DOCSLIB.ORG

Expression of Nicotinic Acetylcholine Receptor Subunit Genes in Non–Small-Cell Lung Cancer Reveals Differences Between Smokers and Nonsmokers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression of Nicotinic Acetylcholine Receptor Subunit Genes in Non–Small-Cell Lung Cancer Reveals Differences Between Smokers and Nonsmokers Research Article Expression of Nicotinic Acetylcholine Receptor Subunit Genes in Non–Small-Cell Lung Cancer Reveals Differences between Smokers and Nonsmokers David Chi-leung Lam,1,2 Luc Girard,4 Ruben Ramirez,4 Wing-shun Chau,3 Wai-sing Suen,3 Shelley Sheridan,4 Vicky P.C. Tin,2 Lap-ping Chung,2 Maria P. Wong,2 Jerry W. Shay,5 Adi F. Gazdar,4 Wah-kit Lam,1 and John D. Minna4 Departments of 1Medicine and 2Pathology, University of Hong Kong; 3Cardiothoracic Surgical Unit, The Grantham Hospital, HKSAR, China; and 4Hamon Center for Therapeutic Oncology Research and 5Department of Cell Biology, Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas Abstract could also participate in lung cancer pathogenesis by activating Nicotine and its derivatives, by binding to nicotinic acetyl- signal transduction pathways such as the Akt pathway (1). One choline receptors (nAChR) on bronchial epithelial cells, can model could be that nicotine by stimulating nicotinic AChRs regulate cellular proliferation and apoptosis via activating the (nAChR) would activate Akt in lung epithelial cells and perhaps Akt pathway. Delineation of nAChR subtypes in non–small-cell stimulate cell proliferation and/or overcome apoptotic responses lung cancers (NSCLC) may provide information for prevention engendered by carcinogen exposure (1). If this model is true, then or therapeutic targeting. Expression of nAChR subunit genes one may ask whether lung tumors have different nAChR expression in 66 resected primary NSCLCs, 7 histologically non-involved patterns compared with normal lung tissues and whether lung lung tissues, 13 NSCLC cell lines, and 6 human bronchial cancers arising in smokers have different patterns compared with epithelial cell lines (HBEC) was analyzed with quantitative never smokers. Such differences would provide additional infor- PCR and microarray analysis. Five nonmalignant HBECs were mation that nicotine is playing a role via the nAChRs in lung cancer exposed to nicotine in vitro to study the variation of nAChR pathogenesis. In recent decades, there have been an increasing subunit gene expression with nicotine exposure and removal. proportion of female nonsmokers compared with male smokers in NSCLCs from nonsmokers showed higher expression of nAChR patients with lung cancer (2). It is possible that both gender and A6(P < 0.001) and B3(P = 0.007) subunit genes than those smoking, or an interaction of both factors, are playing roles in lung from smokers, adjusted for gender. In addition, nAChR A4 carcinogenesis. Differences between men and women may also (P < 0.001) and B4(P = 0.029) subunit gene expression showed make them respond to tobacco smoke in different ways, and lung significant difference between NSCLCs and normal lung. Using tumors derived from male smokers and female nonsmokers may Affymetrix GeneChip U133 Sets, 65 differentially expressed have adopted different carcinogenic pathways. Thus, it would be genes associated with NSCLC nonsmoking nAChR A6B3 important to analyze the role of nAChR expression in the context of phenotype were identified, which gave high sensitivity and gender as well. specificity of prediction. nAChR A1, A5, and A7 showed AChRs are divided into nicotinic (nAChR) and muscarinic significant reversible changes in expression levels in HBECs (mAChR) subtypes. nAChRs are further subdivided into neuronal or upon nicotine exposure. We conclude that between NSCLCs muscle subtypes, which could also be present in nonneuronal or from smokers and nonsmokers, different nAChR subunit gene non-muscle tissues. Neuronal nAChRs are composed of different h h h expression patterns were found, and a 65-gene expression subunits including a1, a2, a3, a4, a5, a6, a7, a9, a10, 1, 2, 3, or h h signature was associated with nonsmoking nAChR A6B3 4. In addition to these different a and subunits, the muscle type y q expression. Finally, nicotine exposure in HBECs resulted in nAChR may also contain , , and g subunits. Genes encoding for reversible differences in nAChR subunit gene expression. individual nAChR subunit are named CHRNA1, CHRNA2, CHRNA3, These results further implicate nicotine in bronchial carcino- CHRNA4, CHRNA5, CHRNA6, CHRNA7, CHRNA9, and CHRNA10 for genesis and suggest targeting nAChRs for prevention and the a subunits and CHRNB1, CHRNB2, CHRNB3, and CHRNB4 for h therapy in lung cancer. [Cancer Res 2007;67(10):4638–47] the subunits. nAChRs are found to be present throughout the central nervous system (CNS) and in nonneuronal tissues, such as Introduction a3, a5, and a7 in bronchial epithelium (3, 4); a4 in alveolar epithelial cells (4); and a3, a5, a7, h2, and h4 in pulmonary Tobacco smoking is the major cause of lung cancer, and nicotine neuroendocrine cells and human small cell lung cancer (SCLC) cell in tobacco smoke leads to both addiction and further metabolism lines (5–8), skin keratinocytes (9), vascular tissues (10), and human into potent carcinogen(s). In addition, recent discoveries of lymphocytes (11). nAChR holoreceptor is a pentamer consisting of functional acetylcholine receptors (AChR) on lung epithelial cells five homologous or different nAChR subunits surrounding a ligand- and lung tumors raise the question of whether exposure to nicotine gated channel (12) that responds to binding by ligands such as acetylcholine, nicotine, or its highly carcinogenic derivative 4(methylnitrosamine)-1-(3-pyridyl)-1-butanone (NNK; ref. 13). Neu- Requests for reprints: John D. Minna, Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center at Dallas, 6000 Harry ronal nAChR consists of only two types of subunits: either a Hines Boulevard, Dallas, TX 75390-8593. Phone: 214-648-4900; Fax: 214-648-4940; combination of a and h subunits or five copies of the same a E-mail: [email protected]. h I2007 American Association for Cancer Research. subunits (14). Both the a and subunits are thought to contribute doi:10.1158/0008-5472.CAN-06-4628 to the physiologic properties of nAChR, where a subunit contains Cancer Res 2007; 67: (10). May 15, 2007 4638 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2007 American Association for Cancer Research. Nicotinic Acetylcholine Receptors in Lung Cancer the principal sites for agonist binding, such as acetylcholine, and h (NSCLC) specimens and 14 normal lungs tissues. NSCLC tumor specimens subunits are believed to regulate the rate of binding and were collected from Hong Kong Chinese patients undergoing surgical dissociation by agonists (15). Functional receptors in the brain resection. Normal lung tissues used in this study were collected from are composed mainly of a4h2, a4a5h2, a6h2h3, a6h3, a4a6h2h3, patients with lung cancer undergoing surgical resection, and specimens were reviewed to show no tumor involvement. Written informed consent and a7 (16, 17). In fact, a4h2 in the brain is thought to be h for tumor and normal lung tissues collection were obtained from patients responsible for nicotine addiction (18, 19). a6 associated with 2 recruited before surgery, and ethics approval for study protocol was h and 3, a3ora4 is present in dopaminergic and adrenergic obtained from the local Institutional Review Board of the University of neurons in the brain (20); and a6h3, in particular, is a functional Hong Kong (HKU)/Hong Kong Hospital Authority Hong Kong West Cluster. nAChR (21). Receptor affinity for nicotine varies with different The demographic characteristics of these lung cancer patients, including composition of nAChR subunits (20). Transfection studies have their age, gender, smoking habits, and tumor-node-metastasis pathologic shown that the ratio of a/h subunits in nAChRs depends on the staging information, are summarized in Table 1. Nonsmokers were patients ratio of expression of the encoding nAChR subunit genes (22). who have never smoked for their lifetime. Smokers included patients who nAChRs were first implicated in the growth regulation of lung have been current active chronic smokers before surgery and patients who have been daily smoking for more than 6 months in the past but have quit cancer when nicotine was found to stimulate DNA synthesis in smoking at the time of surgery. All 66 NSCLC tumors collected were human SCLC cell lines (23), and this was supported by subsequent included in quantitative PCR, and 49 (all primary lung adenocarcinomas) of identification that the receptor involved was nAChR a7 (7, 24). We these 66 specimens were used for microarray studies; in addition, of the 14 have previously shown that lung cancer cells expressed nAChR, and normal lung tissue specimens, 9 were used for microarray analysis, whereas that nicotine, at concentrations found in smokers, blocked the 7 of them were included in quantitative PCR analysis (two normal lung induction of apoptosis in lung cancer cells (25); whereas West et al. tissue specimens were used in both microarray analysis and quantitative showed that activation of nAChR resulted in downstream PCR analysis). activation of the Akt pathway (1), protein kinase C pathway, and A panel of 13 NSCLC cell lines (9 NCI-H lung cancer cell lines and 4 the mitogen-activated protein kinase (MAPK) pathways, leading to HKULC lung cancer cell lines) were used in this study, and total RNA was extracted for quantitative PCR (Table 1). The NCI-H lung cancer cell lines inhibition of apoptosis and promotion of growth and proliferation (all were NSCLC lines: H1437, H1648, H1770, H1819, H1993, H2009, H2087, in human bronchial epithelial cells (HBEC; refs. 1, 25). H2122, and H2347) were maintained at the Hamon Center for Therapeutic a In the brain, nAChR 7 showed paradoxical up-regulation in Oncology Research, University of Texas Southwestern Medical Center at response to chronic exposure to nicotine, whereas other nAChR Dallas (31) and have been deposited in the American Type Culture subunits were down-regulated. It has also been shown that the Collection (ATCC) repository (32). The HKULC cell lines (HKULC1–4) were nAChR a7 in the lungs of monkeys is up-regulated by exposure to newly established lung adenocarcinomas from Hong Kong Chinese nicotine (26).
Load more

Recommended publications
  • Gene Expression Studies in Depression Development and Treatment
    Mariani et al. Translational Psychiatry (2021) 11:354 https://doi.org/10.1038/s41398-021-01469-6 Translational Psychiatry REVIEW ARTICLE Open Access Gene expression studies in Depression development and treatment: an overview of the underlying molecular mechanisms and biological processes to identify biomarkers Nicole Mariani 1, Nadia Cattane2,CarminePariante 1 and Annamaria Cattaneo 2,3 Abstract A combination of different risk factors, such as genetic, environmental and psychological factors, together with immune system, stress response, brain neuroplasticity and the regulation of neurotransmitters, is thought to lead to the development of major depressive disorder (MDD). A growing number of studies have tried to investigate the underlying mechanisms of MDD by analysing the expression levels of genes involved in such biological processes. These studies have shown that MDD is not just a brain disorder, but also a body disorder, and this is mainly due to the interplay between the periphery and the Central Nervous System (CNS). To this purpose, most of the studies conducted so far have mainly dedicated to the analysis of the gene expression levels using postmortem brain tissue as well as peripheral blood samples of MDD patients. In this paper, we reviewed the current literature on candidate gene expression alterations and the few existing transcriptomics studies in MDD focusing on inflammation, neuroplasticity, neurotransmitters and stress-related genes. Moreover, we focused our attention on studies, which have investigated 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; mRNA levels as biomarkers to predict therapy outcomes. This is important as many patients do not respond to antidepressant medication or could experience adverse side effects, leading to the interruption of treatment.
    [Show full text]
  • Research Article Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed Hipscs To
    Hindawi Publishing Corporation Stem Cells International Volume 2013, Article ID 784629, 25 pages http://dx.doi.org/10.1155/2013/784629 Research Article Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed hiPSCs to Differentiated Neuronal and Cardiac Progeny Leonhard Linta,1 Marianne Stockmann,1 Qiong Lin,2 André Lechel,3 Christian Proepper,1 Tobias M. Boeckers,1 Alexander Kleger,3 and Stefan Liebau1 1 InstituteforAnatomyCellBiology,UlmUniversity,Albert-EinsteinAllee11,89081Ulm,Germany 2 Institute for Biomedical Engineering, Department of Cell Biology, RWTH Aachen, Pauwelstrasse 30, 52074 Aachen, Germany 3 Department of Internal Medicine I, Ulm University, Albert-Einstein Allee 11, 89081 Ulm, Germany Correspondence should be addressed to Alexander Kleger; [email protected] and Stefan Liebau; [email protected] Received 31 January 2013; Accepted 6 March 2013 Academic Editor: Michael Levin Copyright © 2013 Leonhard Linta et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ion channels are involved in a large variety of cellular processes including stem cell differentiation. Numerous families of ion channels are present in the organism which can be distinguished by means of, for example, ion selectivity, gating mechanism, composition, or cell biological function. To characterize the distinct expression of this group of ion channels we have compared the mRNA expression levels of ion channel genes between human keratinocyte-derived induced pluripotent stem cells (hiPSCs) and their somatic cell source, keratinocytes from plucked human hair. This comparison revealed that 26% of the analyzed probes showed an upregulation of ion channels in hiPSCs while just 6% were downregulated.
    [Show full text]
  • Ion Channels
    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
    [Show full text]
  • Nicotinic Receptors in Sleep-Related Hypermotor Epilepsy: Pathophysiology and Pharmacology
    brain sciences Review Nicotinic Receptors in Sleep-Related Hypermotor Epilepsy: Pathophysiology and Pharmacology Andrea Becchetti 1,* , Laura Clara Grandi 1 , Giulia Colombo 1 , Simone Meneghini 1 and Alida Amadeo 2 1 Department of Biotechnology and Biosciences, University of Milano-Bicocca, 20126 Milano, Italy; [email protected] (L.C.G.); [email protected] (G.C.); [email protected] (S.M.) 2 Department of Biosciences, University of Milano, 20133 Milano, Italy; [email protected] * Correspondence: [email protected] Received: 13 October 2020; Accepted: 21 November 2020; Published: 25 November 2020 Abstract: Sleep-related hypermotor epilepsy (SHE) is characterized by hyperkinetic focal seizures, mainly arising in the neocortex during non-rapid eye movements (NREM) sleep. The familial form is autosomal dominant SHE (ADSHE), which can be caused by mutations in genes encoding subunits of the neuronal nicotinic acetylcholine receptor (nAChR), Na+-gated K+ channels, as well as non-channel signaling proteins, such as components of the gap activity toward rags 1 (GATOR1) macromolecular complex. The causative genes may have different roles in developing and mature brains. Under this respect, nicotinic receptors are paradigmatic, as different pathophysiological roles are exerted by distinct nAChR subunits in adult and developing brains. The widest evidence concerns α4 and β2 subunits. These participate in heteromeric nAChRs that are major modulators of excitability in mature neocortical circuits as well as regulate postnatal synaptogenesis. However, growing evidence implicates mutant α2 subunits in ADSHE, which poses interpretive difficulties as very little is known about the function of α2-containing (α2*) nAChRs in the human brain.
    [Show full text]
  • Ca2+ and Brain-Derived Neurotrophic Factor (BDNF) in STC-1 Cells Jie Qian Virginia Commonwealth University
    Virginia Commonwealth University VCU Scholars Compass Physiology and Biophysics Publications Dept. of Physiology and Biophysics 2015 Nicotine-Induced Effects on Nicotinic Acetylcholine Receptors (nAChRs), Ca2+ and Brain-Derived Neurotrophic Factor (BDNF) in STC-1 Cells Jie Qian Virginia Commonwealth University Shobha K. Mummalaneni Virginia Commonwealth University Reem M. Alkahtan Virginia Commonwealth University See next page for additional authors Follow this and additional works at: http://scholarscompass.vcu.edu/phis_pubs Part of the Medicine and Health Sciences Commons Copyright: © 2016 Qian et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Downloaded from http://scholarscompass.vcu.edu/phis_pubs/54 This Article is brought to you for free and open access by the Dept. of Physiology and Biophysics at VCU Scholars Compass. It has been accepted for inclusion in Physiology and Biophysics Publications by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Authors Jie Qian, Shobha K. Mummalaneni, Reem M. Alkahtan, Sunila Mahavadi, Karnam S. Murthy, John R. Grider, and Vijay Lyall This article is available at VCU Scholars Compass: http://scholarscompass.vcu.edu/phis_pubs/54 RESEARCH ARTICLE Nicotine-Induced Effects on Nicotinic Acetylcholine Receptors (nAChRs), Ca2+ and Brain-Derived Neurotrophic
    [Show full text]
  • Ligand-Gated Ion Channels
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: Ligand-gated ion channels. British Journal of Pharmacology (2015) 172, 5870–5903 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: Ligand-gated ion channels Stephen PH Alexander1, John A Peters2, Eamonn Kelly3, Neil Marrion3, Helen E Benson4, Elena Faccenda4, Adam J Pawson4, Joanna L Sharman4, Christopher Southan4, Jamie A Davies4 and CGTP Collaborators L 1 School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, N 2Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/ doi/10.1111/bph.13350/full. Ligand-gated ion channels are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage- gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading. The Concise Guide is published in landscape format in order to facilitate comparison of related targets.
    [Show full text]
  • Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation
    WEB-ONLY CONTENT Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation Audrey Guilmatre, PhD; Christèle Dubourg, PhD; Anne-Laure Mosca, MD; Solenn Legallic, BSc; Alice Goldenberg, MD; Vale´rie Drouin-Garraud, MD; Vale´rie Layet, MD; Antoine Rosier, MD; Sylvain Briault, MD; Fre´de´rique Bonnet-Brilhault, MD, PhD; Fre´de´ric Laumonnier, PhD; Sylvie Odent, MD, PhD; Gael Le Vacon, MD; Ge´raldine Joly-Helas, MD; Ve´ronique David, MD; Claude Bendavid, MD; Jean-Michel Pinoit, MD; Ce´line Henry, MD; Caterina Impallomeni, MD; Eva Germano, MD; Gaetano Tortorella, MD; Gabriella Di Rosa, MD; Catherine Barthelemy, MD; Christian Andres, MD; Laurence Faivre, MD, PhD; Thierry Fre´bourg, MD, PhD; Pascale Saugier Veber, PhD; Dominique Campion, MD, PhD Arch Gen Psychiatry. 2009;66(9):947-956 eTable 1. Polymerase Chain Reaction Primers and Amplification Conditionsa Gene Forward Primer Reverse Primer Amplicon Size, bp NRXN1␣ exon 1 CGTTAGATAGTCGGGACCCTTATTTCTTCG GATAGGGTTA GCAGCAGGCGTTCCACTT 258 NRXN1␣ exon 5 CGTTAGATAGTAGTGGAGCCTGTGAATGGAAAG GATAGGGTTAGAGGAGCCCTGTATCATGTTGTT 192 NRXN1␤ exon 4 CGTTAGATAGGCCTGGCCCTGCTTTGG GATAGGGTTAGGAAATGGTGGATGTGGTGC 119 DPP10 CGTTAGATAGCAGATAAGTTCCATATTGACTGGG GATAGGGTTAGCTGTTATTTGGTCCTTTACTTCT 180 ERBB4 CGTTAGATAGCCGAGGATGAGTATGTGAATGA GATAGGGTTAGAAGGGTGCTCCGAGGTG 188 CNTN4 CGTTAGATAGGATCTTCAATGAATACCCTTCC GATAGGGTTACCCAGGACCTTGTGGTTTGT 170 GRM7 CGTTAGATAGTGTGAGCCTTGCGATGGTTA GATAGGGTTAGGGCGTGTCATTGTAGCG 245 NLGN1 CGTTAGATAGGATAAGAGGGATTAAGAAGGAACTCA
    [Show full text]
  • Retrograde Inhibition by a Specific Subset of Interpeduncular Α5 Nicotinic Neurons Regulates Nicotine Preference
    Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference Jessica L. Ablesa,b,c, Andreas Görlicha,1, Beatriz Antolin-Fontesa,2,CuidongWanga, Sylvia M. Lipforda, Michael H. Riada, Jing Rend,e,3,FeiHud,e,4,MinminLuod,e,PaulJ.Kennyc, Nathaniel Heintza,f,5, and Ines Ibañez-Tallona,5 aLaboratory of Molecular Biology, The Rockefeller University, New York, NY 10065; bDepartment of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY 10029; dNational Institute of Biological Sciences, Beijing 102206, China; eSchool of Life Sciences, Tsinghua University, Beijing 100084, China; and fHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Nathaniel Heintz, October 23, 2017 (sent for review October 5, 2017; reviewed by Jean-Pierre Changeux and Lorna W. Role) Repeated exposure to drugs of abuse can produce adaptive changes nicotine withdrawal, and optical activation of IPN GABAergic cells that lead to the establishment of dependence. It has been shown that is sufficient to produce a withdrawal syndrome, while blockade of allelic variation in the α5 nicotinic acetylcholine receptor (nAChR) gene GABAergic cells in the IPN reduced symptoms of withdrawal (17). CHRNA5 is associated with higher risk of tobacco dependence. In the Taken together these studies highlight the critical role of α5in brain, α5-containing nAChRs are expressed at very high levels in the regulating behavioral responses to nicotine. Here we characterize two subpopulations of GABAergic interpeduncular nucleus (IPN). Here we identified two nonoverlapping Amigo1 Epyc α + α Amigo1 α Epyc neurons in the IPN that express α5: α5- and α5- neu- 5 cell populations ( 5- and 5- ) in mouse IPN that respond α Amigo1 α Epyc differentially to nicotine.
    [Show full text]
  • Retrograde Inhibition by a Specific Subset of Interpeduncular Α5 Nicotinic Neurons Regulates Nicotine Preference
    Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference Jessica L. Ablesa,b,c, Andreas Görlicha,1, Beatriz Antolin-Fontesa,2,CuidongWanga, Sylvia M. Lipforda, Michael H. Riada, Jing Rend,e,3,FeiHud,e,4,MinminLuod,e,PaulJ.Kennyc, Nathaniel Heintza,f,5, and Ines Ibañez-Tallona,5 aLaboratory of Molecular Biology, The Rockefeller University, New York, NY 10065; bDepartment of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY 10029; dNational Institute of Biological Sciences, Beijing 102206, China; eSchool of Life Sciences, Tsinghua University, Beijing 100084, China; and fHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Nathaniel Heintz, October 23, 2017 (sent for review October 5, 2017; reviewed by Jean-Pierre Changeux and Lorna W. Role) Repeated exposure to drugs of abuse can produce adaptive changes nicotine withdrawal, and optical activation of IPN GABAergic cells that lead to the establishment of dependence. It has been shown that is sufficient to produce a withdrawal syndrome, while blockade of allelic variation in the α5 nicotinic acetylcholine receptor (nAChR) gene GABAergic cells in the IPN reduced symptoms of withdrawal (17). CHRNA5 is associated with higher risk of tobacco dependence. In the Taken together these studies highlight the critical role of α5in brain, α5-containing nAChRs are expressed at very high levels in the regulating behavioral responses to nicotine. Here we characterize two subpopulations of GABAergic interpeduncular nucleus (IPN). Here we identified two nonoverlapping Amigo1 Epyc α + α Amigo1 α Epyc neurons in the IPN that express α5: α5- and α5- neu- 5 cell populations ( 5- and 5- ) in mouse IPN that respond α Amigo1 α Epyc differentially to nicotine.
    [Show full text]
  • Nicotinic Receptors Atlas in the Adult Human Lung
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.29.176750; this version posted August 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Nicotinic receptors atlas in the adult human lung 2 3 Zania Diabasana1, Jeanne-Marie Perotin1,2, Randa Belgacemi1, Julien Ancel1,2, Pauline 4 Mulette1,2, Gonzague Delepine3, Philippe Gosset4, Uwe Maskos5, Myriam Polette1,6, Gaëtan 5 Deslée1,2, Valérian Dormoy1 6 7 1University of Reims Champagne-Ardenne, Inserm, P3Cell UMR-S1250, SFR CAP-SANTE, 8 51092 Reims, France 9 2CHU of Reims, Hôpital Maison Blanche, Department of respiratory diseases, 51092 Reims, 10 France 11 3CHU of Reims, Hôpital Maison Blanche, Department of thoracic surgery, 51092 Reims, 12 France 13 4University of Lille, CNRS UMR9017, Inserm U1019, CHRU Lille, Pasteur Institute of Lille, 14 CIIL - Center for Infection and Immunity of Lille, 59000 Lille, France 15 5Pasteur Institute of Paris, Integrative Neurobiology of Cholinergic Systems, CNRS UMR 16 3571, Paris, France. 17 6CHU Reims, Hôpital Maison Blanche, Department of biopathology, 51092 Reims, France 18 19 Correspondence to: 20 Dr Valérian Dormoy 21 Inserm UMR-S 1250 22 University of Reims Champagne-Ardenne 23 CHU Maison Blanche 24 45 rue Cognacq-Jay 25 51092 Reims 26 Phone +33 (0)3 10 73 62 28; Fax +33 (0)3 26 06 58 61 27 e-mail: [email protected] 28 29 Short title: lung nicotinic receptors 30 31 32 33 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.29.176750; this version posted August 13, 2020.
    [Show full text]
  • Structure, Dynamics, and Ligand Recognition of Human-Specific CHRFAM7A (Dup7) Nicotinic Receptor Linked to Neuropsychiatric Diso
    International Journal of Molecular Sciences Article Structure, Dynamics, and Ligand Recognition of Human-Specific CHRFAM7A (Dupα7) Nicotinic Receptor Linked to Neuropsychiatric Disorders Danlin Liu 1,†, João V. de Souza 1,†, Ayaz Ahmad 1 and Agnieszka K. Bronowska 1,2,* 1 Chemistry—School of Natural and Environmental Sciences, Newcastle University, Newcastle NE1 7RU, UK; [email protected] (D.L.); [email protected] (J.V.d.S.); [email protected] (A.A.) 2 Newcastle University Centre for Cancer, Newcastle University, Newcastle NE1 7RU, UK * Correspondence: [email protected] † Equal contribution. Abstract: Cholinergic α7 nicotinic receptors encoded by the CHRNA7 gene are ligand-gated ion chan- nels directly related to memory and immunomodulation. Exons 5–7 in CHRNA7 can be duplicated and fused to exons A-E of FAR7a, resulting in a hybrid gene known as CHRFAM7A, unique to humans. Its product, denoted herein as Dupα7, is a truncated subunit where the N-terminal 146 residues of the ligand binding domain of the α7 receptor have been replaced by 27 residues from FAM7. Dupα7 negatively affects the functioning of α7 receptors associated with neurological disorders, including Alzheimer’s diseases and schizophrenia. However, the stoichiometry for the α7 nicotinic receptor containing dupα7 monomers remains unknown. In this work, we developed computational models Citation: Liu, D.; de Souza, J.V.; of all possible combinations of wild-type α7 and dupα7 pentamers and evaluated their stability via Ahmad, A.; Bronowska, A.K. atomistic molecular dynamics and coarse-grain simulations. We assessed the effect of dupα7 subunits Structure, Dynamics, and Ligand on the Ca2+ conductance using free energy calculations.
    [Show full text]
  • A Human-Specific A7-Nicotinic Acetylcholine Receptor Gene In
    A Human-Specific α7-Nicotinic Acetylcholine Receptor Gene in Human Leukocytes: Identification, Regulation and the Consequences of CHRFAM7A Expression Todd W Costantini,1* Xitong Dang,1,2* Maryana V Yurchyshyna,1 Raul Coimbra,1 Brian P Eliceiri,1 and Andrew Baird1 1Department of Surgery, University of California San Diego Health Sciences, San Diego, California, United States of America; and 2Cardiovascular Research Center, Luzhou Medical College, Luzhou, Sichuan, China The human genome contains a variant form of the α7-nicotinic acetylcholine receptor (α7nAChR) gene that is uniquely human. This CHRFAM7A gene arose during human speciation and recent data suggests that its expression alters ligand tropism of the normally homopentameric human α7-AChR ligand-gated cell surface ion channel that is found on the surface of many dif- ferent cell types. To understand its possible significance in regulating inflammation in humans, we investigated its expression in nor- mal human leukocytes and leukocyte cell lines, compared CHRFAM7A expression to that of the CHRNA7 gene, mapped its pro- moter and characterized the effects of stable CHRFAM7A overexpression. We report here that CHRFAM7A is highly expressed in human leukocytes but that the levels of both CHRFAM7A and CHRNA7 mRNAs were independent and varied widely. To this end, mapping of the CHRFAM7A promoter in its 5′-untranslated region (UTR) identified a unique 1-kb sequence that independently reg- ulates CHRFAM7A gene expression. Because overexpression of CHRFAM7A in THP1 cells altered the cell phenotype and modified the expression of genes associated with focal adhesion (for example, FAK, P13K, Akt, rho, GEF, Elk1, CycD), leukocyte transepithe- lial migration (Nox, ITG, MMPs, PKC) and cancer (kit, kitL, ras, cFos cyclinD1, Frizzled and GPCR), we conclude that CHRFAM7A is bi- ologically active.
    [Show full text]