Mouse Ergic3 Knockout Project (CRISPR/Cas9)

Total Page:16

File Type:pdf, Size:1020Kb

Mouse Ergic3 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Ergic3 Knockout Project (CRISPR/Cas9) Objective: To create a Ergic3 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ergic3 gene (NCBI Reference Sequence: NM_025516 ; Ensembl: ENSMUSG00000005881 ) is located on Mouse chromosome 2. 13 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 13 (Transcript: ENSMUST00000006035). Exon 5~10 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 5 starts from about 32.03% of the coding region. Exon 5~10 covers 44.56% of the coding region. The size of effective KO region: ~6514 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 10 1 5 6 7 8 9 13 Legends Exon of mouse Ergic3 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 1460 bp section upstream of Exon 5 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 626 bp section downstream of Exon 10 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 9 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(1460bp) | A(23.36% 341) | C(20.82% 304) | T(31.16% 455) | G(24.66% 360) Note: The 1460 bp section upstream of Exon 5 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(626bp) | A(20.61% 129) | C(27.48% 172) | T(24.44% 153) | G(27.48% 172) Note: The 626 bp section downstream of Exon 10 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 9 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 1460 1 1460 1460 100.0% chr2 + 156008981 156010440 1460 browser details YourSeq 220 794 1067 1460 92.9% chr10 + 61403327 61403890 564 browser details YourSeq 215 806 1068 1460 93.2% chr1 - 39523142 39523508 367 browser details YourSeq 211 825 1067 1460 95.7% chr15 + 96066260 96596320 530061 browser details YourSeq 205 791 1052 1460 92.8% chr5 - 126977348 126977675 328 browser details YourSeq 205 792 1056 1460 93.6% chr11 + 85262094 85262448 355 browser details YourSeq 205 815 1067 1460 93.7% chr1 + 180748188 180748709 522 browser details YourSeq 204 815 1068 1460 93.3% chr16 - 17194907 17195253 347 browser details YourSeq 202 825 1068 1460 94.3% chr13 + 100736556 100820996 84441 browser details YourSeq 198 825 1067 1460 93.5% chr11 - 60824663 60824957 295 browser details YourSeq 198 825 1068 1460 93.1% chr15 + 102173166 102173671 506 browser details YourSeq 197 799 1067 1460 93.5% chr13 + 17811134 17811679 546 browser details YourSeq 196 825 1067 1460 92.7% chr11 - 101588254 101588589 336 browser details YourSeq 194 825 1066 1460 92.3% chr14 + 49205100 49205574 475 browser details YourSeq 193 825 1067 1460 93.3% chr16 - 22056591 22056927 337 browser details YourSeq 189 792 1067 1460 92.0% chr11 - 95917783 95918095 313 browser details YourSeq 188 769 1068 1460 94.0% chr17 - 29037871 29529425 491555 browser details YourSeq 181 803 1189 1460 91.8% chr9 - 110513487 110513909 423 browser details YourSeq 176 825 1046 1460 94.0% chr11 - 52288513 52289043 531 browser details YourSeq 171 825 1061 1460 90.6% chr11 - 80380265 80380576 312 Note: The 1460 bp section upstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 626 1 626 626 100.0% chr2 + 156016955 156017580 626 browser details YourSeq 24 470 499 626 76.0% chr16 - 31719625 31719649 25 browser details YourSeq 23 584 606 626 100.0% chr2 - 171881849 171881871 23 browser details YourSeq 22 159 181 626 100.0% chr14 - 58206009 58206034 26 browser details YourSeq 21 467 488 626 100.0% chr14 + 24096559 24096581 23 browser details YourSeq 21 200 220 626 100.0% chr11 + 58335065 58335085 21 browser details YourSeq 20 368 387 626 100.0% chr12 - 71353446 71353465 20 browser details YourSeq 20 46 65 626 100.0% chr11 - 71414610 71414629 20 Note: The 626 bp section downstream of Exon 10 is BLAT searched against the genome. No significant similarity is found. Page 5 of 9 https://www.alphaknockout.com Gene and protein information: Ergic3 ERGIC and golgi 3 [ Mus musculus (house mouse) ] Gene ID: 66366, updated on 24-Oct-2019 Gene summary Official Symbol Ergic3 provided by MGI Official Full Name ERGIC and golgi 3 provided by MGI Primary source MGI:MGI:1913616 See related Ensembl:ENSMUSG00000005881 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as CGI-54; D2Ucla1; AV318804; NY-BR-84; Sdbcag84; 2310015B14Rik Expression Ubiquitous expression in testis adult (RPKM 128.8), ovary adult (RPKM 102.0) and 28 other tissues See more Orthologs human all Genomic context Location: 2 H1; 2 77.32 cM See Ergic3 in Genome Data Viewer Exon count: 14 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 2 NC_000068.7 (156008028..156018279) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 2 NC_000068.6 (155833861..155844015) Chromosome 2 - NC_000068.7 Page 6 of 9 https://www.alphaknockout.com Transcript information: This gene has 10 transcripts Gene: Ergic3 ENSMUSG00000005881 Description ERGIC and golgi 3 [Source:MGI Symbol;Acc:MGI:1913616] Gene Synonyms 2310015B14Rik, CGI-54, D2Ucla1, NY-BR-84, Sdbcag84 Location Chromosome 2: 156,008,045-156,018,279 forward strand. GRCm38:CM000995.2 About this gene This gene has 10 transcripts (splice variants), 204 orthologues, 2 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Ergic3- ENSMUST00000006035.12 1377 383aa ENSMUSP00000006035.6 Protein coding CCDS16959 Q9CQE7 TSL:1 201 GENCODE basic APPRIS P1 Ergic3- ENSMUST00000088650.10 1349 394aa ENSMUSP00000086025.4 Protein coding - Q9CQE7 TSL:1 202 GENCODE basic Ergic3- ENSMUST00000155370.1 751 235aa ENSMUSP00000119051.1 Protein coding - F6RK81 CDS 5' incomplete 210 TSL:3 Ergic3- ENSMUST00000142859.7 739 246aa ENSMUSP00000115912.1 Protein coding - F6UIS1 CDS 5' and 3' incomplete 205 TSL:5 Ergic3- ENSMUST00000137545.1 654 No protein - Retained intron - - TSL:3 204 Ergic3- ENSMUST00000144707.1 649 No protein - Retained intron - - TSL:2 206 Ergic3- ENSMUST00000152568.1 488 No protein - Retained intron - - TSL:2 209 Ergic3- ENSMUST00000149381.1 412 No protein - Retained intron - - TSL:2 207 Ergic3- ENSMUST00000150970.7 463 No protein - lncRNA - - TSL:3 208 Ergic3- ENSMUST00000130793.7 382 No protein - lncRNA - - TSL:5 203 Page 7 of 9 https://www.alphaknockout.com 30.23 kb Forward strand 156.00Mb 156.01Mb 156.02Mb Genes (Comprehensive set... Cep250-201 >protein coding Ergic3-201 >protein coding Cep250-202 >protein coding Ergic3-202 >protein coding Cep250-204 >protein coding Ergic3-206 >retained intron Ergic3-208 >lncRNA Cep250-206 >retained intron Ergic3-205 >protein coding Ergic3-207 >retained intron Ergic3-210 >protein coding Ergic3-203 >lncRNA Ergic3-209 >retained intron Ergic3-204 >retained intron Contigs AL833786.8 > Genes < 6430550D23Rik-203nonsense mediated decay < Fer1l4-201protein coding (Comprehensive set... < 6430550D23Rik-202protein coding < Fer1l4-204retained intron < 6430550D23Rik-201protein coding < Fer1l4-206retained intron < 6430550D23Rik-204retained intron < 6430550D23Rik-208protein coding < 6430550D23Rik-206protein coding < 6430550D23Rik-205protein coding < 6430550D23Rik-209protein coding < 6430550D23Rik-207protein coding Regulatory Build 156.00Mb 156.01Mb 156.02Mb Reverse strand 30.23 kb Regulation Legend CTCF Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding processed transcript RNA gene Page 8 of 9 https://www.alphaknockout.com Transcript: ENSMUST00000006035 10.23 kb Forward strand Ergic3-201 >protein coding ENSMUSP00000006... Transmembrane heli... Low complexity (Seg) Pfam Endoplasmic reticulum vesicle transporter, N-terminal Endoplasmic reticulum vesicle transporter, C-terminal PANTHER PTHR10984 PTHR10984:SF25 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 40 80 120 160 200 240 280 320 383 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 9 of 9.
Recommended publications
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Genome-Wide Association and Gene Enrichment Analyses of Meat Sensory Traits in a Crossbred Brahman-Angus
    Proceedings of the World Congress on Genetics Applied to Livestock Production, 11. 124 Genome-wide association and gene enrichment analyses of meat tenderness in an Angus-Brahman cattle population J.D. Leal-Gutíerrez1, M.A. Elzo1, D. Johnson1 & R.G. Mateescu1 1 University of Florida, Department of Animal Sciences, 2250 Shealy Dr, 32608 Gainesville, Florida, United States. [email protected] Summary The objective of this study was to identify genomic regions associated with meat tenderness related traits using a whole-genome scan approach followed by a gene enrichment analysis. Warner-Bratzler shear force (WBSF) was measured on 673 steaks, and tenderness and connective tissue were assessed by a sensory panel on 496 steaks. Animals belong to the multibreed Angus-Brahman herd from University of Florida and range from 100% Angus to 100% Brahman. All animals were genotyped with the Bovine GGP F250 array. Gene enrichment was identified in two pathways; the first pathway is involved in negative regulation of transcription from RNA polymerase II, and the second pathway groups several cellular component of the endoplasmic reticulum membrane. Keywords: tenderness, gene enrichment, regulation of transcription, cell growth, cell proliferation Introduction Identification of quantitative trait loci (QTL) for any complex trait, including meat tenderness, is the first most important step in the process of understanding the genetic architecture underlying the phenotype. Given a large enough population and a dense coverage of the genome, a genome-wide association study (GWAS) is usually successful in uncovering major genes and QTLs with large and medium effect on these type of traits. Several GWA studies on Bos indicus (Magalhães et al., 2016; Tizioto et al., 2013) or crossbred beef cattle breeds (Bolormaa et al., 2011b; Hulsman Hanna et al., 2014; Lu et al., 2013) were successful at identifying QTL for meat tenderness; and most of them include the traditional candidate genes µ-calpain and calpastatin.
    [Show full text]
  • Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis
    Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis by Valbona Luga A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy, Department of Molecular Genetics, University of Toronto © Copyright by Valbona Luga, 2013 Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis Valbona Luga Doctor of Philosophy Department of Molecular Genetics University of Toronto 2013 Abstract The tumour-associated stroma, consisting of fibroblasts, inflammatory cells, vasculature and extracellular matrix proteins, plays a critical role in tumour growth, but how it regulates cancer cell migration and metastasis is poorly understood. The Wnt-planar cell polarity (PCP) pathway regulates convergent extension movements in vertebrate development. However, it is unclear whether this pathway also functions in cancer cell migration. In addition, the factors that mobilize long-range signalling of Wnt morphogens, which are tightly associated with the plasma membrane, have yet to be completely characterized. Here, I show that fibroblasts secrete membrane microvesicles of endocytic origin, termed exosomes, which promote tumour cell protrusive activity, motility and metastasis via the exosome component Cd81. In addition, I demonstrate that fibroblast exosomes activate autocrine Wnt-PCP signalling in breast cancer cells as detected by the association of Wnt with Fzd receptors and the asymmetric distribution of Fzd-Dvl and Vangl-Pk complexes in exosome-stimulated cancer cell protrusive structures. Moreover, I show that Pk expression in breast cancer cells is essential for fibroblast-stimulated cancer cell metastasis. Lastly, I reveal that trafficking in cancer cells promotes tethering of autocrine Wnt11 to fibroblast exosomes. These studies further our understanding of the role of ii the tumour-associated stroma in cancer metastasis and bring us closer to a more targeted approach for the treatment of cancer spread.
    [Show full text]
  • Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders
    177 Arch Neuropsychitry 2020;57:177−191 RESEARCH ARTICLE https://doi.org/10.29399/npa.24890 Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders Hakan GÜRKAN1 , Emine İkbal ATLI1 , Engin ATLI1 , Leyla BOZATLI2 , Mengühan ARAZ ALTAY2 , Sinem YALÇINTEPE1 , Yasemin ÖZEN1 , Damla EKER1 , Çisem AKURUT1 , Selma DEMİR1 , Işık GÖRKER2 1Faculty of Medicine, Department of Medical Genetics, Edirne, Trakya University, Edirne, Turkey 2Faculty of Medicine, Department of Child and Adolescent Psychiatry, Trakya University, Edirne, Turkey ABSTRACT Introduction: Aneuploids, copy number variations (CNVs), and single in 39 (39/123=31.7%) patients. Twelve CNV variant of unknown nucleotide variants in specific genes are the main genetic causes of significance (VUS) (9.75%) patients and 7 CNV benign (5.69%) patients developmental delay (DD) and intellectual disability disorder (IDD). were reported. In 6 patients, one or more pathogenic CNVs were These genetic changes can be detected using chromosome analysis, determined. Therefore, the diagnostic efficiency of CMA was found to chromosomal microarray (CMA), and next-generation DNA sequencing be 31.7% (39/123). techniques. Therefore; In this study, we aimed to investigate the Conclusion: Today, genetic analysis is still not part of the routine in the importance of CMA in determining the genomic etiology of unexplained evaluation of IDD patients who present to psychiatry clinics. A genetic DD and IDD in 123 patients. diagnosis from CMA can eliminate genetic question marks and thus Method: For 123 patients, chromosome analysis, DNA fragment analysis alter the clinical management of patients. Approximately one-third and microarray were performed. Conventional G-band karyotype of the positive CMA findings are clinically intervenable.
    [Show full text]
  • WO 2013/064702 A2 10 May 2013 (10.05.2013) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2013/064702 A2 10 May 2013 (10.05.2013) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12Q 1/68 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (21) International Application Number: HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, PCT/EP2012/071868 KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, (22) International Filing Date: ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, 5 November 20 12 (05 .11.20 12) NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, (25) Filing Language: English TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, (26) Publication Language: English ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 1118985.9 3 November 201 1 (03. 11.201 1) GB kind of regional protection available): ARIPO (BW, GH, 13/339,63 1 29 December 201 1 (29. 12.201 1) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, (71) Applicant: DIAGENIC ASA [NO/NO]; Grenseveien 92, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, N-0663 Oslo (NO).
    [Show full text]
  • The Link Between Type 2 Diabetes Mellitus and the Polymorphisms Of
    life Article The Link between Type 2 Diabetes Mellitus and the Polymorphisms of Glutathione-Metabolizing Genes Suggests a New Hypothesis Explaining Disease Initiation and Progression Iuliia Azarova 1,2 , Elena Klyosova 2 and Alexey Polonikov 3,4,* 1 Department of Biological Chemistry, Kursk State Medical University, 3 Karl Marx Street, 305041 Kursk, Russia; [email protected] 2 Laboratory of Biochemical Genetics and Metabolomics, Research Institute for Genetic and Molecular Epidemiology, Kursk State Medical University, 18 Yamskaya St., 305041 Kursk, Russia; [email protected] 3 Laboratory of Statistical Genetics and Bioinformatics, Research Institute for Genetic and Molecular Epidemiology, Kursk State Medical University, 18 Yamskaya St., 305041 Kursk, Russia 4 Department of Biology, Medical Genetics and Ecology, Kursk State Medical University, 3 Karl Marx Street, 305041 Kursk, Russia * Correspondence: [email protected]; Tel.: +7-471-258-8147 Abstract: The present study investigated whether type 2 diabetes (T2D) is associated with polymor- phisms of genes encoding glutathione-metabolizing enzymes such as glutathione synthetase (GSS) and gamma-glutamyl transferase 7 (GGT7). A total of 3198 unrelated Russian subjects including 1572 T2D patients and 1626 healthy subjects were enrolled. Single nucleotide polymorphisms (SNPs) of the GSS and GGT7 genes were genotyped using the MassArray-4 system. We found that the GSS Citation: Azarova, I.; Klyosova, E.; and GGT7 gene polymorphisms alone and in combinations are associated with T2D risk regardless of Polonikov, A. The Link between Type sex, age, and body mass index, as well as correlated with plasma glutathione, hydrogen peroxide, 2 Diabetes Mellitus and the and fasting blood glucose levels. Polymorphisms of GSS (rs13041792) and GGT7 (rs6119534 and Polymorphisms of Glutathione- Metabolizing Genes Suggests a New rs11546155) genes were associated with the tissue-specific expression of genes involved in unfolded Hypothesis Explaining Disease protein response and the regulation of proteostasis.
    [Show full text]
  • A Novel Mirna Identified in GRSF1 Complex Drives the Metastasis Via the PIK3R3/AKT/NF-Κb and TIMP3/MMP9 Pathways in Cervical Ca
    Sun et al. Cell Death and Disease (2019) 10:636 https://doi.org/10.1038/s41419-019-1841-5 Cell Death & Disease ARTICLE Open Access AnovelmiRNAidentified in GRSF1 complex drives the metastasis via the PIK3R3/AKT/NF-κBand TIMP3/MMP9 pathways in cervical cancer cells Qi Sun1, Zhen Yang1,PuLi2,XuWang1,LuSun1, Shixing Wang1,MinLiu1 and Hua Tang1 Abstract microRNAs (miRNAs) play an important role in carcinogenesis. Typically, miRNAs downregulate the target expression by binding to the 3′ UTR of mRNAs. However, recent studies have demonstrated that miRNAs can upregulate target gene expression, but its mechanism is not fully understood. We previously found that G-rich RNA sequence binding protein (GRSF1) mediates upregulation of miR-346 on hTERT gene. To explore whether GRSF1 mediate other miRNA’s upregulation on their target genes, we obtained profile of GRSF1-bound miRNAs by Flag-GRSF1-RIP-deep sequencing and found 12 novel miRNAs, named miR-G. In this study, we focused on miR-G-10, which is highly expressed in cervical cancer tissues and cell lines and serum from patients with metastatic cervical cancer. miR-G-10 in cervical cancer cells significantly promoted migration/invasion and anoikis resistance in vitro and lung metastasis in vivo. Furthermore, miR-G-10 bound to the 3′ UTR of PIK3R3 and upregulated its expression to activate the AKT/NF-κB signal pathway in a GRSF1-dependent manner, whereas miR-G-10 suppressed TIMP3 in the AGO2 complex to modulate the MMP9 signaling pathway in cervical cancer cells. Taken together, our findings may provide a new insight into the upregulation mechanism mediated by miRNAs and a potential biomarker for cervical cancer.
    [Show full text]
  • Microrna‑490‑3P and ‑490‑5P in Carcinogenesis: Separate Or the Same Goal? (Review)
    ONCOLOGY LETTERS 22: 678, 2021 MicroRNA‑490‑3p and ‑490‑5p in carcinogenesis: Separate or the same goal? (Review) YIN LI1, DONGMEI TIAN1, HAO CHEN1, YUANTING CAI1, SANG CHEN1 and SHIWEI DUAN1,2 1Medical Genetics Center, Ningbo University School of Medicine, Ningbo, Zhejiang 315211; 2School of Medicine, Zhejiang University City College, Hangzhou, Zhejiang 310015, P.R. China Received March 16, 2021; Accepted June 3, 2021 DOI: 10.3892/ol.2021.12939 Abstract. MicroRNA (miR)‑490‑3p and miR‑490‑5p, Contents located on chromosome 7q33, are two independent mature products of miR‑490 exerting distinct effects on tumor 1. Introduction progression. miR‑490‑3p and miR‑490‑5p possess antitumor 2. Aberrant expression of miR‑490‑3p and miR‑490‑5p in properties. miR‑490‑3p dysfunction has been associated cancer with malignancies including colorectal cancer, while the 3. Signaling pathways associated with miR‑490‑3p and abnormal function of miR‑490‑5p has been more considerably miR‑490‑5p associated with bladder cancer (for example). At present, there 4. Primary ceRNA regulatory networks of miR‑490‑3p and are 30 and 11 target genes of miR‑490‑3p and miR‑490‑5p, miR‑490‑5p respectively, that have been experimentally verified, of 5. Clinical diagnostic and prognostic values of miR‑490‑3p which the cyclin D1 (CCND1) gene is a common target. and miR‑490‑5p Through these target genes, miR‑490‑3p and miR‑490‑5p 6. miR‑490‑3p‑related anticancer drug resistance are involved in 7 and 3 signaling pathways, respectively, of 7. Discussion which only 2 are shared regulatory signaling pathways.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name endoplasmic reticulum-Golgi intermediate compartment protein 3 Gene Symbol Ergic3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001106533 UniGene ID Rn.22956 Ensembl Gene ID ENSRNOG00000031085 Entrez Gene ID 296306 Assay Information Unique Assay ID qRnoCIP0026362 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000045484 Amplicon Context Sequence GGAGCACAACCTGTTCAAGAAACGACTGGACAAGGATGGCATCCCCGTGAGCTC AGAGGCTGAACGGCATGAGCTTGGGAAAGTCGAGGTGACAGTGTTTGACCCAG ACTCCCTGGACCCCAATCGCT Amplicon Length (bp) 98 Chromosome Location 3:157918985-157920369 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9999 cDNA Cq 19.7 cDNA Tm (Celsius) 85 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Ergic3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]
  • FLAME: Long‐Read Bioinformatics Tool for Comprehensive Spliceome Characterization
    Downloaded from rnajournal.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press FLAME: Long‐read bioinformatics tool for comprehensive spliceome characterization Isak Holmqvist*1, Alan Bäckerholm*1, Yarong Tian1, Guojiang Xie1, Kaisa Thorell1, Ka Wei Tang1,2 *These authors contributed equally 1Department of Infectious Diseases, Institute of Biomedicine, University of Gothenburg, Gothenburg, Sweden. 2Wallenberg Centre for Molecular and Translational Medicine, Sahlgrenska Center for Cancer Research, Västra Götaland Region, Department of Clinical Microbiology, Sahlgrenska University Hospital, Gothenburg, Sweden Corresponding author: [email protected] Downloaded from rnajournal.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Comprehensive characterization of differentially spliced RNA transcripts with nanopore sequencing is limited by bioinformatics tools that are reliant on existing annotations. We have developed FLAME, a bioinformatics pipeline for alternative splicing analysis of gene‐specific or transcriptome‐wide long‐ read sequencing data. FLAME is a Python‐based tool aimed at providing comprehensible quantification of full‐length splice variants, reliable de novo recognition of splice sites and exons, and representation of consecutive exon connectivity in the form of a weighted adjacency matrix. Notably, this workflow circumvents issues related to inadequate reference annotations and allows for incorporation of short‐ read sequencing data to improve the confidence of nanopore sequencing reads. In this study, the Epstein‐Barr virus long non‐coding RNA RPMS1 was used to demonstrate the utility of the pipeline. RPMS1 is ubiquitously expressed in Epstein‐Barr virus associated cancer and known to undergo ample differential splicing. To fully resolve the RPMS1 spliceome, we combined gene‐specific nanopore sequencing reads from a primary gastric adenocarcinoma and a nasopharyngeal carcinoma cell line with matched publicly available short‐read sequencing datasets.
    [Show full text]