Phospholipase C-β3 Is a Key Modulator of IL-8 Expression in Cystic Fibrosis Bronchial Epithelial Cells

This information is current as Valentino Bezzerri, Pio d'Adamo, Alessandro Rimessi, of October 1, 2021. Carmen Lanzara, Sergio Crovella, Elena Nicolis, Anna Tamanini, Emmanouil Athanasakis, Maela Tebon, Giulia Bisoffi, Mitchell L. Drumm, Michael R. Knowles, Paolo Pinton, Paolo Gasparini, Giorgio Berton and Giulio Cabrini J Immunol 2011; 186:4946-4958; Prepublished online 16 March 2011; Downloaded from doi: 10.4049/jimmunol.1003535 http://www.jimmunol.org/content/186/8/4946 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2011/03/16/jimmunol.100353 Material 5.DC1 References This article cites 39 articles, 8 of which you can access for free at: http://www.jimmunol.org/content/186/8/4946.full#ref-list-1

Why The JI? Submit online. by guest on October 1, 2021

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Phospholipase C-b3 Is a Key Modulator of IL-8 Expression in Cystic Fibrosis Bronchial Epithelial Cells

Valentino Bezzerri,*,1 Pio d’Adamo,†,1 Alessandro Rimessi,‡,1 Carmen Lanzara,† Sergio Crovella,† Elena Nicolis,* Anna Tamanini,* Emmanouil Athanasakis,† Maela Tebon,* Giulia Bisoffi,x Mitchell L. Drumm,{ Michael R. Knowles,‖ Paolo Pinton,‡,2 Paolo Gasparini,†,2 Giorgio Berton,#,2 and Giulio Cabrini*,2

Respiratory insufficiency is the major cause of morbidity and mortality in patients affected by cystic fibrosis (CF). An excessive neutrophilic inflammation, mainly orchestrated by the release of IL-8 from bronchial epithelial cells and amplified by chronic bacterial infection with Pseudomonas aeruginosa, leads to progressive tissue destruction. The anti-inflammatory drugs presently used in CF patients have several limitations, indicating the need for identifying novel molecular targets. To address this issue, we preliminarily studied the association of 721 single nucleotide polymorphisms from 135 genes potentially involved in signal trans- Downloaded from duction implicated in neutrophil recruitment in a cohort of F508del homozygous CF patients with either severe or mild pro- gression of lung disease. The top ranking association was found for a nonsynonymous polymorphism of the phospholipase C-b3 (PLCB3) gene. Studies in bronchial epithelial cells exposed to P. aeruginosa revealed that PLCB3 is implicated in extracellular nucleotide-dependent intracellular calcium signaling, leading to activation of the protein kinase Ca and Cb and of the nuclear transcription factor NF-kB p65. The proinflammatory pathway regulated by PLCB3 acts by potentiating the Toll-like Receptors’ signaling cascade and represents an interesting molecular target to attenuate the excessive recruitment of neutrophils without http://www.jimmunol.org/ completely abolishing the inflammatory response. The Journal of Immunology, 2011, 186: 4946–4958.

ystic fibrosis (CF), an autosomal-recessive disease man- centration in the sweat, is related to loss-of-function mutations of ifesting progressive respiratory insufficiency, defective exo- the CF transmembrane conductance regulator (CFTR) gene encoding C crine pancreatic secretion, and elevated electrolyte con- a chloride transporting protein (OMIM 219700). The major cause of morbidity and mortality of CF patients is *Laboratory of Molecular Pathology, University Hospital of Verona, 37126 Verona, chronic lung disease. Innovative therapies to prevent the onset or Italy; †Laboratory of Medical Genetics, Department of Reproductive and Develop- reduce the pulmonary damage are under intensive preclinical and ‡ by guest on October 1, 2021 mental Sciences, University of Trieste, 34137 Trieste, Italy; Signal Transduction Lab, clinical investigation (1). Besides pharmaceutical approaches to Department of Experimental and Diagnostic Medicine, University of Ferrara, 44100 Ferrara, Italy; xBiostatistics Unit, University Hospital of Verona, 37126 Verona, Italy; correct the mutated CFTR protein and to potentiate its ion trans- {Department of Genetics, Case Western Reserve University, Cleveland, OH 44106; ‖Cys- port function, novel anti-inflammatory drugs will be particularly tic Fibrosis, Pulmonary Research, and Treatment Center, School of Medicine, University of North Carolina, Chapel Hill, NC 27599; and #Section of General Pathology, Depart- relevant to those adolescent and adult CF patients who have already ment of Pathology and Diagnostics, University of Verona, 37134 Verona, Italy developed lung pathology (2). However, current anti-inflammatory 1V.B., A.R., and P.d’A. contributed equally to this work. drugs, such as corticosteroids, show limitations in terms of efficacy 2G.C., G.B., P.G., and P.P. share senior authorship. or occurrence of adverse effects in CF patients, suggesting the need Received for publication October 25, 2010. Accepted for publication February 11, of identifying novel molecular targets and more effective anti- 2011. inflammatory drugs specifically tailored for CF pulmonary patho- This work was supported by the Italian Cystic Fibrosis Foundation (Grants 3/2008, physiology (2). 8/2009, 13/2009, 18/2009, and 2/2010; to P.G., G.C. and P.P.), the Italian Association A hallmark of lung pathology in CF is a neutrophil-dominated for Cancer Research Telethon (Grant GGP09128), local funds from the University of Ferrara, the Itaian Ministry of Education, University, and Research and the Ita- inflammation, which is disproportionate to the bacterial infection, lian Ministry of Health (to P.P.), National Institutes of Health Grants HL68890 typically by Pseudomonas aeruginosa. Excessive infiltrates of and DK27651, and American Cystic Fibrosis Foundation Grants DRUMM00A0, neutrophils, releasing proteases upon continuous activation by KNOWLES00A0, and RDPR026 (to M.L.D. and M.R.K.). V.B. is a fellow of the Italian Cystic Fibrosis Research Foundation, and E.N. is a fellow of the Azienda bacterial products, are presently thought to play a major role in the Ospedaliera Universitaria Integrata di Verona. progressive destruction of the CF lung tissue (3, 4). The chemo- Address correspondence and reprints requests to Dr. Giulio Cabrini, Laboratory of Mo- kine IL-8 is the most abundant soluble mediator recruiting neu- lecular Pathology, Department of Pathology and Diagnostics, University Hospital of trophils in the bronchi of CF patients, being found in the airway Verona, Piazzale Stefani 1, 37126 Verona, Italy. E-mail address: [email protected] secretions both in advanced and in early stages of the disease (5– The online version of this article contains supplemental material. 7). Interestingly, IL-8 promoter variant alleles resulting in reduced Abbreviations used in this article: ASGM1R, asialo-GM1 receptor; BIM-I, bisindo- 2+ 2+ 2+ expression of IL-8 protein are protective in respect to the severity lylmaleimide-I; [Ca ]c, cytosolic-free calcium concentration; [Ca ]er,ERCa con- 2+ 2+ 2+ centrations; [Ca ]i, intracellular calcium concentration; [Ca ]m, rise of [Ca ]c in of progression of lung disease in CF patients (8), supporting the the mitochondrial matrix; CF, cystic fibrosis; CTFR, cystic fibrosis transmembrane concept that reduction of the excessive IL-8–driven neutrophil conductance regulator; DAG, 1,2-diacylglycerol; ER, endoplasmic reticulum; GMSG, recruitment could be a relevant pharmacological objective to ame- Gene Modifier Study Group; IP3, inositol 1,4,5-trisphosphate; KRB, Krebs Ringer’s Buffer; LHC, Laboratory of Human Carcinogenesis; PLC, phospholipase C; PLCB, liorate CF pulmonary disease. phospholipase C-b; P2Y2R, purinergic receptor Y2; siRNA, small-interfering RNA; A major source of IL-8 release in CF lungs is the bronchial SNP, single nucleotide polymorphism. epithelial cells lining the conductive airways of CF patients (5, 0). Copyright Ó 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00 Binding of bacterial components to pattern-recognition receptors www.jimmunol.org/cgi/doi/10.4049/jimmunol.1003535 The Journal of Immunology 4947 expressed on epithelial cell surface, such as TLRs 2, 4, and 5, within which tag SNPs to be picked. As output, Tagger produced a list of activates a series of kinases and adaptors, ultimately triggering tag SNPs and corresponding statistical tests to capture all variants of in- nuclear translocation of transcription factors and expression of terest and a summary coverage report of the selected tag SNPs. proinflammatory genes (10). In addition, interaction of P. aeru- Genotyping by Illumina technology ginosa with asialo-GM1 receptor (ASGM1R), which colocalizes First, analysis of SNPs has been performed by Illumina technology. An with TLR5, promotes sustained release of nucleotides (11, 12). overall number of 721 SNPs was selected within 135 genes and analyzed by Extracellular ATP, through an autocrine binding to the seven- using the “Custom Golden-Gate Genotyping” (http://www.illumina.com) membrane spanning domain P2Y2 purinergic receptor, activates assay on ILLUMINA platform. This genotyping system consisted of an cytosolic calcium signaling and contributes, together with TLRs, initial allele-specific extension reaction, followed by PCR amplification. to the expression of IL-8 (13). Amplified products were hybridized to an array matrix of bead-based probe sequences where each bead is coated with universal probes and Because of the high redundancy in receptors and downstream represented multiple times for increased accuracy (average of 25 times). signaling components triggered by P. aeruginosa in bronchial epithelial cells, finding key targets to effectively reduce excessive Genotyping by TaqMan technology inflammatory response represents a major challenge. To prioritize The genotype of the SNPs ranking on top of statistical significance has been the investigation on key target molecule(s) intervening in this verified with TaqMan assays from Applied Biosystems. All reactions using proinflammatory network, we performed a pilot genotype-phe- TaqMan MGB probes were run under standard condition on an ABI notype association study between variants of genes involved in PRISM 9700 HT system. Genotyping of phospholipase C (PLC) SNPs in the human bronchial epithelial cell lines IB3-1 and CuFi-1 was performed the innate immune response and the severity of lung disease in CF by both TaqMan technology and direct sequencing (see Supplemental patients. So far, association studies have highlighted that the Tables V, VI). mannose-binding lectin 2, the TGF-b1 (TGFB1), and the IFRD1 Downloaded from genes can modulate the progression of lung disease in CF (14– Human bronchial epithelial cell culture 16). Thus, to start identifying critical components modulating IB3-1 cells (LGC Promochem Europe) are human bronchial epithelial cells the inflammatory signaling cascade triggered by P. aeruginosa in immortalized with adeno12/SV40, derived from a CF patient with a mutant bronchial epithelial cells, we studied the distribution of allelic F508del/W1282X genotype (17). Cells were grown in Laboratory of Hu- man Carcinogenesis (LHC)-8 basal medium (Biofluids, Rockville, MO) variants of 721 single nucleotide polymorphisms (SNPs) from supplemented with 5% FBS. All culture flasks and plates were coated with http://www.jimmunol.org/ a panel of 135 genes of innate immunity in two groups of CF a solution containing 35 mg/ml bovine collagen (BD Biosciences, Franklin patients characterized by severe or mild progression of lung dis- Lakes, NJ), 1 mg/ml BSA (Sigma-Aldrich), and 1 mg/ml human fibronectin ease. By ranking the association of each SNP with the progression (BD Biosciences) as described previously. CuFi-1 cells were a gift from of lung disease severity, we found on the top a nonsynonymous A. Klingelhutz, P. Karp, and J. Zabner (University of Iowa, Iowa City, IA). CuFi-1 cells were derived from human bronchial epithelia from a patient polymorphism of the phospholipase C-b (PLCB)3 gene, leading to with CF (CFTR mutant genotype F508del/F508del) and transformed by investigate first the role of the PLCB3 enzyme. Functional studies reverse transcriptase component of telomerase, hTERT, and human pap- performed in human bronchial epithelial cells exposed to P. aer- illomavirus type 16 E6 and E7 genes (18). These cells were grown on uginosa demonstrate that PLCB3, by regulating intracellular cal- human placental collagen type IV (Sigma-Aldrich)-coated flasks in bron- chial epithelial growth medium (Cambrex Bioscience, Walkersville, MD), cium transients, plays a relevant role in amplifying the expression as described previously (18). CuFi-1 cells were seeded onto cell culture by guest on October 1, 2021 and release of IL-8, the major chemokine recruiting neutrophils in inserts (pore size, 0.4 mm) in Falcon 24-well multitrays (BD Biosciences) CF airway lungs. at a density of 7 3 105 cells/insert and grown in bronchial epithelial growth medium for 15 d. Transepithelial electrical resistance was mea- sured with an epithelial voltometer (World Precision Instruments, Sarasota, Materials and Methods FL). The cell inserts were used for experiments when the cell monolayers 2 Materials reached a transepithelial electrical resistance . 1000 V 3 cm . The calcium chelator BAPTA-AM was purchased from Molecular Probes Infection with P. aeruginosa bacterial strains (Eugene, OR), the broad protein kinase C (PKC) inhibitor bisindolylmaleimide- I (BIM-I) was purchased from Merck KGaA (Darmstadt, Germany), all the The well-characterized motile nonmucoid laboratory strains of P. aerugi- other reagents were obtained from Sigma-Aldrich (St. Louis, MO), unless nosa named PAO1, PAK, and PAK FliC (recombinant P. aeruginosa strain otherwise indicated. PAK lacking expression of flagellin) have been donated by A. Prince (Columbia University, New York, NY). Bacteria colonies from overnight Subjects cultures on trypticase soy agar (Difco, Detroit, MI) plates were grown with shaking in 20 ml trypticase soy broth (Difco) at 37˚C until an OD (A660 DNA samples were collected from CFTR F508del homozygous patients nm wavelength), corresponding to 1 3 107 CFU/ml, was reached. Bacteria enrolled by the University of North Carolina (Chapel Hill, NC) (M.R.K.) and were washed twice with PBS and diluted in each specific serum-free by Case Western Reserve University (Cleveland, OH) (M.L.D.). CF patients medium before infection and added to cells at the concentration indi- were classified as “mild” (n = 300) or “severe” (n = 208) with respect to the cated as CFUs per cell. progression of lung disease according to the forced expiratory volume at 1st minute measurements, according to the criteria reported previously by Expression of PLC isoforms and of IL-8 the North American Gene Modifier Study Group (GMSG) (15). The study was approved by the Institutional Review Boards of the participating PLC and IL-8 transcripts were quantified real-time PCR as described institutions collecting the samples from patients affected by CF. previously (19). Briefly, total RNA from cells was isolated using High Pure RNA Isolation Kit (Roche, Mannheim, Germany). Two microrgrams of Selection of SNPs total RNA was reverse transcribed to cDNA using the High Capacity cDNA Archive Kit and random primers (Applied Biosystems, Foster City, Different types of SNPs have been chosen in candidate genes by using the CA) in a 100-ml reaction. The cDNA (2 ml) was then amplified for 40 PCR HapMap database. In particular, two different types of polymorphisms have cycles using the SYBR Green PCR Master Mix (Applied Biosystems) in been chosen: 1) nonsynonymous coding SNPs that include a group of SNP a 10-ml reaction using 7900HT Fast Real-Time PCR apparatus (Applied having the highest impact on phenotype for their potential to directly affect Biosystems, Foster City, CA). The quantified real-time PCRs were per- the structure, function, and interactions of expressed proteins; and 2) Tag formed in duplicates for both target and normalizer genes. Primer se- SNPs, which represent a subset of SNPs capturing most of the haplotype quences and concentration are shown in Supplemental Table IV. Primer diversity of each haplotype block or gene-specific region. Tag SNPs have sets were purchased from Integrated DNA Technologies (Tema Ricerca been selected using Tagger, a software implemented in Haploview (http:// s.r.l., Bologna, Italy). Relative quantification of gene expression was per- www.broad.mit.edu/mpg/haploview/). Genotype data in raw HapMap formed using the comparative threshold (CT) method as described by the format have been uploaded to specify the genomic regions of interest manufacturer (Applied Biosystems User Bulletin 2). Changes in mRNA 4948 PLCB3, CHEMOTACTIC SIGNALING, AND CYSTIC FIBROSIS

Table I. Prevalence of polymorphic genotypes according to the severe or mild phenotype of CF patients

Lung Genotype CC Genotype CT Genotype TT Total x2 p Gene SNP No. Function Patients n (%) Patients n (%) Patients n (%) Patients n Value Value PLCB3 Severe 185 (92) 15 (8) 0 200 8.01 0.0046 rs35169799 Mild 260 (84) 45 (15) 3 (1) 308 expression level were calculated after normalization to calibrator gene. Activation of NF-kB The ratios obtained after normalization are expressed as fold changes over untreated samples for IL-8 mRNA and for the relative expression of the IB3-1 cell nuclear extracts were prepared as described previously (19). housekeeping gene human cytokeratin-15 for the isoforms of PLC. PLCB3 Briefly, IB3-1 cells were transfected with PLCB3 siRNA or scrambled protein was detected by immunofluorescence. IB3-1 cells were seeded duplexes for 24 h and stimulated with P. aeruginosa, PAO1 strain (100 on 8-well chamber slides (Nunc, Naperville, IL) and preincubated with CFU/cell) for an additional 1, 2, or 4 h, washed twice with iced PBS, and PLCB3 small-interfering RNA (siRNA) or scrambled duplexes for 24 h in detached by trypsinization. Nuclear proteins were separated by hypotonic LHC-8 basal serum-free medium as indicated below in the silencing lysis followed by high-salt extraction treatment of nuclei. A quantitative protocol. Cells were washed three times with PBS and fixed with 4% NF-kB p65 subunit capture assay was performed by TransAM NF-kB paraformaldehyde (w/v) in PBS for 20 min at room temperature. After p65 Activation Assay (Active Motif, Carlsbad, CA) using 2.5 mg nuclear three washes with PBS, cells were permeabilized with methanol at 220˚C extracts for each sample, according to the manufacturer’s instructions. for 5 min and dried for 1 h. Slides were incubated with 5% BSA in PBS for Briefly, nuclear extracts were added to wells coated with an oligonucleo- 90 min at room temperature and then subjected to three incubations at tide containing a NF-kB consensus binding site. The binding was revealed room temperature with the following: 1) 1/200 dilution of rabbit polyclonal by subsequent addition of a primary Ab directed against p65 and a sec- Ab anti-PLCB3 (sc-13958 from Santa Cruz Biotechnology, Santa Cruz, ondary Ab conjugated to HRP, and after the addition of the substrate, Downloaded from CA) in 5% BSA for 1 h or with an irrelevant rabbit IgG Ab; 2) 1/200 absorbance was read at a 450-nm wavelength. dilution of biotinylated goat anti-rabbit IgG (Santa Cruz Biotechnology) in Purification of flagellin and pilin from P. aeruginosa 1% BSA/PBS-0.1% Tween 20; and 3) 1/60 dilution of FITC conjugated streptavidin (Sigma-Aldrich) in 1% BSA/PBS-0.1% Tween 20. Coverslips Purification of flagellin was performed as previously described (20) starting were mounted with Prolong Antifade (Molecular Probes) and stored at from the PAK/NP recombinant P. aeruginosa strain lacking expression of room temperature. Fluorescence was examined with a digital imaging pilin. Pilin proteins were isolated using the method of Castric (21), starting system based on a Zeiss Axiovert 200 fluorescence microscope equipped from the PAK/fliC recombinant P. aeruginosa strain lacking expression of http://www.jimmunol.org/ with a back-illuminated charge-coupled device camera (Roper Scientific), flagellin. excitation, and emission filter wheels (Sutter Instruments, Novato, CA) and piezoelectric motoring of the z stage (Physik Instrumente, Karlsruhe, Fura-2/AM measurements Germany) for rapid focusing in the Z plane. The data were acquired and The cytosolic free Ca2+ concentration was evaluated using the fluorescent processed using the MetaMorph analyzing program (Universal Imaging, 2+ Downingtown, PA). The Z-steps were then turned into projections, and the Ca indicator Fura-2/AM (Molecular Probes). Briefly, cells were in- average intensity after background subtraction was determined. All in- cubated in medium supplemented with 2.5 mM Fura-2/AM for 30 min, tensity comparisons were determined from at least 10 different cells to washed with Krebs Ringer’s Buffer (KRB) to remove the extracellular minimize cell-to-cell staining variations. The levels of PLCB3-silencing probe, supplied with preheated KRB (supplemented with 1 mM CaCl2), were expressed as the percentage of arbitrary unit of fluorescence, in re- and placed in a thermostated (37˚C) incubation chamber of an LS50 Perkin spect to scrambled condition. IL-8 protein release was measured with an Elmer fluorometer (Perkin Elmer, Beaconsfield, U.K.). Fluorescence was by guest on October 1, 2021 ELISA. IB3-1 and CuFi-1 cells were grown and infected as previously measured every 100 ms with the excitation wavelength alternating between 340 and 380 nm and the emission fluorescence being recorded at 510 nm. described, then supernatants were collected from each well, and an ELISA 2+ The intracellular calcium concentration ([Ca ]i) was calculated by the for the quantitative detection of human IL-8 was performed using the 2+ ratio method using the equation: [Ca ]i = Kd 3 (R 2 Rmin)/(R 2 Rmax) 3 Human IL-8 Instant ELISA kit (Bender MedSystems, Vienna, Austria), 2+ according to the manufacturer’s protocol. Sf2/Sf1, where Kd is the dissociation constant of Fura-2/AM for (Ca ) taken as 240 nM at 37˚C, R is the ratio of fluorescence for Fura-2/AM at the two excitation wavelengths, F340/F380, Rmax is the ratio of fluo- Silencing PLCB3 gene rescence in the presence of excess of calcium obtained by lysing the To perform silencing experiments of PLCB3 gene a TriFECTa RNAi Kit cells with 10 mM ionomycin (Sigma Aldrich), Rmin is the ratio of fluo- rescence in the presence of minimal calcium obtained by lysing the cells (Integrated DNA technologies, Coralville, Iowa, IA) was used accordingly 2+ to the manufacturer’s instructions. IB3-1 cells were transiently transfected and then chelating all the Ca with 0.5 M EGTA, Sf2 is the fluorescence of Ca2+ free form of Fura-2/AM at 380-nm excitation wavelength, and with specific siRNA for PLCB3 (sequence 1, 59-AGAUGAGGGACAA- 2+ GCAUAAGAAGGA-39; sequence 2, 59-GCUCGAAAGAGGAACCGA- Sf1 is the fluorescence of Ca -bound form of Fura-2/AM at 380-nm AGCAUUUGUUCCU-39) or scrambled (sequence, 59-CUUCCUCUCUU- excitation wavelength. IB3-1 cells were transfected and stimulated with UCUCUCCCUUGUGA-39) duplexes complexed with cationic liposomes P. aeruginosa, PAO1 strain (100 CFU/cell), as reported in the figures. Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Lipofectamine 2000 Aequorin measurements (4 ml) was diluted in 1 ml LHC-8 serum-free cell culture medium. PLCB3 siRNA or scrambled duplexes (10 nM) were added and incubated for The probes used (cytAEQ, erAEQmut, and mtAEQ) are chimeric aequorins 10 min. Liposome:duplexes complexes in LHC-8 serum-free medium targeted to the cytosol, endoplasmic reticulum (ER), and mitochondria, (500 ml) were added to IB3-1 cells grown in 2-cm2 wells and incubated at respectively (22). For the experiments with cytAEQ and mtAEQ, cells 37˚C/5% CO2 for 6 h. Cells were washed twice with culture medium and were incubated with 5 mM coelenterazine for 1–2 h in modified KRB left at 37˚C/5% CO2 for an additional 18 h. supplemented with 1 mM CaCl2. Then, the coverslip with transfected cells

Table II. Prevalence of polymorphic alleles according to the severe or mild phenotype of CF patients

Minor Allele Odds Ratio Lung (95% Confidence Gene SNP No. Function Allele Allele n Allelic Frequency Interval) PLCB3 Severe C 385 385/400 = 0.962 Allele T in mild rs35169799 Mild C 565 565/616 = 0.917 CF patients Severe T 15 15/400 = 0.037 2.297 (1.27–4.14) Mild T 51 51/616 = 0.083 The Journal of Immunology 4949 was placed in a perfused, thermostatedchamberlocatedintheclose medium, as shown in the figures. The experiments were terminated by proximity of a low-noise photomultiplier with a built-in amplifier-dis- lysing the cells with 100 mM digitonin in a hypotonic Ca2+-containing criminator. To reconstitute the erAEQmut with high efficiency, the lu- solution (10 mM CaCl2 in H2O), thus discharging the remaining aequorin minal [Ca2+] of the ER first had to be reduced. This was achieved by pool. The output of the discriminator was captured by a Thorn-EMI incubating the cells for 1 h at 4˚C in KRB supplemented with 5 mM photon counting board and stored in an IBM-compatible computer for coelenterazine, the Ca2+ ionophore ionomycin, and 600 mM EGTA. After further analyses. The aequorin luminescence data were calibrated off- this incubation, cells were extensively washed with KRB supplemented line into [Ca2+] values, using a computer algorithm based on the Ca2+ with 2% BSA and then transferred to the perfusion chamber. All ae- response curve of wild-type and mutant aequorins. Chemicals and quorin measurements were carried out in KRB supplemented with either reagents were obtained from Sigma-Aldrich or from Merck, except for 1mMCaCl2 (cytAEQ and mtAEQ) or 100 mM EGTA (erAEQmut). coelenterazine and coelenterazine n, which were obtained from Molec- Agonist, as 100 mM histamine, and other drugs were added to the same ular Probes.

E Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 1. Silencing PLCB3 reduces P. aeruginosa-dependent expression and release of IL-8 in human bronchial epithelial IB3-1 cells. A, Quantitative expression of PLCB3 mRNA by quantified real-time PCR after transfection with PLCB3 siRNA or scrambled oligonucleotides sequences 1 and 2 for 24 h and subsequent infection with PAO1 (100 CFU/cell) for an additional 4 h. The mRNA expression reported in y-axis is relative to scrambled-treated un- infected cells. Mean 6 SEM of eight independent experiments performed in duplicate. Immunofluorescence signal of PLCB3 protein in IB3-1 cells transfected with scrambled oligonucleotide sequence 1 (B) or PLCB3 siRNA oligonucleotide sequence, in the presence of primary anti-PLCB3 Ab (C)or irrelevant Ab (D). E, Quantification of the fluorescence signal as percentage of fluorescence arbitrary units (F.A.U.) related to the expression of PLCB3 protein of IB3-1 cells treated with scrambled versus PLCB3 siRNA oligonucleotides. Percentual reduction of 36.8 6 6.6 of the fluorescent signal of 10 cells treated with PLCB3 siRNA and 10 cells treated with scrambled oligonucleotides, respectively. F, Quantitative expression of IL-8 mRNA after transfection with PLCB3 siRNA sequences 1 and 2 or scrambled oligonucleotides in IB3-1 cells as described for A. Mean 6 SEM of five independent experiments performed in duplicate. G, Effect of PLCB3 siRNA (sequence 1) on IL-8 transcription induced by flagellin (10 mg/ml) and TNF-a (50 ng/ml). Mean 6 SEM of three independent experiments performed in duplicate. H, Effect of PAO1 (100 CFU/cell), flagellin (10 mg/ml), and TNF-a (50 ng/ml) on IL-8 protein release, treated as in A with PLCB3 siRNA (sequence 1), or scrambled oligonucleotide. Mean 6 SEM of three independent experiments performed in duplicate. I, Effect of PAO1 (100 CFU/cell) in IB3-1 cells transfected with PLCB3 siRNA (sequences 1 or 2) on ICAM-1, growth-related oncogene g, IL-6, and TNF-a mRNA transcription. Mean 6 SEM of three independent experiments performed in duplicate. 4950 PLCB3, CHEMOTACTIC SIGNALING, AND CYSTIC FIBROSIS

Microscopic analysis of PKC translocation SNPs resulting in nonsynonymous changes in the coding regions Images of PKC translocation were recorded using a digital imaging system and, second, those TagSNPs in intronic, 39- and 59-untranslated based on a Zeiss Axiovert 200 fluorescence microscope. The data were regions that mark the haploblocks composed of several single acquired and processed using the MetaMorph analysis program (Universal SNPs, for a total of 721 SNPs, as listed in the Supplemental Table Imaging). For computational deblurring, a stack of images through the z II. DNA samples were from a representative cohort of 508 CF plane was acquired (200 ms/image; 20 plans 0.5 mm apart) and processed patients selected by the North American GMSG and classified as using the EPR software developed by the Biomedical Imaging group of the University of Massachusetts Medical School (Worcester, MA). Microscope having either severe (n =200)ormild(n = 308) progression of lung analysis was performed 36 h after transfection. The medium was changed disease, according to the criteria described previously (15). Gen- from LHC-8 basal medium plus 5% FCS to KRB. P. aeruginosa strain, and otyping the 721 SNPs has been performed first by using Illumina other drugs (400 nM phorbol ester PMA and 3 U/ml apyrase, respectively) platforms with individual 508 DNA samples. The top-ranking were added to the buffer, as shown in the figures. The recruitment of the kinases are represented as plasma membrane translocation of different group of SNPs showing significant genotype-phenotype associa- PKC–GFP chimeras, expressed as the increase in fluorescence ratio with tion was subsequently validated with TaqMan probe assays. By respect to time 0 (calculated as the ratio of plasma membrane and cytosol ranking the association between variant alleles and the severe or average intracellular fluorescence, obtained from multiple regions inside mild groups of CF patients, 26 SNPs showed a statistical signifi- the cytosol and on the cell membrane, measured on single cell). The graphs cance with p , 0.05, as calculated by permutation test (Supple- (Fig. 5) indicate the levels of PKC translocation, expressed as the fluo- rescence ratio, to plasma membrane (for PKCa, PKCb, and PKCd)or mental Table III). Interestingly, within the top-ranking list of the nucleus (for PKCz), on the average of cytosolic fluorescence intensity. 721 SNPs, 5 of them were variants of PLC isoforms b, namely a nonsynonymous SNP of the PLC isoform b3 gene (PLCB3), Statistical methods three intronic Tag SNPs of the PLC isoform b1 gene (PLCB1), and For association between disease and single SNPs, test for allelic association one intronic Tag SNP of the PLC isoform b4 gene (PLCB4). The Downloaded from (which compares frequencies of alleles in cases versus controls) have been C2534T variant (rs35169799) of the PLCB3 gene was found on top used. For these analyses, permutation tests (i.e., permuting the phenotypes) of the rank of the 721 SNPs. The minor allele T was found sig- have been conducted to account for the large numbers of tests. Our analyses 2 have been performed using PLINK (http://pngu.mgh.harvard.edu/∼purcell/ nificantly associated with the milder CF phenotype group (x test plink/) and R (http://www.r-project.org/). After validation of Illumina ge- value = 8.01, permutation test; p = 0.0046) (Table I). Milder CF notype screening by TaqMan assay, allelic associations have been tested patients were associated with the minor 2534T allele with odds 2 with x test. The Student t test has been applied to the experiments per- ratio = 2.297 (95 confidence interval = 1.27–4.14), as shown in http://www.jimmunol.org/ formed in human bronchial epithelial cells with statistical significance at *p , 0.05 or **p , 0.01 levels. Table II. The C2534T variant encodes a nonsynonymous serine to leucine change in the amino acid residue at position 845, which is Results localized in the C-terminal tail in close proximity to the C2 domain of the PLCB3 protein (23, 24). These two domains are known to be Association of PLCB3 gene with the progression of lung involved in the interaction with Ga heterotrimeric GTPase disease in CF q/11 protein and in the anchoring of PLCB3 to the plasma membrane A panel of genes of the innate immunity has been chosen as through salt-like Ca2+ bonds, respectively (23, 24). candidate modulators of the proinflammatory signaling elicited by P. aeruginosa in bronchial epithelial cells (Supplemental Table I). Silencing PLCB3 reduces the expression of IL-8 chemokine by guest on October 1, 2021 They included 135 genes, such as those encoding chemokines and PLCb isoforms are implicated in signal transduction by receptors adhesion molecules, pattern-recognition receptors sensing the pres- for hormones, growth factors, neurotransmitters and other ligands ence of bacteria in the lumen of the conductive airways and several involved in regulation of different cellular processes, including the components of the signaling network acting downstream the pat- immune response (24). Although human bronchial epithelial cells tern-recognition receptors. To choose in each gene those allelic express, albeit at different levels, the transcripts of all the PLC b variants most probably contributing to changes in expression or isoforms, (Supplemental Figs. 1, 2), we focused our attention on function of the encoded proteins, because of the large series of PLCB3, because it is the most highly expressed within the b SNPs reported for each of these genes, first, we selected all those isoforms, and it is the top-ranking gene associated with clinical

FIGURE 2. Silencing PLCB3 reduces P. aeruginosa-dependent expression and release of IL-8 in polarized human bronchial CF CuFi-1 cells. A, Quantitative expression of PLCB3 mRNA by quantified real-time PCR after transfection with PLCB3 siRNA sequences 1 and 2 or scrambled oligonu- cleotides for 24 h and subsequent infection with PAO1 (100 CFU/cell) for an additional 4 h. The mRNA expression reported in y-axis is relative to scrambled-treated uninfected cells. Mean 6 SEM of four independent experiments performed in duplicate. B, Levels of IL-8 mRNA in the same experiments reported in A. C, Release of IL-8 protein in the same experiments reported in A with a PLCB3 siRNA sequence 1. IL-8 protein concentration refers to that collected from the apical side of the Transwell insert filter. Mean 6 SEM of three separate experiments performed in duplicate. The Journal of Immunology 4951 phenotype. To understand whether PLCB3 could be relevant in the (S845), as reported in Supplemental Table V. Transfection of two induction of IL-8 in respiratory cells exposed to bacterial in- different duplexes PLCB3 siRNA reduced significantly, albeit fection, we studied the transcription and release of IL-8 after si- partially, the levels of expression of PLCB3 mRNA (Fig. 1A) and lencing the expression of endogenous PLCB3 with siRNA oligo- protein (Fig. 1B–E), as detected by quantitative RT-PCR and nucleotides in human bronchial epithelial cells from CF patients confocal immunofluorescence, respectively. No significant re- exposed to P. aeruginosa. The bronchial cell lines used were all duction of transcript levels of PLC isozymes b1, b2, and b4 was homozygous for the major allele of the PLCB3 C2534T variant observed with PLCB3 siRNA in IB3-1 cells (Supplemental Fig. 1). Infection with P. aeruginosa did not change significantly the levels of PLCB3 mRNA. In the same experimental model, partial silencing of PLCB3 produced a parallel reduction of IL-8 tran- scription and release in IB3-1 cells exposed to P. aeruginosa (Fig. 1F,1H) without changing the basal IL-8 mRNA levels in un- infected cells. Silencing PLCB3 did reduce the IL-8 transcription and release induced by flagellin, a component of P. aeruginosa interacting with TLR5, but did not affect the TNF-a–dependent IL-8 expression (Fig. 1G,1H), suggesting that PLCB3 may have a role in downstream signaling of TLR5 but not TNFRs. The ef- fect of silencing PLCB3 gene seems mainly restricted to IL-8, because the expression of other genes induced by P. aeruginosa Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 3. Intracellular calcium chelator BAPTA inhibits the tran- FIGURE 4. Silencing PLCB3 affects the release of calcium from the scription of IL-8 mRNA induced by P. aeruginosa. A, Cytosolic free Ca2+ ER. IB3-1 cells were pretreated with PLCB3 siRNA sequence 1 (gray concentration as measured with Fura-2/AM assay in IB3-1 cells exposed traces) or scrambled (black traces) oligonucleotides, respectively, for 24 h 2+ 2+ to PAO1 (black trace) or with tissue culture medium alone (gray trace). before measuring intracellular Ca transients. A, intracellular free [Ca ]i Traces are representative of eight independent experiments. B, The in- with Fura-2/AM assay after addition of PAO1 (100 CFU/cell), n =8.B,ER 2+ 2+ tracellular Ca -chelator BAPTA-AM (5 mM) was preincubated with IB3- calcium concentration ([Ca ]er) by ER-targeted aequorin in the presence 1 cells for 30 min at 37˚C to obtain diesterification of the acetoxymethyl of 1 mM extracellular calcium or with the addition of histamine (His, 100 ester. Cells were exposed to PAO1 (100 CFU/cell) or TNF-a (50 ng/ml) for mM) for the time indicated. Luminal ER Ca2+ concentration measurement an additional 4 h before extraction of total RNA and quantified real-time was 212 6 9.52 mM in mock versus 215 6 5.51 mM in PLCB3 silenced PCR. Data are mean 6 SEM of three separate experiments performed in cells, n = 10. C, Variation of ER calcium release kinetic upon histamine duplicate. C, After preincubating IB3-1 cells with PLCB3 siRNA sequence addition expressed as mM/s: in mock 4.26 6 0.33 versus 3.31 6 0.13, p , 1 or scrambled oligonucleotides for 24 h, BAPTA-AM was added for 30 0.05, n = 10 PLCB3-silenced cells, respectively. D, Mitochondrial calci- 2+ min at 37˚C to obtain intracellular partition and diesterification of the um concentration ([Ca ]m) by mitochondrial-targeted aequorin with the 2+ acetoxymethy lester. Infection with PAO1 strain was performed for an addition of histamine, [Ca ]m: mock 2.58 6 0.19 mM versus PLCB3 additional 4 h, total RNA was extracted, and IL-8 mRNA was quantified silenced 2.06 6 0.23 mM, n = 10. E, cytosolic calcium concentration 2+ 2+ by quantified real-time PCR. Data are mean 6 SEM of four separate ([Ca ]c) by native aequorin with the addition of histamine, [Ca ]c: mock experiments performed in duplicate. 1.65 6 0.13 mM versus PLCB3 silenced 1.50 6 0.11 mM, n = 10. 4952 PLCB3, CHEMOTACTIC SIGNALING, AND CYSTIC FIBROSIS

2+ 2+ in bronchial epithelial cells, such as ICAM-1, growth-related on- crease of cytosolic Ca concentration ([Ca ]c) as measured using cogene g, IL-6, and TNF-a, is not reduced (Fig. 1I). The reduction fura-2 technique (Fig. 3A). Conversely, buffering the increase of 2+ 2+ of IL-8 expression after silencing PLCB3 was confirmed in the CF [Ca ]c with the intracellular Ca -chelator BAPTA reduced sig- human bronchial epithelial cell lines CuFi-1 grown polarized on nificantly the induction of IL-8 mRNA (Fig. 3B), as already Transwell filters, after exposure to P. aeruginosa on the apical side reported by other investigators (12, 26). BAPTA further reduced (Fig. 2). These results provide, to our knowledge, the first evi- the IL-8 mRNA expression in cells silenced for PLCB3 (Fig. 3C), dence that PLCB3 could be one of the components of a signaling but in BAPTA-loaded cells PLCB3, silencing did not reduce IL-8 network involved in the expression of IL-8 in human bronchial expression below the level detected in cells treated with the control epithelial cells exposed to P. aeruginosa. siRNA. These findings suggest two set of conclusions. First, that in

2+ our experimental model, calcium signaling is not completely me- PLCB3 is implicated in Ca -related signaling and activation diated by PLCB3. Notably, IB3-1 and CuFi-1 bronchial epithelial a b of PKC and cells express different PLC isoforms besides the b ones, in particular As with the other PLC isoforms, PLCB3 catalyzes the hydrolysis of PLCg2, PLCd3, and PLCε1, which could participate in activation of phosphatidylinositol 4,5-biphosphate to generate two second mes- calcium transients (Supplemental Fig. 2). Second, that silencing of sengers, 1,2-diacylglycerol (DAG) and inositol 1,4,5-trisphosphate PLCB has an effect only because it reduces calcium signaling, be- (IP3), which in turn activate intracellular calcium transients (23, cause in cells in which calcium is chelated by BAPTA, no further 24). Notably, it has been recently shown that PLCB3 is a critical reduction of IL-8 expression is induced by PLCB3 siRNA. regulator of intracellular Ca2+ in murine macrophages (25). Ex- The role of PLCB3 in intracellular Ca2+ signaling upon in- posure of IB3-1 cells to P. aeruginosa-induced a sustained in- teraction of P. aeruginosa with bronchial epithelial cells was Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 5. P. aeruginosa activates conventional PKC isoforms a and b. Fluorescence signal of GFP- tagged PKC isoforms A, a, B, b, C, d and D, z before and after 30 min from the addition of PAO1 (100 CFU/ cell) to IB3-1 cells. Histograms indicate the intra- cellular localization of PKC isoforms, as increase in fluorescence ratio with respect to time 0 (ratio of translocation from cytosol to plasma membrane or nucleus) as mean 6 SEM for at least seven single cells (see Materials and Methods). Averaging of percent ratio: PKCa +76% 6 11.6; PKCb +114% 6 11.4; PKCd +5% 6 0.8; and PKCz +4% 6 1.0. The Journal of Immunology 4953

2+ studied in some details. The [Ca ]c increase promoted by P. conventional PKC isoforms (27). Activation of PKC was studied aeruginosa was reduced in IB3-1 cells preincubated with PLCB3 by observing the translocation of the recombinant GFP-tagged siRNA (Fig. 4A), although not completely, possibly as a result Ca2+-dependent conventional PKC isoforms a and b to the plas- of a parallel partial reduction of PLCB3 expression. By inducing ma membrane in IB3-1 cells infected with P. aeruginosa. Bacte- 2+ [Ca ]c transients with histamine (causing the generation of inositol rial exposure induced activation of the conventional PKC isoforms 1,4,5 trisphosphate and the consequent release of Ca2+ from the a and b (Fig. 5A,5B), but not of the novel d isoform (Fig. 5C) and ER) in IB3-1 cells expressing the intracellular organelle-targeted of the atypical z isoform (Fig. 5D), the most striking effect being Ca2+-sensitive aequorins, no difference in ER Ca2+ uptake was observed for PKC b, where an average 56.1% of the cells showed observed between silenced PLCB3 and control cells. Indeed, both membrane translocation. By silencing PLCB3 expression, the acti- groups of cells showed very similar luminal ER Ca2+ concen- vation of PKC b was abrogated in the majority of the IB3-1 cells 2+ trations ([Ca ]er) at rest (see left part of Fig. 4B). On the contrary, (Fig. 6A,6B), a residual PKC b activation being observed only we found that silencing PLCB3 reduces the release of Ca2+ from in an average 12.0% of cells exposed to P. aeruginosa. The role of the ER (right part of Fig. 4B,4C). Accordingly, the transient rises PKC activation in the P. aeruginosa- but not TNF-a–dependent 2+ 2+ of [Ca ]c and in the mitochondrial matrix ([Ca ]m) elicited by signaling of our experimental model has been also confirmed by the agonist were smaller in silenced PLCB3 cells compared with the effect of the broad PKC inhibitor BIM-I (Fig. 6C). It has been control cells (Fig. 4D,4E). Signals that elevate intracellular Ca2+ previously shown that P. aeruginosa PAO1 strain activates a Ca2+- and DAG, such as those induced by PLCs, are known to activate dependent activation of the transcription factor NF-kB, which is Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 6. Silencing PLCB3 reduces the activation of PKC-b and of NF-kB p65 induced by P. aeruginosa. IB3-1 cells were transfected with PLCB3 siRNA sequence 1 (A) or scrambled oligonucleotides 24 h before the addition of PAO1 (100 CFU/cell) (B). Images refer to representative experiments of expression of GFP-tagged PKC isoform b before and 30 min after exposure to PAO1. The PKC activator PMA (400 nM) was added to cells not responding to PAO1-dependent translocation as an internal control. Translocation of PKCb from cytosol to membrane was observed in 56.1% of the IB3-1 cells transfected with scrambled sequence (on 57 scrambled cells 32 cells presented PKCb traslocation) and in 12.0% (on 25 PLCB3 siRNA cells only 3 cells presented PKCb traslocation) of cells transfected with PLCB3 siRNA sequence. The histograms indicate the intracellular localization of PKCb, expressed as ratio of translocation from cytosol to plasma membrane. Averaging of percent ratio in silenced cells: after 30 min to PAO +1% 6 10.3 and after treatment with PMA +275% 6 21.5 respect to time 0; in mock cells: after 30 min to PAO +78% 6 24.6. C, IB3-1 cells were preincubated with the PKCs inhibitor BIM-I (2 mM) for 30 min and infected with PAO1 or stimulated with TNF-a for an additional 4 h, before quantitation of IL-8 mRNA by quantified real-time PCR. Data are mean 6 SEM of three separate experiments performed in duplicate. D, Activation of NF-kB p65 in IB3-1 cells transfected with either PLCB3 siRNA sequence 1 or scrambled oligonucleotide for 24 h before exposure to PAO1 (100 CFU/cell) or solvent alone in a lapse of time ranging from 1 to 4 h. Absorbance at 450 nm wavelength is proportional to the activation of NF-kB p65, as performed with the TransAM NF-kB p65 Activation Assay kit. Data are mean 6 SEM of four independent experiments performed in duplicate. 4954 PLCB3, CHEMOTACTIC SIGNALING, AND CYSTIC FIBROSIS critical in the regulation of IL-8 gene transcription also in human IB3-1 cells with apyrase before exposure to P. aeruginosa PAO1 2+ airway epithelial cells (26). Therefore, we tested the role of strain, reduced the sustained increase of [Ca ]c (Fig. 8A), the PLCB3 on the activation of NF-kB p65 induced by PAO1 in IB3-1 activation of PKC isoform b (Fig. 8B,8C) and, more relevantly, cells, with a time course preceding the lapse of time of 4 h chosen the IL-8 mRNA transcription and release of IL-8 protein (Fig. 8D, to measure IL-8 mRNA levels. We confirm that PAO1 pro- 8E). Interestingly, apyrase does not further reduce the P. aerugi- gressively activates NF-kB and that silencing PLCB3 significantly nosa-dependent IL-8 expression (Fig. 8F), suggesting that the reduces the P. aeruginosa-induced activation of NF-kB p65 (Fig. contribution of the purinergic receptor-dependent IL-8 expression 6D). Collectively, these results indicate that PLCB3 plays a rele- is mainly mediated its coupling with PLCB3. This confirms a role vant role in triggering free calcium transients induced by P. aer- of extracellular nucleotides, released upon interaction of P. aer- uginosa in human bronchial epithelial cells, thus regulating the uginosa with IB3-1 bronchial epithelial cells, in the proinflam- activation of the PKCs a and b and of the nuclear transcription matory signaling leading to the expression and secretion of IL-8 factor NF-kB. in our model system.

Extracellular ATP is not sufficient for IL-8 expression but acts Discussion in synergy with TLRs Excessive inflammation in the lungs of patients affected by CF is Interaction of P. aeruginosa with ASGM1R, colocalized with considered a major cause of the lung tissue damage leading to TLR5, is known to promote the release of nucleotides from epi- respiratory insufficiency, and therefore anti-inflammatory drugs are thelial cells, activating an autocrine loop with P2Y2 receptors (11, included within the therapeutic pipeline of the innovative therapies 12). Interestingly, PLCB3 has been shown to be selectively cou- to treat or cure CF lung disease (1). The identification of novel Downloaded from pled to the P2Y2 receptor-dependent activation of intracellular molecular targets in the proinflammatory signaling, which is or- Ca2+ transients in recombinant CHO cells (28). The role of dif- chestrated first by the bronchial epithelial cells on the surface of ferent ligands on the expression of IL-8 has been tested pre- the conductive airways, is presently of paramount importance (2). liminarily. IL-8 transcription was induced, albeit at different ex- To prioritize the relevance of specific molecules within the large tents, after exposing IB3-1 cells to intact P. aeruginosa bacteria of series of different receptors, kinases, phosphatases, phospholipases, strains PAO1 and PAK, to the purified P. aeruginosa bacterial and adaptors regulating the expression of inflammatory genes, we components flagellin and pilin, and to the proinflammatory cyto- chose to apply an association study between genes of the innate http://www.jimmunol.org/ kine TNF-a (Fig. 7A). PAK FliC, a recombinant P. aeruginosa immunity andtheclinicalprogression ofCFlungdisease,byagenetic PAK strain lacking expression of flagellin, induces IL-8 expres- ranking approach. In this respect, the aim of our genetic analysis was sion at a level lower than that observed with PAK (Fig. 7A), not to find the strongest modifier gene(s) for CF lung disease, a task suggesting a strong contribution of bacterial flagellum in this that should be presently pursued by Genome-Wide Association signaling pathway. On the contrary, no significant induction was Studies in much larger cohorts of affected individuals, but to obtain obtained with classical ligands of TLR4 and purinergic receptor hints on the relative clinical relevance within a list of genes selected Y2 (P2Y2R), such as LPS and ATP/UTP, respectively (Fig. 7A). in a family with homogeneous pathophysiological role (e.g., the

Because ATP-dependent induction of IL-8 in bronchial epithelial signaling network of the innate immune response to bacteria in re- by guest on October 1, 2021 cells has been previously described only in association with li- spiratory epithelial cells). Therefore, although the association of gands activating TLRs (29), we tested the effect of ATP on the PLCB3 with clinical progression of lung disease that we found here expression of IL-8 upon stimulation with flagellin, which interacts is quite modest, our genetic ranking approach allowed us to focus on with TLR5. We observed that ATP is not sufficient by itself to PLCB3 to demonstrate its role in regulating the expression of IL-8 induce IL-8 expression, but it is able to potentiate the flagellin- elicited by P. aeruginosa in bronchial epithelial cells. induced one (Fig. 7B). To verify that P. aeruginosa induces an PLCs have been shown to be implicated in different cellular autocrine loop of release of nucleotides, we tested the effect of the responses, due to their role in intracellular calcium homeostasis (for ectonucleotidase apyrase in our model system. Preincubation of review, see Ref. 24). In particular, it was initially proposed that

FIGURE 7. ATP is not sufficient to activate IL-8 mRNA transcription but acts in synergy with TLR-dependent signaling. A, IB3-1 cells were exposed to the P. aeruginosa laboratory strains PAO1, PAK, or PAK FliC (100 CFU/cell), to flagellin (10 mg/ml) and pilin (10 mg/ml) purified from PAK recombinant cells, to LPS (10 mg/ml), to ATP and UTP (1 mM), or to TNF-a (50 ng/ml) for 4 h before extraction of total RNA and measurement of IL-8 mRNA. B, Similarly to A, IB3-1 cells were exposed to ATP or flagellin alone, or to both stimulants together, for 4 h before extraction of total RNA and measurement of IL-8 mRNA. Mean 6 SEM of three independent experiments performed in duplicate. The Journal of Immunology 4955 Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 8. The ectonucleotidase apyrase affects calcium signaling and IL-8 expression induced by P. aeruginosa. The ectonucleotidase apyrase (3 U/ml) was added to IB3-1 cells 2 h before and again together with the addition of PAO1 for an additional 4 h. A, Cytosolic Ca2+ transients by Fura-2/AM assay in IB3-1 cells exposed to PAO1 treated with apyrase (gray trace) or solvent alone (untreated, black trace), n = 8. Activation of PKC isoform b in IB3-1 cells exposed to PAO1 treated with either apyrase (B) or solvent alone (untreated) (C). The PKC activator PMA (400 nM), a Ca2+-independent DAG-like agonist, was added to cells not responding to PAO1-dependent translocation, as an internal control. Translocation of PKCb from cytosol to membrane was observed in 56.1% of the IB3-1 cells mock treated and in 25.9% of cells treated with apyrase (on 27 pretreated apyrase cells only 7 cells presented PKCb tras- location, after PAO1 exposition). Histograms show the intracellular localization of PKCb isoform: averaging of percent ratio in apyrase-treated cells: after 30 min to PAO +8% 6 2.6 and after PMA +89% 6 16.0 respect to time 0; in untreated cells: after 30 min to PAO +61% 6 15.2. D, IL-8 mRNA transcription was quantitated in IB3-1 cells exposed to PAO1 treated with either apyrase or solvent alone. E, As for C, the release of IL-8 protein was measured by ELISA in IB3-1 cells treated with apyrase or solvent alone. Mean 6 SEM of three independent experiments performed in duplicate. F, Apyrase (3 IU/ml) was incubated for 2 h at 37˚C after a preincubation of 24 h with PLCB3 siRNA sequence 1 or scrambled oligonucleotides in IB3-1 cells. An additional 4-h infection with PAO1 strain was performed, and IL-8 transcription was quantified by quantified real-time PCR. Data are mean 6 SEM of three separate experiments performed in duplicate. 4956 PLCB3, CHEMOTACTIC SIGNALING, AND CYSTIC FIBROSIS the PLCB3 isoform is involved in signal transduction triggered engaged by P. aeruginosa, TLRs and ASGM1R have not been by hormones, growth factors, and neurotransmitters (30). As far described as coupled to GTP-binding proteins (35). However, it as its role in inflammatory processes is concerned, PLCB3 has has been previously shown that the interaction of P. aeruginosa been investigated in the context of leukocyte chemotaxis (31). with bronchial epithelial cells induces the release of ATP in the PLCB2- and PLCB3-dependent rise in intracellular calcium has extracellular milieu, which binds to the seven-membrane spanning been shown to regulate T lymphocyte chemotaxis (32). However, P2Y2 purinergic receptors (11, 12). Our results with the ectonu- 2+ PLCB3-deficient neutrophils or macrophages, in which calcium cleotidase apyrase confirm a role of extracellular ATP in the [Ca ]c transients were blunted, did not show reduction of chemotactic increase and report, to our knowledge, for the first time the acti- activity or migration (33, 34), suggesting that PLCB3 is required vation of PKCs a and b by P. aeruginosa in an ATP-dependent for the chemotaxis of T lymphocytes but not neutrophils or mac- manner (Fig. 8). Moreover, silencing experiments reducing cyto- rophages. Because T lymphocytes infiltrate the bronchial walls solic calcium increase and activation of PKC b confirm the in- of CF patients, these early reports established already a possible volvement of PLCB3 in the Ca2+ pathway activated by P. aeruginosa link between PLCB3 and the progression of CF lung disease. (Figs. 4, 6). Thus, these results are consistent with the coupling of Our findings strengthen this notion implicating PLCB3 in reg- P2Y2 purinergic receptors with PLCB3, which is known to involve ulation of IL-8 expression by bronchial epithelial cells and hence Gaq/11 heterotrimeric GTPase protein (28, 35). Because PLCB1 and neutrophil recruitment into the airways. PLCB4 are also able to interact with seven-membrane spanning Bronchial epithelial cells do express different isoforms of PLC receptors, we cannot definitely restrict to PLCB3 the role to mod- that could regulate intracellular calcium homeostasis and, in par- ulate P. aeruginosa-dependent calcium transients in bronchial ep- ticular, IB3-1 and CuFi-1 cells express detectable transcript levels ithelial cells. Interestingly, in murine macrophages, it has been of PLCB1 and PLCB4, PLCG2, PLCD3, and PLCE1, besides shown that UDP can activate cytosolic calcium rise through puri- Downloaded from PLCB3 (Supplemental Fig. 2). How can we explain the specific nergic receptors by using PLCB3 in parallel with PLCB4, whereas contribution of PLCB3 in the proinflammatory signaling induced other ligands, such as C5a, use predominantly PLCB3 (25). Be- by P. aeruginosa in bronchial epithelial cells? Activation of g and cause, in our experimental model, selective silencing of PLCB3 ε isoforms is known to be dependent on tyrosine-kinase–coupled resulted in a consistent, but not total, reduction of intracellular Ca2+- receptors, of the d isoforms on elevation of cytosolic calcium, of dependent expression of IL-8, we cannot exclude a partial contri- the b isoforms on seven-membrane spanning domain receptors bution of the other PLC b isoforms. http://www.jimmunol.org/ through GTP-binding proteins (24). As far as we know, among the Silencing PLCB3 reduces only partially the P. aeruginosa- surface receptors expressed in bronchial epithelial cell that are dependent expression of IL-8 (Figs. 1, 2). This is not surprising by guest on October 1, 2021

FIGURE 9. Model of cooperation of PLCB3 in the P. aeruginosa-dependent signaling in bronchial epithelial cells. The illustration depicts the signaling pathways elicited by TLRs/MyD88 (A) and P2Y2R/PLCB3 (B), based on previous reports from other investigators and the results presented in this paper. A, Binding of P. aeruginosa surface components (flagellin and pilin) with TLR5 and TLR2 triggers a MyD88-dependent proinflammatory signaling cascade, eventually leading to nuclear translocation of NF-kB, which is a critical transcription factor for the expression of IL-8 gene, together with AP-1 and CHOP. TLRs/MyD88 pathway is sufficient to promote transcription of IL-8 gene. Besides exerting this direct effect, P. aeruginosa induces the extracellular release of ATP, possibly via a cooperative interaction of TLR5, TLR2, and ASGM1R. B, Extracellular ATP binds to P2Y2R that activates PLCB3 through the

Gaq,11 heterotrimeric GTPase protein. By degrading phosphatidylinositol 4,5-biphosphate, PLCB3 promotes IP3 release and DAG formation. IP3 triggers 2+ 2+ Ca release from intracellular stores, and the rise of [Ca ]c, together with DAG, promotes intracellular translocation of conventional PKC isoforms a and b, which ultimately cooperate in activation of NF-kB. The P2Y2R/PLCB3 pathway is not sufficient to induce IL-8 transcription by itself but strongly act in synergy with the TLR/MyD88 signaling cascade. CHOP, CREB-homologous protein transcription factor. The Journal of Immunology 4957 in light of the partial efficiency of PLCB3 silencing and of the Acknowledgments evidence that P. aeruginosa activates the inflammatory response We thank the patients affected by CF who participated in this study, the because of its capability to interact with multiple receptors, in- North American GMSG who contributed to the collection of the DNA sam- cluding TLRs and ASGM1Rs (36). Thus, the ATP–P2Y2R auto- ples and the clinical classification of the CF patients, A. Klingelhutz, crine loop that generates intracellular Ca2+-signaling should be P. Karp, and J. Zabner (University of Iowa, Iowa City, IA) for CuFi cells, considered only one of the pathways regulating IL-8 expression, in A. Prince (Columbia University, New York, NY) for P. aeruginosa labo- parallel with those elicited by TLRs via MyD88-dependent sig- ratory strains, M. Cristina Dechecchi (Verona, Italy) for helpful discussion, nals. We observed a significant reduction of IL-8 mRNA expres- and Federica Quiri and Valentina Lovato (Verona) for excellent technical assistance. sion with the intracellular Ca2+ chelator BAPTA (Fig. 3), whereas direct stimulation of IB3-1 cells with P2Y2 ligands, such as ATP or UTP, that are known to stimulate directly cytosolic Ca2+ tran- Disclosures sients were not sufficient to induce transcription of IL-8 mRNA The authors have no financial conflicts of interest. (Fig.7), as previously observed by other investigators (29). This apparent discrepancy can be explained observing that the addition References of ATP to the TLR5/2 and ASGM1R ligand flagellin increases IL- 1. Ashlock, M. A., R. J. Beall, N. M. Hamblett, M. W. Konstan, C. M. Penland, 8 mRNA expression (Fig. 7), thus suggesting that the intracellular B. W. Ramsey, J. M. Van Dalfsen, D. R. Wetmore, and P. W. Campbell, III. 2009. calcium signaling triggered by purinergic receptors upon release A pipeline of therapies for cystic fibrosis. Semin. Respir. Crit. Care Med. 30: 611–626. of ATP, albeit not sufficient by itself to completely activate the 2. Nichols, D. P., M. W. Konstan, and J. F. Chmiel. 2008. Anti-inflammatory transcription machinery for IL-8 expression, works in synergy therapies for cystic fibrosis-related lung disease. Clin. Rev. Allergy Immunol. 2+ 35: 135–153. Downloaded from with TLRs-mediated signaling. As further evidence that Ca 3. Welsh, M. J., B. W. Ramsey, F. J. Accurso, and G. R. Cutting. 2001. Cystic fi- signaling mediated by PLCB3 is indeed relevant to regulate IL-8 brosis. In The Metabolic and Molecular Bases of Inherited Disease. C. R. expression, we observed that silencing of PLCB3 significantly Scriver, A. L. Beaudet, W. S. Sly, and D. Valle, eds. McGraw-Hill, New York, NY, p. 5121–5188. reduced the activation of the NF-kB (Fig. 6), which plays a critical 4. Elizur, A., C. L. Cannon, and T. W. Ferkol. 2008. Airway inflammation in cystic role in the induction of IL-8 transcription (19, 29). On the basis fibrosis. Chest 133: 489–495. of these and previous findings (11, 12), we conclude that in the 5. Bonfield, T. L., J. R. Panuska, M. W. Konstan, K. A. Hilliard, J. B. Hilliard,

2+ H. Ghnaim, and M. Berger. 1995. Inflammatory cytokines in cystic fibrosis http://www.jimmunol.org/ CF airway tract chronically infected with P. aeruginosa, the Ca - lungs. Am. J. Respir. Crit. Care Med. 152: 2111–2118. dependent pathway induced by the release of nucleotides acti- 6. Khan, T. Z., J. S. Wagener, T. Bost, J. Martinez, F. J. Accurso, and D. W. Riches. vates, through binding to P2Y2R, PLCB3, and amplifies the innate 1995. Early pulmonary inflammation in infants with cystic fibrosis. Am. J. Respir. Crit. Care Med. 151: 1075–1082. defense signaling based on TLRs and ASGM1R. The illustration 7. Noah, T. L., H. R. Black, P. W. Cheng, R. E. Wood, and M. W. Leigh. 1997. reported in Fig. 9 summarizes our working hypothesis. Nasal and bronchoalveolar lavage fluid cytokines in early cystic fibrosis. J. In- fect. Dis. 175: 638–647. The biological importance of intracellular calcium homeostasis 8. Hillian, A. D., D. Londono, J. M. Dunn, K. A. Goddard, R. G. Pace, in bronchial epithelial cells in the CF lung disease has been widely M. R. Knowles, M. L. Drumm; CF Gene Modifier Study Group. 2008. Modu- debated. For instance, it has been proposed that the defective lation of cystic fibrosis lung disease by variants in interleukin-8. Genes Immun. 9: 501–508. chloride transport due to the mutated CFTR protein can be over-

9. Muhlebach, M. S., W. Reed, and T. L. Noah. 2004. Quantitative cytokine gene by guest on October 1, 2021 come by activating alternative Ca2+-dependent chloride channels, expression in CF airway. Pediatr. Pulmonol. 37: 393–399. such as those recently identified (37, 38). Independent of the 10. Kawai, T., and S. Akira. 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol. 11: 373–384. presence of a constitutive inflammation in CF bronchial epithelial 11. McNamara, N., A. Khong, D. McKemy, M. Caterina, J. Boyer, D. Julius, and cells, in which alteration of Ca2+ homeostasis might not play C. Basbaum. 2001. ATP transduces signals from ASGM1, a glycolipid that functions as a bacterial receptor. Proc. Natl. Acad. Sci. USA 98: 9086–9091. a role (38), when chronic bacterial infection intervenes in the first 12. Adamo, R., S. Sokol, G. Soong, M. I. Gomez, and A. Prince. 2004. Pseudomonas 2+ decades of life, the Ca signaling in the bronchial epithelial cells aeruginosa flagella activate airway epithelial cells through asialoGM1 and Toll- greatly amplifies the recruitment and transepithelial migration of like receptor 2 as well as Toll-like receptor 5. Am. J. Respir. Cell Mol. Biol. 30: 627–634. leukocytes, first of all polymorphonuclear neutrophils (39), that 13. McNamara, N., M. Gallup, A. Sucher, I. Maltseva, D. McKemy, and are considered unwilling actors of the progressive destruction of C. Basbaum. 2006. AsialoGM1 and TLR5 cooperate in flagellin-induced nu- cleotide signaling to activate Erk1/2. Am. J. Respir. Cell Mol. Biol. 34: 653–660. CF lung tissue (2). Thus, in the advanced stages of CF lung dis- 14. Garred, P., T. Pressler, H. O. Madsen, B. Frederiksen, A. Svejgaard, N. Høiby, ease characterized by chronic bacterial infection, intracellular M. Schwartz, and C. Koch. 1999. Association of mannose-binding lectin gene Ca2+ signals are known to induce ER Ca2+ store expansion leading heterogeneity with severity of lung disease and survival in cystic fibrosis. J. Clin. Invest. 104: 431–437. to an overt hyper-inflammatory phenotype, with inappropriate re- 15. Drumm, M. L., M. W. Konstan, M. D. Schluchter, A. Handler, R. Pace, F. Zou, lease of chemokines and cytokines, that amplifies the recruitment M. Zariwala, D. Fargo, A. Xu, J. M. Dunn, et al; Gene Modifier Study Group. and activation of leukocytes (40). 2005. Genetic modifiers of lung disease in cystic fibrosis. N. Engl. J. Med. 353: 1443–1453. The inexorable decline of the lung function in patients affected 16. Gu, Y., I. T. Harley, L. B. Henderson, B. J. Aronow, I. Vietor, L. A. Huber, by CF is presently faced with different approaches directed to- J. B. Harley, J. R. Kilpatrick, C. D. Langefeld, A. H. Williams, et al. 2009. ward the mutated CFTR protein, alternative chloride channels, Identification of IFRD1 as a modifier gene for cystic fibrosis lung disease. Nature 458: 1039–1042. novel anti-inflammatory and anti-infective drugs (1). Consensus 17. Zeitlin, P. L., L. Lu, J. Rhim, G. Cutting, G. Stetten, K. A. Kieffer, R. Craig, and is growing on that effective causative therapies, when available, W. B. Guggino. 1991. A cystic fibrosis bronchial epithelial cell line: immor- talization by adeno-12-SV40 infection. Am. J. Respir. Cell Mol. Biol. 4: 313– should be initiated as soon as possible, to prevent the onset of pul- 319. monary complications. However, in patients who already developed 18. Zabner, J., P. Karp, M. Seiler, S. L. Phillips, C. J. Mitchell, M. Saavedra, bacterial infection, a novel anti-inflammatory approach directed M. Welsh, and A. J. Klingelhutz. 2003. Development of cystic fibrosis and noncystic fibrosis airway cell lines. Am. J. Physiol. Lung Cell. Mol. Physiol. 284: toward the specific pathophysiology of infected CF lungs should L844–L854. be taken into consideration. In this respect, PLCB3, which rele- 19. Bezzerri, V., M. Borgatti, E. Nicolis, I. Lampronti, M. C. Dechecchi, I. Mancini, 2+ P. Rizzotti, R. Gambari, and G. Cabrini. 2008. Transcription factor oligodeox- vantly regulates the extracellular nucleotide-cytosolic Ca sig- ynucleotides to NF-kB inhibit transcription of IL-8 in bronchial cells. Am. J. naling axis potentiating the TLRs signaling cascade, represents a Respir. Cell Mol. Biol. 39: 86–96. novel pharmacological target to attenuate the excessive recruit- 20. Smith, K. D., E. Andersen-Nissen, F. Hayashi, K. Strobe, M. A. Bergman, S. L. Barrett, B. T. Cookson, and A. Aderem. 2003. Toll-like receptor 5 rec- ment of neutrophils without completely abolishing the inflam- ognizes a conserved site on flagellin required for protofilament formation and matory response. bacterial motility. Nat. Immunol. 4: 1247–1253. 4958 PLCB3, CHEMOTACTIC SIGNALING, AND CYSTIC FIBROSIS

21. Castric, P. 1995. pilO, a gene required for glycosylation of Pseudomonas aer- 31. Van Haastert, P. J., and P. N. Devreotes. 2004. Chemotaxis: signalling the way uginosa 1244 pilin. Microbiology 141: 1247–1254. forward. Nat. Rev. Mol. Cell Biol. 5: 626–634. 22. Pinton, P., A. Rimessi, A. Romagnoli, A. Prandini, and R. Rizzuto. 2007. Bio- 32. Bach, T. L., Q. M. Chen, W. T. Kerr, Y. Wang, L. Lian, J. K. Choi, D. Wu, sensors for the detection of calcium and pH. Methods Cell Biol. 80: 297–325. M. G. Kazanietz, G. A. Koretzky, S. Zigmond, and C. S. Abrams. 2007. Phos- 23. Katan, M. 1998. Families of phosphoinositide-specific phospholipase C: struc- pholipase cb is critical for T cell chemotaxis. J. Immunol. 179: 2223–2227. ture and function. Biochim. Biophys. Acta 1436: 5–17. 33. Li, Z., H. Jiang, W. Xie, Z. Zhang, A. V. Smrcka, and D. Wu. 2000. Roles of 24. Suh, P. G., J. I. Park, L. Manzoli, L. Cocco, J. C. Peak, M. Katan, K. Fukami, PLC-b2 and -b3 and PI3Kg in chemoattractant-mediated signal transduction. T. Kataoka, S. Yun, and S. H. Ryu. 2008. Multiple roles of phosphoinositide- Science 287: 1046–1049. specific phospholipase C isozymes. BMB Rep 41: 415–434. 34. Wang, Z., B. Liu, P. Wang, X. Dong, C. Fernandez-Hernando, Z. Li, T. Hla, 25. Roach, T. I., R. A. Rebres, I. D. Fraser, D. L. Decamp, K. M. Lin, Z. Li, K. Claffey, J. D. Smith, and D. Wu. 2008. Phospholipase Cb3 deficiency P. C. Sternweis, M. I. Simon, and W. E. Seaman. 2008. Signaling and cross-talk leads to macrophage hypersensitivity to apoptotic induction and reduction of by C5a and UDP in macrophages selectively use PLCb3 to regulate intracellular atherosclerosis in mice. J. Clin. Invest. 118: 195–204. free calcium. J. Biol. Chem. 283: 17351–17361. 35. Wettschureck, N., and S. Offermanns. 2005. Mammalian G proteins and their 26. Ratner, A. J., R. Bryan, A. Weber, S. Nguyen, D. Barnes, A. Pitt, S. Gelber, cell type specific functions. Physiol. Rev. 85: 1159–1204. A. Cheung, and A. Prince. 2001. Cystic fibrosis pathogens activate Ca2+- 36. Prince, A. 2006. Flagellar activation of epithelial signaling. Am. J. Respir. Cell dependent mitogen-activated protein kinase signaling pathways in airway epi- Mol. Biol. 34: 548–551. thelial cells. J. Biol. Chem. 276: 19267–19275. 37. Caputo, A., E. Caci, L. Ferrera, N. Pedemonte, C. Barsanti, E. Sondo, U. Pfeffer, 27. Newton, A. C. 2003. Regulation of the ABC kinases by phosphorylation: protein R. Ravazzolo, O. Zegarra-Moran, and L. J. Galietta. 2008. TMEM16A, a mem- kinase C as a paradigm. Biochem. J. 370: 361–371. brane protein associated with calcium-dependent chloride channel activity. 28. Strassheim, D., and C. L. Williams. 2000. P2Y2 purinergic and M3 muscarinic Science 322: 590–594. acetylcholine receptors activate different phospholipase C-b isoforms that are 38. Clunes, M. T., and R. C. Boucher. 2008. Front-runners for pharmacotherapeutic uniquely susceptible to protein kinase C-dependent phosphorylation and in- correction of the airway ion transport defect in cystic fibrosis. Curr. Opin. activation. J. Biol. Chem. 275: 39767–39772. Pharmacol. 8: 292–299. 29. Fu, Z., K. Bettega, S. Carroll, K. R. Buchholz, and T. E. Machen. 2007. Role of 39. Chun, J., and A. Prince. 2009. Ca2+ signaling in airway epithelial cells facilitates Ca2+ in responses of airway epithelia to Pseudomonas aeruginosa, flagellin, ATP, leukocyte recruitment and transepithelial migration. J. Leukoc. Biol. 86: 1135– and thapsigargin. Am. J. Physiol. Lung Cell. Mol. Physiol. 292: L353–L364. 1144. 30. Lagercrantz, J., E. Carson, C. Phelan, S. Grimmond, A. Rose´n, E. Dare´, 40. Ribeiro, C. M., A. M. Paradiso, U. Schwab, J. Perez-Vilar, L. Jones, W. O’neal, Downloaded from 2+ M. Nordenskjo¨ld, N. K. Hayward, C. Larsson, and G. Weber. 1995. Genomic and R. C. Boucher. 2005. Chronic airway infection/inflammation induces a Ca i- organization and complete cDNA sequence of the human phosphoinositide- dependent hyperinflammatory response in human cystic fibrosis airway epithelia. specific phospholipase Cb3 gene (PLCB3). Genomics 26: 467–472. J. Biol. Chem. 280: 17798–17806. http://www.jimmunol.org/ by guest on October 1, 2021

SUPPLEMENTAL DATA

Bezzerri et al.

Table S1: Candidate genes

abbreviation gene name

• Chemokines CXCL2 GRO – beta CXCL3 GRO – gamma CC chemokine L1 CCL1 CCL2 MCP-1 CCL3 MIP-1alpha CCL4 MIP-1beta CCL7 MCP-3 CCL8 MCP-2 CCL11 eotaxin CCL13 MCP-4 CCL23 MIP-3 CCL24 eotaxin-2 CCL26 eotaxin-3 CXCL10 IP-10 CXCL11 I-TAC CXCL13 Angie CXCL14 MIP-2gamma

• Receptors for chemokines CXCR1 CXC 1 receptor (also IL-8 receptor) CXCR2 CXC 2 receptor (also IL-8/GRO-a receptor) CXCR7 CXC receptor 7 CCR1 C-C receptor 1 CCR3 C-C receptor 3 CCR6 C-C receptor 6 CCR7 C-C receptor 7 CCR9 C-C receptor 9 CCRL2 C-C receptor-like 2 FPRL1 FMLP-R-II or lipoxin A4-R

• Adhesion molecules ICAM-1 Intercellular adhesion molecule 1 VCAM-1 Vascular adhesion protein 1

1 • Receptors involved in host – pathogen interactions TLR2 Toll-like Receptor 2 TLR4 Toll-like Receptor 4 TLR5 Toll-like Receptor 5

• Cytokines IL-1A Interleukin 1 alpha IL-1B Interleukin 1 beta IL-4 Interleukin 4 IL-6 Interleukin 6 IL-17C Interleukin 17C IL-18 Interleukin 18 TNFA Tumor Necrosis Factor alpha

• Purinergic receptors P2RY1 P2Y receptor 1 P2RY2 P2Y receptor 2

• Antimicrobial peptides HNP4 Human Alpha defensin 4 HBD-1 Human Beta Defensin-1 CG Catepsin G AZU1 Azurocidin

• System components generating reactive oxygen and nitrogen species p40Phox SH3 and PX domain-containing protein 4 p67Phox NADPH oxidase activator 2 NOX1 NADPH oxidase 1 variant NOH-1L NOX2 NADPH oxidase 2 NOX3 NADPH oxidase catalytic subunit-like 3 NOX4 Kidney superoxide-producing NADPH oxidase NOX5 NADPH oxidase 5 NOS1 Nitric oxide synthase 1 NOS2 Nitric oxide synthase 2 NOS3 Nitric oxide synthase 3 DUOX1 Flavoprotein NADPH oxidase 1 DUOX2 Flavoprotein NADPH oxidase 2 DUOXA1 Dual oxidase maturation factor 1 LPO Lactoperoxydase

Transmembrane signaling in pro-inflammatory pathways: PI3K (PI3-K catalytic/regulatory subunits and AKT) PIK3R5 Phosphoinositide 3-kinase p101 class Ib regulatory subunit PIK3CA Phosphoinositide 3-kinase p110 alpha, class Ia catalytic subunit PIK3CB Phosphoinositide 3-kinase p110 beta, class Ia catalytic

2 subunit PIK3CD Phosphoinositide 3-kinase p110 delta, class Ia catalytic subunit PIK3R1 Phosphoinositide 3-Kinase p50 alpha regulatory subunit PI3K p85 Phosphoinositide 3-Kinase p85 alpha regulatory subunit alpha PI3K p85 beta Phosphoinositide 3-Kinase p85 beta catalytic subunit PI3Kgamma Phosphoinositide 3-kinase gamma catalytic subunit AKT1 RAC-alpha serine/threonine-protein kinase AKT2 RAC-beta serine/threonine-protein kinase AKT3 RAC-gamma serine/threonine-protein kinase

• Transmembrane signaling in pro-inflammatory pathways: MAP kinases MAPK14 p38 alpha MAPK11 p38 beta MAPK13 p38 delta MAPK8 Jnk1 MAPK9 Jnk2 MAPK10 Jnk3 MAPK1 ERK2

• Transmembrane signaling in pro-inflammatory pathways: Cytoplasmatic Tyrosin Kinases SRC tyrosine-protein kinase SRC-1 FYN tyrosine-protein kinase Fyn YES proto-oncogene tyrosine-protein kinase YES LYN tyrosine-protein kinase Lyn HCK tyrosine-protein kinase HCK FGR proto-oncogene tyrosine-protein kinase FGR LCK tyrosine-protein kinase Lck ABL tyrosine-protein kinase ABL1 BMX epithelial and endothelial tyrosine kinase TEC tyrosine-protein kinase Tec ZAP-70 zeta-chain associated protein kinase, 70kD FAK1 protein-tyrosine kinase 2 FAK2 protein tyrosine kinase 2 beta CSK tyrosine-protein kinase CSK

• Transmembrane signaling in pro-inflammatory pathways: nuclear transcription factor NF-kB TRAF1 TNF receptor-associated factor 1 TRAF2 TNF receptor-associated factor 2 TRAF3 TNF receptor-associated factor 3 TRAF4 TNF receptor-associated factor 4 TRAF5 TNF receptor-associated factor 5 TRAF6 TNF receptor-associated factor 6 IRAK1 Interleukin-1 Receptor Associated Kinase 1

3 IRAK2 Interleukin-1 Receptor Associated Kinase 2 IRAK4 Interleukin-1 Receptor Associated Kinase 4 NFKBIA Nuclear Factor of kappa light polypeptide gene enhancer in B cell - inhibitor alpha NFKBIB Nuclear Factor of kappa light polypeptide gene enhancer in B cell - inhibitor beta NFKBIE Nuclear Factor of kappa light polypeptide gene enhancer in B cell - inhibitor epsilon CHUK Conserved helix-loop-helix ubiquitous kinase IKBKB Inhibitor of k light polypeptide gene enhancer in B cell kinase beta

• Transmembrane signaling in pro-inflammatory pathways: Small GTPases with their molecular targets HRAS V-Ha-RAS (Harvey rat sarcoma viral oncogene homolog) NRAS Neuroblastoma RAS viral (V-RAS) ncogène homolog RHOA RAS Homolog gene family member A RHOC RAS Homolog gene family member C RHOG RAS Homolog gene family member G RAC1 RAS-related C3 botulinum toxin substrate 1 RAC2 RAS-related C3 botulinum toxin substrate 2 CDC42 Cell division cycle 42 ROCK1 Rho-Associated coiled-call containing protein K1 ROCK2 Rho-Associated coiled-call containing protein K2 PAK1 P21 protein-activated kinase 1 PAK2 P21 protein-activated kinase 2

• Transmembrane signaling in pro-inflammatory pathways: Phospholipases PLA2G2A Phospholipase A2, group IIA PLA2G2D Phospholipase A2, group IId PLA2G2E Phospholipase A2, group IIe PLA2G2F Phospholipase A2, group IIf PLA2G3 Phospholipase A2, group III PLA2G4A Phospholipase A2, group IVa PLA2G4B Phospholipase A2, group IVB PLA2G4C Phospholipase A2, group IVC PLCB1 Phospholipase C beta1 PLCB2 Phospholipase C beta2 PLCB3 Phospholipase C beta3 PLCB4 Phospholipase C beta4 PLCD1 Phospholipase C delta1 PLCD3 Phospholipase C delta3 PLCD4 Phospholipase C delta4 PLCE Phospholipase C epsilon PLCG1 Phospholipase C gamma1 PLCG2 Phospholipase C gamma2

4

Table S2 Single Nucleotide Polymorphisms (SNPs) selected

Chr Gene_symbol (Gene_ID) SNP_Name Location 1 AKT3 (10000) rs4518884 intron rs1538773 intron rs9428576 flanking_3UTR rs1121276 intron CDC42 (998) rs2268177 intron FGR (2268) rs2231878 coding rs35334091 coding LCK (3932) rs11576032 coding rs11567841 coding rs695161 intron NCF2 (4688) / p67 Phox rs35012521 coding rs13306575 coding rs17849502 coding rs35937854 coding rs13306581 coding rs11578964 intron rs10911363 intron rs789185 intron NRAS (4893) rs969273 intron rs14804 3UTR PIK3CD (5293) rs28730673 coding rs4240910 intron rs1135427 3UTR rs4240896 intron rs9430220 intron rs6540991 intron PLA2G2A (5320) rs34568801 coding rs1804275 coding PLA2G2D (26279) rs584367 coding PLA2G2E (30814) rs877064 intron PLA2G2F (64600) rs11582551 intron PLA2G4A (5321) rs12720588 coding rs2307198 coding RHOC (389) rs2999156 intron rs12144044 intron TLR5 (7100) rs7512943 coding rs5744176 coding rs5744175 coding rs5744171 coding rs5744168 coding rs4140966 coding rs5744167 coding 5 rs5744166 coding rs764535 coding TRAF5 (7188) rs3946808 coding rs2271458 coding rs4951523 intron rs10494936 intron rs6672742 intron VCAM1 (7412) rs34228330 coding rs34708918 coding rs3783611 coding rs3783612 coding rs34199378 coding rs3783615 coding rs3917012 intron rs3176877 intron rs3176861 intron rs3181088 intron rs3176860 intron 2 CXCR7 (57007) rs10183022 intron rs7585641 intron rs1045879 coding IL1A (3552) rs3783531 coding rs3783550 intron IL1B (3553) rs1143634 coding rs1143643 intron IL8RA (3577) / CXCR1 rs16858811 coding IL8RB (3579) / CXCR2 rs10201766 coding rs1126579 3UTR PLCD4 (84812) rs658378 intron ROCK2 (9475) rs34945852 coding rs35768389 coding rs9808232 coding rs13397757 intron rs10194620 intron rs6730673 intron rs4669702 intron rs4477886 intron ZAP70 (7535) rs3192177 coding 3 CCR1 (1230) rs6781048 coding rs41413045 coding rs41393844 coding 3 CCR3 (1232) rs41276533 coding rs9854776 intron rs6441948 intron rs9853223 intron rs3091309 intron 3 CCR9 (10803) rs12721497 coding rs9862611 intron 6 rs7614342 intron 3 CCRL2 (9034) rs6441977 coding 3 CXCR6 (10663) rs2234355 coding rs2234356 coding rs2234357 coding rs2234358 3UTR rs936939 intron rs3774634 intron 3 IRAK2 (3656) rs35060588 coding rs11465910 coding rs11465930 coding rs2302859 intron rs6442159 intron rs155266 intron rs1177614 intron rs11465897 intron rs11706450 intron rs11465853 intron rs263413 intron rs2619508 intron rs1642736 intron rs1169670 intron rs3844279 intron rs708030 intron rs776514 intron rs1144911 intron 3 P2RY1 (5028) rs701265 coding 3 PAK2 (5062) rs9877495 intron rs2084382 intron rs7626440 intron rs6583177 intron rs11923075 intron rs9222 3UTR rs7649045 intron rs4916555 intron rs6583176 intron rs2686600 intron 3 PIK3CA (5290) rs17849072 coding rs41273621 coding rs2699905 intron rs2677760 intron rs1607237 intron rs6443624 intron 3 PIK3CB (5291) rs558905 intron rs10513055 intron 3 PLCD1 (5333) rs9837637 coding rs933135 coding rs2268749 intron 7 rs9857730 coding 3 RHOA (387) rs11706370 intron 4 CXCL10 (3627) rs1126858 coding rs4859586 intron CXCL11 (6373) rs4859596 coding rs7436646 3UTR CXCL13 (10563) rs355674 intron rs355686 intron rs355667 intron rs920666 intron rs355689 intron rs1500500 intron CXCL2 (2920) rs9131 3UTR rs6832638 coding CXCL3 (2921) rs370655 intron MAPK10 (5602) / JNK3 rs2904100 intron rs17451306 intron rs17417758 intron rs4487330 intron rs10516763 intron rs9884282 intron rs4693141 intron rs7665868 intron rs10009993 intron rs12507758 intron rs6815306 intron rs1460769 intron rs1436529 intron rs17418221 intron rs1460767 intron SLAIN2 (57606) rs10938526 flanking_5UTR SPP1 (6696) rs9138 3UTR TEC (7006) rs35374286 coding rs2089511 intron rs17574847 flanking_5UTR rs17470919 intron rs2704425 intron rs7687704 intron rs17574371 coding rs4695356 intron rs2704421 intron rs12643804 flanking_5UTR rs11725773 intron rs2664019 intron rs2704423 intron TLR2 (7097) rs5743699 coding rs5743702 coding rs5743703 coding 8 rs5743704 coding rs3804099 coding rs11938228 intron rs1898830 intron 5 CXCL14 (9547) rs1016666 intron rs2237062 intron rs1148360 intron IL4 (3565) rs4986964 coding rs2227282 intron MAPK9 (5601) / JNK2 rs35693958 coding rs35421153 coding rs17627536 intron rs4481314 intron rs3111515 intron rs6868333 intron rs6863088 intron rs4147385 intron PIK3R1 (5295) rs3730089 coding rs6863431 intron rs1819987 intron rs251409 intron rs34306 intron rs6881033 intron rs251408 intron rs1445760 intron rs251406 intron rs4122269 intron rs12652661 intron rs1823023 intron rs173702 intron 6 CCR6 (1235) rs17860852 coding rs1571878 intron rs3093012 intron rs3093009 intron rs2071171 coding rs1855025 intron rs3093010 intron FYN (2534) rs28763975 coding rs6568704 intron rs6933144 intron rs804188 intron rs11963612 intron rs13192832 intron rs12910 UTR rs804192 intron rs927010 intron rs13218316 intron rs1621289 intron 9 rs706862 intron rs1327200 intron rs7768046 flanking_5UTR rs706895 intron MAPK13 (5603) / p38delta rs2071864 intron MAPK14 (1432) / p38alpha rs851010 intron rs3804454 intron rs851006 intron NFKBIE (4794) rs35500460 coding rs730775 intron NOX3 (50508) rs3749930 coding rs13207865 intron rs231960 intron rs231955 intron rs231961 intron rs6935359 intron rs6557421 intron rs12196156 intron rs231944 intron rs231947 intron rs1016259 intron rs2235675 intron rs9371890 intron rs9478652 intron rs231948 intron rs438239 intron rs2235674 intron TNF (7124) rs35131721 coding rs11574936 coding 7 CCL24 (6369) rs2302004 intron CCL26 (10344) rs11465333 coding rs41341147 coding rs41463245 coding rs2302009 3UTR IL6 (3569) rs11544633 coding rs2069840 intron NOS3 (4846) rs3918166 coding rs1799983 coding rs41508746 coding rs3918201 coding rs1800783 intron rs3918188 intron PIK3CG (5294) rs17847825 coding rs28763989 coding rs28763991 coding rs4730205 intron rs4460309 intron rs12536620 intron 10 RAC1 (5879) rs3729790 intron rs702484 intron 8 DEFA4 (1669) rs2239668 intron DEFB1 (1672) rs2977779 intron IKBKB (3551) rs6991366 coding rs2272736 coding rs17875749 coding rs34309584 coding rs10958713 intron rs3747811 intron rs5029748 intron LYN (4067) rs907424 intron rs2668015 intron rs16922502 intron rs2292419 intron rs4436100 intron rs2719245 intron rs1027990 intron rs7834615 intron rs10282821 intron rs7828258 intron rs2668021 intron rs7829816 intron rs333616 intron rs13249338 intron rs7005312 intron rs6983130 intron PTK2 (5747) / FAK1 rs4563941 intron rs12156014 intron rs10109684 intron rs6993266 intron rs7839119 intron rs13270490 intron rs13257119 intron rs7827949 intron PTK2B (2185) / FAK2 rs41276291 coding rs35174236 coding rs751019 coding rs41276293 coding rs7000615 intron rs11995441 intron rs1019832 intron rs17057051 intron rs2322599 intron rs10086852 intron rs10097861 intron 9 ABL1 (25) rs34549764 coding rs2229071 coding 11 rs10901275 intron rs2791738 intron rs2855172 intron rs12005009 intron rs10901285 intron rs11788639 intron rs2791743 intron rs2855171 intron TLR4 (7099) rs5030718 coding rs5030719 coding rs34953464 coding rs5030720 coding rs5030722 coding rs5030723 coding rs5030724 coding rs5030728 intron rs1927911 intron TRAF1 (7185) rs36084135 coding rs34119250 coding rs7021049 intron TRAF2 (7186) rs10870140 intron rs2784081 intron rs4880073 intron rs10781522 intron 10 CHUK (1147) / IKKalpha rs2230804 coding rs36065428 coding rs11597086 intron MAPK8 (5599) / JNK1 rs7086275 intron rs12358297 intron rs10508901 intron PLCE1 (51196) rs17508082 coding rs17417407 coding rs11596200 coding rs12768416 coding rs11187829 coding rs2274224 coding rs41291138 coding rs3765524 coding rs2274223 coding rs7917353 intron rs10882416 intron rs7919320 intron rs2689698 intron rs11187820 intron rs9663362 intron rs1223635 intron rs11187792 intron rs11187851 intron 12 rs2689694 intron rs17415514 intron rs17109869 intron rs2797992 intron rs12769135 intron rs2797986 intron rs17416616 intron rs4918082 intron rs1858608 intron rs2077218 intron 11 IL18 (3606) rs5744258 intron rs549908 coding NOX4 (50507) rs317139 coding rs10765208 intron rs317155 intron rs3793973 intron rs12799930 intron rs497279 intron P2RY2 (5029) rs3741156 coding rs1783596 coding PAK1 (5058) rs35345144 coding rs2250647 intron rs478134 intron PLCB3 (5331) rs35169799 coding rs3815362 intron rs2244625 coding RHOG (391) rs1451722 intron rs1349542 intron rs10835184 intron rs10835182 intron TRAF6 (7189) rs34320471 coding rs5030419 intron 12 IRAK4 (51135) rs4251469 coding rs4251583 coding rs4251545 coding rs4251513 intron 12 KRAS (3845) rs4368021 intron rs12226937 intron rs12579073 intron rs10842514 intron 12 NOS1 (4842) rs9658482 coding rs9658445 coding rs41356652 coding rs9658356 coding rs4519169 coding rs9658279 coding rs2291908 intron rs7977109 intron 13 rs3782218 intron rs816361 intron rs693534 intron rs3782221 intron rs1123425 intron rs12578547 intron rs547954 intron rs6490121 intron rs545654 intron 14 AKT1 (207) rs1130214 5UTR CTSG (1511) / catepsin G rs11623400 intron NFKBIA (4792) rs696 3UTR TRAF3 (7187) rs7154305 intron rs12878111 intron rs10137035 intron 15 CSK (1445) rs34866753 coding rs34616395 coding rs35556162 coding rs2301249 intron rs1378942 intron DUOX1 (53905) rs1648305 intron rs16939752 coding rs2458236 coding DUOX2 (50506) rs269866 intron rs269868 coding DUOXA1 (90527) rs1648281 UTR NOX5 (79400) rs34406284 coding rs12907196 coding rs2277553 coding rs2277552 coding rs7167318 coding rs7168025 coding rs12899318 intron rs371352 intron rs4777102 intron PLA2G4B (8681) rs7174710 coding rs2290552 coding PLCB2 (5330) rs936212 coding rs9972332 coding rs8025153 coding rs2305650 intron rs936213 intron rs1123487 intron rs1869901 intron 16 IL17C (27189) rs2254073 intron PLCG2 (5336) rs9936371 coding rs17537869 coding rs3935625 coding 14 rs8063604 intron rs12716922 intron rs8054878 intron rs4405545 intron rs7189843 intron rs8043619 intron rs4077853 intron rs1143686 coding rs9928191 intron rs12444459 intron rs4580153 intron rs4889384 intron rs4243225 intron rs3936112 intron rs3934956 intron rs9938212 intron rs9932716 intron rs4580154 intron rs13333420 intron rs8055576 intron rs3922849 intron rs6564928 intron rs12444401 intron rs4888182 intron 17 CCL1 (6346) rs2282691 intron CCL11 (6356) rs34262946 coding rs1860184 intron CCL13 (6357) rs3136677 coding rs34566308 coding rs159313 intron CCL2 (6347) rs4586 coding CCL23 (6368) rs1003645 coding CCL3 (6348) rs1130371 coding CCL4 (6351) rs1719152 coding rs1634517 intron CCL7 (6354) rs3091321 intron rs41362546 coding CCL8 (6355) rs1133763 coding rs34202026 coding CCR7 (1236) rs2023906 intron LPO (4025) rs7219860 intron rs11868650 intron rs2301870 coding NOS2A (4843) rs2314808 coding rs28944173 coding rs2297518 coding rs944725 intron rs9906835 intron 15 rs4795067 intron rs8072199 intron rs3729508 intron PIK3R5 (23533) / p101 rs419849 intron rs181531 intron rs12945251 intron rs394811 coding rs16957702 coding PLCD3 (113026) rs734921 coding rs34721135 coding rs3744760 intron rs1052169 3UTR rs713101 coding TRAF4 (9618) rs35932778 coding rs35100992 coding rs2070265 coding 18 ROCK1 (6093) rs2663698 coding rs1045142 coding rs35881519 coding rs2292296 coding rs2271255 coding rs8085654 intron rs288980 intron rs2663695 intron rs1481280 intron YES1 (7525) rs35126906 coding rs34580680 coding rs1060922 3UTR rs3897601 flanking_5UTR rs8093865 flanking_5UTR 19 AKT2 (208) rs35817154 coding rs12460555 intron AZU1 (566) rs12460890 coding FPR1 (2357) / FMLP rs5030878 coding ICAM1 (3383) rs5491 coding rs422429 coding rs1799969 coding rs34369517 coding rs5495 coding rs5497 coding rs5030400 coding rs281432 intron NFKBIB (4793) rs8108039 intron rs3136640 intron PLA2G4C (8605) rs35229843 coding rs11564638 coding rs11564620 coding rs11564541 coding 16 rs156631 coding rs11564538 coding 20 HCK (3055) rs6089165 coding rs6089166 coding rs17093828 coding PLCB1 (23236) rs13037181 coding rs13041270 coding rs13042803 coding rs6086575 coding rs28390202 coding rs6086672 intron rs6056072 intron rs6077418 intron rs2745784 intron rs3848832 intron rs6140583 intron rs6056094 intron rs6118283 intron rs2294259 intron rs708926 flanking_3UTR rs6055628 intron rs4399790 intron rs2745769 intron rs718986 intron rs6140770 intron rs6055697 intron rs4813865 flanking_5UTR rs2179137 intron rs12481262 intron rs6077404 intron rs6039215 intron rs1238231 flanking_3UTR rs2876140 intron rs6086506 flanking_5UTR rs708910 3UTR rs6039208 flanking_5UTR rs6108205 intron rs6133613 intron rs761042 intron rs2235947 intron rs6108195 intron rs1232779 flanking_3UTR rs11087811 flanking_5UTR rs6039209 intron rs2719795 flanking_3UTR rs2745787 intron rs2076685 intron rs2663004 intron 17 rs6077428 intron rs6039051 intron rs1028370 intron rs17446441 intron rs6140561 intron rs6055652 intron rs17446308 intron rs6516403 intron rs2207306 intron rs6086518 flanking_5UTR rs13037679 intron rs6055991 intron rs6039109 intron rs1509116 intron rs6055928 flanking_5UTR rs6140546 intron rs1474937 intron rs6140549 intron rs6056037 intron rs6118083 intron rs13040543 intron rs6077332 intron rs6086403 intron rs6055562 intron rs4496390 intron rs2719775 intron rs4419296 flanking_5UTR rs1509117 intron rs2327044 flanking_5UTR rs4813853 intron rs2179138 intron rs1232784 intron PLCB4 (5332) rs6077510 coding rs6118603 coding rs8183759 coding rs6108299 coding rs16995736 intron rs6056596 intron rs6039432 intron rs984010 intron rs2072954 intron rs6118505 intron rs6108280 intron rs926395 intron rs725941 intron rs2208295 intron rs2179321 intron rs5011374 intron 18 rs3819579 intron rs6056522 intron rs6056437 intron rs4369940 intron rs6118591 intron rs6056519 intron PLCG1 (5335) rs2229348 coding rs2228246 coding rs7266677 coding rs6065316 coding rs34203315 coding rs753381 coding rs2235361 coding rs2076146 intron rs3795131 intron rs6093446 intron SRC (6714) rs6018260 coding rs34881773 coding rs6017944 intron rs1547836 intron rs6018027 intron rs12106024 intron 22 MAPK1 (5594) / ERK2 rs1063311 3UTR rs9610487 intron rs8136867 intron rs2298432 intron MAPK11 (5600) / p38beta rs33932986 coding rs2076139 coding rs2066776 coding rs35396905 coding rs34422484 coding rs2272857 coding rs742184 intron NCF4 (4689) / p40 rs13057803 coding rs9610595 coding rs35355915 coding rs3827352 intron rs738148 intron rs760519 intron rs2284027 intron rs746713 intron rs4821544 intron PLA2G3 (50487) rs2232183 coding rs2074735 coding rs2074734 coding rs2232176 coding RAC2 (5880) rs8135343 intron rs13058338 intron 19 rs739041 intron rs6572 3UTR X BMX (660) rs35353387 coding rs41300892 coding IRAK1 (3654) rs12860727 coding NOX1 (27035) rs34688635 coding rs35242502 coding

20

Table S3 Ranking of statistical significance of association of the SNPs analyzed

Rank Gene SNP P_Value 1 PLCB3 RS35169799 0.00465 2 NOS2 RS3729508 0.01028 3 PAK2 RS6583177 0.0169 4 CXCL13 RS355689 0.01776 5 CXCR6 RS2234355 0.01938 6 PLCB1 RS6086479 0.01962 7 LYN RS7828258 0.02039 8 LYN RS13249338 0.02146 9 NOS2 RS8072199 0.02172 10 PLA2G4C RS11564538 0.02371 11 PLCB1 RS6086403 0.02664 12 CXCR6 RS3774634 0.02705 13 PIK3R1 RS6863431 0.02926 14 NOX3 RS1016259 0.03004 15 YES1 RS3897601 0.0305 16 FYN RS13218316 0.03379 17 ABL1 RS2855171 0.03413 18 MAPK8 RS12358297 0.03654 19 ABL1 RS2229071 0.04079 20 P2RY2 RS1783596 0.04147 21 ABL1 RS2791738 0.0416 22 PLCB1 RS2876140 0.04523 23 PLCB4 RS5011374 0.04545 24 PLCE1 RS2274223 0.04729 25 MAPK11 RS2076139 0.04762 26 IL17C RS2254073 0.04839

Table reports the ranking of significance of association with mild or severe phenotype for P values < 0.05, as calculated by permutation test

21

Table S4 Primers for quantification of gene transcripts

Accession Calibrator Primer Sequence (5′–3′) mM Number gene IL 8-F GACCACACTGCGCCAACA AF385628.2 15 GAPDH GCTCTCTTCCATCAGAAAGTTACATAAT IL 8-R 15 TT PLCb1-F CAGCTCTTCTGGAATGCAGGT NM_015192 2.5 GAPDH PLCb1-R TTTATTTGCATAGCCAGGTCC 15 PLCb2-F ATGTTCTGGAATGCTGGA NM_004573 15 GAPDH PLCb2-R TGCTGCATGGGCAAGTC 15 PLCb3-F TCTTCTGGAACGTAGGG NM_000932 15 eEF1g PLCb3-R AGCTGCATCGCCACATC 2.5 PLCb4-F CCTCAGATTTTCTGGAACGCTGGC NM_000933 15 eEF1g PLCb4-R TTCAATTGCATCGCTAAATC 2.5 PLCd1-F GGACGGAGGCTGGGCCTACA NM_001130964 15 G6PD PLCd1-R GGAGCTGGCTGCCCTTCAGCAG 15 PLCd3-F ACCCTGCCAGGTCAGCTCCC NM_133373 45 G6PD PLCd3-R AGCTGTTCCCTGCCTCCCGA 2.5 PLCd4-F GGGGGACCAGCTTTGCGGC NM_032726 2.5 RPII PLCd4-R CCCCGCTTCAGGGCCCGTAT 15 PLCg1-F GACCTTCATCAAGAGCGCCA NM_002660 45 G6PD PLCg1-R CCCCTCGCCACCAGCCTCCC 45 PLCg2-F GAGCTTCTGCCGTGGTGCCC NM_002661 2.5 CK-15 PLCg2-R CTCCTTTCCACCAGCCCCCG 2.5 PLCe1-F AGGCCAGTGTCCTCCCCTGTG NM_016341 2.5 G6PD PLCe1-R AGCCCATCCAGTGCTTGGAGC 15 GAPDH-F GTGGAGTCCACTGGCGTCTT J04038 2.5 GAPDH- GCAAATGAGCCCAGCCTTC 15 R G6PD-F GCCAAGAAGAAGATCTACCCCA NM_000402.2 15 G6PD-R AAGGCCATCCCGGAACAG 2.5 RPII-F TCGAGCAGATCAGCAAGGTG NM_000937.2 2.5 RPII-R TCTTGTTGTCTGTCTGTGGCAA 2.5 eEF1g-F AAACTGTGTGAGAAGATGGCCC NM_001404.3 15 eEF1g-R GGGTCTCTGCAAACTTTTTAGCA 2.5 CK 15-F GGCTGGCTGCGGACG NM_002275 15 CK 15-R GCAGGGCCAGCTCATTCTC 15

22

Supplementary Table 5 - Genotype of the SNPs of the PLC family in the top rank of Major/minor aminoacid IB3-1 CuFi-1 GENE SNP alleles change Chromosome genotype genotype PLCB3 RS35169799 C/T S845L 11 C/C C/C PLCB1 RS6086479 C/T no change 20 (intronic) C/T C/C PLCB1 RS6086403 A/C no change 20 (intronic) A/C A/C PLCB1 RS2876140 A/G no change 20 (intronic) A/G A/G PLCB4 RS5011374 A/C no change 20 (intronic) A/C A/A PLCE1 RS2274223 A/G H1619R 10 A/A A/A association with severe or mild CF lung progression

23

GENE Forward Reverse PLCB3 GATACCACTACGTCTGCC CCTGGTGGTCGTCAGGAATG PLCB1 CTTTCTGTGTATGAGGGAGGAA CCCATAAATGCACCCCATAA PLCB1 AGCCTCTGCTGGTGTATGCT CCAGTAGTGCCCAGGAGAAA PLCB1 GTCCGGTTGAATTTTGGGTA TCCAATCAGTCTTGTCATTCAA PLCB4 AAACCCTCTTGGAGAGAGCTG ACAACGAGGCTAAGGAGCAC PLCE1 CAGAATGTGTGCCCCAGTAAT GCTTTCAGTGGAATGATTCTC

Supplementary Table 6 – Sequencing primers for PLC family SNPs

24

Figure S1

Expression and silencing of phospholipase C beta (PLCB) isoforms in IB3-1 cells

Expression of PLC mRNA of the PLC isoforms beta 1 to beta 4 was quantified by qRT-PCR relative to the levels of expression of the housekeeping gene cytokeratin (CK)-15 after transfection of siRNA PLCB3 or scrambled oligonucleotides

26

Figure S2

Relative transcript expression levels of PLC isoforms in CF bronchial epithelial IB3-1 and CuFi-1 cell lines

Expression of PLC mRNA of the PLC isoforms beta, gamma, delta and epsilon was quantified by qRT-PCR relative to the levels of expression of the housekeeping gene cytokeratin (CK)-15.

27