DOCSLIB.ORG

Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation WEB-ONLY CONTENT Recurrent Rearrangements in Synaptic and Neurodevelopmental Genes and Shared Biologic Pathways in Schizophrenia, Autism, and Mental Retardation Audrey Guilmatre, PhD; Christèle Dubourg, PhD; Anne-Laure Mosca, MD; Solenn Legallic, BSc; Alice Goldenberg, MD; Vale´rie Drouin-Garraud, MD; Vale´rie Layet, MD; Antoine Rosier, MD; Sylvain Briault, MD; Fre´de´rique Bonnet-Brilhault, MD, PhD; Fre´de´ric Laumonnier, PhD; Sylvie Odent, MD, PhD; Gael Le Vacon, MD; Ge´raldine Joly-Helas, MD; Ve´ronique David, MD; Claude Bendavid, MD; Jean-Michel Pinoit, MD; Ce´line Henry, MD; Caterina Impallomeni, MD; Eva Germano, MD; Gaetano Tortorella, MD; Gabriella Di Rosa, MD; Catherine Barthelemy, MD; Christian Andres, MD; Laurence Faivre, MD, PhD; Thierry Fre´bourg, MD, PhD; Pascale Saugier Veber, PhD; Dominique Campion, MD, PhD Arch Gen Psychiatry. 2009;66(9):947-956 eTable 1. Polymerase Chain Reaction Primers and Amplification Conditionsa Gene Forward Primer Reverse Primer Amplicon Size, bp NRXN1␣ exon 1 CGTTAGATAGTCGGGACCCTTATTTCTTCG GATAGGGTTA GCAGCAGGCGTTCCACTT 258 NRXN1␣ exon 5 CGTTAGATAGTAGTGGAGCCTGTGAATGGAAAG GATAGGGTTAGAGGAGCCCTGTATCATGTTGTT 192 NRXN1␤ exon 4 CGTTAGATAGGCCTGGCCCTGCTTTGG GATAGGGTTAGGAAATGGTGGATGTGGTGC 119 DPP10 CGTTAGATAGCAGATAAGTTCCATATTGACTGGG GATAGGGTTAGCTGTTATTTGGTCCTTTACTTCT 180 ERBB4 CGTTAGATAGCCGAGGATGAGTATGTGAATGA GATAGGGTTAGAAGGGTGCTCCGAGGTG 188 CNTN4 CGTTAGATAGGATCTTCAATGAATACCCTTCC GATAGGGTTACCCAGGACCTTGTGGTTTGT 170 GRM7 CGTTAGATAGTGTGAGCCTTGCGATGGTTA GATAGGGTTAGGGCGTGTCATTGTAGCG 245 NLGN1 CGTTAGATAGGATAAGAGGGATTAAGAAGGAACTCA GATAGGGTTAAGGCAGTCTTCGCTCTGGTCT 299 GABRG1 CGTTAGATAGATGACTCCTGGTCTCCATCCT GATAGGGTTAAAGATAGCCAACCCAATAAACCA 278 SLC1A3 CGTTAGATAGGCCAACGAAACGCTTGTG GATAGGGTTAGGAGAAGACAACTAGACCCAGG 158 ST7 CGTTAGATAGCATGTTTTATGGGCATGTGTAC GATAGGGTTAGGAATCTGAGTCCCCGTTAC 236 CNTNAP2 CGTTAGATAGATTTGGGCAATGTGGAGATT GATAGGGTTATTTGGCTCATCTTGGTCTGTG 101 NRG1 CGTTAGATAGTGCGGGAGGCTCAAGGA GATAGGGTTAGGGAAAGAGGCTCGGAA 118 DLGAP2 CGTTAGATAGCAAAAGCAACGCCAACGG GATAGGGTTATGGAGGTCTTGAGGGACAGG 301 PTK2 CGTTAGATAGCCTGGGTACTGGTATGGAACG GATAGGGTTAGTGGTTGGCTCACTATTGCTTT 110 DLG2 CGTTAGATAGAGTAAAGCGGTGGAAGCCCT GATAGGGTTAGCCTTTGAACAGTTTGATTTC 128 GRIP1 CGTTAGATAGACCTTGTGCAGCTCCACAGGA GATAGGGTTATAAAAATTGTCAATGCCAC 277 GABRA5 CGTTAGATAGCAGACCTACCTTCCCTGCATAA GATAGGGTTAAGAGGCAGCACTAGAAGTTTCG 214 APBA2 CGTTAGATAGGAAGCACAAGGGCGAGATC GATAGGGTTAGTGCCTACCTTGATGATGCC 230 CHRNA7 CGTTAGATAG GGACAAGGAGCTGGTCAAGAACT GATAGGGTTA CTGGGGCCAACTAGAGTGC 226 DOC2A CGTTAGATAGCCCTGCAGCCCTCCTTG GATAGGGTTAACTCACTGGCATCATCCGA 100 MAPT CGTTAGATAGAGCCTGGGCGATAGAGCAA GATAGGGTTACTGAGATGCCGTGGAGACG 281 PRODH CGTTAGATAGGGCTTCCCTTTGCCTTTCAG GATAGGGTTAGCCTTACTCCATCTCCTTGTGCT 256 SHANK3 CGTTAGATAGCTCCACCGCAGCCATCTTC GATAGGGTTATGCTCAGACGCACCCAGTT 183 NLGN4 CGTTAGATAGAAGAAGCCCGTCATGGTCTATAT GATAGGGTTATTCCTCTTGCTCAGTCATTCACA 192 TSPAN7 CGTTAGATAGGGATGCTGAAACTGGTGAGTATG GATAGGGTTATTGTTTTTACCTCTAGGGGATTAA 198 CASK CGTTAGATAGGGGTCCCTTCAGTGTTGTACGA GATAGGGTTAATGGAATAAAGCCAGACA 182 IL1RAPL1 CGTTAGATAGAGCCGATGGATGCACTGACT GATAGGGTTACACTTTGGGCAAGGGAGTAAT 148 GRIA3 CGTTAGATAGGCAGTTATACAACACCAACCAGAA GATAGGGTTACTACTTACAAGCATTTGTCACGGA 132 MECP2 CGTTAGATAGTCAAGGACAAACCCCTCAAGT GATAGGGTTAGCCTGACCCTTCTGATGTCTC 166 a Quantitative multiplex polymerase chain reaction of short fluorescent fragments (QMPSF) included the following: QMPSF 1 (23 cycles at 94°C for 5 minutes, 94°C for 30 seconds, 57°C for 1 minute, 72°C for 30 seconds, and 72°C for 5 minutes), QMPSF 2 (23 cycles at 94°C for 5 minutes, 94°C for 30 seconds, 56°C for 1 minute, 72°C for 30 seconds, and 72°C for 5 minutes), and QMPSF 3 (24 cycles at 94°C for 5 minutes, 94°C for 30 seconds, 58°C for 1 minute, 72°C for 30 seconds, and 72°C for 5 minutes). (REPRINTED) ARCH GEN PSYCHIATRY/ VOL 66 (NO. 9), SEP 2009 WWW.ARCHGENPSYCHIATRY.COM E1 ©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 eTable 2. Other Copy Number Variations Chromosomal Case Diagnosis Location Genes Involved Type Confirmation 1003 Control 22q11 PRODH, DGCR6 Dup QMPSF 1060 Control 22q11 PRODH, DGCR6 Dup QMPSF 1069 Control 22q11 PRODH, DGCR6 Dup QMPSF 1136 Control 22q11 PRODH, DGCR6 Dup QMPSF 1182 Control 22q11 PRODH, DGCR6 Dup QMPSF 292/002 Control 22q11 PRODH, DGCR6 Dup QMPSF 1 SZ AFF 22q11 PRODH, DGCR6 Dup QMPSF 99 SZ 22q11 PRODH, DGCR6 Dup QMPSF 136 SZ 22q11 PRODH, DGCR6 Dup QMPSF 189 SZ 22q11 PRODH, DGCR6 Dup QMPSF 236 SZ 22q11 PRODH, DGCR6 Dup QMPSF 244 SZ 22q11 PRODH, DGCR6 Dup QMPSF 280 SZ AFF 22q11 PRODH, DGCR6 Dup QMPSF 44 544 ASDs 22q11 PRODH, DGCR6 Dup QMPSF 44 743 ASDs 22q11 PRODH, DGCR6 Dup QMPSF 44 822 ASDs 22q11 PRODH, DGCR6 Dup QMPSF 46 658 ASDs 22q11 PRODH, DGCR6 Dup QMPSF 11 198 MR 22q11 PRODH, DGCR6 Dup QMPSF 11 984 MR 22q11 PRODH, DGCR6 Dup QMPSF 14 150 MR 22q11 PRODH, DGCR6 Dup QMPSF 14 260 MR 22q11 PRODH, DGCR6 Dup QMPSF 15 051 MR 22q11 PRODH, DGCR6 Dup QMPSF 6355.002 MR 22q11 PRODH, DGCR6 Dup QMPSF 8635 MR 22q11 PRODH, DGCR6 Dup QMPSF 9930 MR 22q11 PRODH, DGCR6 Dup QMPSF 10 403 MR 22q11 PRODH, DGCR6 Dup QMPSF 1050 Control 15q13 CHRNA7 Dup QMPSF, array-CGH 1067 Control 15q13 CHRNA7 Dup QMPSF SDI013 SZ 15q13 CHRNA7 Dup QMPSF 16 144 ASDs 15q13 CHRNA7 Dup QMPSF 14 522 MR 15q13 CHRNA7 Dup QMPSF Abbreviations: array-CGH, microarray-based technologies for comparative genomic hybridization; ASDs, autism spectrum disorders; Dup, duplication; MR, mental retardation; QMPSF, quantitative multiplex polymerase chain reaction of short fluorescent fragments; SZ, schizophrenia; SZ AFF, schizoaffective disorder. (REPRINTED) ARCH GEN PSYCHIATRY/ VOL 66 (NO. 9), SEP 2009 WWW.ARCHGENPSYCHIATRY.COM E2 ©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 eTable 3. Copy Number Variation (CNV) Margins and Confirmation Methods Margin, bp Case CNV Last Outer First Inner Last Inner First Outer Confirmation 113 Dup (Xp11.4) 38 326 267 38 376 483 38 432 836 38 549 143 QMPSF, array-CGH 313 Dup (8p23) 1 436 299 1 481 035 1 590 831 1 642 837 QMPSF, array-CGH 185 Dup (15q13) 26 999 744 27 000 694 27 994 706 28 109 371 QMPSF, array-CCH 144.1 Del (22q11) . QMPSF 223 Del (2p16.3) 50 704 195 51 006 556 51 114 057 51 433 167 QMPSF, array-CGH 220 Del (2p16.3) 50 172 024 50 420 164 50 420 164 50 704 195 QMPSF, array-CGH 33 Dup (16p11) . QMPSF 136 Dup (16p11) . QMPSF 146 Dup (16p11) . QMPSF 151 Dup (17q21) 40 869 151 41 073 486 41 700 762 42 143 048 QMPSF, array-CGH T35 Del (2p16.3) 51 006 556 51 114 057 51 114 057 51 433 167 QMPSF, array-CGH, FISH 45 431 Del (2p16.3) 50 704 195 51 006 556 51 114 057 51 433 167 QMPSF, array-CGH 47 604 Del (22q13) 47 124 905 47 265 476 49 525 071 . QMPSF, array-CGH Si22 Del (22q13) . QMPSF, MLPA 60 478 Dup (15q11-q13) . QMPSF, FISH T34 Dup (Xq25) 120 669 107 120 746 477 122 166 142 122 316 448 QMPSF, array-CGH, FISH 12 746 Del (22q11) . QMPSF 12 452 Del (22q11) . QMPSF 13 899 Del (22q11) . QMPSF 44 737 Del (22q11) . QMPSF 45 435 Del (22q11) . QMPSF 45 856 Del (22q11) . QMPSF 46 261 Del (22q11) . QMPSF 47 766 Del (22q11) . QMPSF Si30 Del (22q11) . QMPSF 44 813 Dup (15q13) 26 198 996 26 999 744 30 796 716 30 812 300 QMPSF, array-CGH 12 363 Del (22q11) . QMPSF 11 780 Del (22q11) . QMPSF 9680 Del (22q11) . QMPSF 14 684 Del (22q11) . QMPSF 11 695 Del (2p16.3) 51 006 556 51 114 057 51 114 057 51 433 167 QMPSF, array-CGH 14 921 Del (16p11) . QMPSF, FISH 10 417 Del (16p11) . QMPSF, FISH 13 165 Dup (16p11) . QMPSF, FISH 14 390 Del (16p11) . QMPSF, FISH 13 907 Del (15q13) 28 109 371 28 725 507 30 298 096 30 701 373 QMPSF, array-CGH 11 919 Del (15q13) 28 109 371 28 725 507 30 298 096 30 701 373 QMPSF, array-CGH 9930 Del (15q13) 28 109 371 28 725 507 30 298 096 30 701 373 QMPSF, array-CGH 12 988 Del (8p23) . QMPSF, HRK 011/003 Del (22q11) . QMPSF Abbreviations: array-CGH, microarray-based technologies for comparative genomic hybridization; bp, base pair; Del, deletion; Dup, duplication; ellipsis, not applicable; FISH, fluorescence in situ hybridization; HRK, high-resolution karyotype; MLPA, multiplex ligation-dependent probe amplification; QMPSF, quantitative multiplex polymerase chain reaction of short fluorescent fragments. (REPRINTED) ARCH GEN PSYCHIATRY/ VOL 66 (NO. 9), SEP 2009 WWW.ARCHGENPSYCHIATRY.COM E3 ©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 A 90 120 150 180 210 240 270 300 MAPK3 2700 2400 DOC2A 2100 NLGN4 1800 QPRT 1500 PBGD 1200 900 600 300 0 B 150 180 210 240 270 300 2700 2400 ARVCF USP18 PRODH SNAP29 2100 DGCR6 UFD1L DGCR2 1800 1500 DGSA 1200 MSH2 900 600 300 0 eFigure 1. A, Detection by a dedicated quantitative multiplex polymerase chain reaction of short fluorescent fragments (QMPSF) of a 16p11 duplication. The electropherogram of subject 136 with schizophrenia (red) was superimposed on that of a healthy control subject (blue) by adjusting to the same level the peaks obtained from the amplicon PBGD located on chromosome 11. The vertical axis shows fluorescence in arbitrary units and the horizontal axis indicates the size of the amplicon in base pairs. Horizontal bars indicate heterozygous duplications of the amplicons detected by a 1.5-fold increase of the corresponding peaks. This QMPSF covers 5 genes located at 16p11.2 (DOC2A, QPRT, and MAPK3), Xp22.3 (NLGN4), and 11q23.3 (PBGD). NLGN4 located on the X chromosome was used as a control and shows a 2-fold heightening in the female patient compared with the male control. B, Detection by a dedicated QMPSF of a 22q11 deletion. The electropherogram of subject 9680 with mental retardation
Load more

Recommended publications
  • Gene Expression Studies in Depression Development and Treatment
    Mariani et al. Translational Psychiatry (2021) 11:354 https://doi.org/10.1038/s41398-021-01469-6 Translational Psychiatry REVIEW ARTICLE Open Access Gene expression studies in Depression development and treatment: an overview of the underlying molecular mechanisms and biological processes to identify biomarkers Nicole Mariani 1, Nadia Cattane2,CarminePariante 1 and Annamaria Cattaneo 2,3 Abstract A combination of different risk factors, such as genetic, environmental and psychological factors, together with immune system, stress response, brain neuroplasticity and the regulation of neurotransmitters, is thought to lead to the development of major depressive disorder (MDD). A growing number of studies have tried to investigate the underlying mechanisms of MDD by analysing the expression levels of genes involved in such biological processes. These studies have shown that MDD is not just a brain disorder, but also a body disorder, and this is mainly due to the interplay between the periphery and the Central Nervous System (CNS). To this purpose, most of the studies conducted so far have mainly dedicated to the analysis of the gene expression levels using postmortem brain tissue as well as peripheral blood samples of MDD patients. In this paper, we reviewed the current literature on candidate gene expression alterations and the few existing transcriptomics studies in MDD focusing on inflammation, neuroplasticity, neurotransmitters and stress-related genes. Moreover, we focused our attention on studies, which have investigated 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; mRNA levels as biomarkers to predict therapy outcomes. This is important as many patients do not respond to antidepressant medication or could experience adverse side effects, leading to the interruption of treatment.
    [Show full text]
  • Research Article Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed Hipscs To
    Hindawi Publishing Corporation Stem Cells International Volume 2013, Article ID 784629, 25 pages http://dx.doi.org/10.1155/2013/784629 Research Article Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed hiPSCs to Differentiated Neuronal and Cardiac Progeny Leonhard Linta,1 Marianne Stockmann,1 Qiong Lin,2 André Lechel,3 Christian Proepper,1 Tobias M. Boeckers,1 Alexander Kleger,3 and Stefan Liebau1 1 InstituteforAnatomyCellBiology,UlmUniversity,Albert-EinsteinAllee11,89081Ulm,Germany 2 Institute for Biomedical Engineering, Department of Cell Biology, RWTH Aachen, Pauwelstrasse 30, 52074 Aachen, Germany 3 Department of Internal Medicine I, Ulm University, Albert-Einstein Allee 11, 89081 Ulm, Germany Correspondence should be addressed to Alexander Kleger; [email protected] and Stefan Liebau; [email protected] Received 31 January 2013; Accepted 6 March 2013 Academic Editor: Michael Levin Copyright © 2013 Leonhard Linta et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ion channels are involved in a large variety of cellular processes including stem cell differentiation. Numerous families of ion channels are present in the organism which can be distinguished by means of, for example, ion selectivity, gating mechanism, composition, or cell biological function. To characterize the distinct expression of this group of ion channels we have compared the mRNA expression levels of ion channel genes between human keratinocyte-derived induced pluripotent stem cells (hiPSCs) and their somatic cell source, keratinocytes from plucked human hair. This comparison revealed that 26% of the analyzed probes showed an upregulation of ion channels in hiPSCs while just 6% were downregulated.
    [Show full text]
  • Ion Channels
    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
    [Show full text]
  • Nicotinic Receptors in Sleep-Related Hypermotor Epilepsy: Pathophysiology and Pharmacology
    brain sciences Review Nicotinic Receptors in Sleep-Related Hypermotor Epilepsy: Pathophysiology and Pharmacology Andrea Becchetti 1,* , Laura Clara Grandi 1 , Giulia Colombo 1 , Simone Meneghini 1 and Alida Amadeo 2 1 Department of Biotechnology and Biosciences, University of Milano-Bicocca, 20126 Milano, Italy; [email protected] (L.C.G.); [email protected] (G.C.); [email protected] (S.M.) 2 Department of Biosciences, University of Milano, 20133 Milano, Italy; [email protected] * Correspondence: [email protected] Received: 13 October 2020; Accepted: 21 November 2020; Published: 25 November 2020 Abstract: Sleep-related hypermotor epilepsy (SHE) is characterized by hyperkinetic focal seizures, mainly arising in the neocortex during non-rapid eye movements (NREM) sleep. The familial form is autosomal dominant SHE (ADSHE), which can be caused by mutations in genes encoding subunits of the neuronal nicotinic acetylcholine receptor (nAChR), Na+-gated K+ channels, as well as non-channel signaling proteins, such as components of the gap activity toward rags 1 (GATOR1) macromolecular complex. The causative genes may have different roles in developing and mature brains. Under this respect, nicotinic receptors are paradigmatic, as different pathophysiological roles are exerted by distinct nAChR subunits in adult and developing brains. The widest evidence concerns α4 and β2 subunits. These participate in heteromeric nAChRs that are major modulators of excitability in mature neocortical circuits as well as regulate postnatal synaptogenesis. However, growing evidence implicates mutant α2 subunits in ADSHE, which poses interpretive difficulties as very little is known about the function of α2-containing (α2*) nAChRs in the human brain.
    [Show full text]
  • Ca2+ and Brain-Derived Neurotrophic Factor (BDNF) in STC-1 Cells Jie Qian Virginia Commonwealth University
    Virginia Commonwealth University VCU Scholars Compass Physiology and Biophysics Publications Dept. of Physiology and Biophysics 2015 Nicotine-Induced Effects on Nicotinic Acetylcholine Receptors (nAChRs), Ca2+ and Brain-Derived Neurotrophic Factor (BDNF) in STC-1 Cells Jie Qian Virginia Commonwealth University Shobha K. Mummalaneni Virginia Commonwealth University Reem M. Alkahtan Virginia Commonwealth University See next page for additional authors Follow this and additional works at: http://scholarscompass.vcu.edu/phis_pubs Part of the Medicine and Health Sciences Commons Copyright: © 2016 Qian et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Downloaded from http://scholarscompass.vcu.edu/phis_pubs/54 This Article is brought to you for free and open access by the Dept. of Physiology and Biophysics at VCU Scholars Compass. It has been accepted for inclusion in Physiology and Biophysics Publications by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Authors Jie Qian, Shobha K. Mummalaneni, Reem M. Alkahtan, Sunila Mahavadi, Karnam S. Murthy, John R. Grider, and Vijay Lyall This article is available at VCU Scholars Compass: http://scholarscompass.vcu.edu/phis_pubs/54 RESEARCH ARTICLE Nicotine-Induced Effects on Nicotinic Acetylcholine Receptors (nAChRs), Ca2+ and Brain-Derived Neurotrophic
    [Show full text]
  • Ligand-Gated Ion Channels
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: Ligand-gated ion channels. British Journal of Pharmacology (2015) 172, 5870–5903 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: Ligand-gated ion channels Stephen PH Alexander1, John A Peters2, Eamonn Kelly3, Neil Marrion3, Helen E Benson4, Elena Faccenda4, Adam J Pawson4, Joanna L Sharman4, Christopher Southan4, Jamie A Davies4 and CGTP Collaborators L 1 School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, N 2Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/ doi/10.1111/bph.13350/full. Ligand-gated ion channels are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage- gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading. The Concise Guide is published in landscape format in order to facilitate comparison of related targets.
    [Show full text]
  • Retrograde Inhibition by a Specific Subset of Interpeduncular Α5 Nicotinic Neurons Regulates Nicotine Preference
    Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference Jessica L. Ablesa,b,c, Andreas Görlicha,1, Beatriz Antolin-Fontesa,2,CuidongWanga, Sylvia M. Lipforda, Michael H. Riada, Jing Rend,e,3,FeiHud,e,4,MinminLuod,e,PaulJ.Kennyc, Nathaniel Heintza,f,5, and Ines Ibañez-Tallona,5 aLaboratory of Molecular Biology, The Rockefeller University, New York, NY 10065; bDepartment of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY 10029; dNational Institute of Biological Sciences, Beijing 102206, China; eSchool of Life Sciences, Tsinghua University, Beijing 100084, China; and fHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Nathaniel Heintz, October 23, 2017 (sent for review October 5, 2017; reviewed by Jean-Pierre Changeux and Lorna W. Role) Repeated exposure to drugs of abuse can produce adaptive changes nicotine withdrawal, and optical activation of IPN GABAergic cells that lead to the establishment of dependence. It has been shown that is sufficient to produce a withdrawal syndrome, while blockade of allelic variation in the α5 nicotinic acetylcholine receptor (nAChR) gene GABAergic cells in the IPN reduced symptoms of withdrawal (17). CHRNA5 is associated with higher risk of tobacco dependence. In the Taken together these studies highlight the critical role of α5in brain, α5-containing nAChRs are expressed at very high levels in the regulating behavioral responses to nicotine. Here we characterize two subpopulations of GABAergic interpeduncular nucleus (IPN). Here we identified two nonoverlapping Amigo1 Epyc α + α Amigo1 α Epyc neurons in the IPN that express α5: α5- and α5- neu- 5 cell populations ( 5- and 5- ) in mouse IPN that respond α Amigo1 α Epyc differentially to nicotine.
    [Show full text]
  • Retrograde Inhibition by a Specific Subset of Interpeduncular Α5 Nicotinic Neurons Regulates Nicotine Preference
    Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference Jessica L. Ablesa,b,c, Andreas Görlicha,1, Beatriz Antolin-Fontesa,2,CuidongWanga, Sylvia M. Lipforda, Michael H. Riada, Jing Rend,e,3,FeiHud,e,4,MinminLuod,e,PaulJ.Kennyc, Nathaniel Heintza,f,5, and Ines Ibañez-Tallona,5 aLaboratory of Molecular Biology, The Rockefeller University, New York, NY 10065; bDepartment of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029; cDepartment of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, NY 10029; dNational Institute of Biological Sciences, Beijing 102206, China; eSchool of Life Sciences, Tsinghua University, Beijing 100084, China; and fHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Nathaniel Heintz, October 23, 2017 (sent for review October 5, 2017; reviewed by Jean-Pierre Changeux and Lorna W. Role) Repeated exposure to drugs of abuse can produce adaptive changes nicotine withdrawal, and optical activation of IPN GABAergic cells that lead to the establishment of dependence. It has been shown that is sufficient to produce a withdrawal syndrome, while blockade of allelic variation in the α5 nicotinic acetylcholine receptor (nAChR) gene GABAergic cells in the IPN reduced symptoms of withdrawal (17). CHRNA5 is associated with higher risk of tobacco dependence. In the Taken together these studies highlight the critical role of α5in brain, α5-containing nAChRs are expressed at very high levels in the regulating behavioral responses to nicotine. Here we characterize two subpopulations of GABAergic interpeduncular nucleus (IPN). Here we identified two nonoverlapping Amigo1 Epyc α + α Amigo1 α Epyc neurons in the IPN that express α5: α5- and α5- neu- 5 cell populations ( 5- and 5- ) in mouse IPN that respond α Amigo1 α Epyc differentially to nicotine.
    [Show full text]
  • Nicotinic Receptors Atlas in the Adult Human Lung
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.29.176750; this version posted August 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Nicotinic receptors atlas in the adult human lung 2 3 Zania Diabasana1, Jeanne-Marie Perotin1,2, Randa Belgacemi1, Julien Ancel1,2, Pauline 4 Mulette1,2, Gonzague Delepine3, Philippe Gosset4, Uwe Maskos5, Myriam Polette1,6, Gaëtan 5 Deslée1,2, Valérian Dormoy1 6 7 1University of Reims Champagne-Ardenne, Inserm, P3Cell UMR-S1250, SFR CAP-SANTE, 8 51092 Reims, France 9 2CHU of Reims, Hôpital Maison Blanche, Department of respiratory diseases, 51092 Reims, 10 France 11 3CHU of Reims, Hôpital Maison Blanche, Department of thoracic surgery, 51092 Reims, 12 France 13 4University of Lille, CNRS UMR9017, Inserm U1019, CHRU Lille, Pasteur Institute of Lille, 14 CIIL - Center for Infection and Immunity of Lille, 59000 Lille, France 15 5Pasteur Institute of Paris, Integrative Neurobiology of Cholinergic Systems, CNRS UMR 16 3571, Paris, France. 17 6CHU Reims, Hôpital Maison Blanche, Department of biopathology, 51092 Reims, France 18 19 Correspondence to: 20 Dr Valérian Dormoy 21 Inserm UMR-S 1250 22 University of Reims Champagne-Ardenne 23 CHU Maison Blanche 24 45 rue Cognacq-Jay 25 51092 Reims 26 Phone +33 (0)3 10 73 62 28; Fax +33 (0)3 26 06 58 61 27 e-mail: [email protected] 28 29 Short title: lung nicotinic receptors 30 31 32 33 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.29.176750; this version posted August 13, 2020.
    [Show full text]
  • Structure, Dynamics, and Ligand Recognition of Human-Specific CHRFAM7A (Dup7) Nicotinic Receptor Linked to Neuropsychiatric Diso
    International Journal of Molecular Sciences Article Structure, Dynamics, and Ligand Recognition of Human-Specific CHRFAM7A (Dupα7) Nicotinic Receptor Linked to Neuropsychiatric Disorders Danlin Liu 1,†, João V. de Souza 1,†, Ayaz Ahmad 1 and Agnieszka K. Bronowska 1,2,* 1 Chemistry—School of Natural and Environmental Sciences, Newcastle University, Newcastle NE1 7RU, UK; [email protected] (D.L.); [email protected] (J.V.d.S.); [email protected] (A.A.) 2 Newcastle University Centre for Cancer, Newcastle University, Newcastle NE1 7RU, UK * Correspondence: [email protected] † Equal contribution. Abstract: Cholinergic α7 nicotinic receptors encoded by the CHRNA7 gene are ligand-gated ion chan- nels directly related to memory and immunomodulation. Exons 5–7 in CHRNA7 can be duplicated and fused to exons A-E of FAR7a, resulting in a hybrid gene known as CHRFAM7A, unique to humans. Its product, denoted herein as Dupα7, is a truncated subunit where the N-terminal 146 residues of the ligand binding domain of the α7 receptor have been replaced by 27 residues from FAM7. Dupα7 negatively affects the functioning of α7 receptors associated with neurological disorders, including Alzheimer’s diseases and schizophrenia. However, the stoichiometry for the α7 nicotinic receptor containing dupα7 monomers remains unknown. In this work, we developed computational models Citation: Liu, D.; de Souza, J.V.; of all possible combinations of wild-type α7 and dupα7 pentamers and evaluated their stability via Ahmad, A.; Bronowska, A.K. atomistic molecular dynamics and coarse-grain simulations. We assessed the effect of dupα7 subunits Structure, Dynamics, and Ligand on the Ca2+ conductance using free energy calculations.
    [Show full text]
  • A Human-Specific A7-Nicotinic Acetylcholine Receptor Gene In
    A Human-Specific α7-Nicotinic Acetylcholine Receptor Gene in Human Leukocytes: Identification, Regulation and the Consequences of CHRFAM7A Expression Todd W Costantini,1* Xitong Dang,1,2* Maryana V Yurchyshyna,1 Raul Coimbra,1 Brian P Eliceiri,1 and Andrew Baird1 1Department of Surgery, University of California San Diego Health Sciences, San Diego, California, United States of America; and 2Cardiovascular Research Center, Luzhou Medical College, Luzhou, Sichuan, China The human genome contains a variant form of the α7-nicotinic acetylcholine receptor (α7nAChR) gene that is uniquely human. This CHRFAM7A gene arose during human speciation and recent data suggests that its expression alters ligand tropism of the normally homopentameric human α7-AChR ligand-gated cell surface ion channel that is found on the surface of many dif- ferent cell types. To understand its possible significance in regulating inflammation in humans, we investigated its expression in nor- mal human leukocytes and leukocyte cell lines, compared CHRFAM7A expression to that of the CHRNA7 gene, mapped its pro- moter and characterized the effects of stable CHRFAM7A overexpression. We report here that CHRFAM7A is highly expressed in human leukocytes but that the levels of both CHRFAM7A and CHRNA7 mRNAs were independent and varied widely. To this end, mapping of the CHRFAM7A promoter in its 5′-untranslated region (UTR) identified a unique 1-kb sequence that independently reg- ulates CHRFAM7A gene expression. Because overexpression of CHRFAM7A in THP1 cells altered the cell phenotype and modified the expression of genes associated with focal adhesion (for example, FAK, P13K, Akt, rho, GEF, Elk1, CycD), leukocyte transepithe- lial migration (Nox, ITG, MMPs, PKC) and cancer (kit, kitL, ras, cFos cyclinD1, Frizzled and GPCR), we conclude that CHRFAM7A is bi- ologically active.
    [Show full text]
  • Genetic Mapping of Putative Chrna7 and Luzp2 Neuronal Transcriptional
    BMC Genomics 2005, 6:157 http://www.biomedcentral.com/1471-2164/6/157 Research article Genetic mapping of putative Chrna7 and Luzp2 neuronal transcriptional enhancers due to impact of a transgene-insertion and 6.8 Mb deletion in a mouse model of Prader-Willi and Angelman syndromes Mihaela Stefan1,7, Kathryn C Claiborn1, Edyta Stasiek3, Jing-Hua Chai1, Tohru Ohta1,6, Richard Longnecker4, John M Greally3 and Robert D Nicholls*1,2,5,7 Address: 1Center for Neurobiology and Behavior, Department of Psychiatry, University of Pennsylvania, Philadelphia, PA 19104, USA, 2Department of Genetics, University of Pennsylvania, Philadelphia, PA 19104, USA, 3Division of Hematology, Department of Medicine, Albert Einstein College of Medicine, The Bronx, USA, 4Department of Microbiology and Immunology, Feinberg School of Medicine, Northwestern University, Ward 6-231, 303 East Chicago Ave, Chicago, IL 60611, USA, 5Birth Defects Laboratories, Children's Hospital of Pittsburgh, Room 2109 Rangos Research Center, 3460 Fifth Avenue, Pittsburgh, PA 15213, USA, 6Health Science University of Hokkaido, Hokkaido, Japan and 7Department of Pediatrics, Children's Hospital of Pittsburgh, 3460 Fifth Avenue, Pittsburgh, PA 15213 Email: Mihaela Stefan - [email protected]; Kathryn C Claiborn - [email protected]; Edyta Stasiek - [email protected]; Jing- Hua Chai - [email protected]; Tohru Ohta - [email protected]; Richard Longnecker - [email protected]; John M Greally - [email protected]; Robert D Nicholls* - [email protected] * Corresponding author Published: 09 November 2005 Received: 14 July 2005 Accepted: 09 November 2005 BMC Genomics 2005, 6:157 doi:10.1186/1471-2164-6-157 This article is available from: http://www.biomedcentral.com/1471-2164/6/157 © 2005 Stefan et al; licensee BioMed Central Ltd.
    [Show full text]