DOCSLIB.ORG

Genomic and Genetic Studies in Autism Spectrum Disorders Moyra Smith* University of California, Irvine, CA, USA

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genomic and Genetic Studies in Autism Spectrum Disorders Moyra Smith* University of California, Irvine, CA, USA Smith M. J Rare Dis Res Treat. (2016) 1(1): 30-32 Journal of www.rarediseasesjournal.com Rare Diseases Research & Treatment Mini Review Open Access Genomic and Genetic Studies in Autism Spectrum Disorders Moyra Smith* University of California, Irvine, CA, USA Article Info Introduction Article Notes Received: June 28, 2016 Accepted: July 13, 2016 The primary manifestations of autism spectrum disorders are deficits in social1. and emotional reciprocity, deficits in non-verbal communication; an additional *Correspondence: manifestation is the occurrence of restrictive repetitive patterns of behavior Moyra Smith, Autism may occur as a one of the features present in particular syndromic University of California, Irvine, CA, USA E-mail: [email protected] disorders that involve additional defined clinical and pathological features, e.g. Tuberous Sclerosis, Rett syndrome etc. However, the majority of cases are non- © 2016 Smith M. This article is distributed under the terms of syndromic and autism is the key clinical manifestation. the Creative Commons Attribution 4.0 International License. In 2012 we reported results of analysis of genomic2 segmental copy number Keywords variants (CNVs) in 69 cases of autism including monozygotic twins and affected Canakinumab IL-1 sib-pairs and on 35 parents of autistic individuals . CNVs analyzed included autoinflammatory diseases regions that contained at least 20 markers. We analyzed the relative frequencies of CNVs in our study population relative to frequencies of CNVs in an available control data set (CEU). Results of our analyses revealed that the numbers of CNVs present were higher in the autism individuals than in their parents and higher than in controls. The number of CNVs present in parents was higher than the number of CNVs present in controls. In autistic individuals the predominant categories of genes present in CNVs greater than 1 MB in size included genes with ion channel related functions and genes that had mitochondrial related functions. The ion channel related genes included 6 genes that function at synapses GABRA5, GABRB3, GABRG3, CHRNA7, GPM6, and CACNA1C. The mitochondrial function genes included genes that encode subunits of electron transfer complexes, and genes that encode proteins that transport specific molecules across mitochondrial membranes. It is interesting to consider our report in the context of recent publications. Since 2012 comprehensive data have been generated relating to CNV analyses in autistic subjects and controls and in addition studies on exome sequencing on large numbers of cases of autism and controlsCNV analyses have been published. spe In 2013 Moreno-De Luca et al. analyzed3 data from three different autism ctrum cohorts (SSC AGRE and AGP) . Their analyses included 3955 individuals diagnosed with autism. From their analyses they identified recurrent deletions in the ASD cohorts at the following chromosome positions: 16p11.2, 15q13.2- 15q13, 16p13.11, 16p12.1, 17q12, 1q21, 1q21.1, 3q29, 5q35, 16p11.2, 22q11.2. In some cases of autism duplications occurred at these chromosome positions. Pinto et al. 2014 carried out copy number variant analyses on 2446 individuals with autism and their parents and they also assembled4 data on copy number variants present in 2640 unrelated control individuals . The Illumina 1M arrays were used for CNV analyses. They reported that copy number variants were present in 4.7% of autism-affected individuals and in 1 to 2 percent of controls. The de novo CNVs found in autism-affected individuals were on average larger than those found in control individuals. The average length of CNVs in autism individuals was 1.17Mb while in control individuals the average length of CNVs was 0.55MB. Importantly the number of genes impacted by CNVs was 3.8 fold higher in autism-affected individuals than in controls. In cases where the parental origin of CNVs could be determined, the numbers found to be of paternal origin where equal to the numbers found to be of maternal origin. Pinto et al. reported that 64% Page 30 of 32 Smith M. J Rare Dis Res Treat. 2016 1(1): 30-32 Journal of Rare Diseases Research & Treatment glutamate ionotropic receptor NMDA type GRIN2B 25 subunit 2B of the CNVs that were considered to be pathogenic were de novo HOXA1 15 homeobox A1 in origin in the autistic individuals. Pinto et al. reported that brain IL1RAPL1 18 interleukin 1 receptor accessory protein like 1 expressed genes were more frequently impacted in the CNVs potassium calcium-activated channel subfamily KCNMA1 16 found in autistic individuals than in the CNVs found in control M alpha 1 individuals;Exome sequencing this was particularly studies the case in deletion CNVs. MACROD2 15 MACRO domain containing 2 MBD5 22 methyl-CpG binding domain protein 5 MECP2 50 methyl-CpG binding protein 2 In recent years a number of large scale sequencing studies MET 32 MET proto-oncogene, receptor tyrosine kinase on autistic individuals and their parents have revealed that NF1 20 Neurofibromin 1 rare de novo damaging loss of function mutations occurred in NLGN3 30 Neuroligin 3 autism cases. Rubeis et al. (2014) carried out exome sequencing NLGN4X 30 neuroligin 4, X-linked on 3,8715 autism cases and 9,937 ancestry-matched or parental NLGN4Y 26 neuroligin 4, Y-linked controls . They identified de novo loss-of-function mutations NRXN1 61 neurexin 1 in over 5% of autistic subjects. These mutations impacted 129 OXTR 34 oxytocin receptor genes. These genes were reported to include voltage-gated PTEN 34 phosphatase and tensin homolog ion channels histone-modifying enzymes and chromatin RBFOX1 39 RNA binding protein, fox-1 homolog 1 remodelers-particularly those involved in post-translational RELN 28 Reelin lysine methylation/demethylation modifications of histones. RORA 15 RAR related orphan receptor A Additional gene sequencing studies have. been carried out by SCN1A 31 sodium voltage-gated channel alpha subunit 1 several groups. It is important to note6 that defects in 200-1000 Autism risk genes identified through merged analyses SCN2A 30 sodium voltage-gated channel alpha subunit 2 genes have been implicated in autism SHANK2 19 SH3 and multiple ankyrin repeat domains 2 [ SHANK3 49 SH3 and multiple ankyrin repeat domains 3 Solute carrier 25A12, (calcium-binding SLC25A12 19 The Simons Foundation autism research initiative SFARI mitochondrial carrier protein) (https://sfari.org/ merges information from multiple studies solute carrier family 6 member 4 (serotonin SLC6A4 22 and compiles lists of genes implicated in autism including transporter) syndromic and non-syndromic autism. In addition, the genes STXBP1 20 syntaxin binding protein 1 listed have been implicated through analyses on copy number SYN1 16 synapsin I variants and through sequencing analyses. The SFARI gene list SYNGAP1 28 synaptic Ras GTPase activating protein 1 also includes the number of published reports that implicate a TCF4 19 transcription factor 4 specific gene. Table 1 in this review lists 50 genes reported in TSC1 15 Tuberous scleorsis 1 (tuberin stabilizer) SFARI as being involved in autism spectrum disorder in 15 or TSC2 19 Tuberous sclerosis 2 (tuberin) more publications.Number of ubiquitin protein ligase E3A (ubiquitin protein Gene symbol Gene Names UBE3A 19 reports degradation) AHI1 17 Abelson helper integration site 1 Table 1: Risk genes for autism including syndromic and non- ANK3 18 ankyrin 3, node of Ranvier syndromic cases, linked to at least 15 references in SFARI data base, ANKRD4 17 protein phosphatase 1 regulatory subunit 16B https://sfari.org/ accessed July 9th 2016 (PPP1R16B) ARID1B 17 AT-rich interaction domain 1B Gene Networks in autism AVPR1B 16 arginine vasopressin receptor 1B CACNA1C 35 calcium voltage-gated channel subunit alpha1 C calcium voltage-gated channel subunit alpha1 CACNA1H 19 Clearly it is of great importance to determine whether genes H implicated in autism converge on specific cellular pathways or CDKL5 22 cyclin dependent kinase like 5 molecular processes or on specific developmental processes. CHD8 18 chromodomain helicase DNA binding protein 8 A number of large-scale studies on genetic variants in autism CNTN4 17 contactin 4 have led to the identification of networks of gene involved in CNTNAP2 49 contactin associated protein-like 2 autism. It is interesting to note that the networks identified in DMD 33 dystrophin different studies overlap but are not necessarily identical. Most DPP6 22 dipeptidyl peptidase like 6 studies identify genes involved in synaptic functions, genes dual specificity tyrosine phosphorylation DYRK1A 19 regulated kinase responsible for chromatin remodeling. Several studies identify genes involved in gene expression and transcription. EN2 18 engrailed homeobox 2 . One FMR1 38 fragile X mental retardation 1 Sanders et al. (2015) reported that autism spectrum disorder7 FOXP2 28 forkhead box P2 risk genes could be placed into two major networks gamma-aminobutyric acid type A receptor major network included neuronal elements related to: synapse, GABRB3 30 beta3 subunit neuronal projections, signaling, long-term potentiation, post- glutamate ionotropic receptor NMDA type GRIN2A 20 synaptic density and cytoskeleton. subunit 2A The second network included elements related to chromatin organization, nucleosome remodeling complexes, bromodomain Page 31 of 32 Smith M. J Rare Dis Res Treat 2016 1(1): 30-32 Journal of Rare Diseases Research & Treatment histone modification complexes, transcription related elements, autism occur in individuals without a diagnosis
Load more

Recommended publications
  • Gene Expression Studies in Depression Development and Treatment
    Mariani et al. Translational Psychiatry (2021) 11:354 https://doi.org/10.1038/s41398-021-01469-6 Translational Psychiatry REVIEW ARTICLE Open Access Gene expression studies in Depression development and treatment: an overview of the underlying molecular mechanisms and biological processes to identify biomarkers Nicole Mariani 1, Nadia Cattane2,CarminePariante 1 and Annamaria Cattaneo 2,3 Abstract A combination of different risk factors, such as genetic, environmental and psychological factors, together with immune system, stress response, brain neuroplasticity and the regulation of neurotransmitters, is thought to lead to the development of major depressive disorder (MDD). A growing number of studies have tried to investigate the underlying mechanisms of MDD by analysing the expression levels of genes involved in such biological processes. These studies have shown that MDD is not just a brain disorder, but also a body disorder, and this is mainly due to the interplay between the periphery and the Central Nervous System (CNS). To this purpose, most of the studies conducted so far have mainly dedicated to the analysis of the gene expression levels using postmortem brain tissue as well as peripheral blood samples of MDD patients. In this paper, we reviewed the current literature on candidate gene expression alterations and the few existing transcriptomics studies in MDD focusing on inflammation, neuroplasticity, neurotransmitters and stress-related genes. Moreover, we focused our attention on studies, which have investigated 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; mRNA levels as biomarkers to predict therapy outcomes. This is important as many patients do not respond to antidepressant medication or could experience adverse side effects, leading to the interruption of treatment.
    [Show full text]
  • Research Article Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed Hipscs To
    Hindawi Publishing Corporation Stem Cells International Volume 2013, Article ID 784629, 25 pages http://dx.doi.org/10.1155/2013/784629 Research Article Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed hiPSCs to Differentiated Neuronal and Cardiac Progeny Leonhard Linta,1 Marianne Stockmann,1 Qiong Lin,2 André Lechel,3 Christian Proepper,1 Tobias M. Boeckers,1 Alexander Kleger,3 and Stefan Liebau1 1 InstituteforAnatomyCellBiology,UlmUniversity,Albert-EinsteinAllee11,89081Ulm,Germany 2 Institute for Biomedical Engineering, Department of Cell Biology, RWTH Aachen, Pauwelstrasse 30, 52074 Aachen, Germany 3 Department of Internal Medicine I, Ulm University, Albert-Einstein Allee 11, 89081 Ulm, Germany Correspondence should be addressed to Alexander Kleger; [email protected] and Stefan Liebau; [email protected] Received 31 January 2013; Accepted 6 March 2013 Academic Editor: Michael Levin Copyright © 2013 Leonhard Linta et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ion channels are involved in a large variety of cellular processes including stem cell differentiation. Numerous families of ion channels are present in the organism which can be distinguished by means of, for example, ion selectivity, gating mechanism, composition, or cell biological function. To characterize the distinct expression of this group of ion channels we have compared the mRNA expression levels of ion channel genes between human keratinocyte-derived induced pluripotent stem cells (hiPSCs) and their somatic cell source, keratinocytes from plucked human hair. This comparison revealed that 26% of the analyzed probes showed an upregulation of ion channels in hiPSCs while just 6% were downregulated.
    [Show full text]
  • Ion Channels
    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
    [Show full text]
  • Nicotinic Receptors in Sleep-Related Hypermotor Epilepsy: Pathophysiology and Pharmacology
    brain sciences Review Nicotinic Receptors in Sleep-Related Hypermotor Epilepsy: Pathophysiology and Pharmacology Andrea Becchetti 1,* , Laura Clara Grandi 1 , Giulia Colombo 1 , Simone Meneghini 1 and Alida Amadeo 2 1 Department of Biotechnology and Biosciences, University of Milano-Bicocca, 20126 Milano, Italy; [email protected] (L.C.G.); [email protected] (G.C.); [email protected] (S.M.) 2 Department of Biosciences, University of Milano, 20133 Milano, Italy; [email protected] * Correspondence: [email protected] Received: 13 October 2020; Accepted: 21 November 2020; Published: 25 November 2020 Abstract: Sleep-related hypermotor epilepsy (SHE) is characterized by hyperkinetic focal seizures, mainly arising in the neocortex during non-rapid eye movements (NREM) sleep. The familial form is autosomal dominant SHE (ADSHE), which can be caused by mutations in genes encoding subunits of the neuronal nicotinic acetylcholine receptor (nAChR), Na+-gated K+ channels, as well as non-channel signaling proteins, such as components of the gap activity toward rags 1 (GATOR1) macromolecular complex. The causative genes may have different roles in developing and mature brains. Under this respect, nicotinic receptors are paradigmatic, as different pathophysiological roles are exerted by distinct nAChR subunits in adult and developing brains. The widest evidence concerns α4 and β2 subunits. These participate in heteromeric nAChRs that are major modulators of excitability in mature neocortical circuits as well as regulate postnatal synaptogenesis. However, growing evidence implicates mutant α2 subunits in ADSHE, which poses interpretive difficulties as very little is known about the function of α2-containing (α2*) nAChRs in the human brain.
    [Show full text]
  • Ca2+ and Brain-Derived Neurotrophic Factor (BDNF) in STC-1 Cells Jie Qian Virginia Commonwealth University
    Virginia Commonwealth University VCU Scholars Compass Physiology and Biophysics Publications Dept. of Physiology and Biophysics 2015 Nicotine-Induced Effects on Nicotinic Acetylcholine Receptors (nAChRs), Ca2+ and Brain-Derived Neurotrophic Factor (BDNF) in STC-1 Cells Jie Qian Virginia Commonwealth University Shobha K. Mummalaneni Virginia Commonwealth University Reem M. Alkahtan Virginia Commonwealth University See next page for additional authors Follow this and additional works at: http://scholarscompass.vcu.edu/phis_pubs Part of the Medicine and Health Sciences Commons Copyright: © 2016 Qian et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Downloaded from http://scholarscompass.vcu.edu/phis_pubs/54 This Article is brought to you for free and open access by the Dept. of Physiology and Biophysics at VCU Scholars Compass. It has been accepted for inclusion in Physiology and Biophysics Publications by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Authors Jie Qian, Shobha K. Mummalaneni, Reem M. Alkahtan, Sunila Mahavadi, Karnam S. Murthy, John R. Grider, and Vijay Lyall This article is available at VCU Scholars Compass: http://scholarscompass.vcu.edu/phis_pubs/54 RESEARCH ARTICLE Nicotine-Induced Effects on Nicotinic Acetylcholine Receptors (nAChRs), Ca2+ and Brain-Derived Neurotrophic
    [Show full text]
  • Ligand-Gated Ion Channels
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: Ligand-gated ion channels. British Journal of Pharmacology (2015) 172, 5870–5903 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: Ligand-gated ion channels Stephen PH Alexander1, John A Peters2, Eamonn Kelly3, Neil Marrion3, Helen E Benson4, Elena Faccenda4, Adam J Pawson4, Joanna L Sharman4, Christopher Southan4, Jamie A Davies4 and CGTP Collaborators L 1 School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, N 2Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/ doi/10.1111/bph.13350/full. Ligand-gated ion channels are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage- gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading. The Concise Guide is published in landscape format in order to facilitate comparison of related targets.
    [Show full text]
  • Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation
    WEB-ONLY CONTENT Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation Audrey Guilmatre, PhD; Christèle Dubourg, PhD; Anne-Laure Mosca, MD; Solenn Legallic, BSc; Alice Goldenberg, MD; Vale´rie Drouin-Garraud, MD; Vale´rie Layet, MD; Antoine Rosier, MD; Sylvain Briault, MD; Fre´de´rique Bonnet-Brilhault, MD, PhD; Fre´de´ric Laumonnier, PhD; Sylvie Odent, MD, PhD; Gael Le Vacon, MD; Ge´raldine Joly-Helas, MD; Ve´ronique David, MD; Claude Bendavid, MD; Jean-Michel Pinoit, MD; Ce´line Henry, MD; Caterina Impallomeni, MD; Eva Germano, MD; Gaetano Tortorella, MD; Gabriella Di Rosa, MD; Catherine Barthelemy, MD; Christian Andres, MD; Laurence Faivre, MD, PhD; Thierry Fre´bourg, MD, PhD; Pascale Saugier Veber, PhD; Dominique Campion, MD, PhD Arch Gen Psychiatry. 2009;66(9):947-956 eTable 1. Polymerase Chain Reaction Primers and Amplification Conditionsa Gene Forward Primer Reverse Primer Amplicon Size, bp NRXN1␣ exon 1 CGTTAGATAGTCGGGACCCTTATTTCTTCG GATAGGGTTA GCAGCAGGCGTTCCACTT 258 NRXN1␣ exon 5 CGTTAGATAGTAGTGGAGCCTGTGAATGGAAAG GATAGGGTTAGAGGAGCCCTGTATCATGTTGTT 192 NRXN1␤ exon 4 CGTTAGATAGGCCTGGCCCTGCTTTGG GATAGGGTTAGGAAATGGTGGATGTGGTGC 119 DPP10 CGTTAGATAGCAGATAAGTTCCATATTGACTGGG GATAGGGTTAGCTGTTATTTGGTCCTTTACTTCT 180 ERBB4 CGTTAGATAGCCGAGGATGAGTATGTGAATGA GATAGGGTTAGAAGGGTGCTCCGAGGTG 188 CNTN4 CGTTAGATAGGATCTTCAATGAATACCCTTCC GATAGGGTTACCCAGGACCTTGTGGTTTGT 170 GRM7 CGTTAGATAGTGTGAGCCTTGCGATGGTTA GATAGGGTTAGGGCGTGTCATTGTAGCG 245 NLGN1 CGTTAGATAGGATAAGAGGGATTAAGAAGGAACTCA
    [Show full text]
  • Retrograde Inhibition by a Specific Subset of Interpeduncular Α5 Nicotinic Neurons Regulates Nicotine Preference
    Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference Jessica L. Ablesa,b,c, Andreas Görlicha,1, Beatriz Antolin-Fontesa,2,CuidongWanga, Sylvia M. Lipforda, Michael H. Riada, Jing Rend,e,3,FeiHud,e,4,MinminLuod,e,PaulJ.Kennyc, Nathaniel Heintza,f,5, and Ines Ibañez-Tallona,5 aLaboratory of Molecular Biology, The Rockefeller University, New York, NY 10065; bDepartment of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY 10029; dNational Institute of Biological Sciences, Beijing 102206, China; eSchool of Life Sciences, Tsinghua University, Beijing 100084, China; and fHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Nathaniel Heintz, October 23, 2017 (sent for review October 5, 2017; reviewed by Jean-Pierre Changeux and Lorna W. Role) Repeated exposure to drugs of abuse can produce adaptive changes nicotine withdrawal, and optical activation of IPN GABAergic cells that lead to the establishment of dependence. It has been shown that is sufficient to produce a withdrawal syndrome, while blockade of allelic variation in the α5 nicotinic acetylcholine receptor (nAChR) gene GABAergic cells in the IPN reduced symptoms of withdrawal (17). CHRNA5 is associated with higher risk of tobacco dependence. In the Taken together these studies highlight the critical role of α5in brain, α5-containing nAChRs are expressed at very high levels in the regulating behavioral responses to nicotine. Here we characterize two subpopulations of GABAergic interpeduncular nucleus (IPN). Here we identified two nonoverlapping Amigo1 Epyc α + α Amigo1 α Epyc neurons in the IPN that express α5: α5- and α5- neu- 5 cell populations ( 5- and 5- ) in mouse IPN that respond α Amigo1 α Epyc differentially to nicotine.
    [Show full text]
  • Retrograde Inhibition by a Specific Subset of Interpeduncular Α5 Nicotinic Neurons Regulates Nicotine Preference
    Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference Jessica L. Ablesa,b,c, Andreas Görlicha,1, Beatriz Antolin-Fontesa,2,CuidongWanga, Sylvia M. Lipforda, Michael H. Riada, Jing Rend,e,3,FeiHud,e,4,MinminLuod,e,PaulJ.Kennyc, Nathaniel Heintza,f,5, and Ines Ibañez-Tallona,5 aLaboratory of Molecular Biology, The Rockefeller University, New York, NY 10065; bDepartment of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY 10029; dNational Institute of Biological Sciences, Beijing 102206, China; eSchool of Life Sciences, Tsinghua University, Beijing 100084, China; and fHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Nathaniel Heintz, October 23, 2017 (sent for review October 5, 2017; reviewed by Jean-Pierre Changeux and Lorna W. Role) Repeated exposure to drugs of abuse can produce adaptive changes nicotine withdrawal, and optical activation of IPN GABAergic cells that lead to the establishment of dependence. It has been shown that is sufficient to produce a withdrawal syndrome, while blockade of allelic variation in the α5 nicotinic acetylcholine receptor (nAChR) gene GABAergic cells in the IPN reduced symptoms of withdrawal (17). CHRNA5 is associated with higher risk of tobacco dependence. In the Taken together these studies highlight the critical role of α5in brain, α5-containing nAChRs are expressed at very high levels in the regulating behavioral responses to nicotine. Here we characterize two subpopulations of GABAergic interpeduncular nucleus (IPN). Here we identified two nonoverlapping Amigo1 Epyc α + α Amigo1 α Epyc neurons in the IPN that express α5: α5- and α5- neu- 5 cell populations ( 5- and 5- ) in mouse IPN that respond α Amigo1 α Epyc differentially to nicotine.
    [Show full text]
  • Nicotinic Receptors Atlas in the Adult Human Lung
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.29.176750; this version posted August 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Nicotinic receptors atlas in the adult human lung 2 3 Zania Diabasana1, Jeanne-Marie Perotin1,2, Randa Belgacemi1, Julien Ancel1,2, Pauline 4 Mulette1,2, Gonzague Delepine3, Philippe Gosset4, Uwe Maskos5, Myriam Polette1,6, Gaëtan 5 Deslée1,2, Valérian Dormoy1 6 7 1University of Reims Champagne-Ardenne, Inserm, P3Cell UMR-S1250, SFR CAP-SANTE, 8 51092 Reims, France 9 2CHU of Reims, Hôpital Maison Blanche, Department of respiratory diseases, 51092 Reims, 10 France 11 3CHU of Reims, Hôpital Maison Blanche, Department of thoracic surgery, 51092 Reims, 12 France 13 4University of Lille, CNRS UMR9017, Inserm U1019, CHRU Lille, Pasteur Institute of Lille, 14 CIIL - Center for Infection and Immunity of Lille, 59000 Lille, France 15 5Pasteur Institute of Paris, Integrative Neurobiology of Cholinergic Systems, CNRS UMR 16 3571, Paris, France. 17 6CHU Reims, Hôpital Maison Blanche, Department of biopathology, 51092 Reims, France 18 19 Correspondence to: 20 Dr Valérian Dormoy 21 Inserm UMR-S 1250 22 University of Reims Champagne-Ardenne 23 CHU Maison Blanche 24 45 rue Cognacq-Jay 25 51092 Reims 26 Phone +33 (0)3 10 73 62 28; Fax +33 (0)3 26 06 58 61 27 e-mail: [email protected] 28 29 Short title: lung nicotinic receptors 30 31 32 33 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.29.176750; this version posted August 13, 2020.
    [Show full text]
  • Structure, Dynamics, and Ligand Recognition of Human-Specific CHRFAM7A (Dup7) Nicotinic Receptor Linked to Neuropsychiatric Diso
    International Journal of Molecular Sciences Article Structure, Dynamics, and Ligand Recognition of Human-Specific CHRFAM7A (Dupα7) Nicotinic Receptor Linked to Neuropsychiatric Disorders Danlin Liu 1,†, João V. de Souza 1,†, Ayaz Ahmad 1 and Agnieszka K. Bronowska 1,2,* 1 Chemistry—School of Natural and Environmental Sciences, Newcastle University, Newcastle NE1 7RU, UK; [email protected] (D.L.); [email protected] (J.V.d.S.); [email protected] (A.A.) 2 Newcastle University Centre for Cancer, Newcastle University, Newcastle NE1 7RU, UK * Correspondence: [email protected] † Equal contribution. Abstract: Cholinergic α7 nicotinic receptors encoded by the CHRNA7 gene are ligand-gated ion chan- nels directly related to memory and immunomodulation. Exons 5–7 in CHRNA7 can be duplicated and fused to exons A-E of FAR7a, resulting in a hybrid gene known as CHRFAM7A, unique to humans. Its product, denoted herein as Dupα7, is a truncated subunit where the N-terminal 146 residues of the ligand binding domain of the α7 receptor have been replaced by 27 residues from FAM7. Dupα7 negatively affects the functioning of α7 receptors associated with neurological disorders, including Alzheimer’s diseases and schizophrenia. However, the stoichiometry for the α7 nicotinic receptor containing dupα7 monomers remains unknown. In this work, we developed computational models Citation: Liu, D.; de Souza, J.V.; of all possible combinations of wild-type α7 and dupα7 pentamers and evaluated their stability via Ahmad, A.; Bronowska, A.K. atomistic molecular dynamics and coarse-grain simulations. We assessed the effect of dupα7 subunits Structure, Dynamics, and Ligand on the Ca2+ conductance using free energy calculations.
    [Show full text]
  • A Human-Specific A7-Nicotinic Acetylcholine Receptor Gene In
    A Human-Specific α7-Nicotinic Acetylcholine Receptor Gene in Human Leukocytes: Identification, Regulation and the Consequences of CHRFAM7A Expression Todd W Costantini,1* Xitong Dang,1,2* Maryana V Yurchyshyna,1 Raul Coimbra,1 Brian P Eliceiri,1 and Andrew Baird1 1Department of Surgery, University of California San Diego Health Sciences, San Diego, California, United States of America; and 2Cardiovascular Research Center, Luzhou Medical College, Luzhou, Sichuan, China The human genome contains a variant form of the α7-nicotinic acetylcholine receptor (α7nAChR) gene that is uniquely human. This CHRFAM7A gene arose during human speciation and recent data suggests that its expression alters ligand tropism of the normally homopentameric human α7-AChR ligand-gated cell surface ion channel that is found on the surface of many dif- ferent cell types. To understand its possible significance in regulating inflammation in humans, we investigated its expression in nor- mal human leukocytes and leukocyte cell lines, compared CHRFAM7A expression to that of the CHRNA7 gene, mapped its pro- moter and characterized the effects of stable CHRFAM7A overexpression. We report here that CHRFAM7A is highly expressed in human leukocytes but that the levels of both CHRFAM7A and CHRNA7 mRNAs were independent and varied widely. To this end, mapping of the CHRFAM7A promoter in its 5′-untranslated region (UTR) identified a unique 1-kb sequence that independently reg- ulates CHRFAM7A gene expression. Because overexpression of CHRFAM7A in THP1 cells altered the cell phenotype and modified the expression of genes associated with focal adhesion (for example, FAK, P13K, Akt, rho, GEF, Elk1, CycD), leukocyte transepithe- lial migration (Nox, ITG, MMPs, PKC) and cancer (kit, kitL, ras, cFos cyclinD1, Frizzled and GPCR), we conclude that CHRFAM7A is bi- ologically active.
    [Show full text]