DOCSLIB.ORG

7-Nicotinic Acetylcholine Receptor Subunit Gene (CHRNA7)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
7-Nicotinic Acetylcholine Receptor Subunit Gene (CHRNA7) American Journal of Medical Genetics 105:20–22 (2001) Brief Research Communication Linkage Disequilibrium for Schizophrenia at the Chromosome 15q13-14 Locus of the ␣7-Nicotinic Acetylcholine Receptor Subunit Gene (CHRNA7) Robert Freedman,1* Sherry Leonard,1 Judith M. Gault,1 Jan Hopkins,1 C. Robert Cloninger,2 Charles A. Kaufmann,2 Ming T. Tsuang,2 Stephen V. Farone,2 Dolores Malaspina,2 Dragan M. Svrakic,2 Alan Sanders,3 and Pablo Gejman3 1Departments of Psychiatry and Pharmacology, University of Colorado Health Sciences Center and Denver VA Medical Center, Denver, Colorado 2NIMH Schizophrenia Genetics Initiative, Bethesda, Maryland 3Department of Psychiatry, University of Chicago, Chicago, Illinois The transmission/disequilibrium test was We reported an initial linkage for a neurophysiologi- used for fine mapping of the linkage of cal phenotype associated with schizophrenia to genetic schizophrenia to the chromosome 15q13-14 markers at chromosome 15q13-14 in nine multiply af- region, the site of a candidate gene, the ␣7 fected, European American families. The lod score for nicotinic acetylcholine receptor subunit the neurophysiological phenotype at D15S1360 was Z -P < 0.001; the lod score for schizophre .0.0 ס ␪ ,5.3 ס gene (CHRNA7), in parent–child triads from P < 0.007, in an ,0.07 ס ␪ ,1.3 ס the NIMH Schizophrenia Genetics Initiative nia was lower, Z families. This candidate gene was identified affecteds-only model [Freedman et al., 1997]. The lod from neurobiological studies of deficits in score for schizophrenia was less than the lod score for schizophrenics of the inhibitory gating of the neurophysiological phenotype, principally because the P50 auditory evoked potential. The neu- the neurophysiological phenotype diminished inhibi- robiological deficit was also used as a phe- tion of the P50 auditory evoked response to repeated notype for subsequent linkage analysis. In the present study, significant genotype-wise stimuli, has a highly penetrant dominant inheritance, disequilibrium (P < 0.007) was found at whereas schizophrenia is a less penetrant and more D15S165, a polymorphic simple sequence heterogeneous phenotype [Freedman et al., 1999]. Al- marker physically located within 1 mega- though biological phenotypes have been successfully base of both CHRNA7 and a partially dupli- used as surrogates for the genetic analyses of other cated, expressed sequence that includes ex- illnesses, including colon cancer (polyp formation), ons 5–10 of CHRNA7. Replication of this re- sickle-cell anemia (laboratory demonstration of red cell sult was found in an additional set of sickling), and hemochromatosis (serum iron levels), families. The results support this region as a this approach has not been widely employed for psy- chromosomal location involved in the ge- chiatric illnesses. The test of the value of this approach netic transmission of schizophrenia. Am. J. is whether it leads to replicable linkage findings and, Med. Genet. (Neuropsychiatr. Genet.) 105: ultimately, to the discovery of pathogenic molecular 20–22, 2001. © 2001 Wiley-Liss, Inc. changes. Because P50 inhibition is not generally mea- sured in genetic studies, replication of the finding in KEY WORDS: human chromosome pair 15; other samples has been performed using schizophrenia genetic linkage; nicotinic re- as the phenotype. A similar low positive score was re- ceptor; polymorphism; ported in the NIMH Genetics Initiative Schizophrenia P <0.002 .0.0 ס ␪ ,1.5 ס schizophrenia families by us at D15S1360, Z [Leonard et al., 1998]. The NIMH Genetics Initiative Contract grant sponsors: Veterans Affairs Medical Research investigators independently published a replication, Service, National Association for Research on Schizophrenia and with a multipoint linkage score derived from markers Affective Disorders, Colorado Associates, Inc., USPHS; Contract in the region; the Z score was higher for African Ameri- grant numbers: MH38321, DA09457. can than for European American families in the sample *Correspondence to: Robert Freedman, Department of Psychia- try C-268-71, University of Colorado Health Sciences Center, [Kaufmann et al., 1998]. A subsequent study of Bantu 4200 East Ninth Ave., Denver, CO 80262. families with D15S1360 revealed a positive nonpara- E-mail: [email protected] metric linkage score and significant transmission dis- Received 2 March 2000; Accepted 4 May 2000 equilibrium [Riley et al., 2000], and two other groups © 2001 Wiley-Liss, Inc. Chromosome 15 Disequilibrium in Schizophrenia 21 reported negative findings [Neves-Pereira et al., 1998; physical map confirms this location [Gault et al., 1998]. Curtis et al., 1999]. Interestingly, one of the groups Heterozygosity of the markers was also estimated from reporting negative findings has positive findings of CEPH families (D15S165 0.86; D15S1360 0.57; transmission disequilibrium with D15S1360 in their D15S144 0.69). The genetic distance between D15S165 bipolar families [Neves-Pereira et al., 1999]. The flank- and D15S144 is 6.4 cm; the physical distance is ap- ing marker ACTC has recently been reported to show a proximately 2.7 mb, contained within overlapping lod score of 3.46 in a selected population of lithium- YAC’s 940c5 and 810f11. The families of the NIMH responsive bipolar families [Turecki et al., 2000]. Genetics Initiative, whose ascertainment has previ- D15S1360 is a simple sequence repeat that is within ously been described, were studied [Kaufmann et al., 120 kb of the coding region of the ␣7 nicotinic acetyl- 1998]. Sixty-two parent–child triads in 50 families choline receptor subunit gene (CHRNA 7) [Gault et al., were examined. Genotyping with these markers has 1998]. This marker was chosen because preliminary been previously described [Leonard et al., 1998]. analysis had shown evidence for linkage of the P50 Table I demonstrates significant genotype-wise inhibitory abnormality at chromosome 15q14, which transmission disequilibrium for D15S165 (genotype- df, P < 0.007). The empirical P-value 24 ,44.5 ס was subsequently shown to be the locus of CHRNA7 wise ␹2 [Coon et al., 1993; Chini et al., 1994]. CHRNA7 is a from 1,000 Monte Carlo simulations was P < 0.0310 ± viable candidate gene because of neurobiological evi- 0.0055 (SE). Because there is preexisting information dence indicating the involvement in P50 inhibition of about linkage in this region, the analysis was repeated the nicotinic receptor that is coded for by this gene using only the oldest affected individual in each sibling [Freedman et al., 1994]. CHRNA7 itself has a compli- pair. The allele-wise significance was P < 0.044 and the cated genomic structure. The gene has 10 exons that genotype-wise significance was P < 0.040, demonstrat- are conserved across chick and other mammalian spe- ing a positive test of association with D15S165. Repli- cies. However, the human gene is part of a duplicated cation of the D15S165 transmission disequilibrium was cassette of expressed sequences; the duplicons are lo- assessed in an independent sample of 47 triads from 47 cated nearly adjacent to each other within approxi- families, 45 of which were European American [Cao et mately 1 mb of DNA at chromosome 15q14. The dupli- al., 1997]; a genotype-wise significance of P < 0.019 was con that contains CHRNA7, and is adjacent to found. D15S1360, is telomeric of a duplicon that contains an Stratification of the NIMH sample into African expressed sequence which has four novel exons fol- Americans and European Americans revealed similar lowed by six exons which duplicate exons 5–10 of the genotype-wise disequilibrium in both groups at this full-length CHRNA7. The sequence homology between marker. Transmission disequilibrium of D15S144, these last six exons and CHRNA7 is over 99% [Gault et which was not significant in the entire sample, was al., 1998]. The functional significance of this duplica- significantly responsible for transmission disequilib- tion is unknown. Mutation screening of the coding re- rium in the European American sample. Transmission gion of the full-length CHRNA7 reveals no polymor- disequilibrium of D15S1360 was not significant in ei- phism that is uniquely found in a high proportion of ther the entire sample or in the two subsets. Examina- people with schizophrenia [Gault et al., 1999]. There- tion of the transmission of specific alleles of each fore, additional mapping and sequencing outside the marker showed that a rare allele of D15S165 (206 bp, coding region of CHRNA7 is required to find the mo- CEPH frequency 0.01) was transmitted to 14 of 15 lecular alterations that give rise to the linkage signal schizophrenics in three African American and four Eu- and to the dysfunction of the ␣7 nicotinic receptor in ropean American pedigrees (P < 0.000006). In addition, schizophrenia. the 190 bp allele of D15S165 (CEPH frequency 0.03) The fine mapping of complex traits to genetic loci is was significantly transmitted in African Americans frequently necessary in the discovery of the molecular DNA polymorphisms that are responsible for patho- genic alterations in gene function. For rare genetic ill- TABLE I. Linkage Disequilibrium Mapping of Schizophrenia at nesses, single recombinations are often informative be- Chromosome 15q14 cause the rareness of the illness makes it unlikely that Significance (P) of Transmission Disequilibrium: an allelic or genetic variant or even a phenocopy is Marker Allele-wise Genotype-wise responsible for the apparent recombination. However, in a common, complex trait like schizophrenia, these Total sample D15S165 0.071 0.0069* alternative explanations are as likely, if not more D15S1360 0.18 0.26 likely, than a recombination, particularly in families D15S144 0.16 0.17 ascertained by an affected sibpair. Therefore, linkage African Americans disequilibrium was selected as a strategy for fine map- D15S165 0.25 0.066 ping. All probability inferences are from ␹2 tests, un- D15S1360 0.32 0.23 less otherwise noted. D15S144 0.94 0.87 European Americans The extended transmission disequilibrium test D15S165 0.058 0.059 (ETDT) [Sham and Curtis, 1995] was used for fine D15S1360 0.24 0.33 mapping of the region indicated to be involved in link- D15S144 0.036 0.012* age.
Load more

Recommended publications
  • Gene Expression Studies in Depression Development and Treatment
    Mariani et al. Translational Psychiatry (2021) 11:354 https://doi.org/10.1038/s41398-021-01469-6 Translational Psychiatry REVIEW ARTICLE Open Access Gene expression studies in Depression development and treatment: an overview of the underlying molecular mechanisms and biological processes to identify biomarkers Nicole Mariani 1, Nadia Cattane2,CarminePariante 1 and Annamaria Cattaneo 2,3 Abstract A combination of different risk factors, such as genetic, environmental and psychological factors, together with immune system, stress response, brain neuroplasticity and the regulation of neurotransmitters, is thought to lead to the development of major depressive disorder (MDD). A growing number of studies have tried to investigate the underlying mechanisms of MDD by analysing the expression levels of genes involved in such biological processes. These studies have shown that MDD is not just a brain disorder, but also a body disorder, and this is mainly due to the interplay between the periphery and the Central Nervous System (CNS). To this purpose, most of the studies conducted so far have mainly dedicated to the analysis of the gene expression levels using postmortem brain tissue as well as peripheral blood samples of MDD patients. In this paper, we reviewed the current literature on candidate gene expression alterations and the few existing transcriptomics studies in MDD focusing on inflammation, neuroplasticity, neurotransmitters and stress-related genes. Moreover, we focused our attention on studies, which have investigated 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; mRNA levels as biomarkers to predict therapy outcomes. This is important as many patients do not respond to antidepressant medication or could experience adverse side effects, leading to the interruption of treatment.
    [Show full text]
  • Research Article Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed Hipscs To
    Hindawi Publishing Corporation Stem Cells International Volume 2013, Article ID 784629, 25 pages http://dx.doi.org/10.1155/2013/784629 Research Article Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed hiPSCs to Differentiated Neuronal and Cardiac Progeny Leonhard Linta,1 Marianne Stockmann,1 Qiong Lin,2 André Lechel,3 Christian Proepper,1 Tobias M. Boeckers,1 Alexander Kleger,3 and Stefan Liebau1 1 InstituteforAnatomyCellBiology,UlmUniversity,Albert-EinsteinAllee11,89081Ulm,Germany 2 Institute for Biomedical Engineering, Department of Cell Biology, RWTH Aachen, Pauwelstrasse 30, 52074 Aachen, Germany 3 Department of Internal Medicine I, Ulm University, Albert-Einstein Allee 11, 89081 Ulm, Germany Correspondence should be addressed to Alexander Kleger; [email protected] and Stefan Liebau; [email protected] Received 31 January 2013; Accepted 6 March 2013 Academic Editor: Michael Levin Copyright © 2013 Leonhard Linta et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ion channels are involved in a large variety of cellular processes including stem cell differentiation. Numerous families of ion channels are present in the organism which can be distinguished by means of, for example, ion selectivity, gating mechanism, composition, or cell biological function. To characterize the distinct expression of this group of ion channels we have compared the mRNA expression levels of ion channel genes between human keratinocyte-derived induced pluripotent stem cells (hiPSCs) and their somatic cell source, keratinocytes from plucked human hair. This comparison revealed that 26% of the analyzed probes showed an upregulation of ion channels in hiPSCs while just 6% were downregulated.
    [Show full text]
  • Ion Channels
    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
    [Show full text]
  • Nicotinic Receptors in Sleep-Related Hypermotor Epilepsy: Pathophysiology and Pharmacology
    brain sciences Review Nicotinic Receptors in Sleep-Related Hypermotor Epilepsy: Pathophysiology and Pharmacology Andrea Becchetti 1,* , Laura Clara Grandi 1 , Giulia Colombo 1 , Simone Meneghini 1 and Alida Amadeo 2 1 Department of Biotechnology and Biosciences, University of Milano-Bicocca, 20126 Milano, Italy; [email protected] (L.C.G.); [email protected] (G.C.); [email protected] (S.M.) 2 Department of Biosciences, University of Milano, 20133 Milano, Italy; [email protected] * Correspondence: [email protected] Received: 13 October 2020; Accepted: 21 November 2020; Published: 25 November 2020 Abstract: Sleep-related hypermotor epilepsy (SHE) is characterized by hyperkinetic focal seizures, mainly arising in the neocortex during non-rapid eye movements (NREM) sleep. The familial form is autosomal dominant SHE (ADSHE), which can be caused by mutations in genes encoding subunits of the neuronal nicotinic acetylcholine receptor (nAChR), Na+-gated K+ channels, as well as non-channel signaling proteins, such as components of the gap activity toward rags 1 (GATOR1) macromolecular complex. The causative genes may have different roles in developing and mature brains. Under this respect, nicotinic receptors are paradigmatic, as different pathophysiological roles are exerted by distinct nAChR subunits in adult and developing brains. The widest evidence concerns α4 and β2 subunits. These participate in heteromeric nAChRs that are major modulators of excitability in mature neocortical circuits as well as regulate postnatal synaptogenesis. However, growing evidence implicates mutant α2 subunits in ADSHE, which poses interpretive difficulties as very little is known about the function of α2-containing (α2*) nAChRs in the human brain.
    [Show full text]
  • Ca2+ and Brain-Derived Neurotrophic Factor (BDNF) in STC-1 Cells Jie Qian Virginia Commonwealth University
    Virginia Commonwealth University VCU Scholars Compass Physiology and Biophysics Publications Dept. of Physiology and Biophysics 2015 Nicotine-Induced Effects on Nicotinic Acetylcholine Receptors (nAChRs), Ca2+ and Brain-Derived Neurotrophic Factor (BDNF) in STC-1 Cells Jie Qian Virginia Commonwealth University Shobha K. Mummalaneni Virginia Commonwealth University Reem M. Alkahtan Virginia Commonwealth University See next page for additional authors Follow this and additional works at: http://scholarscompass.vcu.edu/phis_pubs Part of the Medicine and Health Sciences Commons Copyright: © 2016 Qian et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Downloaded from http://scholarscompass.vcu.edu/phis_pubs/54 This Article is brought to you for free and open access by the Dept. of Physiology and Biophysics at VCU Scholars Compass. It has been accepted for inclusion in Physiology and Biophysics Publications by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Authors Jie Qian, Shobha K. Mummalaneni, Reem M. Alkahtan, Sunila Mahavadi, Karnam S. Murthy, John R. Grider, and Vijay Lyall This article is available at VCU Scholars Compass: http://scholarscompass.vcu.edu/phis_pubs/54 RESEARCH ARTICLE Nicotine-Induced Effects on Nicotinic Acetylcholine Receptors (nAChRs), Ca2+ and Brain-Derived Neurotrophic
    [Show full text]
  • Ligand-Gated Ion Channels
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: Ligand-gated ion channels. British Journal of Pharmacology (2015) 172, 5870–5903 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: Ligand-gated ion channels Stephen PH Alexander1, John A Peters2, Eamonn Kelly3, Neil Marrion3, Helen E Benson4, Elena Faccenda4, Adam J Pawson4, Joanna L Sharman4, Christopher Southan4, Jamie A Davies4 and CGTP Collaborators L 1 School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, N 2Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/ doi/10.1111/bph.13350/full. Ligand-gated ion channels are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage- gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading. The Concise Guide is published in landscape format in order to facilitate comparison of related targets.
    [Show full text]
  • Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation
    WEB-ONLY CONTENT Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation Audrey Guilmatre, PhD; Christèle Dubourg, PhD; Anne-Laure Mosca, MD; Solenn Legallic, BSc; Alice Goldenberg, MD; Vale´rie Drouin-Garraud, MD; Vale´rie Layet, MD; Antoine Rosier, MD; Sylvain Briault, MD; Fre´de´rique Bonnet-Brilhault, MD, PhD; Fre´de´ric Laumonnier, PhD; Sylvie Odent, MD, PhD; Gael Le Vacon, MD; Ge´raldine Joly-Helas, MD; Ve´ronique David, MD; Claude Bendavid, MD; Jean-Michel Pinoit, MD; Ce´line Henry, MD; Caterina Impallomeni, MD; Eva Germano, MD; Gaetano Tortorella, MD; Gabriella Di Rosa, MD; Catherine Barthelemy, MD; Christian Andres, MD; Laurence Faivre, MD, PhD; Thierry Fre´bourg, MD, PhD; Pascale Saugier Veber, PhD; Dominique Campion, MD, PhD Arch Gen Psychiatry. 2009;66(9):947-956 eTable 1. Polymerase Chain Reaction Primers and Amplification Conditionsa Gene Forward Primer Reverse Primer Amplicon Size, bp NRXN1␣ exon 1 CGTTAGATAGTCGGGACCCTTATTTCTTCG GATAGGGTTA GCAGCAGGCGTTCCACTT 258 NRXN1␣ exon 5 CGTTAGATAGTAGTGGAGCCTGTGAATGGAAAG GATAGGGTTAGAGGAGCCCTGTATCATGTTGTT 192 NRXN1␤ exon 4 CGTTAGATAGGCCTGGCCCTGCTTTGG GATAGGGTTAGGAAATGGTGGATGTGGTGC 119 DPP10 CGTTAGATAGCAGATAAGTTCCATATTGACTGGG GATAGGGTTAGCTGTTATTTGGTCCTTTACTTCT 180 ERBB4 CGTTAGATAGCCGAGGATGAGTATGTGAATGA GATAGGGTTAGAAGGGTGCTCCGAGGTG 188 CNTN4 CGTTAGATAGGATCTTCAATGAATACCCTTCC GATAGGGTTACCCAGGACCTTGTGGTTTGT 170 GRM7 CGTTAGATAGTGTGAGCCTTGCGATGGTTA GATAGGGTTAGGGCGTGTCATTGTAGCG 245 NLGN1 CGTTAGATAGGATAAGAGGGATTAAGAAGGAACTCA
    [Show full text]
  • Retrograde Inhibition by a Specific Subset of Interpeduncular Α5 Nicotinic Neurons Regulates Nicotine Preference
    Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference Jessica L. Ablesa,b,c, Andreas Görlicha,1, Beatriz Antolin-Fontesa,2,CuidongWanga, Sylvia M. Lipforda, Michael H. Riada, Jing Rend,e,3,FeiHud,e,4,MinminLuod,e,PaulJ.Kennyc, Nathaniel Heintza,f,5, and Ines Ibañez-Tallona,5 aLaboratory of Molecular Biology, The Rockefeller University, New York, NY 10065; bDepartment of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY 10029; dNational Institute of Biological Sciences, Beijing 102206, China; eSchool of Life Sciences, Tsinghua University, Beijing 100084, China; and fHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Nathaniel Heintz, October 23, 2017 (sent for review October 5, 2017; reviewed by Jean-Pierre Changeux and Lorna W. Role) Repeated exposure to drugs of abuse can produce adaptive changes nicotine withdrawal, and optical activation of IPN GABAergic cells that lead to the establishment of dependence. It has been shown that is sufficient to produce a withdrawal syndrome, while blockade of allelic variation in the α5 nicotinic acetylcholine receptor (nAChR) gene GABAergic cells in the IPN reduced symptoms of withdrawal (17). CHRNA5 is associated with higher risk of tobacco dependence. In the Taken together these studies highlight the critical role of α5in brain, α5-containing nAChRs are expressed at very high levels in the regulating behavioral responses to nicotine. Here we characterize two subpopulations of GABAergic interpeduncular nucleus (IPN). Here we identified two nonoverlapping Amigo1 Epyc α + α Amigo1 α Epyc neurons in the IPN that express α5: α5- and α5- neu- 5 cell populations ( 5- and 5- ) in mouse IPN that respond α Amigo1 α Epyc differentially to nicotine.
    [Show full text]
  • Retrograde Inhibition by a Specific Subset of Interpeduncular Α5 Nicotinic Neurons Regulates Nicotine Preference
    Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference Jessica L. Ablesa,b,c, Andreas Görlicha,1, Beatriz Antolin-Fontesa,2,CuidongWanga, Sylvia M. Lipforda, Michael H. Riada, Jing Rend,e,3,FeiHud,e,4,MinminLuod,e,PaulJ.Kennyc, Nathaniel Heintza,f,5, and Ines Ibañez-Tallona,5 aLaboratory of Molecular Biology, The Rockefeller University, New York, NY 10065; bDepartment of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY 10029; dNational Institute of Biological Sciences, Beijing 102206, China; eSchool of Life Sciences, Tsinghua University, Beijing 100084, China; and fHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Nathaniel Heintz, October 23, 2017 (sent for review October 5, 2017; reviewed by Jean-Pierre Changeux and Lorna W. Role) Repeated exposure to drugs of abuse can produce adaptive changes nicotine withdrawal, and optical activation of IPN GABAergic cells that lead to the establishment of dependence. It has been shown that is sufficient to produce a withdrawal syndrome, while blockade of allelic variation in the α5 nicotinic acetylcholine receptor (nAChR) gene GABAergic cells in the IPN reduced symptoms of withdrawal (17). CHRNA5 is associated with higher risk of tobacco dependence. In the Taken together these studies highlight the critical role of α5in brain, α5-containing nAChRs are expressed at very high levels in the regulating behavioral responses to nicotine. Here we characterize two subpopulations of GABAergic interpeduncular nucleus (IPN). Here we identified two nonoverlapping Amigo1 Epyc α + α Amigo1 α Epyc neurons in the IPN that express α5: α5- and α5- neu- 5 cell populations ( 5- and 5- ) in mouse IPN that respond α Amigo1 α Epyc differentially to nicotine.
    [Show full text]
  • Nicotinic Receptors Atlas in the Adult Human Lung
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.29.176750; this version posted August 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Nicotinic receptors atlas in the adult human lung 2 3 Zania Diabasana1, Jeanne-Marie Perotin1,2, Randa Belgacemi1, Julien Ancel1,2, Pauline 4 Mulette1,2, Gonzague Delepine3, Philippe Gosset4, Uwe Maskos5, Myriam Polette1,6, Gaëtan 5 Deslée1,2, Valérian Dormoy1 6 7 1University of Reims Champagne-Ardenne, Inserm, P3Cell UMR-S1250, SFR CAP-SANTE, 8 51092 Reims, France 9 2CHU of Reims, Hôpital Maison Blanche, Department of respiratory diseases, 51092 Reims, 10 France 11 3CHU of Reims, Hôpital Maison Blanche, Department of thoracic surgery, 51092 Reims, 12 France 13 4University of Lille, CNRS UMR9017, Inserm U1019, CHRU Lille, Pasteur Institute of Lille, 14 CIIL - Center for Infection and Immunity of Lille, 59000 Lille, France 15 5Pasteur Institute of Paris, Integrative Neurobiology of Cholinergic Systems, CNRS UMR 16 3571, Paris, France. 17 6CHU Reims, Hôpital Maison Blanche, Department of biopathology, 51092 Reims, France 18 19 Correspondence to: 20 Dr Valérian Dormoy 21 Inserm UMR-S 1250 22 University of Reims Champagne-Ardenne 23 CHU Maison Blanche 24 45 rue Cognacq-Jay 25 51092 Reims 26 Phone +33 (0)3 10 73 62 28; Fax +33 (0)3 26 06 58 61 27 e-mail: [email protected] 28 29 Short title: lung nicotinic receptors 30 31 32 33 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.29.176750; this version posted August 13, 2020.
    [Show full text]
  • Structure, Dynamics, and Ligand Recognition of Human-Specific CHRFAM7A (Dup7) Nicotinic Receptor Linked to Neuropsychiatric Diso
    International Journal of Molecular Sciences Article Structure, Dynamics, and Ligand Recognition of Human-Specific CHRFAM7A (Dupα7) Nicotinic Receptor Linked to Neuropsychiatric Disorders Danlin Liu 1,†, João V. de Souza 1,†, Ayaz Ahmad 1 and Agnieszka K. Bronowska 1,2,* 1 Chemistry—School of Natural and Environmental Sciences, Newcastle University, Newcastle NE1 7RU, UK; [email protected] (D.L.); [email protected] (J.V.d.S.); [email protected] (A.A.) 2 Newcastle University Centre for Cancer, Newcastle University, Newcastle NE1 7RU, UK * Correspondence: [email protected] † Equal contribution. Abstract: Cholinergic α7 nicotinic receptors encoded by the CHRNA7 gene are ligand-gated ion chan- nels directly related to memory and immunomodulation. Exons 5–7 in CHRNA7 can be duplicated and fused to exons A-E of FAR7a, resulting in a hybrid gene known as CHRFAM7A, unique to humans. Its product, denoted herein as Dupα7, is a truncated subunit where the N-terminal 146 residues of the ligand binding domain of the α7 receptor have been replaced by 27 residues from FAM7. Dupα7 negatively affects the functioning of α7 receptors associated with neurological disorders, including Alzheimer’s diseases and schizophrenia. However, the stoichiometry for the α7 nicotinic receptor containing dupα7 monomers remains unknown. In this work, we developed computational models Citation: Liu, D.; de Souza, J.V.; of all possible combinations of wild-type α7 and dupα7 pentamers and evaluated their stability via Ahmad, A.; Bronowska, A.K. atomistic molecular dynamics and coarse-grain simulations. We assessed the effect of dupα7 subunits Structure, Dynamics, and Ligand on the Ca2+ conductance using free energy calculations.
    [Show full text]
  • A Human-Specific A7-Nicotinic Acetylcholine Receptor Gene In
    A Human-Specific α7-Nicotinic Acetylcholine Receptor Gene in Human Leukocytes: Identification, Regulation and the Consequences of CHRFAM7A Expression Todd W Costantini,1* Xitong Dang,1,2* Maryana V Yurchyshyna,1 Raul Coimbra,1 Brian P Eliceiri,1 and Andrew Baird1 1Department of Surgery, University of California San Diego Health Sciences, San Diego, California, United States of America; and 2Cardiovascular Research Center, Luzhou Medical College, Luzhou, Sichuan, China The human genome contains a variant form of the α7-nicotinic acetylcholine receptor (α7nAChR) gene that is uniquely human. This CHRFAM7A gene arose during human speciation and recent data suggests that its expression alters ligand tropism of the normally homopentameric human α7-AChR ligand-gated cell surface ion channel that is found on the surface of many dif- ferent cell types. To understand its possible significance in regulating inflammation in humans, we investigated its expression in nor- mal human leukocytes and leukocyte cell lines, compared CHRFAM7A expression to that of the CHRNA7 gene, mapped its pro- moter and characterized the effects of stable CHRFAM7A overexpression. We report here that CHRFAM7A is highly expressed in human leukocytes but that the levels of both CHRFAM7A and CHRNA7 mRNAs were independent and varied widely. To this end, mapping of the CHRFAM7A promoter in its 5′-untranslated region (UTR) identified a unique 1-kb sequence that independently reg- ulates CHRFAM7A gene expression. Because overexpression of CHRFAM7A in THP1 cells altered the cell phenotype and modified the expression of genes associated with focal adhesion (for example, FAK, P13K, Akt, rho, GEF, Elk1, CycD), leukocyte transepithe- lial migration (Nox, ITG, MMPs, PKC) and cancer (kit, kitL, ras, cFos cyclinD1, Frizzled and GPCR), we conclude that CHRFAM7A is bi- ologically active.
    [Show full text]