase requires the serine-threonine kinase Akt/protein kinase B." Proc Natl Acad Sci U S A (1999) 96(5): 2077-2081.

Jin S and White E. "Role of autophagy in cancer: management of metabolic stress." Autophagy (2007) 3(1): 28-31.

Josson S, Sharp S, Sung SY, Johnstone PA, Aneja R, Wang R, Gururajan M, Turner T, Chung LW and Yates C. "Tumor-Stromal Interactions Influence Radiation Sensitivity in Epithelial- versus Mesenchymal-Like Prostate Cancer Cells." J Oncol (2010) 2010.

Jung CH, Jun CB, Ro SH, Kim YM, Otto NM, Cao J, Kundu M and Kim DH. "ULK-Atg13-FIP200 complexes mediate mTOR signaling to the autophagy machinery." Mol Biol Cell (2009) 20(7): 1992-2003.

Jung JW, Hwang SY, Hwang JS, Oh ES, Park S and Han IO. "Ionising radiation induces changes associated with epithelial-mesenchymal transdifferentiation and increased cell motility of A549 lung epithelial cells." Eur J Cancer (2007) 43(7): 1214-1224.

Jung P, Sato T, Merlos-Suarez A, Barriga FM, Iglesias M, Rossell D, Auer H, Gallardo M, Blasco MA, Sancho E, Clevers H and Batlle E. "Isolation and in vitro expansion of human colonic stem cells." Nat Med (2011) 17(10): 1225-1227.

Kaliberov SA, Kaliberova LN and Buchsbaum DJ. "Combined ionizing radiation and sKDR gene delivery for treatment of prostate carcinomas." Gene Ther (2005) 12(5): 407-417.

Karar J and Maity A. "PI3K/AKT/mTOR Pathway in Angiogenesis." Front Mol Neurosci (2011) 4: 51.

303

Karve S, Werner ME, Sukumar R, Cummings ND, Copp JA, Wang EC, Li C, Sethi M, Chen RC, Pacold ME and Wang AZ. "Revival of the abandoned therapeutic wortmannin by nanoparticle drug delivery." Proc Natl Acad Sci U S A (2012) 109(21): 8230-8235.

Kastan MB, Canman CE and Leonard CJ. "P53, cell cycle control and apoptosis: implications for cancer." Cancer Metastasis Rev (1995) 14(1): 3-15.

Kasuno K, Takabuchi S, Fukuda K, Kizaka-Kondoh S, Yodoi J, Adachi T, Semenza GL and Hirota K. "Nitric oxide induces hypoxia-inducible factor 1 activation that is dependent on MAPK and phosphatidylinositol 3-kinase signaling." J Biol Chem (2004) 279(4): 2550-2558.

Keilholz L, Willner J, Thiel HJ, Zamboglou N, Sack H and Popp W. "Time management in radiation oncology: evaluation of time, attendance of medical staff, and resources during radiotherapy for prostate cancer: the DEGRO-QUIRO trial." Strahlenther Onkol (2014) 190(1): 17-25.

Khan MA, Han M, Partin AW, Epstein JI and Walsh PC. "Long-term cancer control of radical prostatectomy in men younger than 50 years of age: update 2003." Urology (2003) 62(1): 86-91; discussion 91-82.

Khan MA, Walsh PC, Miller MC, Bales WD, Epstein JI, Mangold LA, Partin AW and Veltri RW. "Quantitative alterations in nuclear structure predict prostate carcinoma distant metastasis and death in men with biochemical recurrence after radical prostatectomy." Cancer (2003) 98(12): 2583-2591.

Khuntia D, Reddy CA, Mahadevan A, Klein EA and Kupelian PA. "Recurrence- free survival rates after external-beam radiotherapy for patients with clinical T1- T3 prostate carcinoma in the prostate-specific antigen era: what should we expect?" Cancer (2004) 100(6): 1283-1292.

Killick E, Morgan R, Launchbury F, Bancroft E, Page E, Castro E, Kote-Jarai Z, Aprikian A, Blanco I, Clowes V, Domchek S, Douglas F, Eccles D, Evans DG, Harris M, Kirk J, Lam J, Lindeman G, Mitchell G, Pachter N, Selkirk C, Tucker K, Zgajnar J, Eeles R and Pandha H. "Role of Engrailed-2 (EN2) as a prostate cancer detection biomarker in genetically high risk men." Sci Rep (2013) 3: 2059.

Kim BY, Kim KA, Kwon O, Kim SO, Kim MS, Kim BS, Oh WK, Kim GD, Jung M and Ahn JS. "NF-kappaB inhibition radiosensitizes Ki-Ras-transformed cells to ionizing radiation." Carcinogenesis (2005) 26(8): 1395-1403.

304

Kim DH, Sarbassov DD, Ali SM, King JE, Latek RR, Erdjument-Bromage H, Tempst P and Sabatini DM. "mTOR interacts with raptor to form a nutrient- sensitive complex that signals to the cell growth machinery." Cell (2002) 110(2): 163-175.

Kim E, Youn H, Kwon T, Son B, Kang J, Yang HJ, Seong KM, Kim W and Youn B. "PAK1 tyrosine phosphorylation is required to induce epithelial-mesenchymal transition and radioresistance in lung cancer cells." Cancer Res (2014) 74(19): 5520-5531.

Kim JH, Liu L, Lee SO, Kim YT, You KR and Kim DG. "Susceptibility of cholangiocarcinoma cells to parthenolide-induced apoptosis." Cancer Res (2005) 65(14): 6312-6320.

Kim JS, Chang JW, Yun HS, Yang KM, Hong EH, Kim DH, Um HD, Lee KH, Lee SJ and Hwang SG. "Chloride intracellular channel 1 identified using proteomic analysis plays an important role in the radiosensitivity of HEp-2 cells via reactive oxygen species production." Proteomics (2010) 10(14): 2589-2604.

Kim KW, Moretti L, Mitchell LR, Jung DK and Lu B. "Endoplasmic reticulum stress mediates radiation-induced autophagy by perk-eIF2alpha in caspase-3/7- deficient cells." Oncogene (2010) 29(22): 3241-3251.

Kim KW, Myers CJ, Jung DK and Lu B. "NVP-BEZ-235 enhances radiosensitisation via blockade of the PI3K/mTOR pathway in cisplatin-resistant non-small cell lung carcinoma." Genes Cancer (2014) 5(7-8): 293-302.

Kim MH, Jung SY, Ahn J, Hwang SG, Woo HJ, An S, Nam SY, Lim DS and Song JY. "Quantitative proteomic analysis of single or fractionated radiation- induced proteins in human breast cancer MDA-MB-231 cells." Cell Biosci (2015) 5: 2.

Kim SY, Jo HY, Kim MH, Cha YY, Choi SW, Shim JH, Kim TJ and Lee KY. "H2O2-dependent hyperoxidation of peroxiredoxin 6 (Prdx6) plays a role in cellular toxicity via up-regulation of iPLA2 activity." J Biol Chem (2008) 283(48): 33563-33568.

Kim Y, Han D, Min H, Jin J, Yi EC and Kim Y. "Comparative proteomic profiling of pancreatic ductal adenocarcinoma cell lines." Mol Cells (2014) 37(12): 888-898.

305

Kim Y, Lin Q, Glazer PM and Yun Z. "Hypoxic tumor microenvironment and cancer cell differentiation." Curr Mol Med (2009) 9(4): 425-434.

Kimbro KS and Simons JW. "Hypoxia-inducible factor-1 in human breast and prostate cancer." Endocr Relat Cancer (2006) 13(3): 739-749.

Kimmelman AC. "The dynamic nature of autophagy in cancer." Genes Dev (2011) 25(19): 1999-2010.

Kitada S, Leone M, Sareth S, Zhai D, Reed JC and Pellecchia M. "Discovery, characterization, and structure-activity relationships studies of proapoptotic polyphenols targeting B-cell lymphocyte/leukemia-2 proteins." J Med Chem (2003) 46(20): 4259-4264.

Kittel JA, Reddy CA, Smith KL, Stephans KL, Tendulkar RD, Ulchaker J, Angermeier K, Campbell S, Stephenson A, Klein EA, Wilkinson DA and Ciezki JP. "Long-Term Efficacy and Toxicity of Low-Dose-Rate I Prostate Brachytherapy as Monotherapy in Low-, Intermediate-, and High-Risk Prostate Cancer." Int J Radiat Oncol Biol Phys (2015) 92(4):884-893.

Klarmann GJ, Hurt EM, Mathews LA, Zhang X, Duhagon MA, Mistree T, Thomas SB and Farrar WL. "Invasive prostate cancer cells are tumor initiating cells that have a stem cell-like genomic signature." Clin Exp Metastasis (2009) 26(5): 433-446.

Klodowska M, Olko P and Waligorski MP. "Proton microbeam radiotherapy with scanned pencil-beams - Monte Carlo simulations." Phys Med (2015) pii: S1120- 1797(15) 00097-6.

Klotz L. "Active surveillance for prostate cancer: patient selection and management." Curr Oncol (2010) 17 Suppl 2: S11-17.

Knight DC and Eden JA. "A review of the clinical effects of phytoestrogens." Obstet Gynecol (1996) 87(5 Pt 2): 897-904.

Knizetova P, Ehrmann J, Hlobilkova A, Vancova I, Kalita O, Kolar Z and Bartek J. "Autocrine regulation of glioblastoma cell cycle progression, viability and radioresistance through the VEGF-VEGFR2 (KDR) interplay." Cell Cycle (2008) 7(16): 2553-2561.

306

Kocevar N, Hudler P and Komel R. "The progress of proteomic approaches in searching for cancer biomarkers." N Biotechnol (2013) 30(3): 319-326.

Kondo Y, Kanzawa T, Sawaya R and Kondo S. "The role of autophagy in cancer development and response to therapy." Nat Rev Cancer (2005) 5(9): 726-734.

Kong D, Banerjee S, Ahmad A, Li Y, Wang Z, Sethi S and Sarkar FH. "Epithelial to mesenchymal transition is mechanistically linked with stem cell signatures in prostate cancer cells." PLoS One (2010) 5(8): e12445.

Kong D, Li Y, Wang Z and Sarkar FH. "Cancer Stem Cells and Epithelial-to- Mesenchymal Transition (EMT)-Phenotypic Cells: Are They Cousins or Twins?" Cancers (Basel) (2011) 3(1): 716-729.

Konsoula Z, Cao H, Velena A and Jung M. "Adamantanyl-histone deacetylase inhibitor H6CAHA exhibits favorable pharmacokinetics and augments prostate cancer radiation sensitivity." Int J Radiat Oncol Biol Phys (2011) 79(5): 1541- 1548.

Korpela E, Vesprini D and Liu SK. "MicroRNA in radiotherapy: miRage or miRador?" Br J Cancer (2015) 112(5): 777-782.

Koukourakis MI, Giatromanolaki A, Panteliadou M, Pouliliou SE, Chondrou PS, Mavropoulou S and Sivridis E. "Lactate dehydrogenase 5 isoenzyme overexpression defines resistance of prostate cancer to radiotherapy." Br J Cancer (2014) 110(9): 2217-2223.

Koul D, Fu J, Shen R, LaFortune TA, Wang S, Tiao N, Kim YW, Liu JL, Ramnarian D, Yuan Y, Garcia-Echevrria C, Maira SM and Yung WK. "Antitumor activity of NVP-BKM120--a selective pan class I PI3 kinase inhibitor showed differential forms of cell death based on p53 status of glioma cells." Clin Cancer Res (2012) 18(1): 184-195.

Kozakai N, Kikuchi E, Hasegawa M, Suzuki E, Ide H, Miyajima A, Horiguchi Y, Nakashima J, Umezawa K, Shigematsu N and Oya M. "Enhancement of radiosensitivity by a unique novel NF-kappaB inhibitor, DHMEQ, in prostate cancer." Br J Cancer (2012) 107(4): 652-657.

Kremer CL, Klein RR, Mendelson J, Browne W, Samadzedeh LK, Vanpatten K, Highstrom L, Pestano GA and Nagle RB. "Expression of mTOR signaling pathway markers in prostate cancer progression." Prostate (2006) 66(11): 1203- 1212. 307

Kristjansdottir B, Levan K, Partheen K, Carlsohn E and Sundfeldt K. "Potential tumor biomarkers identified in ovarian cyst fluid by quantitative proteomic analysis, iTRAQ." Clin Proteomics (2013) 10(1): 4.

Kroemer G and Levine B. "Autophagic cell death: the story of a misnomer." Nat Rev Mol Cell Biol (2008) 9(12): 1004-1010.

Kuban DA, Levy LB, Cheung MR, Lee AK, Choi S, Frank S and Pollack A. "Long-term failure patterns and survival in a randomized dose-escalation trial for prostate cancer. Who dies of disease?" Int J Radiat Oncol Biol Phys (2011) 79(5): 1310-1317.

Kuger S, Graus D, Brendtke R, Gunther N, Katzer A, Lutyj P, Polat B, Chatterjee M, Sukhorukov VL, Flentje M and Djuzenova CS. "Radiosensitisation of Glioblastoma Cell Lines by the Dual PI3K and mTOR Inhibitor NVP-BEZ235 Depends on Drug-Irradiation Schedule." Transl Oncol (2013) 6(2): 169-179.

Kulasingam V and Diamandis EP. "Strategies for discovering novel cancer biomarkers through utilization of emerging technologies." Nat Clin Pract Oncol (2008) 5(10): 588-599.

Kuo HP, Lee DF, Chen CT, Liu M, Chou CK, Lee HJ, Du Y, Xie X, Wei Y, Xia W, Weihua Z, Yang JY, Yen CJ, Huang TH, Tan M, Xing G, Zhao Y, Lin CH, Tsai SF, Fidler IJ and Hung MC. "ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway." Sci Signal (2010) 3(108): ra9.

Kupelian PA, Potters L, Khuntia D, Ciezki JP, Reddy CA, Reuther AM, Carlson TP and Klein EA. "Radical prostatectomy, external beam radiotherapy <72 Gy, external beam radiotherapy > or =72 Gy, permanent seed implantation, or combined seeds/external beam radiotherapy for stage T1-T2 prostate cancer." Int J Radiat Oncol Biol Phys (2004) 58(1): 25-33.

Kurrey NK, Jalgaonkar SP, Joglekar AV, Ghanate AD, Chaskar PD, Doiphode RY and Bapat SA. "Snail and slug mediate radioresistance and chemoresistance by antagonizing p53-mediated apoptosis and acquiring a stem-like phenotype in ovarian cancer cells." Stem Cells (2009) 27(9): 2059-2068.

Kuwahara Y, Oikawa T, Ochiai Y, Roudkenar MH, Fukumoto M, Shimura T, Ohtake Y, Ohkubo Y, Mori S, Uchiyama Y and Fukumoto M. "Enhancement of autophagy is a potential modality for tumors refractory to radiotherapy." Cell Death Dis (2011) 2: e177.

308

Kwok WK, Ling MT, Lee TW, Lau TC, Zhou C, Zhang X, Chua CW, Chan KW, Chan FL, Glackin C, Wong YC and Wang X. "Up-regulation of TWIST in prostate cancer and its implication as a therapeutic target." Cancer Res (2005) 65(12): 5153-5162.

Laane E, Tamm KP, Buentke E, Ito K, Kharaziha P, Oscarsson J, Corcoran M, Bjorklund AC, Hultenby K, Lundin J, Heyman M, Soderhall S, Mazur J, Porwit A, Pandolfi PP, Zhivotovsky B, Panaretakis T and Grander D. "Cell death induced by dexamethasone in lymphoid leukemia is mediated through initiation of autophagy." Cell Death Differ (2009) 16(7): 1018-1029.

Lacombe J, Azria D, Mange A and Solassol J. "Proteomic approaches to identify biomarkers predictive of radiotherapy outcomes." Expert Rev Proteomics (2013) 10(1): 33-42.

Lagadec C, Vlashi E, Della Donna L, Dekmezian C and Pajonk F. "Radiation- induced reprogramming of breast cancer cells." Stem Cells (2012) 30(5): 833-844.

Lang SH, Frame FM and Collins AT. "Prostate cancer stem cells." J Pathol (2009) 217(2): 299-306.

Ledezma RA, Negron E, Razmaria AA, Dangle P, Eggener SE, Shalhav AL and Zagaja GP. "Robotic-assisted pelvic lymph node dissection for prostate cancer: frequency of nodal metastases and oncological outcomes." World J Urol (2015).

Lee JT, Jr., Steelman LS and McCubrey JA. "Phosphatidylinositol 3'-kinase activation leads to multidrug resistance protein-1 expression and subsequent chemoresistance in advanced prostate cancer cells." Cancer Res (2004) 64(22): 8397-8404.

Lee JT, Lehmann BD, Terrian DM, Chappell WH, Stivala F, Libra M, Martelli AM, Steelman LS and McCubrey JA. "Targeting prostate cancer based on signal transduction and cell cycle pathways." Cell Cycle (2008) 7(12): 1745-1762.

Lee SH, Poulogiannis G, Pyne S, Jia S, Zou L, Signoretti S, Loda M, Cantley LC and Roberts TM. "A constitutively activated form of the p110beta isoform of PI3- kinase induces prostatic intraepithelial neoplasia in mice." Proc Natl Acad Sci U S A (2010) 107(24): 11002-11007.

Lee SY, Park HR, Cho NH, Choi YP, Rha SY, Park SW and Kim SH. "Identifying genes related to radiation resistance in oral squamous cell carcinoma cell lines." Int J Oral Maxillofac Surg (2013) 42(2): 169-176. 309

Leevers SJ, Vanhaesebroeck B and Waterfield MD. "Signalling through phosphoinositide 3-kinases: the lipids take centre stage." Curr Opin Cell Biol (1999) 11(2): 219-225.

Lehtio J and De Petris L. "Lung cancer proteomics, clinical and technological considerations." J Proteomics (2010) 73(10): 1851-1863.

Leissner K-H and Tisell L-E. "The Weight of the Human Prostate." Scandinavian Journal of Urology and Nephrology (1979) 13(2): 137-142.

Leith JT. "In vitro radiation sensitivity of the LNCaP prostatic tumor cell line." Prostate (1994) 24(3): 119-124.

Leman ES, Magheli A, Cannon GW, Mangold L, Partin AW and Getzenberg RH. "Analysis of a serum test for prostate cancer that detects a second epitope of EPCA-2." Prostate (2009) 69(11): 1188-1194.

Lessa RC, Campos AH, Freitas CE, Silva FR, Kowalski LP, Carvalho AL and Vettore AL. "Identification of upregulated genes in oral squamous cell carcinomas." Head Neck (2013) 35(10): 1475-1481.

Levine B. "Unraveling the role of autophagy in cancer." Autophagy (2006) 2(2): 65-66.

Li DQ, Wang L, Fei F, Hou YF, Luo JM, Zeng R, Wu J, Lu JS, Di GH, Ou ZL, Xia QC, Shen ZZ and Shao ZM. "Identification of breast cancer metastasis- associated proteins in an isogenic tumor metastasis model using two-dimensional gel electrophoresis and liquid chromatography-ion trap-mass spectrometry." Proteomics (2006) 6(11): 3352-3368.

Li G, Xie B, Li X, Chen Y, Xu Y, Xu-Welliver M and Zou L. "Downregulation of peroxiredoxin-1 by beta-elemene enhances the radiosensitivity of lung adenocarcinoma xenografts." Oncol Rep (2015) 33(3): 1427-1433.

Li H, Chen X, Calhoun-Davis T, Claypool K and Tang DG. "PC3 human prostate carcinoma cell holoclones contain self-renewing tumor-initiating cells." Cancer Res (2008) 68(6): 1820-1825.

Li H, Jiang M, Honorio S, Patrawala L, Jeter CR, Calhoun-Davis T, Hayward SW and Tang DG. "Methodologies in assaying prostate cancer stem cells." Methods Mol Biol (2009) 568: 85-138.

310

Li H and Tang DG. "Prostate cancer stem cells and their potential roles in metastasis." J Surg Oncol (2011) 103(6): 558-562.

Li HF, Kim JS and Waldman T. "Radiation-induced Akt activation modulates radioresistance in human glioblastoma cells." Radiat Oncol (2009) 4: 43.

Li L, Huang S, Zhu X, Zhou Z, Liu Y, Qu S and Guo Y. "Identification of radioresistance-associated proteins in human nasopharyngeal carcinoma cell lines by proteomic analysis." Cancer Biother Radiopharm (2013) 28(5): 380-384.

Li T, Zeng ZC, Wang L, Qiu SJ, Zhou JW, Zhi XT, Yu HH and Tang ZY. "Radiation enhances long-term metastasis potential of residual hepatocellular carcinoma in nude mice through TMPRSS4-induced epithelial-mesenchymal transition." Cancer Gene Ther (2011) 18(9): 617-626.

Li Y, Cozzi PJ and Russell PJ. "Promising tumor-associated antigens for future prostate cancer therapy." Med Res Rev (2010) 30(1): 67-101.

Li Y, Jenkins CW, Nichols MA and Xiong Y. "Cell cycle expression and p53 regulation of the cyclin-dependent kinase inhibitor p21." Oncogene (1994) 9(8): 2261-2268.

Liang B, Kong D, Liu Y, Liang N, He M, Ma S and Liu X. "Autophagy inhibition plays the synergetic killing roles with radiation in the multi-drug resistant SKVCR ovarian cancer cells." Radiat Oncol (2012) 7: 213.

Liang YW, Zheng J, Li X, Zheng W and Chen T. "Selenadiazole derivatives as potent thioredoxin reductase inhibitors that enhance the radiosensitivity of cancer cells." Eur J Med Chem (2014) 84: 335-342.

Lin HK, Hu YC, Yang L, Altuwaijri S, Chen YT, Kang HY and Chang C. "Suppression versus induction of androgen receptor functions by the phosphatidylinositol 3-kinase/Akt pathway in prostate cancer LNCaP cells with different passage numbers." J Biol Chem (2003) 278(51): 50902-50907.

Lin HK, Yeh S, Kang HY and Chang C. "Akt suppresses androgen-induced apoptosis by phosphorylating and inhibiting androgen receptor." Proc Natl Acad Sci U S A (2001) 98(13): 7200-7205.

311

Lin J, Adam RM, Santiestevan E and Freeman MR. "The phosphatidylinositol 3'- kinase pathway is a dominant growth factor-activated cell survival pathway in LNCaP human prostate carcinoma cells." Cancer Res (1999) 59(12): 2891-2897.

Lin TY, Chang JT, Wang HM, Chan SH, Chiu CC, Lin CY, Fan KH, Liao CT, Chen IH, Liu TZ, Li HF and Cheng AJ. "Proteomics of the radioresistant phenotype in head-and-neck cancer: Gp96 as a novel prediction marker and sensitizing target for radiotherapy." Int J Radiat Oncol Biol Phys (2010) 78(1): 246-256.

Liu AY and True LD. "Characterization of prostate cell types by CD cell surface molecules." Am J Pathol (2002) 160(1): 37-43.

Liu F, Wang JJ, You ZY, Zhang YD and Zhao Y. "Radiosensitivity of prostate cancer cells is enhanced by EGFR inhibitor C225." Urol Oncol (2010) 28(1): 59- 66.

Liu Q, Nguyen DH, Dong Q, Shitaku P, Chung K, Liu OY, Tso JL, Liu JY, Konkankit V, Cloughesy TF, Mischel PS, Lane TF, Liau LM, Nelson SF and Tso CL. "Molecular properties of CD133+ glioblastoma stem cells derived from treatment-refractory recurrent brain tumors." J Neurooncol (2009) 94(1): 1-19.

Liu T, Xu F, Du X, Lai D, Liu T, Zhao Y, Huang Q, Jiang L, Huang W, Cheng W and Liu Z. "Establishment and characterization of multi-drug resistant, prostate carcinoma-initiating stem-like cells from human prostate cancer cell lines 22RV1." Mol Cell Biochem (2010) 340(1-2): 265-273.

Liu Y, Chen J, Sethi A, Li QK, Chen L, Collins B, Gillet LC, Wollscheid B, Zhang H and Aebersold R. "Glycoproteomic analysis of prostate cancer tissues by SWATH mass spectrometry discovers N-acylethanolamine acid amidase and protein tyrosine kinase 7 as signatures for tumor aggressiveness." Mol Cell Proteomics (2014) 13(7): 1753-1768.

Lohrer HD. "Regulation of the cell cycle following DNA damage in normal and Ataxia telangiectasia cells." Experientia (1996) 52(4): 316-328.

Lojanapiwat B, Anutrakulchai W, Chongruksut W and Udomphot C. "Correlation and diagnostic performance of the prostate-specific antigen level with the diagnosis, aggressiveness, and bone metastasis of prostate cancer in clinical practice." Prostate Int (2014) 2(3): 133-139.

312

Lomonaco SL, Finniss S, Xiang C, Decarvalho A, Umansky F, Kalkanis SN, Mikkelsen T and Brodie C. "The induction of autophagy by gamma-radiation contributes to the radioresistance of glioma stem cells." Int J Cancer (2009) 125(3): 717-722.

Loupakis F, Pollina L, Stasi I, Ruzzo A, Scartozzi M, Santini D, Masi G, Graziano F, Cremolini C, Rulli E, Canestrari E, Funel N, Schiavon G, Petrini I, Magnani M, Tonini G, Campani D, Floriani I, Cascinu S and Falcone A. "PTEN expression and KRAS mutations on primary tumors and metastases in the prediction of benefit from cetuximab plus irinotecan for patients with metastatic colorectal cancer." J Clin Oncol (2009) 27(16): 2622-2629.

Lu NZ, Wardell SE, Burnstein KL, Defranco D, Fuller PJ, Giguere V, Hochberg RB, McKay L, Renoir JM, Weigel NL, Wilson EM, McDonnell DP and Cidlowski JA. "International Union of Pharmacology. LXV. The pharmacology and classification of the nuclear receptor superfamily: glucocorticoid, mineralocorticoid, progesterone, and androgen receptors." Pharmacol Rev (2006) 58(4): 782-797.

Lue HW, Yang X, Wang R, Qian W, Xu RZ, Lyles R, Osunkoya AO, Zhou BP, Vessella RL, Zayzafoon M, Liu ZR, Zhau HE and Chung LW. "LIV-1 promotes prostate cancer epithelial-to-mesenchymal transition and metastasis through HB- EGF shedding and EGFR-mediated ERK signaling." PLoS One (2011) 6(11): e27720.

Ma DJ, Galanis E, Anderson SK, Schiff D, Kaufmann TJ, Peller PJ, Giannini C, Brown PD, Uhm JH, McGraw S, Jaeckle KA, Flynn PJ, Ligon KL, Buckner JC and Sarkaria JN. "A phase II trial of everolimus, temozolomide, and radiotherapy in patients with newly diagnosed glioblastoma: NCCTG N057K." Neuro Oncol (2014).

Madani I, De Neve W and Mareel M. "Does ionizing radiation stimulate cancer invasion and metastasis?" Bull Cancer (2008) 95(3): 292-300.

Magee JA, Piskounova E and Morrison SJ. "Cancer stem cells: impact, heterogeneity, and uncertainty." Cancer Cell (2012) 21(3): 283-296.

Maira SM, Pecchi S, Huang A, Burger M, Knapp M, Sterker D, Schnell C, Guthy D, Nagel T, Wiesmann M, Brachmann S, Fritsch C, Dorsch M, Chene P, Shoemaker K, De Pover A, Menezes D, Martiny-Baron G, Fabbro D, Wilson CJ, Schlegel R, Hofmann F, Garcia-Echeverria C, Sellers WR and Voliva CF. "Identification and characterization of NVP-BKM120, an orally available pan- class I PI3-kinase inhibitor." Mol Cancer Ther (2012) 11(2): 317-328.

313

Maira SM, Stauffer F, Brueggen J, Furet P, Schnell C, Fritsch C, Brachmann S, Chene P, De Pover A, Schoemaker K, Fabbro D, Gabriel D, Simonen M, Murphy L, Finan P, Sellers W and Garcia-Echeverria C. "Identification and characterization of NVP-BEZ235, a new orally available dual phosphatidylinositol 3-kinase/mammalian target of rapamycin inhibitor with potent in vivo antitumor activity." Mol Cancer Ther (2008) 7(7): 1851-1863.

Maira SM, Stauffer F, Schnell C and Garcia-Echeverria C. "PI3K inhibitors for cancer treatment: where do we stand?" Biochem Soc Trans (2009) 37(Pt 1): 265- 272.

Maitland NJ and Collins AT. "Prostate cancer stem cells: a new target for therapy." J Clin Oncol (2008) 26(17): 2862-2870.

Maiuri MC, Criollo A and Kroemer G. "Crosstalk between apoptosis and autophagy within the Beclin 1 interactome." EMBO J (2010) 29(3): 515-516.

Mak P, Leav I, Pursell B, Bae D, Yang X, Taglienti CA, Gouvin LM, Sharma VM and Mercurio AM. "ERbeta impedes prostate cancer EMT by destabilizing HIF- 1alpha and inhibiting VEGF-mediated snail nuclear localization: implications for Gleason grading." Cancer Cell (2010) 17(4): 319-332.

Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C, Yang J and Weinberg RA. "The epithelial-mesenchymal transition generates cells with properties of stem cells." Cell (2008) 133(4): 704-715.

Manning BD and Cantley LC. "AKT/PKB signaling: navigating downstream." Cell (2007) 129(7): 1261-1274.

Mao C, Liao RY and Chen Q. "Loss of PTEN expression predicts resistance to EGFR-targeted monoclonal antibodies in patients with metastatic colorectal cancer." Br J Cancer (2010) 102(5): 940.

Marampon F, Gravina GL, Popov VM, Scarsella L, Festuccia C, La Verghetta ME, Parente S, Cerasani M, Bruera G, Ficorella C, Ricevuto E, Tombolini V, Di Cesare E and Zani BM. "Close correlation between MEK/ERK and Aurora-B signaling pathways in sustaining tumorigenic potential and radioresistance of gynecological cancer cell lines." Int J Oncol (2014) 44(1): 285-294.

314

Marie-Egyptienne DT, Lohse I and Hill RP. "Cancer stem cells, the epithelial to mesenchymal transition (EMT) and radioresistance: potential role of hypoxia." Cancer Lett (2013) 341(1): 63-72.

Martelli AM, Evangelisti C, Chappell W, Abrams SL, Basecke J, Stivala F, Donia M, Fagone P, Nicoletti F, Libra M, Ruvolo V, Ruvolo P, Kempf CR, Steelman LS and McCubrey JA. "Targeting the translational apparatus to improve leukemia therapy: roles of the PI3K/PTEN/Akt/mTOR pathway." Leukemia (2011) 25(7): 1064-1079.

Martelli AM, Evangelisti C, Chiarini F, Grimaldi C, Cappellini A, Ognibene A and McCubrey JA. "The emerging role of the phosphatidylinositol 3- kinase/Akt/mammalian target of rapamycin signaling network in normal myelopoiesis and leukemogenesis." Biochim Biophys Acta (2010) 1803(9): 991- 1002.

Martelli AM, Evangelisti C, Follo MY, Ramazzotti G, Fini M, Giardino R, Manzoli L, McCubrey JA and Cocco L. "Targeting the phosphatidylinositol 3- kinase/Akt/mammalian target of rapamycin signaling network in cancer stem cells." Curr Med Chem (2011) 18(18): 2715-2726.

Marur S and Forastiere AA. "Head and neck cancer: changing epidemiology, diagnosis, and treatment." Mayo Clin Proc (2008) 83(4): 489-501.

Mathew R, Karantza-Wadsworth V and White E. "Role of autophagy in cancer." Nat Rev Cancer (2007) 7(12): 961-967.

Matsubara A, Teishima J, Mirkhat S, Yasumoto H, Mochizuki H, Seki M, Mutaguchi K, McKeehan WL and Usui T. "Restoration of FGF receptor type 2 enhances radiosensitivity of hormone-refractory human prostate carcinoma PC-3 cells." Anticancer Res (2008) 28(4B): 2141-2146.

Matsumoto N, Ariga A, To-e S, Nakamura H, Agata N, Hirano S, Inoue J and Umezawa K. "Synthesis of NF-kappaB activation inhibitors derived from epoxyquinomicin C." Bioorg Med Chem Lett (2000) 10(9): 865-869.

Matsuoka S, Huang M and Elledge SJ. "Linkage of ATM to cell cycle regulation by the Chk2 protein kinase." Science (1998) 282(5395): 1893-1897.

McCall P, Gemmell LK, Mukherjee R, Bartlett JM and Edwards J. "Phosphorylation of the androgen receptor is associated with reduced survival in

315

hormone-refractory prostate cancer patients." Br J Cancer (2008) 98(6): 1094- 1101.

McKenna WG, Muschel RJ, Gupta AK, Hahn SM and Bernhard EJ. "The RAS signal transduction pathway and its role in radiation sensitivity." Oncogene (2003) 22(37): 5866-5875.

McMenamin ME, Soung P, Perera S, Kaplan I, Loda M and Sellers WR. "Loss of PTEN expression in paraffin-embedded primary prostate cancer correlates with high Gleason score and advanced stage." Cancer Res (1999) 59(17): 4291-4296.

Meijer TW, Kaanders JH, Span PN and Bussink J. "Targeting hypoxia, HIF-1, and tumor glucose metabolism to improve radiotherapy efficacy." Clin Cancer Res (2012) 18(20): 5585-5594.

Meng MB, Wang HH, Guo WH, Wu ZQ, Zeng XL, Zaorsky NG, Shi HS, Qian D, Niu ZM, Jiang B, Zhao LJ, Yuan ZY and Wang P. "Targeting pyruvate kinase M2 contributes to radiosensitivity of non-small cell lung cancer cells in vitro and in vivo." Cancer Lett (2015) 356(2 Pt B): 985-993.

Mikolajczyk SD, Millar LS, Wang TJ, Rittenhouse HG, Wolfert RL, Marks LS, Song W, Wheeler TM and Slawin KM. ""BPSA," a specific molecular form of free prostate-specific antigen, is found predominantly in the transition zone of patients with nodular benign prostatic hyperplasia." Urology (2000) 55(1): 41-45.

Mimeault M and Batra SK. "Frequent gene products and molecular pathways altered in prostate cancer- and metastasis-initiating cells and their progenies and novel promising multitargeted therapies." Mol Med (2011) 17(9-10): 949-964.

Mintz PJ, Rietz AC, Cardo-Vila M, Ozawa MG, Dondossola E, Do KA, Kim J, Troncoso P, Logothetis CJ, Sidman RL, Pasqualini R and Arap W. "Discovery and horizontal follow-up of an autoantibody signature in human prostate cancer." Proc Natl Acad Sci U S A (2015) 112(8): 2515-2520.

Miyasaka A, Oda K, Ikeda Y, Sone K, Fukuda T, Inaba K, Makii C, Enomoto A, Hosoya N, Tanikawa M, Uehara Y, Arimoto T, Kuramoto H, Wada-Hiraike O, Miyagawa K, Yano T, Kawana K, Osuga Y and Fujii T. "PI3K/mTOR pathway inhibition overcomes radioresistance via suppression of the HIF1-alpha/VEGF pathway in endometrial cancer." Gynecol Oncol (2015) 138(1):174-180.

MOORADIAN AD, MORLEY JE and KORENMAN SG. "Biological Actions of Androgens." Endocrine Reviews (1987) 8(1): 1-28. 316

Moretti L, Attia A, Kim KW and Lu B. "Crosstalk between Bak/Bax and mTOR signaling regulates radiation-induced autophagy." Autophagy (2007) 3(2): 142- 144.

Morgan TM, Koreckij TD and Corey E. "Targeted therapy for advanced prostate cancer: inhibition of the PI3K/Akt/mTOR pathway." Curr Cancer Drug Targets (2009) 9(2): 237-249.

Morrissey B, O'Shea C, Armstrong J, Rooney C, Staunton L, Sheehan M, Shannon AM and Pennington SR. "Development of a label-free LC-MS/MS strategy to approach the identification of candidate protein biomarkers of disease recurrence in prostate cancer patients in a clinical trial of combined hormone and radiation therapy." Proteomics Clin Appl (2013) 7(5-6): 316-326.

Motzer RJ, Hoosen S, Bello CL and Christensen JG. "Sunitinib malate for the treatment of solid tumours: a review of current clinical data." Expert Opin Investig Drugs (2006) 15(5): 553-561.

Mu Z, Hachem P, Agrawal S and Pollack A. "Antisense MDM2 sensitizes prostate cancer cells to androgen deprivation, radiation, and the combination." Int J Radiat Oncol Biol Phys (2004) 58(2): 336-343.

Mukherjee B, Tomimatsu N, Amancherla K, Camacho CV, Pichamoorthy N and Burma S. "The dual PI3K/mTOR inhibitor NVP-BEZ235 is a potent inhibitor of ATM- and DNA-PKCs-mediated DNA damage responses." Neoplasia (2012) 14(1): 34-43.

Mulholland DJ, Kobayashi N, Ruscetti M, Zhi A, Tran LM, Huang J, Gleave M and Wu H. "Pten loss and RAS/MAPK activation cooperate to promote EMT and metastasis initiated from prostate cancer stem/progenitor cells." Cancer Res (2012) 72(7): 1878-1889.

Murillo H, Huang H, Schmidt LJ, Smith DI and Tindall DJ. "Role of PI3K signaling in survival and progression of LNCaP prostate cancer cells to the androgen refractory state." Endocrinology (2001) 142(11): 4795-4805.

Myers RP. "Structure of the adult prostate from a clinician's standpoint." Clinical Anatomy (2000) 13(3): 214-215.

Nagle RB, Ahmann FR, McDaniel KM, Paquin ML, Clark VA and Celniker A. "Cytokeratin characterization of human prostatic carcinoma and its derived cell lines." Cancer Res (1987) 47(1): 281-286. 317

Nakashio A, Fujita N, Rokudai S, Sato S and Tsuruo T. "Prevention of phosphatidylinositol 3'-kinase-Akt survival signaling pathway during topotecan- induced apoptosis." Cancer Res (2000) 60(18): 5303-5309.

Nakayama K, Inoue T, Sekiya S, Terada N, Miyazaki Y, Goto T, Kajihara S, Kawabata S, Iwamoto S, Ikawa K, Oosaga J, Tsuji H, Tanaka K and Ogawa O. "The C-terminal fragment of prostate-specific antigen, a 2331 Da peptide, as a new urinary pathognomonic biomarker candidate for diagnosing prostate cancer." PLoS One (2014) 9(9): e107234.

Narizhneva NV, Tararova ND, Ryabokon P, Shyshynova I, Prokvolit A, Komarov PG, Purmal AA, Gudkov AV and Gurova KV. "Small molecule screening reveals a transcription-independent pro-survival function of androgen receptor in castration-resistant prostate cancer." Cell Cycle (2009) 8(24): 4155-4167.

Natarajan S, Marks LS, Margolis DJ, Huang J, Macairan ML, Lieu P and Fenster A. "Clinical application of a 3D ultrasound-guided prostate biopsy system." Urol Oncol (2011) 29(3): 334-342.

Nauseef JT and Henry MD. "Epithelial-to-mesenchymal transition in prostate cancer: paradigm or puzzle?" Nat Rev Urol (2011) 8(8): 428-439.

Naylor S. "Biomarkers: current perspectives and future prospects." Expert Rev Mol Diagn (2003) 3(5): 525-529.

Negri FV, Bozzetti C, Lagrasta CA, Crafa P, Bonasoni MP, Camisa R, Pedrazzi G and Ardizzoni A. "PTEN status in advanced colorectal cancer treated with cetuximab." Br J Cancer (2010) 102(1): 162-164.

Ni J, Cozzi P, Hao J, Beretov J, Chang L, Duan W, Shigdar S, Delprado W, Graham P, Bucci J, Kearsley J and Li Y. "Epithelial cell adhesion molecule (EpCAM) is associated with prostate cancer metastasis and chemo/radioresistance via the PI3K/Akt/mTOR signaling pathway." The International Journal of Biochemistry & Cell Biology (2013) 45(12): 2736-2748.

Ni J, Cozzi P, Hao J, Duan W, Graham P, Kearsley J and Li Y. "Cancer stem cells in prostate cancer chemoresistance." Curr Cancer Drug Targets (2014) 14(3): 225- 240.

Ni J, Cozzi PJ, Duan W, Shigdar S, Graham PH, John KH and Li Y. "Role of the EpCAM (CD326) in prostate cancer metastasis and progression." Cancer Metastasis Rev (2012) 31(3-4): 779-791. 318

Ni J, Cozzi PJ, Hao JL, Beretov J, Chang L, Duan W, Shigdar S, Delprado WJ, Graham PH, Bucci J, Kearsley JH and Li Y. "CD44 variant 6 is associated with prostate cancer metastasis and chemo-/radioresistance." Prostate (2014) 74(6): 602-617.

Nicholson KM and Anderson NG. "The protein kinase B/Akt signalling pathway in human malignancy." Cell Signal (2002) 14(5): 381-395.

Nishida S, Hirohashi Y, Torigoe T, Kitamura H, Takahashi A, Masumori N, Tsukamoto T and Sato N. "Gene expression profiles of prostate cancer stem cells isolated by aldehyde dehydrogenase activity assay." J Urol (2012) 188(1): 294- 299.

Noh KH, Kim BW, Song KH, Cho H, Lee YH, Kim JH, Chung JY, Kim JH, Hewitt SM, Seong SY, Mao CP, Wu TC and Kim TW. "Nanog signaling in cancer promotes stem-like phenotype and immune evasion." J Clin Invest (2012) 122(11): 4077-4093.

Nutting C, Horwich A, Fisher C, Parsons C and Dearnaley DP. "Small-cell carcinoma of the prostate." J R Soc Med (1997) 90(6): 340-341.

O'Connell K, Prencipe M, O'Neill A, Corcoran C, Rani S, Henry M, Dowling P, Meleady P, O'Driscoll L, Watson W and O'Connor R. "The use of LC-MS to identify differentially expressed proteins in docetaxel-resistant prostate cancer cell lines." Proteomics (2012) 12(13): 2115-2126.

Ocak S, Chaurand P and Massion PP. "Mass spectrometry-based proteomic profiling of lung cancer." Proc Am Thorac Soc (2009) 6(2): 159-170.

Ogawa K, Yoshioka Y, Isohashi F, Seo Y, Yoshida K and Yamazaki H. "Radiotherapy targeting cancer stem cells: current views and future perspectives." Anticancer Res (2013) 33(3): 747-754.

Okajima E, Yoshikawa M, Masuda Y, Shimizu K, Tanaka N, Hirayama A, Shimada K, Fujimoto K and Hirao Y. "Improvement of the surgical curability of locally confined prostate cancer including non-organ-confined high-risk disease through retropubic radical prostatectomy with intentional wide resection." World J Surg Oncol (2012) 10: 249.

Oparina NY, Snezhkina AV, Sadritdinova AF, Veselovskii VA, Dmitriev AA, Senchenko VN, Mel'nikova NV, Speranskaya AS, Darii MV, Stepanov OA, Barkhatov IM and Kudryavtseva AV. "[Differential expression of genes that 319

encode glycolysis enzymes in kidney and lung cancer in humans]." Genetika (2013) 49(7): 814-823.

Padoan A, Seraglia R, Basso D, Fogar P, Sperti C, Moz S, Greco E, Marchet A, de Manzoni G, Zambon CF, Navaglia F, Cristadoro L, Di Chiara A, Nitti D, Pedrazzoli S, Pavanello G and Plebani M. "Usefulness of MALDI-TOF/MS identification of low-MW fragments in sera for the differential diagnosis of pancreatic cancer." Pancreas (2013) 42(4): 622-632.

Paglin S, Lee NY, Nakar C, Fitzgerald M, Plotkin J, Deuel B, Hackett N, McMahill M, Sphicas E, Lampen N and Yahalom J. "Rapamycin-sensitive pathway regulates mitochondrial membrane potential, autophagy, and survival in irradiated MCF-7 cells." Cancer Res (2005) 65(23): 11061-11070.

Pajonk F, van Ophoven A, Weissenberger C and McBride WH. "The proteasome inhibitor MG-132 sensitizes PC-3 prostate cancer cells to ionizing radiation by a DNA-PK-independent mechanism." BMC Cancer (2005) 5: 76.

Palumbo S and Comincini S. "Autophagy and ionizing radiation in tumors: The "survive or not survive" dilemma." J Cell Physiol (2013) 228(1): 1-8.

Palumbo S, Tini P, Toscano M, Allavena G, Angeletti F, Manai F, Miracco C, Comincini S and Pirtoli L. "Combined EGFR and autophagy modulation impairs cell migration and enhances radiosensitivity in human glioblastoma cells." J Cell Physiol (2014) 229(11): 1863-1873.

Parfenov M, Pedamallu CS, Gehlenborg N, Freeman SS, Danilova L, Bristow CA, Lee S, Hadjipanayis AG, Ivanova EV, Wilkerson MD, Protopopov A, Yang L, Seth S, Song X, Tang J, Ren X, Zhang J, Pantazi A, Santoso N, Xu AW, Mahadeshwar H, Wheeler DA, Haddad RI, Jung J, Ojesina AI, Issaeva N, Yarbrough WG, Hayes DN, Grandis JR, El-Naggar AK, Meyerson M, Park PJ, Chin L, Seidman JG, Hammerman PS, Kucherlapati R and Network tCGA. "Characterization of HPV and host genome interactions in primary head and neck cancers." Proceedings of the National Academy of Sciences (2014) 111(43): 15544-15549.

Parikh A, Childress C, Deitrick K, Lin Q, Rukstalis D and Yang W. "Statin- induced autophagy by inhibition of geranylgeranyl biosynthesis in prostate cancer PC3 cells." Prostate (2010) 70(9): 971-981.

Patrawala L, Calhoun-Davis T, Schneider-Broussard R and Tang DG. "Hierarchical organization of prostate cancer cells in xenograft tumors: the

320

CD44+alpha2beta1+ cell population is enriched in tumor-initiating cells." Cancer Res (2007) 67(14): 6796-6805.

Patrawala L, Calhoun T, Schneider-Broussard R, Li H, Bhatia B, Tang S, Reilly JG, Chandra D, Zhou J, Claypool K, Coghlan L and Tang DG. "Highly purified CD44+ prostate cancer cells from xenograft human tumors are enriched in tumorigenic and metastatic progenitor cells." Oncogene (2006) 25(12): 1696- 1708.

Patrick O. Manafa ACI, Chinaza .I. Ekwueme, Adeola O.Oluboyo,George Chukwuma,Chukwuanukwu Beccky, Onyemelukwe Anuli. "Assessment of the risk of prostate cancer in adult smokers in Nnewi, Nigeria using prostate specific antigen as a biomarker " Indian Journal of Basic and Applied Medical Research (2015) 4(2): 172-183.

Pawlik TM and Keyomarsi K. "Role of cell cycle in mediating sensitivity to radiotherapy." Int J Radiat Oncol Biol Phys (2004) 59(4): 928-942.

Pedrero JM, Carracedo DG, Pinto CM, Zapatero AH, Rodrigo JP, Nieto CS and Gonzalez MV. "Frequent genetic and biochemical alterations of the PI 3- K/AKT/PTEN pathway in head and neck squamous cell carcinoma." Int J Cancer (2005) 114(2): 242-248.

Peng X, Guo W, Liu T, Wang X, Tu X, Xiong D, Chen S, Lai Y, Du H, Chen G, Liu G, Tang Y, Huang S and Zou X. "Identification of miRs-143 and -145 that is associated with bone metastasis of prostate cancer and involved in the regulation of EMT." PLoS One (2011) 6(5): e20341.

Peng Y, Li X, Wu M, Yang J, Liu M, Zhang W, Xiang B, Wang X, Li X, Li G and Shen S. "New prognosis biomarkers identified by dynamic proteomic analysis of colorectal cancer." Mol Biosyst (2012) 8(11): 3077-3088.

Perlmutter MA and Lepor H. "Androgen deprivation therapy in the treatment of advanced prostate cancer." Rev Urol (2007) 9 Suppl 1: S3-8.

Pfeiffer MJ and Schalken JA. "Stem cell characteristics in prostate cancer cell lines." Eur Urol (2010) 57(2): 246-254.

Phillips TM, McBride WH and Pajonk F. "The response of CD24(-/low)/CD44+ breast cancer-initiating cells to radiation." J Natl Cancer Inst (2006) 98(24): 1777- 1785.

321

Piao LS, Hur W, Kim TK, Hong SW, Kim SW, Choi JE, Sung PS, Song MJ, Lee BC, Hwang D and Yoon SK. "CD133+ liver cancer stem cells modulate radioresistance in human hepatocellular carcinoma." Cancer Lett (2012) 315(2): 129-137.

Picotti P and Aebersold R. "Selected reaction monitoring-based proteomics: workflows, potential, pitfalls and future directions." Nat Methods (2012) 9(6): 555-566.

Pollack A, Zagars GK, Starkschall G, Antolak JA, Lee JJ, Huang E, von Eschenbach AC, Kuban DA and Rosen I. "Prostate cancer radiation dose response: results of the M. D. Anderson phase III randomized trial." Int J Radiat Oncol Biol Phys (2002) 53(5): 1097-1105.

Pommery N and Henichart JP. "Involvement of PI3K/Akt pathway in prostate cancer--potential strategies for developing targeted therapies." Mini Rev Med Chem (2005) 5(12): 1125-1132.

Porta C, Paglino C and Mosca A. "Targeting PI3K/Akt/mTOR Signaling in Cancer." Front Oncol (2014) 4: 64.

Posadas EM, Gulley J, Arlen PM, Trout A, Parnes HL, Wright J, Lee MJ, Chung EJ, Trepel JB, Sparreboom A, Chen C, Jones E, Steinberg SM, Daniels A, Figg WD and Dahut WL. "A phase II study of perifosine in androgen independent prostate cancer." Cancer Biol Ther (2005) 4(10): 1133-1137.

Potiron VA, Abderrahmani R, Giang E, Chiavassa S, Di Tomaso E, Maira SM, Paris F and Supiot S. "Radiosensitisation of prostate cancer cells by the dual PI3K/mTOR inhibitor BEZ235 under normoxic and hypoxic conditions." Radiother Oncol (2013) 106(1): 138-146.

Potiron VA, Abderrhamani R, Giang E, Chiavassa S, Di Tomaso E, Maira SM, Paris F and Supiot S. "Radiosensitisation of prostate cancer cells by the dual PI3K/mTOR inhibitor BEZ235 under normoxic and hypoxic conditions." Radiother Oncol (2013) 106(1): 138-146.

Prawettongsopon C, Asawakarn S and Suthiphongchai T. "Suppression of prometastatic phenotype of highly metastatic androgen-independent rat prostate cancer MLL cell line by PI3K inhibitor LY294002." Oncol Res (2009) 17(7): 301-309.

322

Prevo R, Deutsch E, Sampson O, Diplexcito J, Cengel K, Harper J, O'Neill P, McKenna WG, Patel S and Bernhard EJ. "Class I PI3 kinase inhibition by the pyridinylfuranopyrimidine inhibitor PI-103 enhances tumor radiosensitivity." Cancer Res (2008) 68(14): 5915-5923.

Prince HM, Bishton MJ and Johnstone RW. "Panobinostat (LBH589): a potent pan-deacetylase inhibitor with promising activity against hematologic and solid tumors." Future Oncol (2009) 5(5): 601-612.

Probert JC and Parker BR. "The effects of radiation therapy on bone growth." Radiology (1975) 114(1): 155-162.

Qin J, Liu X, Laffin B, Chen X, Choy G, Jeter CR, Calhoun-Davis T, Li H, Palapattu GS, Pang S, Lin K, Huang J, Ivanov I, Li W, Suraneni MV and Tang DG. "The PSA(-/lo) prostate cancer cell population harbors self-renewing long- term tumor-propagating cells that resist castration." Cell Stem Cell (2012) 10(5): 556-569.

Qingyi Z, Lin Y, Junhong W, Jian S, Weizhou H, Long M, Zeyu S and Xiaojian G. "Unfavorable prognostic value of human PEDF decreased in high-grade prostatic intraepithelial neoplasia: a differential proteomics approach." Cancer Invest (2009) 27(7): 794-801.

Raffoul JJ, Banerjee S, Che M, Knoll ZE, Doerge DR, Abrams J, Kucuk O, Sarkar FH and Hillman GG. "Soy isoflavones enhance radiotherapy in a metastatic prostate cancer model." Int J Cancer (2007) 120(11): 2491-2498.

Raffoul JJ, Banerjee S, Singh-Gupta V, Knoll ZE, Fite A, Zhang H, Abrams J, Sarkar FH and Hillman GG. "Down-regulation of apurinic/apyrimidinic endonuclease 1/redox factor-1 expression by soy isoflavones enhances prostate cancer radiotherapy in vitro and in vivo." Cancer Res (2007) 67(5): 2141-2149.

Raffoul JJ, Wang Y, Kucuk O, Forman JD, Sarkar FH and Hillman GG. "Genistein inhibits radiation-induced activation of NF-kappaB in prostate cancer cells promoting apoptosis and G2/M cell cycle arrest." BMC Cancer (2006) 6: 107.

Rajasekhar VK, Studer L, Gerald W, Socci ND and Scher HI. "Tumour-initiating stem-like cells in human prostate cancer exhibit increased NF-kappaB signalling." Nat Commun (2011) 2: 162.

323

Rami A. "Review: autophagy in neurodegeneration: firefighter and/or incendiarist?" Neuropathol Appl Neurobiol (2009) 35(5): 449-461.

Raynaud FI, Eccles S, Clarke PA, Hayes A, Nutley B, Alix S, Henley A, Di- Stefano F, Ahmad Z, Guillard S, Bjerke LM, Kelland L, Valenti M, Patterson L, Gowan S, de Haven Brandon A, Hayakawa M, Kaizawa H, Koizumi T, Ohishi T, Patel S, Saghir N, Parker P, Waterfield M and Workman P. "Pharmacologic characterization of a potent inhibitor of class I phosphatidylinositide 3-kinases." Cancer Res (2007) 67(12): 5840-5850.

Rehman I, Evans CA, Glen A, Cross SS, Eaton CL, Down J, Pesce G, Phillips JT, Yen OS, Thalmann GN, Wright PC and Hamdy FC. "iTRAQ identification of candidate serum biomarkers associated with metastatic progression of human prostate cancer." PLoS One (2012) 7(2): e30885.

Reid AH, Attard G, Ambroisine L, Fisher G, Kovacs G, Brewer D, Clark J, Flohr P, Edwards S, Berney DM, Foster CS, Fletcher A, Gerald WL, Moller H, Reuter VE, Scardino PT, Cuzick J, de Bono JS and Cooper CS. "Molecular characterisation of ERG, ETV1 and PTEN gene loci identifies patients at low and high risk of death from prostate cancer." Br J Cancer (2010) 102(4): 678-684.

Reid AH, Attard G, Ambroisine L, Fisher G, Kovacs G, Brewer D, Clark J, Flohr P, Edwards S, Berney DM, Foster CS, Fletcher A, Gerald WL, Moller H, Reuter VE, Scardino PT, Cuzick J, de Bono JS, Cooper CS and Transatlantic Prostate G. "Molecular characterisation of ERG, ETV1 and PTEN gene loci identifies patients at low and high risk of death from prostate cancer." Br J Cancer (2010) 102(4): 678-684.

Ren Y, Hao P, Dutta B, Cheow ES, Sim KH, Gan CS, Lim SK and Sze SK. "Hypoxia modulates A431 cellular pathways association to tumor radioresistance and enhanced migration revealed by comprehensive proteomic and functional studies." Mol Cell Proteomics (2013) 12(2): 485-498.

Richardson GD, Robson CN, Lang SH, Neal DE, Maitland NJ and Collins AT. "CD133, a novel marker for human prostatic epithelial stem cells." J Cell Sci (2004) 117(Pt 16): 3539-3545.

Rochester MA, Riedemann J, Hellawell GO, Brewster SF and Macaulay VM. "Silencing of the IGF1R gene enhances sensitivity to DNA-damaging agents in both PTEN wild-type and mutant human prostate cancer." Cancer Gene Ther (2005) 12(1): 90-100.

324

Rodon J, Brana I, Siu LL, De Jonge MJ, Homji N, Mills D, Di Tomaso E, Sarr C, Trandafir L, Massacesi C, Eskens F and Bendell JC. "Phase I dose-escalation and -expansion study of buparlisib (BKM120), an oral pan-Class I PI3K inhibitor, in patients with advanced solid tumors." Invest New Drugs (2014) 32(4): 670-681.

Roman E, Lunde ML, Miron T, Warnakulasauriya S, Johannessen AC, Vasstrand EN and Ibrahim SO. "Analysis of protein expression profile of oral squamous cell carcinoma by MALDI-TOF-MS." Anticancer Res (2013) 33(3): 837-845.

Romero J, Zapata I, Cordoba S, Jimeno JM, Lopez-Martin JA, Tercero JC, De La Torre A, Vargas JA, Moleron R and Sanchez-Prieto R. "In vitro radiosensitisation by trabectedin in human cancer cell lines." Eur J Cancer (2008) 44(12): 1726- 1733.

Rosenfeldt MT and Ryan KM. "The multiple roles of autophagy in cancer." Carcinogenesis (2011) 32(7): 955-963.

Rosenzweig KE, Youmell MB, Palayoor ST and Price BD. "Radiosensitisation of human tumor cells by the phosphatidylinositol3-kinase inhibitors wortmannin and LY294002 correlates with inhibition of DNA-dependent protein kinase and prolonged G2-M delay." Clin Cancer Res (1997) 3(7): 1149-1156.

Ross PL, Huang YN, Marchese JN, Williamson B, Parker K, Hattan S, Khainovski N, Pillai S, Dey S, Daniels S, Purkayastha S, Juhasz P, Martin S, Bartlet-Jones M, He F, Jacobson A and Pappin DJ. "Multiplexed protein quantitation in Saccharomyces cerevisiae using amine-reactive isobaric tagging reagents." Mol Cell Proteomics (2004) 3(12): 1154-1169.

Rosser CJ, Tanaka M, Pisters LL, Tanaka N, Levy LB, Hoover DC, Grossman HB, McDonnell TJ, Kuban DA and Meyn RE. "Adenoviral-mediated PTEN transgene expression sensitizes Bcl-2-expressing prostate cancer cells to radiation." Cancer Gene Ther (2004) 11(4): 273-279.

Rowehl RA, Crawford H, Dufour A, Ju J and Botchkina GI. "Genomic analysis of prostate cancer stem cells isolated from a highly metastatic cell line." Cancer Genomics Proteomics (2008) 5(6): 301-310.

Roy AK, Lavrovsky Y, Song CS, Chen S, Jung MH, Velu NK, Bi BY and Chatterjee B. "Regulation of androgen action." Vitam Horm (1999) 55: 309-352.

325

Rudner J, Ruiner CE, Handrick R, Eibl HJ, Belka C and Jendrossek V. "The Akt- inhibitor Erufosine induces apoptotic cell death in prostate cancer cells and increases the short term effects of ionizing radiation." Radiat Oncol (2010) 5: 108.

Rycaj K and Tang DG. "Cancer stem cells and radioresistance." Int J Radiat Biol (2014) 90(8): 615-621.

Sabatini DM. "mTOR and cancer: insights into a complex relationship." Nat Rev Cancer (2006) 6(9): 729-734.

Sahlberg SH, Spiegelberg D, Glimelius B, Stenerlow B and Nestor M. "Evaluation of Cancer Stem Cell Markers CD133, CD44, CD24: Association with AKT Isoforms and Radiation Resistance in Colon Cancer Cells." PLoS One (2014) 9(4): e94621.

Sak A and Stuschke M. "Use of gammaH2AX and other biomarkers of double- strand breaks during radiotherapy." Semin Radiat Oncol (2010) 20(4): 223-231.

Sansal I and Sellers WR. "The biology and clinical relevance of the PTEN tumor suppressor pathway." J Clin Oncol (2004) 22(14): 2954-2963.

Santisteban M, Reiman JM, Asiedu MK, Behrens MD, Nassar A, Kalli KR, Haluska P, Ingle JN, Hartmann LC, Manjili MH, Radisky DC, Ferrone S and Knutson KL. "Immune-induced epithelial to mesenchymal transition in vivo generates breast cancer stem cells." Cancer Res (2009) 69(7): 2887-2895.

Sardana G, Jung K, Stephan C and Diamandis EP. "Proteomic analysis of conditioned media from the PC3, LNCaP, and 22Rv1 prostate cancer cell lines: discovery and validation of candidate prostate cancer biomarkers." J Proteome Res (2008) 7(8): 3329-3338.

Sarkar FH, Li Y, Wang Z and Kong D. "The role of nutraceuticals in the regulation of Wnt and Hedgehog signaling in cancer." Cancer Metastasis Rev (2010) 29(3): 383-394.

Sarkaria JN, Galanis E, Wu W, Dietz AB, Kaufmann TJ, Gustafson MP, Brown PD, Uhm JH, Rao RD, Doyle L, Giannini C, Jaeckle KA and Buckner JC. "Combination of temsirolimus (CCI-779) with chemoradiation in newly diagnosed glioblastoma multiforme (GBM) (NCCTG trial N027D) is associated with increased infectious risks." Clin Cancer Res (2010) 16(22): 5573-5580.

326

Sasaki R, Shirakawa T, Zhang ZJ, Tamekane A, Matsumoto A, Sugimura K, Matsuo M, Kamidono S and Gotoh A. "Additional gene therapy with Ad5CMV- p53 enhanced the efficacy of radiotherapy in human prostate cancer cells." Int J Radiat Oncol Biol Phys (2001) 51(5): 1336-1345.

Schaaij-Visser TB, Brakenhoff RH, Leemans CR, Heck AJ and Slijper M. "Protein biomarker discovery for head and neck cancer." J Proteomics (2010) 73(10): 1790-1803.

Scheid MP and Woodgett JR. "Unravelling the activation mechanisms of protein kinase B/Akt." FEBS Lett (2003) 546(1): 108-112.

Schiewer MJ, Den R, Hoang DT, Augello MA, Lawrence YR, Dicker AP and Knudsen KE. "mTOR is a selective effector of the radiation therapy response in androgen receptor-positive prostate cancer." Endocr Relat Cancer (2012) 19(1): 1- 12.

Schmalhofer O, Brabletz S and Brabletz T. "E-cadherin, beta-catenin, and ZEB1 in malignant progression of cancer." Cancer Metastasis Rev (2009) 28(1-2): 151- 166.

Schmitz M, Grignard G, Margue C, Dippel W, Capesius C, Mossong J, Nathan M, Giacchi S, Scheiden R and Kieffer N. "Complete loss of PTEN expression as a possible early prognostic marker for prostate cancer metastasis." Int J Cancer (2007) 120(6): 1284-1292.

Schuurbiers OC, Kaanders JH, van der Heijden HF, Dekhuijzen RP, Oyen WJ and Bussink J. "The PI3-K/AKT-pathway and radiation resistance mechanisms in non- small cell lung cancer." J Thorac Oncol (2009) 4(6): 761-767.

Scumaci D, Tamme L, Fiumara CV, Pappaianni G, Concolino A, Leone E, Faniello MC, Quaresima B, Ricevuto E, Costanzo FS and Cuda G. "Plasma Proteomic Profiling in Hereditary Breast Cancer Reveals a BRCA1-Specific Signature: Diagnostic and Functional Implications." PLoS One (2015) 10(6): e0129762.

Semenza G. "Signal transduction to hypoxia-inducible factor 1." Biochem Pharmacol (2002) 64(5-6): 993-998.

Seol JW, Lee YJ, Kang HS, Kim IS, Kim NS, Kwak YG, Kim TH, Seol DW and Park SY. "Wortmannin elevates tumor necrosis factor-related apoptosis-inducing

327

ligand sensitivity in LNCaP cells through down-regulation of IAP-2 protein." Exp Oncol (2005) 27(2): 120-124.

Serra V, Markman B, Scaltriti M, Eichhorn PJ, Valero V, Guzman M, Botero ML, Llonch E, Atzori F, Di Cosimo S, Maira M, Garcia-Echeverria C, Parra JL, Arribas J and Baselga J. "NVP-BEZ235, a dual PI3K/mTOR inhibitor, prevents PI3K signaling and inhibits the growth of cancer cells with activating PI3K mutations." Cancer Res (2008) 68(19): 8022-8030.

Sethi S, Macoska J, Chen W and Sarkar FH. "Molecular signature of epithelial- mesenchymal transition (EMT) in human prostate cancer bone metastasis." Am J Transl Res (2010) 3(1): 90-99.

Seyfried T and Shelton L. "Cancer as a metabolic disease." Nutrition & Metabolism (2010) 7(1): 7.

Shen C, Lancaster CS, Shi B, Guo H, Thimmaiah P and Bjornsti MA. "TOR signaling is a determinant of cell survival in response to DNA damage." Mol Cell Biol (2007) 27(20): 7007-7017.

Shi X, Gipp J and Bushman W. "Anchorage-independent culture maintains prostate stem cells." Dev Biol (2007) 312(1): 396-406.

Shimura T, Noma N, Sano Y, Ochiai Y, Oikawa T, Fukumoto M and Kunugita N. "AKT-mediated enhanced aerobic glycolysis causes acquired radioresistance by human tumor cells." Radiother Oncol (2014) 112(2): 302-307.

Shingu T, Fujiwara K, Bogler O, Akiyama Y, Moritake K, Shinojima N, Tamada Y, Yokoyama T and Kondo S. "Inhibition of autophagy at a late stage enhances imatinib-induced cytotoxicity in human malignant glioma cells." Int J Cancer (2009) 124(5): 1060-1071.

Shukla S, Maclennan GT, Hartman DJ, Fu P, Resnick MI and Gupta S. "Activation of PI3K-Akt signaling pathway promotes prostate cancer cell invasion." Int J Cancer (2007) 121(7): 1424-1432.

Singh-Gupta V, Zhang H, Banerjee S, Kong D, Raffoul JJ, Sarkar FH and Hillman GG. "Radiation-induced HIF-1alpha cell survival pathway is inhibited by soy isoflavones in prostate cancer cells." Int J Cancer (2009) 124(7): 1675-1684.

328

Singh A and Settleman J. "EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer." Oncogene (2010) 29(34): 4741-4751.

Sircar K, Yoshimoto M, Monzon FA, Koumakpayi IH, Katz RL, Khanna A, Alvarez K, Chen G, Darnel AD, Aprikian AG, Saad F, Bismar TA and Squire JA. "PTEN genomic deletion is associated with p-Akt and AR signalling in poorer outcome, hormone refractory prostate cancer." J Pathol (2009) 218(4): 505-513.

Skvortsov S, Jimenez CR, Knol JC, Eichberger P, Schiestl B, Debbage P, Skvortsova I and Lukas P. "Radioresistant head and neck squamous cell carcinoma cells: intracellular signaling, putative biomarkers for tumor recurrences and possible therapeutic targets." Radiother Oncol (2011) 101(1): 177-182.

Skvortsova I, Skvortsov S, Stasyk T, Raju U, Popper BA, Schiestl B, von Guggenberg E, Neher A, Bonn GK, Huber LA and Lukas P. "Intracellular signaling pathways regulating radioresistance of human prostate carcinoma cells." Proteomics (2008) 8(21): 4521-4533.

Smith L, Qutob O, Watson MB, Beavis AW, Potts D and Welham KJ. "Proteomic identification of putative biomarkers of radiotherapy resistance: a possible role for the 26S proteasome?" Neoplasia (2009) 11: 1194-1207.

Smith L, Qutob O, Watson MB, Beavis AW, Potts D, Welham KJ, Garimella V, Lind MJ, Drew PJ and Cawkwell L. "Proteomic identification of putative biomarkers of radiotherapy resistance: a possible role for the 26S proteasome?" Neoplasia (2009) 11(11): 1194-1207.

Soond DR, Bjorgo E, Moltu K, Dale VQ, Patton DT, Torgersen KM, Galleway F, Twomey B, Clark J, Gaston JS, Tasken K, Bunyard P and Okkenhaug K. "PI3K p110delta regulates T-cell cytokine production during primary and secondary immune responses in mice and humans." Blood (2010) 115(11): 2203-2213.

Sos ML, Koker M, Weir BA, Heynck S, Rabinovsky R, Zander T, Seeger JM, Weiss J, Fischer F, Frommolt P, Michel K, Peifer M, Mermel C, Girard L, Peyton M, Gazdar AF, Minna JD, Garraway LA, Kashkar H, Pao W, Meyerson M and Thomas RK. "PTEN loss contributes to erlotinib resistance in EGFR-mutant lung cancer by activation of Akt and EGFR." Cancer Res (2009) 69(8): 3256-3261.

Sparks CA and Guertin DA. "Targeting mTOR: prospects for mTOR complex 2 inhibitors in cancer therapy." Oncogene (2010) 29(26): 3733-3744.

329

Steelman LS, Bertrand FE and McCubrey JA. "The complexity of PTEN: mutation, marker and potential target for therapeutic intervention." Expert Opin Ther Targets (2004) 8(6): 537-550.

Steinauer KK, Gibbs I, Ning S, French JN, Armstrong J and Knox SJ. "Radiation induces upregulation of cyclooxygenase-2 (COX-2) protein in PC-3 cells." Int J Radiat Oncol Biol Phys (2000) 48(2): 325-328.

Stephens L, Anderson K, Stokoe D, Erdjument-Bromage H, Painter GF, Holmes AB, Gaffney PR, Reese CB, McCormick F, Tempst P, Coadwell J and Hawkins PT. "Protein kinase B kinases that mediate phosphatidylinositol 3,4,5- trisphosphate-dependent activation of protein kinase B." Science (1998) 279(5351): 710-714.

Stewart GD, Nanda J, Katz E, Bowman KJ, Christie JG, Brown DJ, McLaren DB, Riddick AC, Ross JA, Jones GD and Habib FK. "DNA strand breaks and hypoxia response inhibition mediate the radiosensitisation effect of nitric oxide donors on prostate cancer under varying oxygen conditions." Biochem Pharmacol (2011) 81(2): 203-210.

Stoyanova R, Hachem P, Hensley H, Khor LY, Mu Z, Hammond ME, Agrawal S and Pollack A. "Antisense-MDM2 sensitizes LNCaP prostate cancer cells to androgen deprivation, radiation, and the combination in vivo." Int J Radiat Oncol Biol Phys (2007) 68(4): 1151-1160.

Sun SY. "mTOR kinase inhibitors as potential cancer therapeutic drugs." Cancer Lett (2013) 340(1): 1-8.

Sun Y, St Clair DK, Fang F, Warren GW, Rangnekar VM, Crooks PA and St Clair WH. "The radiosensitisation effect of parthenolide in prostate cancer cells is mediated by nuclear factor-kappaB inhibition and enhanced by the presence of PTEN." Mol Cancer Ther (2007) 6(9): 2477-2486.

Sun Y, Wang BE, Leong KG, Yue P, Li L, Jhunjhunwala S, Chen D, Seo K, Modrusan Z, Gao WQ, Settleman J and Johnson L. "Androgen deprivation causes epithelial-mesenchymal transition in the prostate: implications for androgen- deprivation therapy." Cancer Res (2012) 72(2): 527-536.

Supiot S, Hill RP and Bristow RG. "Nutlin-3 radiosensitizes hypoxic prostate cancer cells independent of p53." Mol Cancer Ther (2008) 7(4): 993-999.

330

Suzuki M, Amano M, Choi J, Park HJ, Williams BW, Ono K and Song CW. "Synergistic effects of radiation and beta-lapachone in DU-145 human prostate cancer cells in vitro." Radiat Res (2006) 165(5): 525-531.

Takeuchi H, Kondo Y, Fujiwara K, Kanzawa T, Aoki H, Mills GB and Kondo S. "Synergistic augmentation of rapamycin-induced autophagy in malignant glioma cells by phosphatidylinositol 3-kinase/protein kinase B inhibitors." Cancer Res (2005) 65(8): 3336-3346.

Tamura K, Aoyagi M, Wakimoto H, Ando N, Nariai T, Yamamoto M and Ohno K. "Accumulation of CD133-positive glioma cells after high-dose irradiation by Gamma Knife surgery plus external beam radiation." J Neurosurg (2010) 113(2): 310-318.

Tan N, Margolis DJ, McClure TD, Thomas A, Finley DS, Reiter RE, Huang J and Raman SS. "Radical prostatectomy: value of prostate MRI in surgical planning." Abdom Imaging (2012) 37(4): 664-674.

Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Fazli L, Wada R, Huang J, Vessella RL, An J, Horvath S, Gleave M, Rettig MB, Wainberg ZA and Reiter RE. "Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance." Nat Med (2010) 16(12): 1414-1420.

Tang DG, Patrawala L, Calhoun T, Bhatia B, Choy G, Schneider-Broussard R and Jeter C. "Prostate cancer stem/progenitor cells: identification, characterization, and implications." Mol Carcinog (2007) 46(1): 1-14.

Tanno S, Yanagawa N, Habiro A, Koizumi K, Nakano Y, Osanai M, Mizukami Y, Okumura T, Testa JR and Kohgo Y. "Serine/threonine kinase AKT is frequently activated in human bile duct cancer and is associated with increased radioresistance." Cancer Res (2004) 64(10): 3486-3490.

Tasci AI, Simsek A, Torer BD, Sokmen D, Sahin S and Tugcu V. "Fascia-sparing intrafascial nerve-sparing robot-assisted radical prostatectomy and anatomic vesicourethral anastomosis: point of technique." Arch Esp Urol (2014) 67(9): 731- 739.

Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, Arora VK, Kaushik P, Cerami E, Reva B, Antipin Y, Mitsiades N, Landers T, Dolgalev I, Major JE, Wilson M, Socci ND, Lash AE, Heguy A, Eastham JA, Scher HI, Reuter VE, Scardino PT, Sander C, Sawyers CL and Gerald WL. "Integrative genomic profiling of human prostate cancer." Cancer Cell (2010) 18(1): 11-22. 331

Teimourian S, Jalal R, Sohrabpour M and Goliaei B. "Down-regulation of Hsp27 radiosensitizes human prostate cancer cells." Int J Urol (2006) 13(9): 1221-1225.

Teiten MH, Gaigneaux A, Chateauvieux S, Billing AM, Planchon S, Fack F, Renaut J, Mack F, Muller CP, Dicato M and Diederich M. "Identification of differentially expressed proteins in curcumin-treated prostate cancer cell lines." OMICS (2012) 16(6): 289-300.

Tell R, Heiden T, Granath F, Borg AL, Skog S and Lewensohn R. "Comparison between radiation-induced cell cycle delay in lymphocytes and radiotherapy response in head and neck cancer." Br J Cancer (1998) 77(4): 643-649.

Teng DH, Hu R, Lin H, Davis T, Iliev D, Frye C, Swedlund B, Hansen KL, Vinson VL, Gumpper KL, Ellis L, El-Naggar A, Frazier M, Jasser S, Langford LA, Lee J, Mills GB, Pershouse MA, Pollack RE, Tornos C, Troncoso P, Yung WK, Fujii G, Berson A, Steck PA and et al. "MMAC1/PTEN mutations in primary tumor specimens and tumor cell lines." Cancer Res (1997) 57(23): 5221- 5225.

Tian J, Ning S and Knox SJ. "Sodium selenite radiosensitizes hormone-refractory prostate cancer xenograft tumors but not intestinal crypt cells in vivo." Int J Radiat Oncol Biol Phys (2010) 78(1): 230-236.

Tiffen JC, Bailey CG, Ng C, Rasko JE and Holst J. "Luciferase expression and bioluminescence does not affect tumor cell growth in vitro or in vivo." Mol Cancer (2010) 9: 299.

Timke C, Zieher H, Roth A, Hauser K, Lipson KE, Weber KJ, Debus J, Abdollahi A and Huber PE. "Combination of vascular endothelial growth factor receptor/platelet-derived growth factor receptor inhibition markedly improves radiation tumor therapy." Clin Cancer Res (2008) 14(7): 2210-2219.

Tiwari N, Gheldof A, Tatari M and Christofori G. "EMT as the ultimate survival mechanism of cancer cells." Semin Cancer Biol (2012) 22(3): 194-207.

Toepfer N, Childress C, Parikh A, Rukstalis D and Yang W. "Atorvastatin induces autophagy in prostate cancer PC3 cells through activation of LC3 transcription." Cancer Biol Ther (2011) 12(8): 691-699.

Tokunaga E, Kimura Y, Mashino K, Oki E, Kataoka A, Ohno S, Morita M, Kakeji Y, Baba H and Maehara Y. "Activation of PI3K/Akt signaling and hormone resistance in breast cancer." Breast Cancer (2006) 13(2): 137-144. 332

Tomioka A, Tanaka M, De Velasco MA, Anai S, Takada S, Kushibiki T, Tabata Y, Rosser CJ, Uemura H and Hirao Y. "Delivery of PTEN via a novel gene microcapsule sensitizes prostate cancer cells to irradiation." Mol Cancer Ther (2008) 7(7): 1864-1870.

Traxler P, Allegrini PR, Brandt R, Brueggen J, Cozens R, Fabbro D, Grosios K, Lane HA, McSheehy P, Mestan J, Meyer T, Tang C, Wartmann M, Wood J and Caravatti G. "AEE788: a dual family epidermal growth factor receptor/ErbB2 and vascular endothelial growth factor receptor tyrosine kinase inhibitor with antitumor and antiangiogenic activity." Cancer Res (2004) 64(14): 4931-4941.

Truman JP, Gueven N, Lavin M, Leibel S, Kolesnick R, Fuks Z and Haimovitz- Friedman A. "Down-regulation of ATM protein sensitizes human prostate cancer cells to radiation-induced apoptosis." J Biol Chem (2005) 280(24): 23262-23272.

Tsukamoto H, Shibata K, Kajiyama H, Terauchi M, Nawa A and Kikkawa F. "Irradiation-induced epithelial-mesenchymal transition (EMT) related to invasive potential in endometrial carcinoma cells." Gynecol Oncol (2007) 107(3): 500-504.

Tu SM and Lin SH. "Prostate cancer stem cells." Clin Genitourin Cancer (2012) 10(2): 69-76.

Udayakumar TS, Hachem P, Ahmed MM, Agrawal S and Pollack A. "Antisense MDM2 enhances E2F1-induced apoptosis and the combination sensitizes androgen-sensitive [corrected] and androgen-insensitive [corrected] prostate cancer cells to radiation." Mol Cancer Res (2008) 6(11): 1742-1754.

Udayakumar TS, Stoyanova R, Hachem P, Ahmed MM and Pollack A. "Adenovirus E2F1 overexpression sensitizes LNCaP and PC3 prostate tumor cells to radiation in vivo." Int J Radiat Oncol Biol Phys (2011) 79(2): 549-558.

Ueno T, Sato W, Horie Y, Komatsu M, Tanida I, Yoshida M, Ohshima S, Mak TW, Watanabe S and Kominami E. "Loss of Pten, a tumor suppressor, causes the strong inhibition of autophagy without affecting LC3 lipidation." Autophagy (2008) 4(5): 692-700.

Umbas R, Schalken JA, Aalders TW, Carter BS, Karthaus HF, Schaafsma HE, Debruyne FM and Isaacs WB. "Expression of the cellular adhesion molecule E- cadherin is reduced or absent in high-grade prostate cancer." Cancer Res (1992) 52(18): 5104-5109.

333

van den Hoogen C, van der Horst G, Cheung H, Buijs JT, Lippitt JM, Guzman- Ramirez N, Hamdy FC, Eaton CL, Thalmann GN, Cecchini MG, Pelger RC and van der Pluijm G. "High aldehyde dehydrogenase activity identifies tumor- initiating and metastasis-initiating cells in human prostate cancer." Cancer Res (2010) 70(12): 5163-5173.

Van Riper SK, de Jong EP, Carlis JV and Griffin TJ. "Mass spectrometry-based proteomics: basic principles and emerging technologies and directions." Adv Exp Med Biol (2013) 990: 1-35.

Vander Griend DJ, Karthaus WL, Dalrymple S, Meeker A, DeMarzo AM and Isaacs JT. "The role of CD133 in normal human prostate stem cells and malignant cancer-initiating cells." Cancer Res (2008) 68(23): 9703-9711.

Vanhaesebroeck B, Leevers SJ, Ahmadi K, Timms J, Katso R, Driscoll PC, Woscholski R, Parker PJ and Waterfield MD. "Synthesis and function of 3- phosphorylated inositol lipids." Annu Rev Biochem (2001) 70: 535-602.

Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z, Kong N, Kammlott U, Lukacs C, Klein C, Fotouhi N and Liu EA. "In vivo activation of the p53 pathway by small-molecule antagonists of MDM2." Science (2004) 303(5659): 844-848.

Vink SR, Lagerwerf S, Mesman E, Schellens JH, Begg AC, van Blitterswijk WJ and Verheij M. "Radiosensitisation of squamous cell carcinoma by the alkylphospholipid perifosine in cell culture and xenografts." Clin Cancer Res (2006) 12(5): 1615-1622.

Vink SR, Schellens JH, Beijnen JH, Sindermann H, Engel J, Dubbelman R, Moppi G, Hillebrand MJ, Bartelink H and Verheij M. "Phase I and pharmacokinetic study of combined treatment with perifosine and radiation in patients with advanced solid tumours." Radiother Oncol (2006) 80(2): 207-213.

Vivanco I and Sawyers CL. "The phosphatidylinositol 3-Kinase AKT pathway in human cancer." Nat Rev Cancer (2002) 2(7): 489-501.

Vlashi E, Kim K, Lagadec C, Donna LD, McDonald JT, Eghbali M, Sayre JW, Stefani E, McBride W and Pajonk F. "In vivo imaging, tracking, and targeting of cancer stem cells." J Natl Cancer Inst (2009) 101(5): 350-359.

334

Vowinckel J, Capuano F, Campbell K, Deery MJ, Lilley KS and Ralser M. "The beauty of being (label)-free: sample preparation methods for SWATH-MS and next-generation targeted proteomics." F1000Res (2013) 2: 272.

Wafa LA, Cheng H, Rao MA, Nelson CC, Cox M, Hirst M, Sadowski I and Rennie PS. "Isolation and identification of L-dopa decarboxylase as a protein that binds to and enhances transcriptional activity of the androgen receptor using the repressed transactivator yeast two-hybrid system." Biochem J (2003) 375(Pt 2): 373-383.

Wagener M, Zhang X, Villarreal HG, Levy L, Allen P, Shentu S, Fang B, Krishnan S, Chang JY and Cheung MR. "Effect of combining anti-epidermal growth factor receptor antibody C225 and radiation on DU145 prostate cancer." Oncol Rep (2008) 19(5): 1071-1077.

Wallin JJ, Edgar KA, Guan J, Berry M, Prior WW, Lee L, Lesnick JD, Lewis C, Nonomiya J, Pang J, Salphati L, Olivero AG, Sutherlin DP, O'Brien C, Spoerke JM, Patel S, Lensun L, Kassees R, Ross L, Lackner MR, Sampath D, Belvin M and Friedman LS. "GDC-0980 is a novel class I PI3K/mTOR kinase inhibitor with robust activity in cancer models driven by the PI3K pathway." Mol Cancer Ther (2011) 10(12): 2426-2436.

Wang J, Yang L, Yang J, Kuropatwinski K, Wang W, Liu XQ, Hauser J and Brattain MG. "Transforming growth factor beta induces apoptosis through repressing the phosphoinositide 3-kinase/AKT/survivin pathway in colon cancer cells." Cancer Res (2008) 68(9): 3152-3160.

Wang P, Zhang J, Zhang L, Zhu Z, Fan J, Chen L, Zhuang L, Luo J, Chen H, Liu L, Chen Z and Meng Z. "MicroRNA 23b regulates autophagy associated with radioresistance of pancreatic cancer cells." Gastroenterology (2013) 145(5): 1133- 1143 e1112.

Wang S, Gao J, Lei Q, Rozengurt N, Pritchard C, Jiao J, Thomas GV, Li G, Roy- Burman P, Nelson PS, Liu X and Wu H. "Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer." Cancer Cell (2003) 4(3): 209-221.

Wang T, Tamae D, LeBon T, Shively JE, Yen Y and Li JJ. "The role of peroxiredoxin II in radiation-resistant MCF-7 breast cancer cells." Cancer Res (2005) 65(22): 10338-10346.

Wang WJ, Long LM, Yang N, Zhang QQ, Ji WJ, Zhao JH, Qin ZH, Wang Z, Chen G and Liang ZQ. "NVP-BEZ235, a novel dual PI3K/mTOR inhibitor, 335

enhances the radiosensitivity of human glioma stem cells in vitro." Acta Pharmacol Sin (2013) 34(5): 681-690.

Wang X, Ma Z, Xiao Z, Liu H, Dou Z, Feng X and Shi H. "Chk1 knockdown confers radiosensitisation in prostate cancer stem cells." Oncol Rep (2012) 28(6): 2247-2254.

Wang Y, Raffoul JJ, Che M, Doerge DR, Joiner MC, Kucuk O, Sarkar FH and Hillman GG. "Prostate cancer treatment is enhanced by genistein in vitro and in vivo in a syngeneic orthotopic tumor model." Radiat Res (2006) 166(1 Pt 1): 73- 80.

Warren G, Grimes K, Xu Y, Kudrimoti M and St Clair W. "Selectively enhanced radiation sensitivity in prostate cancer cells associated with proteasome inhibition." Oncol Rep (2006) 15(5): 1287-1291.

Wei C, Guomin W, Yujun L and Ruizhe Q. "Cancer stem-like cells in human prostate carcinoma cells DU145: the seeds of the cell line?" Cancer Biol Ther (2007) 6(5): 763-768.

Wei R, Zhang Y, Shen L, Jiang W, Li C, Zhong M, Xie Y, Yang D, He L and Zhou Q. "Comparative proteomic and radiobiological analyses in human lung adenocarcinoma cells." Mol Cell Biochem (2012) 359(1-2): 151-159.

Wei ZF, Xu H, Wang H, Wei W, Cheng W, Zhou WQ, Ge JP, Zhang ZY, Gao JP and Yin HL. "[Clinicopathological characterization of prostatic small cell carcinoma: a case report and review of the literature]." Zhonghua Nan Ke Xue (2009) 15(9): 829-832.

White E. "Deconvoluting the context-dependent role for autophagy in cancer." Nat Rev Cancer (2012) 12(6): 401-410.

Whiteaker JR, Zhang H, Zhao L, Wang P, Kelly-Spratt KS, Ivey RG, Piening BD, Feng LC, Kasarda E, Gurley KE, Eng JK, Chodosh LA, Kemp CJ, McIntosh MW and Paulovich AG. "Integrated pipeline for mass spectrometry-based discovery and confirmation of biomarkers demonstrated in a mouse model of breast cancer." J Proteome Res (2007) 6(10): 3962-3975.

Wolff S, Otto A, Albrecht D, Zeng JS, Buttner K, Gluckmann M, Hecker M and Becher D. "Gel-free and gel-based proteomics in Bacillus subtilis: a comparative study." Mol Cell Proteomics (2006) 5(7): 1183-1192.

336

Woodward WA, Chen MS, Behbod F, Alfaro MP, Buchholz TA and Rosen JM. "WNT/beta-catenin mediates radiation resistance of mouse mammary progenitor cells." Proc Natl Acad Sci U S A (2007) 104(2): 618-623.

Woynarowska BA, Roberts K, Woynarowski JM, MacDonald JR and Herman TS. "Targeting apoptosis by hydroxymethylacylfulvene in combination with gamma radiation in prostate tumor cells." Radiat Res (2000) 154(4): 429-438.

Wu P, Zhang H, Qi L, Tang Q, Tang Y, Xie Z, Lv Y, Zhao S and Jiang W. "Identification of ERp29 as a biomarker for predicting nasopharyngeal carcinoma response to radiotherapy." Oncol Rep (2012) 27(4): 987-994.

Wu WK, Coffelt SB, Cho CH, Wang XJ, Lee CW, Chan FK, Yu J and Sung JJ. "The autophagic paradox in cancer therapy." Oncogene (2012) 31(8): 939-953.

Wullschleger S, Loewith R and Hall MN. "TOR signaling in growth and metabolism." Cell (2006) 124(3): 471-484.

Xia S, Zhao Y, Yu S and Zhang M. "Activated PI3K/Akt/COX-2 pathway induces resistance to radiation in human cervical cancer HeLa cells." Cancer Biother Radiopharm (2010) 25(3): 317-323.

Xiao W, Graham PH, Hao J, Chang L, Ni J, Power CA, Dong Q, Kearsley JH and Li Y. "Combination therapy with the histone deacetylase inhibitor LBH589 and radiation is an effective regimen for prostate cancer cells." PLoS One (2013) 8(8): e74253.

Xiao W, Graham PH, Power CA, Hao J, Kearsley JH and Li Y. "CD44 is a biomarker associated with human prostate cancer radiation sensitivity." Clin Exp Metastasis (2012) 29(1): 1-9.

Xiao Y, Guo L and Wang Y. "A targeted quantitative proteomics strategy for global kinome profiling of cancer cells and tissues." Mol Cell Proteomics (2014) 13(4): 1065-1075.

Xie D, Gore C, Liu J, Pong RC, Mason R, Hao G, Long M, Kabbani W, Yu L, Zhang H, Chen H, Sun X, Boothman DA, Min W and Hsieh JT. "Role of DAB2IP in modulating epithelial-to-mesenchymal transition and prostate cancer metastasis." Proc Natl Acad Sci U S A (2010) 107(6): 2485-2490.

337

Xu J, Wang R, Xie ZH, Odero-Marah V, Pathak S, Multani A, Chung LW and Zhau HE. "Prostate cancer metastasis: role of the host microenvironment in promoting epithelial to mesenchymal transition and increased bone and adrenal gland metastasis." Prostate (2006) 66(15): 1664-1673.

Xu L, Yang D, Wang S, Tang W, Liu M, Davis M, Chen J, Rae JM, Lawrence T and Lippman ME. "(-)-Gossypol enhances response to radiation therapy and results in tumor regression of human prostate cancer." Mol Cancer Ther (2005) 4(2): 197-205.

Xu Y, Fang F, Sun Y, St Clair DK and St Clair WH. "RelB-dependent differential radiosensitisation effect of STI571 on prostate cancer cells." Mol Cancer Ther (2010) 9(4): 803-812.

Xue Q, Hopkins B, Perruzzi C, Udayakumar D, Sherris D and Benjamin LE. "Palomid 529, a novel small-molecule drug, is a TORC1/TORC2 inhibitor that reduces tumor growth, tumor angiogenesis, and vascular permeability." Cancer Res (2008) 68(22): 9551-9557.

Yan H, Yang K, Xiao H, Zou YJ, Zhang WB and Liu HY. "Over-expression of cofilin-1 and phosphoglycerate kinase 1 in astrocytomas involved in pathogenesis of radioresistance." CNS Neurosci Ther (2012) 18(9): 729-736.

Yang J, Zhu J, He K, Zhao LY, Liu LY, Song TS and Huang C. "Proteomic Profiling of Invasive Ductal Carcinoma (IDC) using Magnetic Beads-based Serum Fractionation and MALDI-TOF MS." J Clin Lab Anal (2014).

Yang N, Feng S, Shedden K, Xie X, Liu Y, Rosser CJ, Lubman DM and Goodison S. "Urinary glycoprotein biomarker discovery for bladder cancer detection using LC/MS-MS and label-free quantification." Clin Cancer Res (2011) 17(10): 3349-3359.

Yang ZJ, Chee CE, Huang S and Sinicrope F. "Autophagy modulation for cancer therapy." Cancer Biol Ther (2011) 11(2): 169-176.

Yao V, Berkman CE, Choi JK, O'Keefe DS and Bacich DJ. "Expression of prostate-specific membrane antigen (PSMA), increases cell folate uptake and proliferation and suggests a novel role for PSMA in the uptake of the non- polyglutamated folate, folic acid." Prostate (2010) 70(3): 305-316.

338

Yasumizu Y, Miyajima A, Kosaka T, Miyazaki Y, Kikuchi E and Oya M. "Dual PI3K/mTOR inhibitor NVP-BEZ235 sensitizes docetaxel in castration resistant prostate cancer." J Urol (2014) 191(1): 227-234.

Yates JR, Ruse CI and Nakorchevsky A. "Proteomics by mass spectrometry: approaches, advances, and applications." Annu Rev Biomed Eng (2009) 11: 49- 79.

Yaxley J, Yaxley J, Gardiner R and Yaxley W. "Prostate cancer - active surveillance as a management option." Aust Fam Physician (2013) 42(1-2): 74-76.

Yoshida A, Hsu LC and Dave V. "Retinal oxidation activity and biological role of human cytosolic aldehyde dehydrogenase." Enzyme (1992) 46(4-5): 239-244.

You J, Cozzi P, Walsh B, Willcox M, Kearsley J, Russell P and Li Y. "Innovative biomarkers for prostate cancer early diagnosis and progression." Crit Rev Oncol Hematol (2010) 73(1): 10-22.

You S, Li R, Park D, Xie M, Sica GL, Cao Y, Xiao ZQ and Deng X. "Disruption of STAT3 by niclosamide reverses radioresistance of human lung cancer." Mol Cancer Ther (2014) 13(3): 606-616.

Yu C, Shiozawa Y, Taichman RS, McCauley LK, Pienta K and Keller E. "Prostate cancer and parasitism of the bone hematopoietic stem cell niche." Crit Rev Eukaryot Gene Expr (2012) 22(2): 131-148.

Yu C, Yao Z, Jiang Y and Keller ET. "Prostate cancer stem cell biology." Minerva Urol Nefrol (2012) 64(1): 19-33.

Yuan TL and Cantley LC. "PI3K pathway alterations in cancer: variations on a theme." Oncogene (2008) 27(41): 5497-5510.

Zafarana G, Ishkanian AS, Malloff CA, Locke JA, Sykes J, Thoms J, Lam WL, Squire JA, Yoshimoto M, Ramnarine VR, Meng A, Ahmed O, Jurisca I, Milosevic M, Pintilie M, van der Kwast T and Bristow RG. "Copy number alterations of c-MYC and PTEN are prognostic factors for relapse after prostate cancer radiotherapy." Cancer (2012) 118(16): 4053-4062.

Zapatero A, Garcia-Vicente F, Martin de Vidales C, Cruz Conde A, Ibanez Y, Fernandez I and Rabadan M. "Long-term results after high-dose radiotherapy and

339

adjuvant hormones in prostate cancer: how curable is high-risk disease?" Int J Radiat Oncol Biol Phys (2011) 81(5): 1279-1285.

Zaza G, Granata S, Tomei P, Masola V, Gambaro G and Lupo A. "mTOR inhibitors and renal allograft: Yin and Yang." J Nephrol (2014) 27(5): 495-506.

Zeisberg M and Neilson EG. "Biomarkers for epithelial-mesenchymal transitions." J Clin Invest (2009) 119(6): 1429-1437.

Zelefsky MJ, Yamada Y, Fuks Z, Zhang Z, Hunt M, Cahlon O, Park J and Shippy A. "Long-term results of conformal radiotherapy for prostate cancer: impact of dose escalation on biochemical tumor control and distant metastases-free survival outcomes." Int J Radiat Oncol Biol Phys (2008) 71(4): 1028-1033.

Zeng X, Hood BL, Zhao T, Conrads TP, Sun M, Gopalakrishnan V, Grover H, Day RS, Weissfeld JL, Wilson DO, Siegfried JM and Bigbee WL. "Lung cancer serum biomarker discovery using label-free liquid chromatography-tandem mass spectrometry." J Thorac Oncol (2011) 6(4): 725-734.

Zeng X and Kinsella TJ. "Impact of Autophagy on Chemotherapy and Radiotherapy Mediated Tumor Cytotoxicity: "To Live or not to Live"." Front Oncol (2011) 1: 30.

Zha J, Harada H, Yang E, Jockel J and Korsmeyer SJ. "Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L)." Cell (1996) 87(4): 619-628.

Zha J and Huang YF. "[TGF-beta/Smad in prostate cancer: an update]." Zhonghua Nan Ke Xue (2009) 15(9): 840-843.

Zhang B, Qu JQ, Xiao L, Yi H, Zhang PF, Li MY, Hu R, Wan XX, He QY, Li JH, Ye X, Xiao ZQ and Feng XP. "Identification of heat shock protein 27 as a radioresistance-related protein in nasopharyngeal carcinoma cells." J Cancer Res Clin Oncol (2012) 138(12): 2117-2125.

Zhang F, Lin H, Gu A, Li J, Liu L, Yu T, Cui Y, Deng W, Yan M, Li J and Yao M. "SWATH- and iTRAQ-based quantitative proteomic analyses reveal an overexpression and biological relevance of CD109 in advanced NSCLC." J Proteomics (2014) 102: 125-136.

340

Zhang M, Behbod F, Atkinson RL, Landis MD, Kittrell F, Edwards D, Medina D, Tsimelzon A, Hilsenbeck S, Green JE, Michalowska AM and Rosen JM. "Identification of tumor-initiating cells in a p53-null mouse model of breast cancer." Cancer Res (2008) 68(12): 4674-4682.

Zhang M, Liu H, Guo R, Ling Y, Wu X, Li B, Roller PP, Wang S and Yang D. "Molecular mechanism of gossypol-induced cell growth inhibition and cell death of HT-29 human colon carcinoma cells." Biochem Pharmacol (2003) 66(1): 93- 103.

Zhang P, Wei Y, Wang L, Debeb BG, Yuan Y, Zhang J, Yuan J, Wang M, Chen D, Sun Y, Woodward WA, Liu Y, Dean DC, Liang H, Hu Y, Ang KK, Hung MC, Chen J and Ma L. "ATM-mediated stabilization of ZEB1 promotes DNA damage response and radioresistance through CHK1." Nat Cell Biol (2014) 16(9): 864- 875.

Zhang Q, Helfand BT, Jang TL, Zhu LJ, Chen L, Yang XJ, Kozlowski J, Smith N, Kundu SD, Yang G, Raji AA, Javonovic B, Pins M, Lindholm P, Guo Y, Catalona WJ and Lee C. "Nuclear factor-kappaB-mediated transforming growth factor-beta-induced expression of vimentin is an independent predictor of biochemical recurrence after radical prostatectomy." Clin Cancer Res (2009) 15(10): 3557-3567.

Zhang S, Ong CN and Shen HM. "Critical roles of intracellular thiols and calcium in parthenolide-induced apoptosis in human colorectal cancer cells." Cancer Lett (2004) 208(2): 143-153.

Zhang T, Liang ZW, Han J, Bi JP, Yang ZY and Ma H. "Double-arc volumetric modulated therapy improves dose distribution compared to static gantry IMRT and 3D conformal radiotherapy for adjuvant therapy of gastric cancer." Radiat Oncol (2015) 10(1): 114.

Zhang X, Li X, Zhang N, Yang Q and Moran MS. "Low doses ionizing radiation enhances the invasiveness of breast cancer cells by inducing epithelial- mesenchymal transition." Biochem Biophys Res Commun (2011) 412(1): 188- 192.

Zhong H, Chiles K, Feldser D, Laughner E, Hanrahan C, Georgescu MM, Simons JW and Semenza GL. "Modulation of hypoxia-inducible factor 1alpha expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: implications for tumor angiogenesis and therapeutics." Cancer Res (2000) 60(6): 1541-1545.

341

Zhong N, Cui Y, Zhou X, Li T and Han J. "Identification of prohibitin 1 as a potential prognostic biomarker in human pancreatic carcinoma using modified aqueous two-phase partition system combined with 2D-MALDI-TOF-TOF- MS/MS." Tumour Biol (2015) 36(2): 1221-1231.

Zhou BB, Zhang H, Damelin M, Geles KG, Grindley JC and Dirks PB. "Tumour- initiating cells: challenges and opportunities for anticancer drug discovery." Nat Rev Drug Discov (2009) 8(10): 806-823.

Zhou S, Zhao L, Kuang M, Zhang B, Liang Z, Yi T, Wei Y and Zhao X. "Autophagy in tumorigenesis and cancer therapy: Dr. Jekyll or Mr. Hyde?" Cancer Lett (2012) 323(2): 115-127.

Zhou X, Lu X, Richard C, Xiong W, Litchfield DW, Bittman R and Arthur G. "1- O-octadecyl-2-O-methyl-glycerophosphocholine inhibits the transduction of growth signals via the MAPK cascade in cultured MCF-7 cells." J Clin Invest (1996) 98(4): 937-944.

Zhou YC, Liu JY, Li J, Zhang J, Xu YQ, Zhang HW, Qiu LB, Ding GR, Su XM, Mei S and Guo GZ. "Ionizing radiation promotes migration and invasion of cancer cells through transforming growth factor-beta-mediated epithelial- mesenchymal transition." Int J Radiat Oncol Biol Phys (2011) 81(5): 1530-1537.

Zhu LF, Hu Y, Yang CC, Xu XH, Ning TY, Wang ZL, Ye JH and Liu LK. "Snail overexpression induces an epithelial to mesenchymal transition and cancer stem cell-like properties in SCC9 cells." Lab Invest (2012) 92(5): 744-752.

Zhu ML and Kyprianou N. "Role of androgens and the androgen receptor in epithelial-mesenchymal transition and invasion of prostate cancer cells." FASEB J (2010) 24(3): 769-777.

Zhu W, Fu W and Hu L. "NVP-BEZ235, dual phosphatidylinositol 3- kinase/mammalian target of rapamycin inhibitor, prominently enhances radiosensitivity of prostate cancer cell line PC-3." Cancer Biother Radiopharm (2013) 28(9): 665-673.

Zielske SP, Spalding AC and Lawrence TS. "Loss of tumor-initiating cell activity in cyclophosphamide-treated breast xenografts." Transl Oncol (2010) 3(3): 149- 152.

Zieske LR. "A perspective on the use of iTRAQ reagent technology for protein complex and profiling studies." J Exp Bot (2006) 57(7): 1501-1508. 342

Zietman AL, DeSilvio ML, Slater JD, Rossi CJ, Jr., Miller DW, Adams JA and Shipley WU. "Comparison of conventional-dose vs high-dose conformal radiation therapy in clinically localized adenocarcinoma of the prostate: a randomized controlled trial." JAMA (2005) 294(10): 1233-1239.

Zietman AL, Shipley WU and Willett CG. "Residual disease after radical surgery or radiation therapy for prostate cancer. Clinical significance and therapeutic implications." Cancer (1993) 71(3 Suppl): 959-969.

343

9. Appendix

344

1. The sequence for ALDOA siRNA-122362 (Life technologies, Cat No. AM51331): Silencer siRNA , ID 122362

Sense:

CCACCACAUCUACCUGGAATT

Anti sense:

UUCCAGGUAGAUGUGGUGGTC

2. The sequence for ALDOA siRNA-122368 (Life technologies, Cat No. AM51331):

Sense:

GUAUGUGACCGAGAAGGUGTT

Anti sense:

CACCUUCUCGGUCACAUACTG

3. The sequence for ALDOA siRNA-S71 (Life technologies, Cat No. 4390824):

Sense:

AGUCCCUCUUCGUCUCUAATT

Anti sense:

UUAGAGACGAAGAGGGACUCG

345