bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1 2 HIF-2α is essential for carotid body development and function 3 4 5 6 David Macías1, Andrew S. Cowburn1,2, Hortensia Torres-Torrelo3, Patricia 7 Ortega-Sáenz3, José López-Barneo3, and Randall S. Johnson1,4,5. 8 9 1Department of Physiology, Development and Neuroscience. 2Department of 10 Medicine, University of Cambridge, Cambridge, UK; 3Instituto de Biomedicina 11 de Sevilla (IBiS), Seville, Spain. 4Department of Cell and Molecular Biology, 12 Karolinska Institute, Stockholm, Sweden. 13 14 15 16 17 18 19 20 21 22 23 Keywords: hypoxia, carotid body, oxygen sensing, HIF-2α, HVR, physiological 24 responses 25 26 27 28 5For correspondence: Professor Randall S. Johnson, Department of 29 Physiology, Development and Neuroscience, University of Cambridge, 30 Downing Street, Cambridge. CB2 3EG. United Kingdom. E-mail: 31 [email protected] 32
33
1 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
34 Summary
35 Mammalian adaptation to oxygen flux occurs at many levels, from shifts in
36 cellular metabolism to physiological adaptations facilitated by the sympathetic
37 nervous system and carotid body (CB). Interactions between differing forms of
38 adaptive response to hypoxia, including transcriptional responses
39 orchestrated by the Hypoxia Inducible transcription Factors (HIFs), are
40 complex and clearly synergistic. We show here that there is an absolute
41 developmental requirement for HIF-2a, one of the HIF isoforms, for growth
42 and survival of oxygen sensitive glomus cells of the carotid body. The loss of
43 these cells renders mice incapable of ventilatory responses to hypoxia, and
44 this has striking effects on processes as diverse as arterial pressure
45 regulation, exercise performance, and glucose homeostasis. We show that
46 the expansion of the glomus cells is correlated with mTORC1 activation, and
47 is functionally inhibited by rapamycin treatment. These findings demonstrate
48 the central role played by HIF-2a in carotid body development, growth and
49 function.
50
51
52
53
54
55
56
57
58
2 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
59 Introduction
60 Detecting and responding to shifts in oxygen availability is essential for animal
61 survival. Responding to changes in oxygenation occurs in cells, tissues, and
62 at the level of the whole organism. Although many of responses to oxygen flux
63 are regulated at the transcriptional level by the hypoxia inducible transcription
64 factor (HIF), at tissue and organismal levels there are even more dimensions
65 to the adaptive process. In vertebrates, the actors in adaptation are found in
66 different peripheral chemoreceptors, including the neuroepithelial cells of the
67 gills in teleosts, and in the carotid body (CB) of mammals. The CB regulates
68 many responses to changes in oxygenation, including alterations in ventilation
69 and heart rates.
70
71 The carotid body is located at the carotid artery bifurcation, and contains
72 glomeruli that contain O2-sensitive, neuron-like tyrosine hydroxylase (TH)-
73 positive glomus cells (type I cells). These glomus cells are responsible for a
74 rapid compensatory hypoxic ventilatory response (HVR) when a drop in
75 arterial O2 tension (PO2) occurs (Lopez-Barneo, Ortega-Saenz, et al., 2016;
76 Teppema & Dahan, 2010). In addition to this acute reflex, the CB plays an
77 important role in acclimatization to sustained hypoxia, and is commonly
78 enlarged in people living at high altitude (Arias-Stella & Valcarcel, 1976; Wang
79 & Bisgard, 2002) and in patients with chronic respiratory diseases (Heath &
80 Edwards, 1971; Heath, Smith, & Jago, 1982). This enlargement is induced
81 through a proliferative response of CB stem cells (type II cells)(Pardal,
82 Ortega-Saenz, Duran, & Lopez-Barneo, 2007; Platero-Luengo et al., 2014).
3 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
83 During embryogenesis, the initiating event in CB organogenesis occurs when
84 multipotent neural crest cells migrate toward the dorsal aorta, to give rise to
85 the sympathoadrenal system (Le Douarin, 1986). Segregation of sympathetic
86 progenitors from the superior cervical ganglion (SCG) then creates the CB
87 parenchyma (Kameda, 2005; Kameda, Ito, Nishimaki, & Gotoh, 2008). This
88 structure is comprised of O2-sensitive glomus cells (type-I cells) (Pearse et al.,
89 1973), glia-like sustentacular cells (type-II cells) (Pardal et al., 2007) and
90 endothelial cells (Annese, Navarro-Guerrero, Rodriguez-Prieto, & Pardal,
91 2017).
92
93 The cellular response to low oxygen is in part modulated by two isoforms of
94 the HIF-α transcription factor, each with differing roles in cellular and
95 organismal response to oxygen flux: HIF-1α and HIF-2α. At the organismal
96 level, mouse models hemizygous for HIFs-α (Hif-1α+/- and Hif-2α+/-) or where
97 HIF inactivation was induced in adults showed contrasting effects on CB
98 function, without in either case affecting CB morphogenesis (Hodson et al.,
99 2016; Kline, Peng, Manalo, Semenza, & Prabhakar, 2002; Y. J. Peng et al.,
100 2011).
101
102 Transcriptome analysis has confirmed that Hif-2α is the second most
103 abundant transcript in neonatal CB glomus cells (Tian, Hammer, Matsumoto,
104 Russell, & McKnight, 1998; Zhou, Chien, Kaleem, & Matsunami, 2016), and
105 that it is expressed at far higher levels than are found in cells of similar
106 developmental origins, including superior cervical ganglion (SCG) sympathetic
107 neurons (Gao et al., 2017). It has also been recently shown that Hif-2α, but
4 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
108 not Hif-1α, overexpression in sympathoadrenal cells leads to enlargement of
109 the CB (Macias, Fernandez-Aguera, Bonilla-Henao, & Lopez-Barneo, 2014).
110 Here, we report that HIF-2α is required for the development of CB O2-
111 sensitive glomus cells, and that mutant animals lacking CB function have
112 impaired adaptive physiological responses.
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
5 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
133 Results
134 Sympathoadrenal Hif-2α loss blocks carotid body glomus cell
135 development
136 To elucidate the role of HIFα isoforms in CB development and function, we
137 generated mouse strains carrying Hif-1α or Hif-2α embryonic deletions (TH-
138 HIF-1αKO and TH-HIF-2αKO) restricted to catecholaminergic tissues by
139 crossing them with a mouse strain expressing cre recombinase under the
140 control of the endogenous tyrosine hydroxylase (TH) promoter (Macias et al.,
141 2014).
142
143 Histological analysis of the carotid artery bifurcation dissected from adult TH-
144 HIF-2αKO mice revealed virtually no CB TH+ glomus cells (Figure 1A, bottom
145 panels) compared to HIF-2αWT littermate controls (Figure 1A, top panels).
146 Conversely, TH-HIF-1αKO mice showed a typical glomus cell organization,
147 characterized by scattered clusters of TH+ cells throughout the CB
148 parenchyma (Figure 1B, bottom panels) similar to those found in HIF-1αWT
149 littermate controls (Figure 1B, top panels). These observations were further
150 corroborated by quantification of the total CB parenchyma volume (Figure 1D-
151 1F).
152
153 Other catecholaminergic organs whose embryological origins are similar to
154 those of the CB, e.g., the superior cervical ganglion (SCG), do not show
155 significant differences in structure or volume between TH-HIF-2αKO mutants
156 and control mice (Figure 1A-C). This suggests a specific role of HIF-2α in the
157 development of the CB glomus cells, and argues against a global role for the
6 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
158 gene in development of catecholaminergic tissues. Further evidence for this
159 comes from phenotypic characterization of adrenal medulla (AM) TH+
160 chromaffin cells. No major histological alterations were observed in adrenal
161 glands removed from TH-HIF-2αKO and TH-HIF-1αKO mutant mice compared
162 to HIF-2αWT and HIF-1αWT littermate controls (Figure 1G and H). Consistent
163 with this, the amount of catecholamine (adrenaline and noradrenaline) present
164 in the urine of TH-HIF-2αKO and TH-HIF-1αKO deficient mice was similar to
165 that found in their respective littermate controls (Figure 1I).
166
167 To determine deletion frequencies in these tissues, we crossed a loxP-flanked
168 Td-Tomato reporter strain (Madisen et al., 2010) with TH-IRES-Cre mouse
169 mice. Td-Tomato+ signal was only detected within the CB, SCG and AM of
170 mice expressing cre recombinase under the control of the Th promoter
171 (Figure 1-figure supplement 1A). Additionally, SCG and AM from HIF-2αWT,
172 HIF-1αWT, TH-HIF-2αKO and TH-HIF-1αKO were quantified for Hif-2α and Hif-
173 1α deletion efficiency using genomic DNA. As expected, there is a significant
174 level of deletion of Hif-2α and Hif-1α genes detected in TH-HIF-2αKO and TH-
175 HIF-1αKO mutant mice compared to HIF-2αWT and HIF-1αWT littermates
176 controls (Figure 1-figure supplement 1B and C).
177
178 To determine whether absence of CB glomus cells in adult TH-HIF-2αKO mice
179 is a result of impaired glomus cell differentiation or cell survival, we examined
180 carotid artery bifurcations dissected from TH-HIF-2αKO mice at embryonic
181 stage E18.5 (i.e., 1-2 days before birth), and postnatally (P0) (Figure 2A).
182 Differentiated TH+ glomus cells were found in the carotid bifurcation of TH-
7 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
183 HIF-2αKO mutant mice at both stages (Figure 2A). However, there is a
184 significant reduction in the total CB parenchyma volume and in the number of
185 differentiated TH+ glomus cells in TH-HIF-2αKO mice at E18.5, and this
186 reduction is even more evident in newborn mice (Figure 2B and C). Since CB
187 volume and cells number of mutant mice decreased in parallel, no significant
188 changes were seen in TH+ cell density at these two time points, however
189 (Figure 2D).
190
191 Consistent with the results described above (Figure 1C), the SCG volume was
192 not different in mutant newborns relative to wild type controls (Figure 2E). We
193 next assessed cell death in the developing CB, and found a progressive
194 increase in the number of TUNEL+ cells within the CB parenchyma of TH-HIF-
195 2αKO mice compared to HIF-2αWT littermates (Figure 2F and G). These data
196 demonstrate that HIF-2α, but not HIF-1α, is essential for the differentiation of
197 CB glomus cells.
198
199 Impaired ventilatory response and whole-body metabolic activity in TH-
200 HIF-2αKO mice exposed to hypoxia
201 Although TH-HIF-2αKO deficient mice did not show an apparent phenotype in
202 the AM or SCG, it was important to determine whether their secretory or
203 electrical properties were altered (Figure 3-figure supplement 1). The
204 secretory activity of chromaffin cells under basal conditions and in response to
205 hypoxia, hypercapnia and high (20mM) extracellular K+ was not changed in
206 TH-HIF-2αKO mice (8-12 weeks old) relative to control littermates (Figure 3-
207 figure supplement 1A-D). Current-voltage (I-V) relationships for Ca2+ and K+
8 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
208 currents of dispersed chromaffin cells (Figure 3- figure supplement 1E) and
209 SCG neurons (Figure 3-figure supplement 1F) were also similar in HIF-2αWT
210 and TH-HIF-2αKO animals. These data further support the notion that HIF-2α
211 loss in the sympathoadrenal lineages predominantly affects CB glomus cells.
212
213 To study the impact of the TH-HIF-2αKO mutation on respiratory function, we
214 examined ventilation in normoxia (21% O2) and in response to environmental
215 normobaric hypoxia (10% O2) via whole-body plethysmography. Figure 3A
216 illustrates the changes of respiratory rate during a prolonged hypoxic time-
217 course in HIF-2αWT and TH-HIF-2αKO littermates. HIF-2αWT mice breathing
218 10% O2 had a biphasic response, characterized by an initial rapid increase in
219 respiratory rate followed by a slow decline. In contrast, TH-HIF-2αKO mice,
220 which have normal ventilation rates in normoxia (Figure 3A-C), respond
221 abnormally throughout the hypoxic period. Averaged respiratory rate and
222 minute volume during the initial 5 minutes of hypoxia show a substantial
223 reduction in ventilation rate in TH-HIF-2αKO mutant mice relative to HIF-2αWT
224 controls (Figure 3B and C).
225
226 Additional respiratory parameters altered by the lack of CB in response to
227 hypoxia are shown in Figure 3-supplement 2. Consistent with these data,
228 hemoglobin saturation levels dropped to 50-55% in TH-HIF-2αKO mice, as
229 compared to 73% saturation in control animals after exposure to 10% O2 for 5
230 minutes (Figure 3D). HIF-1αWT and TH-HIF-1αKO mice have similar respiratory
231 responses to 21% O2 and 10% O2, which indicates that HIF-1α is not required
9 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
232 for the CB-mediated ventilatory response to hypoxia (Figure 3E-G; Figure 3-
233 supplemental 2F-J).
234 We next determined metabolic activity in HIF-2αWT and TH-HIF-2αKO
235 littermates in a 21% O2 or 10% O2 environment. Circadian metabolic profiles
KO 236 (VO2 and VCO2) were similar in WT and TH-HIF-2α mutant mice (Figure 3H
237 and I). After exposure to hypoxia, however, TH-HIF-2αKO mice showed lower
238 VO2 and VCO2 peaks and had a significantly hampered metabolic adaptation
239 to low oxygen (Figure 3J and K).
240
241 Deficient acclimatization to chronic hypoxia in mice with CBs loss
242 The CB grows and expands during sustained hypoxia, due to the proliferative
243 response of glia-like (GFAP+) neural crest-derived stem cells within the CB
244 parenchyma (Arias-Stella & Valcarcel, 1976; Pardal et al., 2007). Despite the
245 absence of adult TH+ oxygen sensing cells in TH-HIF-2αKO mice, we identified
246 a normal number of CB GFAP+ stem cells in the carotid artery bifurcation of
247 these animals (Figure 4-figure supplement 1A). We then determined the rate
248 at which CB progenitors from TH-HIF-2αKO mice were able to give rise to
249 newly formed CB TH+ glomus cells after chronic hypoxia exposition in vivo.
250 Typical CB enlargement and emergence of double BrdU+ TH+ glomus cells
WT 251 was seen in HIF-2α mice after 14 days breathing 10% O2 (Figure 4-figure
252 supplement 1B-D), as previously described (Pardal et al., 2007). However, no
253 newly formed double BrdU+ TH+ glomus cells were observed in TH-HIF-2αKO
254 mice after 14 days in hypoxia (Figure 4-figure supplement 1B-D). These
255 observations are consistent with the documented role of CB glomus cells as
10 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
256 activators of the CB progenitors proliferation in response to hypoxia (Platero-
257 Luengo et al., 2014).
258
259 HIF-2αWT, HIF-1αWT and TH-HIF-1αKO mice adapted well and survived up to
260 21 days in a 10% O2 atmosphere normally. However, long-term survival of the
KO 261 TH-HIF-2α deficient mice kept in a 10% O2 environment was severely
262 compromised, and only 40% reached the experimental endpoint (Figure 4A).
263 Mouse necropsies revealed internal general haemorrhages, which are most
264 likely the cause of the death. TH-HIF-2αKO mice also showed increased
265 haematocrit and haemoglobin levels relative to HIF-2αWT littermates when
266 maintained for 21 days in a 10% O2 atmosphere (Figure 4B and C).
267 Consistent with this, after 21 days in hypoxia, heart and spleen removed from
268 TH-HIF-2αKO mice were enlarged relative to HIF-2αWT littermates, likely due to
269 increased blood viscosity and extramedullary hematopoiesis, respectively
270 (Figure 4D and E). TH-HIF-1αKO mice did not show significant differences
WT 271 compared to HIF-1α littermates maintained either in a 21% O2 or 10% O2
272 environment (Figure 4-figure supplement 2A-D).
273
274 Chronic exposure to hypoxia induces pulmonary arterial hypertension (PAH)
275 in mice (Cowburn et al., 2016; Stenmark, Meyrick, Galie, Mooi, & McMurtry,
276 2009). The right ventricle was found to be significantly enlarged in TH-HIF-
KO 277 2α mice relative to control mice after 21 days of 10% O2 exposure,
278 indicating an aggravation of pulmonary hypertension (Figure 4F). This result
279 was further confirmed by direct measurement of right ventricular systolic
280 pressure (RVSP) on anaesthetised mice (Figure 4G). Lung histology of mice
11 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
281 chronically exposed to 10% O2 (Figure 4H) shows that the percentage of fully
282 muscularized lung peripheral vessels is significantly increased in TH-HIF-2αKO
283 mice relative to controls. The tunica media of lung peripheral vessels was also
284 significantly thicker in TH-HIF-2αKO mice compared to HIF-2αKO littermates
285 after 21 days of hypoxic exposure (Figure 4I). Taken together, these data
286 demonstrate that pulmonary adaptation to chronic hypoxia is highly reliant on
287 a normally functioning CB.
288
289 Cardiovascular homeostasis is altered in mice lacking CBs
290 An important element of the CB chemoreflex is an increase in sympathetic
291 outflow (Lopez-Barneo, Ortega-Saenz, et al., 2016). To determine whether
292 this had been affected in TH-HIF-2αKO mutants, cardiovascular parameters
293 were recorded on unrestrained mice by radiotelemetry. Circadian blood
294 pressure monitoring showed a constitutive hypotensive condition that was
295 more pronounced during the diurnal period (Figure 5A and B) and did not
296 correlate with changes in heart rate, subcutaneous temperature or activity
297 (Figure 5C; Figure 5-figure supplement 1A and B). We next subjected
WT KO 298 radiotelemetry-implanted HIF-2α and TH-HIF-2α littermates to a 10% O2
299 environment preceded and followed by a 24 hour period of normoxia (Figure
300 5D-F; Figure 5-figure supplement 1C-E). Normal control HIF-2αWT mice have
301 a triphasic response to this level of hypoxia, characterised by a short (10
302 minutes) initial tachycardia and hypertension, followed by a marked drop both
303 in heart rate and blood pressure; a partial to complete recovery is then seen
304 after 24-36 hours (Figure 5D and E; Figure 5-figure supplement 1C and
305 D)(Cowburn, Macias, Summers, Chilvers, & Johnson, 2017). However, while
12 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
306 TH-HIF-2αKO mice experienced similar, but less deep, hypotension 3 hours
307 post hypoxic challenge, they failed to recover, and showed a persistent
308 hypotensive state throughout the hypoxic period (Figure 5D; Figure 5-figure
309 supplement 1C and D). Interestingly, the bradycardic effect of hypoxia on
310 heart rate was abolished in TH-HIF-2αKO animals (Figure 5E). Subcutaneous
311 temperature, an indirect indicator of vascular resistance in the skin, showed
312 an analogous trend to that seen in the blood pressure of TH-HIF-2αKO
313 mutants (Figure 5F). Activity of TH-HIF-2αKO mice during hypoxia was slightly
314 reduced relative to littermate controls (Figure 5-figure supplement 1E).
315
316 The carotid body has been proposed as a therapeutic target for neurogenic
317 hypertension (McBryde et al., 2013; Pijacka et al., 2016). To determine the
318 relationship between CB and hypertension in these mutants, we performed
319 blood pressure recordings in an angiotensin II (Ang II)-induced experimental
320 hypertension model (Figure 5G). As shown, TH-HIF-2αKO animals showed
321 lower blood pressure relative to HIF-2αWT littermate controls after 7 days of
322 Ang II infusion (Figure 5H; Figure 5-figure supplement 1F and G). Heart rate,
323 subcutaneous temperature and physical activity were unchanged throughout
324 the experiment (Figure 5K-M; Figure 5-figure supplement 1). Collectively,
325 these data highlight the CB as a systemic cardiovascular regulator which,
326 contributes to baseline blood pressure modulation, is critical for
327 cardiovascular adaptations to hypoxia and delays the development of Ang II-
328 induced experimental hypertension.
329
13 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
330 Adaptive responses to exercise and high glucose are affected in mice
331 with CB dysfunction
332 We next questioned whether this mutant, which lacks virtually all CB function,
333 can inform questions about adaptation to other physiological stressors. In the
334 first instance, we assessed metabolic activity during a maximal exertion
335 exercise test. Oxygen consumption and carbon dioxide production (VO2 and
WT KO 336 VCO2, respectively) were comparable in HIF-2α and TH-HIF-2α mice at
KO 337 the beginning of the test. However, TH-HIF-2α mutants reached VO2max
338 much earlier than wild type controls, with significantly decreased heat
339 generation (Figure 6A, B and D). There was no shift in energetic substrate
340 usage, as evidenced by the lack of difference in respiratory exchange ratio
341 (RER) (Figure 6C). The time to exhaustion trended lower in mutants, and
342 there was a significant reduction in both aerobic capacity and power output
343 relative to littermate controls (Figure 6E-G). Interestingly, although no
344 significant changes were found in glucose blood content across the
345 experimental groups and conditions (Figure 6H), lactate levels in TH-HIF-2αKO
346 mice were significantly lower than those observed in HIF-2αWT mice after
347 running (Figure 6I).
348
349 We next examined the response of TH-HIF-2αKO mice to hyperglycemic and
350 hypoglycemic challenge. Baseline glucose levels of HIF-2αWT and TH-HIF-
351 2αKO animals were not statistically different under fed and fasting conditions
352 (Figure 6J and K), and metabolic activity during fasting was unaffected (Figure
353 6-figure supplement 1A-D). However, TH-HIF-2αKO mutant mice showed
354 significant changes in glucose tolerance, with no change in insulin tolerance
14 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
355 when compared to HIF-2αWT littermates (Figure 6L and M). TH-HIF-2αKO mice
356 also showed an initially hampered lactate clearance relative to control mice
357 (Figure 6N). Together, these data demonstrate that the mutants demonstrate
358 intriguing roles for the CB in metabolic adaptations triggered by both exercise
359 and hyperglycemia.
360
361 CB development and proliferation in response to hypoxia require
362 mTORC1 activation
363 Hypoxia is an mTORC1 activator that can induce cell proliferation and growth
364 in a number of organs, e.g., the lung parenchyma (Brusselmans et al., 2003;
365 Cowburn et al., 2016; Elorza et al., 2012; Hubbi & Semenza, 2015; Torres-
366 Capelli et al., 2016). Physiological proliferation and differentiation of the CB
367 induced by hypoxia closely resembles CB developmental expansion (Annese
368 et al., 2017; Pardal et al., 2007; Platero-Luengo et al., 2014); therefore a
369 potential explanation for the developmental defects in CB expansion observed
370 in above could be defects in mTORC1 activation.
371
372 To test this hypothesis, we first determined mTORC1 activation levels in the
373 CB of mice maintained at 21% O2 or 10% O2 for 14 days. This was done via
374 immunofluorescent detection of the phosphorylated form of the ribosomal
375 protein S6 (p-S6) (Elorza et al., 2012; Ma & Blenis, 2009). In normoxia, there
376 was a faint p-S6 expression within the TH+ glomus cells of the CB in wild type
377 mice; this contrasts with the strong signal detected in SCG sympathetic
378 neurons (Figure 7A, left panels; Figure 7-figure supplement 1A, left panel).
379 However, after 14 days in a 10% O2 environment, we saw a significantly
15 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
380 increased p-S6 signal within the CB TH+ cells while the SCG sympathetic
381 neurons remained at levels similar to those seen in normoxia (Figure 7A and
382 B; Figure 7-figure supplement 1A and B). TH expression, which is induced by
383 hypoxia (Schnell et al., 2003), was also significantly elevated in CB TH+ cells,
384 and trended higher in SCG sympathetic neurons (Figure 7B; Figure 7-figure
385 supplement 1B).
386
387 We next assessed the role of HIF-2α in this hypoxia-induced mTORC1
388 activation. We began with evaluating expression of p-S6 in late stage
389 embryos. In E18.5 embryos there was a striking accumulation of p-S6; this is
390 significantly reduced in HIF-2α deficient CB TH+ cells in embryos from this
391 stage of development (Figure 7C and D). p-S6 levels in SCG TH+ sympathetic
392 neurons of HIF-2αWT and TH-HIF-2αKO E18.5 embryos were unaffected,
393 however (Figure 7-figure supplement 1C and D).
394
395 TH expression trended lower in both CB and SCG TH+ cells from TH-HIF-
396 2αKO E18.5 embryos relative to HIF-2αWT littermate controls (Figure 7D;
397 Figure 7-figure supplement 1D). These data indicate that HIF-2α regulates
398 mTORC1 activity in the CB glomus cells during development. To determine
399 whether this pathway could be pharmacologically manipulated, we then
400 studied the effect of mTORC1 inhibition by rapamycin on CB proliferation and
401 growth following exposure to environmental hypoxia. mTORC1 activity, as
402 determined by p-S6 staining on SCG and CB TH+ cells after 14 days of
403 hypoxic treatment, was inhibited after in vivo rapamycin administration (Figure
404 7-figure supplement 1E). Interestingly, histological analysis of rapamycin
16 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
405 injected wild type mice maintained for 14 days at 10% O2 showed decreased
406 CB parenchyma volume, TH+ cells number, and showed a dramatic reduction
407 in the number of proliferating double BrdU+ TH+ cells when compared to
408 vehicle-injected mice (Figure 7E-H).
409
410 In addition, we assessed the ventilatory acclimatization to hypoxia (VAH), as a
411 progressive increase in ventilation rates is associated with CB growth during
412 sustained exposure to hypoxia (Hodson et al., 2016). Consistent with the
413 histological analysis above, rapamycin treated mice had a decreased VAH
414 compared to vehicle-injected control mice following 7 days at 10% O2 (Figure
415 7K). Haematocrit levels were comparable between vehicle control and
416 rapamycing treated wild type mice after 7 days in hypoxia (Figure 7-figure
417 supplement 1F).
418
419 Collectively, these data indicate that mTORC1 activation is required for CB
420 expansion in a HIF-2α-dependent manner, and this activation regulates CB
421 growth and subsequent VAH under prolonged low pO2 conditions.
422
17 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
423 Discussion
424 Metabolic homeostasis depends on a complex system of O2-sensing cells and
425 organs. The carotid body is central to this, via its regulation of metabolic and
426 ventilatory responses to oxygen (Lopez-Barneo, Macias, Platero-Luengo,
427 Ortega-Saenz, & Pardal, 2016). At the cellular level, the HIF transcription
428 factor is equally central for responses to oxygen flux. However, how HIF
429 contributes to the development and function of CB O2-sensitivity is still not
430 completely understood. Initial studies performed on global Hif-1α-/- or Hif-2α-/-
431 mutant mice revealed that HIFs are critical for development (Compernolle et
432 al., 2002; Iyer et al., 1998; J. Peng, Zhang, Drysdale, & Fong, 2000; Ryan, Lo,
433 & Johnson, 1998; Scortegagna et al., 2003; Tian et al., 1998), but only HIF-
434 2α-/- embryos showed defects in catecholamine homeostasis, which indicated
435 a potential role in sympathoadrenal development (Tian et al., 1998).
436
437 Investigations using hemizygous Hif-1α+/- and Hif-2α+/- mice showed no
438 changes in the CB histology or overall morphology (Kline et al., 2002; Y. J.
439 Peng et al., 2011). However, our findings demonstrate that embryological
440 deletion of Hif-2α, but not Hif-1α, specifically in sympathoadrenal tissues
+ 441 (TH ) prevents O2-sensitive glomus cell development, without affecting SCG
442 sympathetic neurons or AM chromaffin cells of the same embryological origin.
443 It was previously reported that HIF-2α, but not HIF-1α overactivation in
444 catecholaminergic tissues led to marked enlargement of the CB (Macias et al.,
445 2014). Mouse models of Chuvash polycythemia, which have a global increase
446 in HIF-2α levels, also show CB hypertrophy and enhanced acute hypoxic
447 ventilatory response (Slingo, Turner, Christian, Buckler, & Robbins, 2014).
18 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
448 Thus either over-expression or deficiency of HIF-2α clearly perturbs CB
449 development and, by extension, function.
450
451 Sustained hypoxia is generally thought to attenuate cell proliferation in a HIF-
452 1α-dependent fashion (Carmeliet et al., 1998; Goda et al., 2003; Koshiji et al.,
453 2004). However, environmental hypoxia can also trigger growth of a number
454 of specialized tissues, including the CB (Arias-Stella & Valcarcel, 1976; Pardal
455 et al., 2007) and the pulmonary arteries (Madden, Vadula, & Kurup, 1992). In
456 this context, the HIF-2α isoform seems to play the more prominent role, and
457 has been associated with pulmonary vascular remodeling as well as with
458 bronchial epithelial proliferation (Brusselmans et al., 2003; Bryant et al., 2016;
459 Cowburn et al., 2016; Kapitsinou et al., 2016; Tan et al., 2013; Torres-Capelli
460 et al., 2016).
461
462 CB enlargement induced by hypoxia to a large extent recapitulates the cellular
463 events that give rise to mature O2-sensitive glomus cells in development. In a
464 recent study, global HIF-2α, but not HIF-1α, inactivation in adult mice was
465 shown to impair CB growth and associated VAH caused by exposure to
466 chronic hypoxia (Hodson et al., 2016). Therefore, we used this physiological
467 proliferative response as a model to understand the developmental
468 mechanisms underpinning of HIF-2α deletion in O2-sensitive glomus cells.
469
470 Contrasting effects of HIF-α isoforms on the mammalian target of rapamycin
471 complex 1 (mTORC1) activity can be found in the literature that mirror the
472 differential regulation of cellular proliferation induced by hypoxia in different
19 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
473 tissues (see above) (Brugarolas et al., 2004; Elorza et al., 2012; Liu et al.,
474 2006). Our findings reveal that mTORC1, a central regulator of cellular
475 metabolism, proliferation and survival (Laplante & Sabatini, 2012), is
476 necessary for CB O2-sensitive glomus cell proliferation; and further, that
477 impact in the subsequent enhancement of the hypoxic ventilatory response
478 induced by chronic hypoxia. Importantly, we found that mTORC1 activity is
479 reduced in HIF-2α-deficient embryonic glomus cells, but not in SCG
480 sympathetic neurons, which likely explains the absence of a functional adult
481 CB in these mutants.
482
483 As HIF-2α regulates mTORC1 activity to promote proliferation, this
484 connection could prove relevant in pathological situations; e.g., both somatic
485 and germline Hif-2α gain-of-function mutations have been found in patients
486 with paraganglioma, a catecholamine-secreting tumor of neural crest origin
487 (Lorenzo et al., 2013; Zhuang et al., 2012). Indeed, CB tumors are 10 times
488 more frequent in people living at high altitude (Saldana, Salem, & Travezan,
489 1973). As further evidence of this link, it has been shown that the mTOR
490 pathway is commonly activated in both paraganglioma and
491 pheochromocytoma tumors (Du et al., 2016; Favier, Amar, & Gimenez-
492 Roqueplo, 2015).
493
494 CB chemoreception plays a crucial role in homeostasis, particularly in
495 regulating cardiovascular and respiratory responses to hypoxia. Our data
KO 496 show that mice lacking CB O2-sensitive cells (TH-HIF-2α mice) have
497 impaired respiratory, cardiovascular and metabolic adaptive responses.
20 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
498 Although previous studies have linked HIF-2α and CB function (Hodson et al.,
499 2016; Y. J. Peng et al., 2011), none of them exhibited a complete CB loss of
500 function. This might explain the differing effects observed in hemizygous Hif-
501 2α+/- mice (Hodson et al., 2016; Y. J. Peng et al., 2011) compared to our TH-
502 HIF-2αKO mice.
503 Mice with a specific HIF-1α ablation in CB O2-sensitive glomus cells (TH-HIF-
504 1αKO mice) did not show altered hypoxic responses in our experimental
505 conditions. Consistent with this, hemizygous Hif-1α+/- mice exhibited a normal
506 acute HVR (Hodson et al., 2016; Kline et al., 2002) albeit some otherwise
507 aberrant CB activities in response to hypoxia (Kline et al., 2002; Ortega-
508 Saenz, Pascual, Piruat, & Lopez-Barneo, 2007).
509
510 Alterations in CB development and/or function have recently acquired
511 increasing potential clinical significance and have been associated with
512 diseases such as heart failure, obstructive sleep apnea, chronic obstructive
513 pulmonary disease, sudden death infant syndrome and hypertension
514 (Iturriaga, Del Rio, Idiaquez, & Somers, 2016; Lopez-Barneo, Ortega-Saenz,
515 et al., 2016).
516
517 We describe here the first mouse model with specific loss of carotid body O2-
518 sensitive cells: a model that is viable in normoxia but shows impaired
519 physiological adaptations to both acute and chronic hypoxia. In addition, we
520 describe new and likely important roles for the CB in systemic blood pressure
521 regulation, exercise performance and glucose management. Further
21 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
522 investigation of this mouse model could aid in revealing roles of the carotid
523 body in both physiology and disease.
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
22 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
547 Material and Methods
548 Mice husbandry
549 This research has been regulated under the Animals (Scientific Procedures)
550 Act 1986 Amendment Regulations 2012 following ethical review by the
551 University of Cambridge Animal Welfare and Ethical Review Body (AWERB).
552 Targeted deletion of Hif-1α, Hif-2α and Td-Tomato in sympathoadrenal
553 tissues was achieved by crossing homozygous mice carrying loxP-flanked
554 alleles Hif1atm3Rsjo (Ryan et al., 1998), Epas1tm1Mcs (Gruber et al., 2007) or
555 Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (Madisen et al., 2010) into a mouse strain of
556 cre recombinase expression driven by the endogenous tyrosine hydroxylase
557 promoter (Thtm1(cre)Te)(Lindeberg et al., 2004), which is specific of
558 catecholaminergic cells. LoxP-flanked littermate mice without cre
559 recombinase (HIF-1αflox/flox, HIF-2αflox/flox or Td-Tomatoflox/flox) were used as
560 control group (HIF-1αWT, HIF-2αWT and Td-Tomato, respectively) for all the
561 experiments. C57BL/6J wild type mice were purchased from The Jackson
562 laboratory (Bar Harbor, Maine, US). All the experiments were performed with
563 age and sex matched control and experimental mice.
564
565 Tissue preparation, immunohistochemistry and morphometry
566 Newborn (P0) and adult mice (8-12 weeks old) were killed by an overdose of
567 sodium pentobarbital injected intraperitoneally. E18.5 embryos were collected
568 and submerged into a cold formalin solution (Sigma-Aldrich, Dorset, UK). The
569 carotid bifurcation and adrenal gland, were dissected, fixed for 2 hours with
570 4% paraformaldehyde (Santa Cruz Biotechnology) and cryopreserved (30%
571 sucrose in PBS) for cryosectioning (10 µm thick, Bright Instruments, Luton,
23 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
572 UK). Tyrosine hydroxylase (TH), glial fibrillary acidic protein (GFAP),
573 bromodeoxyuridine (BrdU) and phospho-S6 ribosomal protein (p-S6) were
574 detected using the following polyclonal antibodies: rabbit anti-TH (1:5000,
575 Novus Biologicals, Abindong, UK; NB300-109) for single immunofluorescence
576 or chicken anti-TH (1:1000, abcam, Cambridge, UK; ab76442) for double
577 immunofluorescence, rabbit anti-GFAP (1:500, Dako, Cambridge, UK;
578 Z0334), rat anti-BrdU (1:100, abcam, ab6326), and rabbit anti-phospho-S6
579 ribosomal protein (1:200, Cell Signaling, 2211), respectively. Fluorescence-
580 based detection was visualized using, Alexa-Fluor 488- and 568-conjugated
581 anti-rabbit IgG (1:500, ThermoFisher, Waltham, MA US), Alexa-Fluor 488-
582 conjugated anti-chicken IgG (1:500, ThermoFisher) and Alexa-Fluor 488-
583 conjudaged anti-rat IgG (1:500, ThermoFisher) secondary antibodies.
584 Chromogen-based detection was performed with Dako REAL Detection
585 Systems, Peroxidase/DAB+, Rabbit/Mouse (Dako, K5001) and counterstained
586 with Carrazzi hematoxylin. For the Td-Tomato detection, carotid bifurcation
587 and adrenal gland were dissected, embedded with OCT, flash-frozen into
588 liquid N2 and sectioned (10 µm thick, Bright Instruments). Direct Td-Tomato
589 fluorescence was imaged after nuclear counterstain with 4',6-diamidino-2-
590 phenylindole (DAPI).
591 CB glomus cell counting, area measurements and pixel mean intensity were
592 calculated on micrographs (Leica DM-RB, Wetzlar, Gernany) taken from
593 sections spaced 40 µm apart across the entire CB using Fiji software
594 (Schindelin et al., 2012) as previously reported (Macias et al., 2014). CB and
595 SCG volume was estimated on the same micrographs according to Cavalieri’s
596 principle. Lung tissue was removed in the distended state by infusion into the
24 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
597 trachea of 0.8% agarose and then fixed in 4% paraformaldehyde for paraffin
598 embedding. Lung sections (6 µm thick) were stained with H&E and EVG stain
599 to assess morphology (Merck, Darmstadt, Germany). Vessel medial thickness
600 was measured on micrographs using Fiji software. To determine the degree of
601 muscularization of small pulmonary arteries, serial lung tissue sections were
602 stained with anti-α smooth muscle actin (1:200, Sigma-Aldrich, A2547).
603 Tissue sections were independently coded and quantified by a blinded
604 investigator.
605
606 Gene deletion
607 Genomic DNA was isolated from dissected SCG and AM using DNeasy Blood
608 & Tissue Kit (Qiagen, Hilden, Germany). Relative gene deletion was assayed
609 by qPCR (One-Step Plus Real-Time PCR System; ThermoFisher Scientific)
610 using TaqMan™ Universal PCR Master Mix (ThermoFisher Scientific) and
611 PrimeTime Std qPCR Assay (IDT, Coralville, IA US).
612 For Hif-1α,
613 Hif1_probe: 5’-/56-FAM/CCTGTTGGTTGCGCAGCAAGCATT/3BHQ_1/-3’
614 Hif1_F: 5’-GGTGCTGGTGTCCAAAATGTAG-3’
615 Hif1_R: 5’-ATGGGTCTAGAGAGATAGCTCCACA-3’
616 For Hif-2α,
617 Hif2_probe: 5’-/56-FAM/CCACCTGGACAAAGCCTCCATCAT/3IABkFQ/-3’
618 Hif2_F: 5’-TCTATGAGTTGGCTCATGAGTTG-3’
619 Hif2_R: 5’-GTCCGAAGGAAGCTGATGG-3’
620 Relative gene deletion levels were calculated using the 2ΔΔCT method.
621
25 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
622 Tissue preparation for amperometry and patch clamp experiments
623 Adrenal glands and SCG were quickly removed and transferred to ice-cooled
624 PBS. Dissected AM was enzymatically dispersed in two steps. First, tissue
625 was placed in 3 ml of extraction solution (in mM: 154 NaCl, 5.6 KCl, 10
626 Hepes, 11 glucose; pH 7.4) containing 425 U/ml collagenase type IA and 4-5
627 mg of bovine serum albumin (all from Sigma-Aldrich), and incubated for 30
628 min at 37°C. Tissue was mechanically dissociated every 10 minutes by
629 pipetting. Then, cell suspension was centrifuged (165 g and 15-20ºC for 4
630 min), and the pellet suspended in 3 ml of PBS containing 9550 U/ml of trypsin
631 and 425 U/ml of collagenase type IA (all from Sigma-Aldrich). Cell suspension
632 was further incubated at 37°C for 5 min and mechanically dissociated by
633 pipetting. Enzymatic reaction was stopped by adding ≈10 ml of cold complete
634 culture medium (DMEM/F-12 (21331-020 GIBCO, ThermoFisher Scientific)
635 supplemented with penicillin (100 U/ml)/streptomycin (10 µg/ml), 2 mM L-
636 glutamine and 10% fetal bovine serum. The suspension was centrifuged (165
637 g and 15-20ºC for 4 min), the pellet gently suspended in 200 µl of complete
638 culture medium. Next, cells were plated on small coverslips coated with 1
639 mg/ml poly-L-lysine and kept at 37ºC in a 5% CO2 incubator for settlement.
640 Afterwards, the petri dish was carefully filled with 2 ml of culture medium and
641 returned to the incubator for 2 hours. Under these conditions, cells could be
642 maintained up to 12-14 hours to perform experiments.
643 To obtain SCG dispersed cells, the tissue was placed in a 1.5 ml tube
644 containing enzymatic solution (2.5 mg/ml collagenase type IA in PBS) and
645 incubated for 15 min in a thermoblock at 37°C and 300 rpm. The suspension
646 was mechanically dissociated by pipetting and centrifuged for 3 min at 200 g.
26 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
647 The pellet was suspended in the second enzymatic dispersion (1mg/ml of
648 trypsin in PBS), incubated at 37°C, 300 rpm for 25 min and dissociated again
649 with a pipette. Enzymatic reaction was stopped adding a similar solution than
650 used for chromaffin cells (changing fetal bovine serum for newborn calf
651 serum). Finally, dispersed SCG cells were plated onto poly-L-lysine coated
652 coverslips and kept at the 37ºC incubator. Experiments with SCG cells were
653 done between 24-48h after finishing the culture.
654
655 To prepare AM slices, the capsule and adrenal gland cortex was removed and
656 the AM was embedded into low melting point agarose at when reached 47 ºC.
657 The agarose block is sectioned (200 µm thick) in an O2-saturated Tyrode's
658 solution using a vibratome (VT1000S, Leica). AM slices were washed twice
659 with the recording solution (in mM: 117 NaCl, 4.5 KCl, 23 NaHCO3, 1 MgCl2, 1
660 CaCl2, 5 glucose and 5 sucrose) and bubbled with carbogen (5% CO2 and
661 95% O2) at 37 ºC for 30 min in a water bath. Fresh slices are used for the
662 experiments during 4-5h after preparation.
663
664 Patch-clamp recordings
665 The macroscopic currents were recorded from dispersed mouse AM and SCG
666 cells using the whole cell configurations of the patch clamp technique.
667 Micropipettes (≈3 MΩ) were pulled from capillary glass tubes (Kimax, Kimble
668 Products, Rockwood, TN US) with a horizontal pipette puller (Sutter
669 instruments model P-1000, Novato, CA US) and fire polished with a
670 microforge MF-830 (Narishige, Amityville, NY US). Voltage-clamp recordings
671 were obtained with an EPC-7 amplifier (HEKA Electronik, Lambrecht/Pfalz,
27 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
672 Germany). The signal was filtered (3 kHz), subsequently digitized with an
673 analog/digital converter (ITC-16 Instrutech Corporation, HEKA Electronik) and
674 finally sent to the computer. Data acquisition and storage was done using the
675 Pulse/pulsefit software (Heka Electronik) at a sampling interval of 10 µsec.
676 Data analysis is performed with the Igor Pro Carbon (Wavemetrics, Portland,
677 OR US) and Pulse/pulsefit (HEKA Electronik) programs. All experiments were
678 conducted at 30-33°C. Macroscopic Ca2+, Na+, and K+ currents were recorded
679 in dialyzed cells. The solutions used for the recording of Na+ and Ca2+
680 currents contained (in mM): external: 140 NaCl, 10 BaCl2, 2.5 KCl, 10
681 HEPES, and 10 glucose; pH 7.4 and osmolality 300 mOsm/kg; and internal:
682 110 CsCl, 30 CsF, 10 EGTA, 10 HEPES, and 4 ATP-Mg; pH 7.2 and
683 osmolality 285 mOsm/kg. The external solution used for the recording of
+ 684 whole cell K currents was (in mM): 117 NaCl, 4.5 KCl, 23 NaHCO3, 1 MgCl2,
+ 685 2.5 CaCl2, 5 glucose and 5 sucrose. The internal solution to record K
686 currents was (in mM): 80 potassium glutamate, 50 KCl, 1 MgCl2, 10 HEPES,
687 4 MgATP, and 5 EGTA, pH 7.2. Depolarizing steps of variable duration
688 (normally 10 or 50 msec) from a holding potential of -70 mV to different
689 voltages ranging from -60 up to +50 mV (with voltage increments of 10 mV)
690 were used to record macroscopic ionic currents in AM and SCG cells.
691
692 Amperometric recording
693 To perform the experiments, single slices were transferred to the chamber
694 placed on the stage of an upright microscope (Axioscope, Zeiss, Oberkochen,
695 Germany) and continuously perfused by gravity (flow 1–2 ml min-1) with a
696 solution containing (in mM): 117 NaCl, 4.5 KCl, 23 NaHCO3, 1 MgCl2, 2.5
28 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
697 CaCl2, 5 glucose and 5 sucrose. The ‘normoxic’ solution was bubbled with 5%
698 CO2, 20% O2 and 75 % N2 (PO2 ≈ 150 mmHg). The ‘hypoxic’ solution was
699 bubbled with 5% CO2 and 95% N2 (PO2 ≈ 10–20 mmHg). The ‘hypercapnic’
700 solution was bubbled with 20% CO2, 20% O2 and 60 % N2 (PO2 ≈ 150
701 mmHg). The osmolality of solutions was ≈ 300 mosmol kg−1 and pH = 7.4. In
702 the 20 mM K+ solution, NaCl was replaced by KCl equimolarly (20 mM). All
703 experiments were carried out at a chamber temperature of 36°C.
704 Amperometric currents were recorded with an EPC-8 patch-clamp amplifier
705 (HEKA Electronics), filtered at 100 Hz and digitized at 250 Hz for storage in a
706 computer. Data acquisition and analysis were carried out with an ITC-16
707 interface and PULSE/PULSEFIT software (HEKA Electronics). The secretion
708 rate (fC min−1) was calculated as the amount of charge transferred to the
709 recording electrode during a given period of time.
710
711 Catecholamine measurements
712 Catecholamine levels were determined by ELISA (Abnova, Taipei, Taiwan)
713 following manufacture’s instructions. Spontaneous urination was collected
714 from control and experimental mice (8-12 weeks old) at similar daytime
715 (9:00am). HIF-2αWT and TH-HIF-2αKO or HIF-1αWT, TH-HIF-1αKO samples
716 were collected and assayed in different days.
717
718 Tunel assay
719 Cell death was determined on CB sections using Click-iT™ TUNEL Alexa
720 Fluor™ 488 Imaging Assay (ThermoFisher Scientific), following manufacture’s
29 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
721 indications. TUNEL+ cells across the whole CB parenchyma were counted
722 and normalized by area.
723
724 Plethysmography
725 Respiratory parameters were measured by unrestrained whole-body
726 plethysmography (Data Sciences International, St. Paul, MN US). Mice were
727 maintained in a hermetic chamber with controlled normoxic airflow (1.1 l/min)
728 of 21% O2 (N2 balanced, 5000ppm CO2, BOC Healthcare, Manchester, UK)
729 until they were calm (30-40 minutes). Mice were then exposed to pre-mixed
730 hypoxic air (1.1 l/min) of 10% O2 (N2 balanced, 5000ppm CO2, BOC
731 Healthcare) for 30 min (time-course experiments) or 10 min (VAH
732 experiments). Real-time data were recorded and analyzed using Ponemah
733 software (Data Sciences International). Each mouse was monitored
734 throughout the experiment and periods of movements and/or grooming were
735 noted and subsequently removed from the analysis. The transition periods
736 between normoxia and hypoxia (2-3 min) were also removed from the
737 analysis.
738
739 Oxygen saturations
740 Oxygen saturations were measured using MouseOx Pulse Oximeter (Starr
741 Life Sciences Corp, Oakmont, PA US) on anaesthetised (isofluorane) mice.
742 Anaesthetic was vaporized with 2 l/min of 100% O2 gas flow (BOC
743 Healthcare) and then shift to 2 l/min of pre-mixed 10% O2 flow (N2 balanced,
744 5000ppm CO2, BOC Healthcare) for 5 min. Subsequently, gas flow was
745 switched back to 100% O2.
30 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
746
747 Whole-body metabolic assessments
748 Energy expenditure was measured and recorded using the Columbus
749 Instruments Oxymax system (Columbus, OH US) according to the
750 manufacturer’s instructions. Mice were randomly allocated to the chambers
751 and they had free access to food and water throughout the experiment with
752 the exception of fasting experiments. An initial 18-24h acclimation period was
753 disregarded for all the experiments. Once mice were acclimated to the
754 chamber, the composition of the influx gas was switched from 21% O2 to 10%
755 O2 using a PEGAS mixer (Columbus Instruments). For maximum exertion
756 testing, mice were allowed to acclimatize to the enclosed treadmill
757 environment for 15 min before running. The treadmill was initiated at 5
758 meters/min and the mice warmed up for 5 minutes. The speed was increased
759 up to 27 meters/min or exhaustion at 2.5 min intervals on a 15° incline.
760 Exhaustion was defined as the third time the mouse refused to run for more
761 than 3-5 seconds or when was unable to stay on the treadmill. Blood glucose
762 and lactate levels were measured before and after exertion using a StatStrip
763 Xpress (nova biomedical, Street-Waltham, MA US) glucose and lactate
764 meters.
765
766 Chronic hypoxia exposure and in vivo CB proliferation
767 Mice were exposed to a normobaric 10% O2 atmosphere in an enclosed
768 chamber with controlled O2 and CO2 levels for up to 21 days. Humidity and
769 CO2 levels were quenched throughout the experiments by using silica gel
770 (Sigma-Aldrich) and spherasorb soda lime (Intersurgical, Wokingham, UK),
31 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
771 respectively. Haematocrit was measured in a bench-top haematocrit
772 centrifuge. Haemoglobin levels were analyzed with a Vet abc analyzer
773 (Horiba, Kyoto, Japan) according to the manufacture’s instructions. Heart,
774 spleen tissues were removed and their wet weights measured. Right
775 ventricular systolic pressures were assessed using a pressure-volume loop
776 system (Millar, Houston, TX US) as reported before (Cowburn et al., 2016).
777 Mice were anaesthetized (isoflurane) and right-sided heart catheterization
778 was performed through the right jugular vein. Lungs were processed for
779 histology as describe above. Analogous procedures were followed for mice
780 maintained in normoxia.
781 For hypoxia-induced in vivo CB proliferation studies, mice were injected
782 intraperitoneally once a week with 50 mg/kg of BrdU (Sigma-Aldrich) and
783 constantly supplied in their drinking water (1mg/ml) as previously shown
784 (Pardal et al., 2007). In vivo mTORC inhibition was achieved by
785 intraperitoneal injection of rapamycin (6 mg kg-1 day-1). Tissues were collected
786 for histology after 14 days at 10% O2 as described above. VAH was recorded
787 in vehicle control and rapamycin-injected C57BL/6J mice after 7 days in
788 chronic hypoxia by plethysmography as explained above.
789
790 Blood pressure measurement by radio-telemetry
791 All radio-telemetry hardware and software was purchased from Data Science
792 International. Surgical implantation of radio-telemetry device was performed
793 following University of Cambridge Animal Welfare and Ethical Review Body’s
794 (AWERB) recommendations and according to manufacturer’s instructions.
795 After surgery, mice were allowed to recover for at least 10 days. All baseline
32 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
796 telemetry data were collected over a 72h period in a designated quiet room to
797 ensure accurate and repeatable results. Blood pressure monitoring during
798 hypoxia challenge was conducted in combination with Columbus Instruments
799 Oxymax system and PEGAS mixer. Mice were placed in metabolic chambers
800 and allowed to acclimate for 24h before the oxygen content of the flow gas
801 was reduced to 10%. Mice were kept for 48h at 10% O2 before being returned
802 to normal atmospheric oxygen for a further 24h. For hypertension studies,
803 mice were subsequently implanted with a micro osmotic pump (Alzet,
804 Cupertino, CA; 1002 model) for Ang II (Sigma-Aldrich) infusion (490 ng min-1
805 kg-1) for 2 weeks. Blood pressure, heart rate, temperature and activity were
806 monitored for a 48h period after 7, 14 and 21 days after osmotic pump
807 implantation.
808
809 Glucose, insulin and lactate tolerant tests
810 All the blood glucose and lactate measurements were carried out with a
811 StatStrip Xpress (nova biomedical) glucose and lactate meters. Blood was
812 sampled from the tail vein. For glucose tolerance test (GTT), mice were
813 placed in clean cages and fasted for 14-15 hours (overnight) with free access
814 to water. Baseline glucose level (0 time point) was measured and then a
815 glucose bolus (Sigma-Aldrich) of 2 g/kg in PBS was intraperitoneally injected.
816 Glucose was monitored after 15, 30, 60, 90, 120 and 150 minutes. For insulin
817 tolerance test, mice were fasted for 4 hours and baseline glucose was
818 measured (0 time point). Next, insulin (Roche, Penzberg, Germany) was
819 intraperitoneally injected (0.75 U/kg) and blood glucose content recorded after
820 15, 30, 60, 90 and 120 minutes. For lactate tolerance test, mice were injected
33 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
821 with a bolus of 2 g/kg of sodium lactate (Sigma-Aldrich) in PBS and blood
822 lactate measured after 15, 30, 60, 90 and 120 minutes.
823
824 Statistical analysis
825 Particular statistic tests and sample size can be found in the figures and figure
826 legends. Data are presented as the mean ± standard error of the mean (SEM).
827 Shapiro-Wilk normality test was used to determine Gaussian data distribution.
828 Statistical significance between two groups was assessed by un-paired t-test in
829 cases of normal distribution with a Welch’s correction if standard deviations
830 were different. In cases of non-normal distribution (or low sample size for
831 normality test) the non-parametric Mann-Whitney U test was used. For multiple
832 comparisons we used two-way ANOVA followed by Fisher’s LSD test. Non-
833 linear regression (one-phase association) curve fitting, using a least squares
834 method, was used to model the time course data in Figs. 3, 5 and
835 Supplemental Fig. S6. Extra sum-of-squares F test was used to compare
836 fittings, and determine whether the data were best represented by a single
837 curve, or by separate ones. Individual area under the curve (AUC) was
838 calculated for the circadian time-courses in Figs. 3, 5; Supplemental Figs. S6,
839 S7, followed by un-paired t-test or non-parametric Mann-Whitney U test as
840 explained above. Statistical significance was considered if p ≤ 0.05. Analysis
841 was carried out using Prism6.0f (GraphPad software, La Jolla, CA US) for Mac
842 OS X.
843
844 Ackowledgements
845 This work is funded by the Wellcome Trust (grant WT092738MA).
34 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
846
847 Competing interests:
848 No competing interest declared.
849
850
851 Author Contributions
852 Conceptualization, D.M. and R.S.J.; Investigation, D.M., A.C., H.T.T., and
853 P.O.S.; Writing-Original Draft, D.M. and R.S.J.; Writing-Review & Editing,
854 D.M., A.C., H.T.T., P.O.S., J.L.B., and R.S.J.; Supervision, D.M., J.L.B. and
855 R.S.J.; Funding Acquisition, R.S.J.
856
857
35 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
858 References 859 Annese, V., Navarro-Guerrero, E., Rodriguez-Prieto, I., & Pardal, R. (2017). 860 Physiological Plasticity of Neural-Crest-Derived Stem Cells in the Adult 861 Mammalian Carotid Body. Cell Rep, 19(3), 471-478. doi: 862 10.1016/j.celrep.2017.03.065
863 Arias-Stella, J., & Valcarcel, J. (1976). Chief cell hyperplasia in the human 864 carotid body at high altitudes; physiologic and pathologic significance. 865 Hum Pathol, 7(4), 361-373.
866 Brugarolas, J., Lei, K., Hurley, R. L., Manning, B. D., Reiling, J. H., Hafen, E., 867 . . . Kaelin, W. G., Jr. (2004). Regulation of mTOR function in response 868 to hypoxia by REDD1 and the TSC1/TSC2 tumor suppressor complex. 869 Genes Dev, 18(23), 2893-2904. doi: 10.1101/gad.1256804
870 Brusselmans, K., Compernolle, V., Tjwa, M., Wiesener, M. S., Maxwell, P. H., 871 Collen, D., & Carmeliet, P. (2003). Heterozygous deficiency of hypoxia- 872 inducible factor-2alpha protects mice against pulmonary hypertension 873 and right ventricular dysfunction during prolonged hypoxia. J Clin 874 Invest, 111(10), 1519-1527. doi: 10.1172/JCI15496
875 Bryant, A. J., Carrick, R. P., McConaha, M. E., Jones, B. R., Shay, S. D., 876 Moore, C. S., . . . Lawson, W. E. (2016). Endothelial HIF signaling 877 regulates pulmonary fibrosis-associated pulmonary hypertension. Am J 878 Physiol Lung Cell Mol Physiol, 310(3), L249-262. doi: 879 10.1152/ajplung.00258.2015
880 Carmeliet, P., Dor, Y., Herbert, J. M., Fukumura, D., Brusselmans, K., 881 Dewerchin, M., . . . Keshert, E. (1998). Role of HIF-1alpha in hypoxia- 882 mediated apoptosis, cell proliferation and tumour angiogenesis. Nature, 883 394(6692), 485-490. doi: 10.1038/28867
884 Compernolle, V., Brusselmans, K., Acker, T., Hoet, P., Tjwa, M., Beck, H., . . . 885 Carmeliet, P. (2002). Loss of HIF-2alpha and inhibition of VEGF impair 886 fetal lung maturation, whereas treatment with VEGF prevents fatal 887 respiratory distress in premature mice. Nat Med, 8(7), 702-710. doi: 888 10.1038/nm721
889 Cowburn, A. S., Crosby, A., Macias, D., Branco, C., Colaco, R. D., 890 Southwood, M., . . . Johnson, R. S. (2016). HIF2alpha-arginase axis is 891 essential for the development of pulmonary hypertension. Proc Natl 892 Acad Sci U S A, 113(31), 8801-8806. doi: 10.1073/pnas.1602978113
893 Cowburn, A. S., Macias, D., Summers, C., Chilvers, E. R., & Johnson, R. S. 894 (2017). Cardiovascular adaptation to hypoxia and the role of peripheral 895 resistance. Elife, 6. doi: 10.7554/eLife.28755
36 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
896 Du, J., Tong, A., Wang, F., Cui, Y., Li, C., Zhang, Y., & Yan, Z. (2016). The 897 Roles of PI3K/AKT/mTOR and MAPK/ERK Signaling Pathways in 898 Human Pheochromocytomas. Int J Endocrinol, 2016, 5286972. doi: 899 10.1155/2016/5286972
900 Elorza, A., Soro-Arnaiz, I., Melendez-Rodriguez, F., Rodriguez-Vaello, V., 901 Marsboom, G., de Carcer, G., . . . Aragones, J. (2012). HIF2alpha acts 902 as an mTORC1 activator through the amino acid carrier SLC7A5. Mol 903 Cell, 48(5), 681-691. doi: 10.1016/j.molcel.2012.09.017
904 Favier, J., Amar, L., & Gimenez-Roqueplo, A. P. (2015). Paraganglioma and 905 phaeochromocytoma: from genetics to personalized medicine. Nat Rev 906 Endocrinol, 11(2), 101-111. doi: 10.1038/nrendo.2014.188
907 Gao, L., Bonilla-Henao, V., Garcia-Flores, P., Arias-Mayenco, I., Ortega- 908 Saenz, P., & Lopez-Barneo, J. (2017). Gene expression analyses 909 reveal metabolic specifications in acute O2 -sensing chemoreceptor 910 cells. J Physiol, 595(18), 6091-6120. doi: 10.1113/JP274684
911 Goda, N., Ryan, H. E., Khadivi, B., McNulty, W., Rickert, R. C., & Johnson, R. 912 S. (2003). Hypoxia-inducible factor 1alpha is essential for cell cycle 913 arrest during hypoxia. Mol Cell Biol, 23(1), 359-369.
914 Gruber, M., Hu, C. J., Johnson, R. S., Brown, E. J., Keith, B., & Simon, M. C. 915 (2007). Acute postnatal ablation of Hif-2alpha results in anemia. Proc 916 Natl Acad Sci U S A, 104(7), 2301-2306. doi: 917 10.1073/pnas.0608382104
918 Heath, D., & Edwards, C. (1971). The carotid body in cardiopulmonary 919 disease. Geriatrics, 26(12), 110-111 passim.
920 Heath, D., Smith, P., & Jago, R. (1982). Hyperplasia of the carotid body. J 921 Pathol, 138(2), 115-127. doi: 10.1002/path.1711380203
922 Hodson, E. J., Nicholls, L. G., Turner, P. J., Llyr, R., Fielding, J. W., Douglas, 923 G., . . . Bishop, T. (2016). Regulation of ventilatory sensitivity and 924 carotid body proliferation in hypoxia by the PHD2/HIF-2 pathway. J 925 Physiol, 594(5), 1179-1195. doi: 10.1113/JP271050
926 Hubbi, M. E., & Semenza, G. L. (2015). Regulation of cell proliferation by 927 hypoxia-inducible factors. Am J Physiol Cell Physiol, 309(12), C775- 928 782. doi: 10.1152/ajpcell.00279.2015
929 Iturriaga, R., Del Rio, R., Idiaquez, J., & Somers, V. K. (2016). Carotid body 930 chemoreceptors, sympathetic neural activation, and cardiometabolic 931 disease. Biol Res, 49, 13. doi: 10.1186/s40659-016-0073-8
37 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
932 Iyer, N. V., Kotch, L. E., Agani, F., Leung, S. W., Laughner, E., Wenger, R. H., 933 . . . Semenza, G. L. (1998). Cellular and developmental control of O2 934 homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev, 12(2), 935 149-162.
936 Kameda, Y. (2005). Mash1 is required for glomus cell formation in the mouse 937 carotid body. Dev Biol, 283(1), 128-139. doi: 938 10.1016/j.ydbio.2005.04.004
939 Kameda, Y., Ito, M., Nishimaki, T., & Gotoh, N. (2008). FRS2 alpha 2F/2F 940 mice lack carotid body and exhibit abnormalities of the superior cervical 941 sympathetic ganglion and carotid sinus nerve. Dev Biol, 314(1), 236- 942 247. doi: 10.1016/j.ydbio.2007.12.002
943 Kapitsinou, P. P., Rajendran, G., Astleford, L., Michael, M., Schonfeld, M. P., 944 Fields, T., . . . Haase, V. H. (2016). The Endothelial Prolyl-4- 945 Hydroxylase Domain 2/Hypoxia-Inducible Factor 2 Axis Regulates 946 Pulmonary Artery Pressure in Mice. Mol Cell Biol, 36(10), 1584-1594. 947 doi: 10.1128/MCB.01055-15
948 Kline, D. D., Peng, Y. J., Manalo, D. J., Semenza, G. L., & Prabhakar, N. R. 949 (2002). Defective carotid body function and impaired ventilatory 950 responses to chronic hypoxia in mice partially deficient for hypoxia- 951 inducible factor 1 alpha. Proc Natl Acad Sci U S A, 99(2), 821-826. doi: 952 10.1073/pnas.022634199
953 Koshiji, M., Kageyama, Y., Pete, E. A., Horikawa, I., Barrett, J. C., & Huang, 954 L. E. (2004). HIF-1alpha induces cell cycle arrest by functionally 955 counteracting Myc. EMBO J, 23(9), 1949-1956. doi: 956 10.1038/sj.emboj.7600196
957 Laplante, M., & Sabatini, D. M. (2012). mTOR signaling in growth control and 958 disease. Cell, 149(2), 274-293. doi: 10.1016/j.cell.2012.03.017
959 Le Douarin, N. M. (1986). Cell line segregation during peripheral nervous 960 system ontogeny. Science, 231(4745), 1515-1522.
961 Lindeberg, J., Usoskin, D., Bengtsson, H., Gustafsson, A., Kylberg, A., 962 Soderstrom, S., & Ebendal, T. (2004). Transgenic expression of Cre 963 recombinase from the tyrosine hydroxylase locus. Genesis, 40(2), 67- 964 73. doi: 10.1002/gene.20065
965 Liu, L., Cash, T. P., Jones, R. G., Keith, B., Thompson, C. B., & Simon, M. C. 966 (2006). Hypoxia-induced energy stress regulates mRNA translation 967 and cell growth. Mol Cell, 21(4), 521-531. doi: 968 10.1016/j.molcel.2006.01.010
38 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
969 Lopez-Barneo, J., Macias, D., Platero-Luengo, A., Ortega-Saenz, P., & 970 Pardal, R. (2016). Carotid body oxygen sensing and adaptation to 971 hypoxia. Pflugers Arch, 468(1), 59-70. doi: 10.1007/s00424-015-1734- 972 0
973 Lopez-Barneo, J., Ortega-Saenz, P., Gonzalez-Rodriguez, P., Fernandez- 974 Aguera, M. C., Macias, D., Pardal, R., & Gao, L. (2016). Oxygen- 975 sensing by arterial chemoreceptors: Mechanisms and medical 976 translation. Mol Aspects Med, 47-48, 90-108. doi: 977 10.1016/j.mam.2015.12.002
978 Lorenzo, F. R., Yang, C., Ng Tang Fui, M., Vankayalapati, H., Zhuang, Z., 979 Huynh, T., . . . Prchal, J. T. (2013). A novel EPAS1/HIF2A germline 980 mutation in a congenital polycythemia with paraganglioma. J Mol Med 981 (Berl), 91(4), 507-512. doi: 10.1007/s00109-012-0967-z
982 Ma, X. M., & Blenis, J. (2009). Molecular mechanisms of mTOR-mediated 983 translational control. Nat Rev Mol Cell Biol, 10(5), 307-318. doi: 984 10.1038/nrm2672
985 Macias, D., Fernandez-Aguera, M. C., Bonilla-Henao, V., & Lopez-Barneo, J. 986 (2014). Deletion of the von Hippel-Lindau gene causes 987 sympathoadrenal cell death and impairs chemoreceptor-mediated 988 adaptation to hypoxia. EMBO Mol Med, 6(12), 1577-1592. doi: 989 10.15252/emmm.201404153
990 Madden, J. A., Vadula, M. S., & Kurup, V. P. (1992). Effects of hypoxia and 991 other vasoactive agents on pulmonary and cerebral artery smooth 992 muscle cells. Am J Physiol, 263(3 Pt 1), L384-393.
993 Madisen, L., Zwingman, T. A., Sunkin, S. M., Oh, S. W., Zariwala, H. A., Gu, 994 H., . . . Zeng, H. (2010). A robust and high-throughput Cre reporting 995 and characterization system for the whole mouse brain. Nat Neurosci, 996 13(1), 133-140. doi: 10.1038/nn.2467
997 McBryde, F. D., Abdala, A. P., Hendy, E. B., Pijacka, W., Marvar, P., Moraes, 998 D. J., . . . Paton, J. F. (2013). The carotid body as a putative 999 therapeutic target for the treatment of neurogenic hypertension. Nat 1000 Commun, 4, 2395. doi: 10.1038/ncomms3395
1001 Ortega-Saenz, P., Pascual, A., Piruat, J. I., & Lopez-Barneo, J. (2007). 1002 Mechanisms of acute oxygen sensing by the carotid body: lessons 1003 from genetically modified animals. Respir Physiol Neurobiol, 157(1), 1004 140-147. doi: 10.1016/j.resp.2007.02.009
39 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1005 Pardal, R., Ortega-Saenz, P., Duran, R., & Lopez-Barneo, J. (2007). Glia-like 1006 stem cells sustain physiologic neurogenesis in the adult mammalian 1007 carotid body. Cell, 131(2), 364-377. doi: 10.1016/j.cell.2007.07.043
1008 Pearse, A. G., Polak, J. M., Rost, F. W., Fontaine, J., Le Lievre, C., & Le 1009 Douarin, N. (1973). Demonstration of the neural crest origin of type I 1010 (APUD) cells in the avian carotid body, using a cytochemical marker 1011 system. Histochemie, 34(3), 191-203.
1012 Peng, J., Zhang, L., Drysdale, L., & Fong, G. H. (2000). The transcription 1013 factor EPAS-1/hypoxia-inducible factor 2alpha plays an important role 1014 in vascular remodeling. Proc Natl Acad Sci U S A, 97(15), 8386-8391. 1015 doi: 10.1073/pnas.140087397
1016 Peng, Y. J., Nanduri, J., Khan, S. A., Yuan, G., Wang, N., Kinsman, B., . . . 1017 Prabhakar, N. R. (2011). Hypoxia-inducible factor 2alpha (HIF-2alpha) 1018 heterozygous-null mice exhibit exaggerated carotid body sensitivity to 1019 hypoxia, breathing instability, and hypertension. Proc Natl Acad Sci U 1020 S A, 108(7), 3065-3070. doi: 10.1073/pnas.1100064108
1021 Peng, Y. J., Yuan, G., Ramakrishnan, D., Sharma, S. D., Bosch-Marce, M., 1022 Kumar, G. K., . . . Prabhakar, N. R. (2006). Heterozygous HIF-1alpha 1023 deficiency impairs carotid body-mediated systemic responses and 1024 reactive oxygen species generation in mice exposed to intermittent 1025 hypoxia. J Physiol, 577(Pt 2), 705-716. doi: 1026 10.1113/jphysiol.2006.114033
1027 Pijacka, W., Moraes, D. J., Ratcliffe, L. E., Nightingale, A. K., Hart, E. C., da 1028 Silva, M. P., . . . Paton, J. F. (2016). Purinergic receptors in the carotid 1029 body as a new drug target for controlling hypertension. Nat Med, 1030 22(10), 1151-1159. doi: 10.1038/nm.4173
1031 Platero-Luengo, A., Gonzalez-Granero, S., Duran, R., Diaz-Castro, B., Piruat, 1032 J. I., Garcia-Verdugo, J. M., . . . Lopez-Barneo, J. (2014). An O2- 1033 sensitive glomus cell-stem cell synapse induces carotid body growth in 1034 chronic hypoxia. Cell, 156(1-2), 291-303. doi: 1035 10.1016/j.cell.2013.12.013
1036 Ryan, H. E., Lo, J., & Johnson, R. S. (1998). HIF-1 alpha is required for solid 1037 tumor formation and embryonic vascularization. EMBO J, 17(11), 3005- 1038 3015. doi: 10.1093/emboj/17.11.3005
1039 Saldana, M. J., Salem, L. E., & Travezan, R. (1973). High altitude hypoxia and 1040 chemodectomas. Hum Pathol, 4(2), 251-263.
1041 Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., 1042 Pietzsch, T., . . . Cardona, A. (2012). Fiji: an open-source platform for
40 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1043 biological-image analysis. Nat Methods, 9(7), 676-682. doi: 1044 10.1038/nmeth.2019
1045 Schnell, P. O., Ignacak, M. L., Bauer, A. L., Striet, J. B., Paulding, W. R., & 1046 Czyzyk-Krzeska, M. F. (2003). Regulation of tyrosine hydroxylase 1047 promoter activity by the von Hippel-Lindau tumor suppressor protein 1048 and hypoxia-inducible transcription factors. J Neurochem, 85(2), 483- 1049 491.
1050 Scortegagna, M., Ding, K., Oktay, Y., Gaur, A., Thurmond, F., Yan, L. J., . . . 1051 Garcia, J. A. (2003). Multiple organ pathology, metabolic abnormalities 1052 and impaired homeostasis of reactive oxygen species in Epas1-/- mice. 1053 Nat Genet, 35(4), 331-340. doi: 10.1038/ng1266
1054 Slingo, M. E., Turner, P. J., Christian, H. C., Buckler, K. J., & Robbins, P. A. 1055 (2014). The von Hippel-Lindau Chuvash mutation in mice causes 1056 carotid-body hyperplasia and enhanced ventilatory sensitivity to 1057 hypoxia. J Appl Physiol (1985), 116(7), 885-892. doi: 1058 10.1152/japplphysiol.00530.2013
1059 Stenmark, K. R., Meyrick, B., Galie, N., Mooi, W. J., & McMurtry, I. F. (2009). 1060 Animal models of pulmonary arterial hypertension: the hope for 1061 etiological discovery and pharmacological cure. Am J Physiol Lung Cell 1062 Mol Physiol, 297(6), L1013-1032. doi: 10.1152/ajplung.00217.2009
1063 Tan, Q., Kerestes, H., Percy, M. J., Pietrofesa, R., Chen, L., Khurana, T. S., . . 1064 . Lee, F. S. (2013). Erythrocytosis and pulmonary hypertension in a 1065 mouse model of human HIF2A gain of function mutation. J Biol Chem, 1066 288(24), 17134-17144. doi: 10.1074/jbc.M112.444059
1067 Teppema, L. J., & Dahan, A. (2010). The ventilatory response to hypoxia in 1068 mammals: mechanisms, measurement, and analysis. Physiol Rev, 1069 90(2), 675-754. doi: 10.1152/physrev.00012.2009
1070 Tian, H., Hammer, R. E., Matsumoto, A. M., Russell, D. W., & McKnight, S. L. 1071 (1998). The hypoxia-responsive transcription factor EPAS1 is essential 1072 for catecholamine homeostasis and protection against heart failure 1073 during embryonic development. Genes Dev, 12(21), 3320-3324.
1074 Torres-Capelli, M., Marsboom, G., Li, Q. O., Tello, D., Rodriguez, F. M., 1075 Alonso, T., . . . Aragones, J. (2016). Role Of Hif2alpha Oxygen Sensing 1076 Pathway In Bronchial Epithelial Club Cell Proliferation. Sci Rep, 6, 1077 25357. doi: 10.1038/srep25357
1078 Wang, Z. Y., & Bisgard, G. E. (2002). Chronic hypoxia-induced morphological 1079 and neurochemical changes in the carotid body. Microsc Res Tech, 1080 59(3), 168-177. doi: 10.1002/jemt.10191
41 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1081 Zhou, T., Chien, M. S., Kaleem, S., & Matsunami, H. (2016). Single cell 1082 transcriptome analysis of mouse carotid body glomus cells. J Physiol, 1083 594(15), 4225-4251. doi: 10.1113/JP271936
1084 Zhuang, Z., Yang, C., Lorenzo, F., Merino, M., Fojo, T., Kebebew, E., . . . 1085 Pacak, K. (2012). Somatic HIF2A gain-of-function mutations in 1086 paraganglioma with polycythemia. N Engl J Med, 367(10), 922-930. 1087 doi: 10.1056/NEJMoa1205119 1088
1089
1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104
1105
1106
1107
1108
42 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1109 Figures
1110 Macias_Figure 1
1111
1112
43 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1113 Macias_Fig1-figure supplement 1
1114
44 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1115 Macias_Figure 2
1116
1117
1118
1119
1120
1121
1122
1123
1124
45 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1125 Macias_Figure 3
1126
1127
1128
1129
1130
1131
1132
1133
1134
1135
1136
1137
1138
46 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1139 Macias_Figure 3-figure supplement 1
1140
1141
1142
1143
1144
1145
1146
1147
1148
1149
1150
1151
47 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1152 Macias_Figure 3-figure supplement 2
1153
1154
1155
1156
48 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1157 Macias_Figure 4
1158
1159
1160
1161
1162
1163
1164
1165
1166
1167
1168
49 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1169 Macias_Figure 4-figure supplement 1
1170
50 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1171 Macias_Figure 4-figure supplement 2
1172
1173
1174
1175
1176
1177
1178
1179
1180
1181
1182
1183
1184
1185
1186
51 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1187 Macias_Figure 5
1188
1189
1190
1191
52 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1192 Macias_Figure 5-figure supplement 1
1193
1194
1195
53 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1196 Macias_Figure 6
1197
1198
1199
1200
1201
1202
1203
1204
1205
1206
1207
1208
1209
1210
54 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1211 Macias_Figure 6-figure supplement 1
1212
1213
1214
1215
1216
1217
1218
1219
1220
1221
1222
1223
1224
1225
55 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1226 Macias_Figure 7
1227
1228
1229
1230
1231
56 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1232 Macias_Figure 7-figure supplement 1
1233
1234
1235
1236
1237
1238
1239
1240
1241
1242
57 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1243 Figure Legends
1244 Figure 1. Selective loss of carotid body glomus cells in sympathoadrenal-
1245 specific Hif-2α, but not Hif-1α, deficient mice. (A and B) Tyrosine hydroxylase
1246 (TH) immunostaining on carotid bifurcation sections from HIF-2αWT (A, top
1247 panels), TH-HIF-2αKO (A, bottom panels), HIF-1αWT (B, top panels) and TH-
1248 HIF-1αKO (B, bottom panels) mice. Micrographs showed in A (bottom) were
1249 selected to illustrate the rare presence of TH+ glomus cells in TH-HIF-2αKO
1250 mice (white arrowheads). Dashed rectangles (left panels) are shown at higher
1251 magnification on the right panels. SCG, superior cervical ganglion; CB, carotid
1252 body; ICA, internal carotid artery; ECA, external carotid artery. Scale bars:
1253 200 µm (left panels), 50 µm (right panels). (C-F) Quantification of total SCG
1254 volume (C), total CB volume (D), TH+ cell number (E) and TH+ cell density (F)
1255 on micrograph from HIF-2αWT (black dots, n = 4 for SCG and n = 6 for CB),
1256 TH-HIF-2αKO (red squares, n = 4), HIF-1αWT (black triangles, n = 4) and TH-
1257 HIF-1αKO (blue triangles, n = 3) mice. Data are expressed as mean ± SEM.
1258 Mann-Whitney test, **p < 0.001; ns, non-significant. (G and H) TH-
1259 immunostained adrenal gland sections from HIF-2αWT (G, top panel), TH-HIF-
1260 2αKO (G, bottom panel), HIF-1αWT (H, top panel) and TH-HIF-1αKO (H, bottom
1261 panel) littermates. AM, adrenal medulla. Scale bars: 200 µm. (I) Normalized
1262 adrenaline (left) and noradrenaline (right) urine content measured by ELISA.
1263 HIF-2αWT (black dots, n = 8), TH-HIF-2αKO (red squares, n = 7), HIF-1αWT
1264 (black triangles, n = 7) and TH-HIF-1αKO (blue triangles, n = 4). Mann-Whitney
1265 test, ns, non-significant.
1266
58 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1267 Figure 1-figure supplement 1. Sympathoadrenal gene deletion by TH-IRES-
1268 Cre mouse strain. (A) TH-Cre-mediated recombination in carotid bifurcation
1269 (left panels) and adrenal gland (right panels) sections dissected from the TH-
1270 Td-tomato reporter mice (Cre+) compared to Td-Tomato (Cre-) mice. Notice
1271 the presence of Td-tomato fluorescence into the CB glomus cells, SCG
1272 sympathetic neurons and adrenal medulla due to TH-Cre activity (lower
1273 panels). Dashed lines delineate the location of SCG and AM within Td-tomato
1274 (Cre-) sections. SCG, superior cervical ganglion; CB, carotid body; AM,
1275 adrenal medulla. Scale bars: 100 µm for carotid bifurcation and 200 µm for
1276 adrenal gland sections. (B-C) Relative Hif-2α (B) and Hif-1α (C) gene deletion
1277 of dissected SCG (left graphs) and AM (right graphs) from TH-HIF-2αKO (red,
1278 n = 4) and TH-HIF-1αKO (blue, n = 4) compared to their respective littermate
1279 controls (HIF-2αWT, n = 4; HIF-1αWT, n = 2). Data are expressed as mean
1280 ±SEM. Unpaired t-test, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
1281
1282 Figure 2. Progressive CB glomus cells death during development of TH-
1283 HIF2αKO mouse. (A) Representative micrographs illustrating CB TH+ glomus
1284 cells appearance at embryo stage E18.5 (left) and postnatal stage P0 (right)
1285 in HIF-2αWT (top panels) and TH-HIF-2αKO (bottom panels) mice. Dashed
1286 rectangles (left panels) are shown at higher magnification on the right panels.
1287 SCG, superior cervical ganglion; CB, carotid body; ICA, internal carotid artery;
1288 ECA, external carotid artery. Scale bars: 100 µm. (B-E) Quantitative
1289 histological analysis of CB volume (B), TH+ cells number (C), TH+ cell density
1290 (D) and SCG volume (E) from TH-HIF-2αKO compared to HIF-2αWT mice. HIF-
1291 2αWT (E18.5, n = 8; P0, n = 4; SCG, n = 5), TH-HIF-2αKO (E18.5, n = 7; P0, n
59 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1292 = 5; SCG, n = 5). SCG, superior cervical ganglion. Data are expressed as
1293 mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01, ***p < 0.001, ****p <
1294 0.0001, ns, non significant. (F) Representative pictures of double TH+ and
1295 TUNEL+ (white arrows) stained carotid bifurcation sections from HIF-2αWT (top
1296 panels) and TH-HIF-2αKO (bottom panels) mice at E18.5 (left) and P0 (right)
1297 stages. (G) Number of TUNEL+ cells within the CB (TH+ area) of HIF-2αWT
1298 (E18.5, n = 9; P0, n = 5) and TH-HIF-2αKO (E18.5, n = 5; P0, n = 4) mice at
1299 E18.5 and P0 stages. Data are expressed as mean ±SEM. Two-way ANOVA,
1300 *p < 0.05, **p < 0.01, ****p < 0.0001. Scale bars: 50 µm
1301
1302 Figure 3. Effects of HIF-2α and HIF-1α sympathoadrenal loss on the HVR
1303 and whole-body metabolic activity in response to hypoxia. (A and E) HVR in
1304 TH-HIF-2αKO (A, red line, n = 4) and TH-HIF-1αKO (E, blue line, n = 3)
1305 deficient mice compared to control HIF-2αWT (A, black line, n = 4) and HIF-
WT 1306 1α (E, black line, n = 3) mice. Shift and duration of 10% O2 stimulus (30
1307 minutes) are indicated. Shaded areas represent the period of time analysed in
1308 B and C or F and G, respectively. Data are presented as mean breaths/min
1309 every minute ±SEM. Two-way ANOVA, **p < 0.01, ns, non-significant. (B and
1310 C) Averaged respiratory rate (B) and minute volume (C) of HIF-2αWT (black, n
1311 = 4) and TH-HIF-2αKO (red, n = 4) mice before and during the first 5 minutes
1312 of 10% O2 exposure (shaded rectangle in A). Data are expressed as mean
1313 ±SEM. Two-way ANOVA, *p < 0.05, ***p < 0.001, ****p < 0.0001, ns, non-
1314 significant. (D) Peripheral O2 saturation before, during and after hypoxia in
1315 HIF-2αWT (black, n = 8) and TH-HIF-2αKO (red, n = 9) mice. Data are
1316 expressed as mean percentage every 10 seconds ±SEM. Two-way ANOVA,
60 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1317 ****p < 0.0001. (F and G) Averaged respiratory rate (F) and minute volume (F)
1318 of HIF-1αWT (black, n = 3) and TH-HIF-1αKO (blue, n = 3) mice before and
1319 during the first 5 minutes of 10% O2 exposure (shaded rectangle in E). Data
1320 are expressed as mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01. (H
1321 and I) Baseline metabolic activity of HIF-2αWT (black, n = 3) and TH-HIF-2αKO
1322 (red, n = 3) mice. Data are presented as mean oxygen consumption (VO2, H)
1323 and carbon dioxide generation (VCO2, I) every hour ± SEM. White and black
1324 boxes depict diurnal and nocturnal periods, respectively. Area under the curve
1325 followed by Mann-Whitney test, ns, non-significant. (J and K) Whole-body
1326 metabolic analysis of HIF-2αWT (black, n = 4) and TH-HIF-2αKO (red, n = 6)
1327 mice in response to 10% O2. Shift and duration of 10% O2 stimulus are
1328 indicated. Data are presented as mean oxygen consumption (VO2, J) and
1329 carbon dioxide generation (VCO2, K) every hour ± SEM. White and black
1330 boxes depict diurnal and nocturnal periods, respectively. Recovery across the
1331 hypoxia period was analysed by one-phase association curve fitting. ****p <
1332 0.0001.
1333
1334 Figure 3-figure supplement 1.Secretory and electrophysiological properties
1335 in AM and SCG from TH-HIF-2αKO mice. (A and B) Representative
1336 amperometric recordings of catecholamine release by chromaffin cells from
WT KO 1337 HIF-2α and TH-HIF-2α mice (8-12 weeks old) in response to low PO2
1338 (PO2 ≈ 10-15 mmHg), hypercapnia (20% CO2) and 20 mM KCl. (C)
1339 Percentage of AM slices with response to hypoxia, 20% CO2 and 20 mM KCl,
1340 respectively. HIF-2αWT n = 8; TH-HIF-2αKO, n = 7. (D) Averaged secretion rate
1341 of chromaffin cells from HIF-2αWT and TH-HIF-2αKO mice exposed to hypoxia
61 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1342 (PO2 ≈ 10-15 mmHg), hypercapnia (20% CO2) and 20 mM KCl. Each data
1343 point represents the mean of 2-3 recordings per mouse. HIF-2αWT, n = 8; TH-
1344 HIF-2αKO, n = 7. Data are expressed as mean ±SEM. One-way ANOVA, non-
1345 significant. (E and F) Ca2+ and K+ current/voltage (I/V) curves of AM
1346 chromaffin cells (E) and SCG sympathetic neurons (F) dissociated from HIF-
1347 2αWT (n = 9 cells from 3 mice) and TH-HIF-2αKO (n = 10 cells from 3 mice)
1348 mice. Data are expressed as mean ±SEM. Two-way ANOVA, ns, non-
1349 significant.
1350
1351 Figure 3-figure supplement 2. Respiratory parameters of TH-HIF-2αKO and
1352 TH-HIF-1αKO mice exposed to acute hypoxia. (A-J) Averaged tidal volume (A
1353 and F), inspiration time (B and G), expiration time (C and H), peak inspiratory
1354 flow (D and I) and peak expiratory flow (E and J) of TH-HIF-2αKO (n = 4) and
1355 TH-HIF-1αKO (n = 3) respect to control mice (HIF-2αWT, n = 4; HIF-1αWT, n =
1356 3) before and during the first 5 minutes breathing 10% O2. Data are
1357 expressed as mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01, ***p <
1358 0.001.
1359
1360 Figure 4. Impaired acclimatisation to chronic hypoxia and severe pulmonary
1361 hypertension in mice lacking CBs. (A) Kaplan-Meier survival curve of the
WT 1362 indicated mice housed at 10% O2 up to 21 days. HIF-2α (n = 12), TH-HIF-
1363 2αKO (n = 11), HIF-1αWT (n = 8) and TH-HIF-1αKO (n = 8). ***p < 0.001. (B and
1364 C) Haematocrit (B) and haemoglobin (C) levels of HIF-2αWT (black) and TH-
KO 1365 HIF-2α (red) littermates kept in normoxia (21% O2) and after 21 days at
WT KO 1366 10% O2. In B, HIF-2α (21% O2, n = 6; 10% O2, n = 21), TH-HIF-2α (21%
62 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
WT 1367 O2, n = 7; 10% O2, n = 8). In C, HIF-2α (21% O2, n = 5; 10% O2, n = 8), TH-
KO 1368 HIF-2α (21% O2, n = 5; 10% O2, n = 7). Data are expressed as mean
1369 ±SEM. Two-way ANOVA, *p < 0.05, ***p < 0.001, ****p < 0.0001, ns, non-
1370 significant. (D and E) Normalized heart (D) and spleen (E) weight of HIF-2αWT
KO 1371 (black) and TH-HIF-2α (red) before and after 21 days in hypoxia (10% O2).
WT KO 1372 In D, HIF-2α (21% O2, n = 16; 10% O2, n = 23), TH-HIF-2α (21% O2, n =
WT 1373 15; 10% O2, n = 13). In E, HIF-2α (21% O2, n = 5; 10% O2, n = 23), TH-HIF-
KO 1374 2α (21% O2, n = 5; 10% O2, n = 13). Data are expressed as mean ±SEM.
1375 Two-way ANOVA, ****p < 0.0001, ns, non-significant. (F) Fulton index on
WT 1376 hearts dissected from HIF-2α (black, 21% O2, n = 17; 10% O2, n = 23) and
KO 1377 TH-HIF-2α (red, 21% O2, n = 15; 10% O2, n = 17) mice before and after 21
1378 days in hypoxia (10% O2). Data are expressed as mean ±SEM. Two-way
1379 ANOVA, ****p < 0.0001, ns, non-significant. RV, right ventricle. LV, left
1380 ventricle. (G) Right ventricular systolic pressure (RVSP) recorded on HIF-
WT KO 1381 2α (black, 21% O2, n = 6; 10% O2, n = 7) and TH-HIF-2α (red, 21% O2, n
1382 = 5; 10% O2, n = 5) mice maintained in normoxia (21% O2) or hypoxia (10%
1383 O2) for 21 days. Data are expressed as mean ±SEM. Two-way ANOVA, **p <
1384 0.01, ***p < 0.001, ****p < 0.0001, ns, non-significant. (H and I) Lung
1385 peripheral vessels muscularization (H) and arterial medial thickness (I) in HIF-
WT KO 1386 2α and TH-HIF-2α mice exposed to 10% O2 for 14 and/or 21 days. In H,
WT KO 1387 HIF-2α (10% O2 14d, n = 4; 10% O2 21d, n = 3), TH-HIF-2α (10% O2
WT 1388 14d, n = 6; 10% O2 21d, n = 3). In I, HIF-2α (21% O2, n = 5; 10% O2 21d, n
KO 1389 = 8), TH-HIF-2α (21% O2, n = 5; 10% O2 21d, n = 8). Data are expressed
63 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1390 as mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01, ****p < 0.0001, ns,
1391 non-significant.
1392
1393 Figure 4-figure supplement 1. Impaired hypoxia-induced CB proliferation in
1394 TH-HIF-2αKO mice. (A) Glial fibrillary acidic protein (GFAP) immunostaining to
1395 illustrate the presence of CB stem cells in carotid bifurcation of both HIF-2αWT
1396 and TH-HIF-2αKO mice. Scale bars: 50 µm. (B) Double TH+ BrdU+
1397 immunofluorescence performed on carotid bifurcation sections from HIF-2αWT
KO 1398 (top) and TH-HIF-2α (bottom) mice exposed to 10% O2 for 14 days. Dashed
1399 rectangles are shown at higher magnification on the right panels. Newly
1400 formed TH+ cells are indicated with white arrows. Scale bars: 200 µm (left
1401 pictures), 50 µm (right pictures). (C and D) Quantification of total CB volume
1402 (C, n = 4 per genotype and condition) and double BrdU+ TH+ cells number (D,
1403 n = 3 per genotype and condition) in HIF-2αWT (black) and TH-HIF-2αKO (red)
1404 mice maintained for 14 days in hypoxia (10% O2). Data are presented as
1405 mean ±SEM. Unpaired t-test, **p < 0.01, ***p < 0.001.
1406
1407 Figure 4-figure supplement 2. Adaptation to hypoxia in TH-HIF-1αKO
WT 1408 animals. (A) Haematocrit levels of HIF-1α (black, 21% O2, n = 4; 10% O2, n
KO 1409 = 8) and TH-HIF-1α (blue, 21% O2, n = 4; 10% O2, n = 8) mice housed at
1410 21% O2 or after 21 days at 10% O2. Data are expressed as mean ±SEM.
1411 Two-way ANOVA, ****p < 0.001, ns, non-significant. (B and C) Normalized
1412 heart (B) and spleen (C) weight of HIF-1αWT (black) and TH-HIF-1αKO (blue)
WT 1413 mice before and after 21 days of hypoxia (10% O2) exposure. In B, HIF-1α ,
KO 1414 21% O2, n = 9; 10% O2, n = 8; TH-HIF-1α , n = 9, per condition. In C, 21%
64 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1415 O2, n = 4 per genotype; 10% O2, n = 5 per genotype. Data are expressed as
1416 mean ±SEM. Two-way ANOVA, *p < 0.05, ns, non-significant. (D) Fulton
1417 index on hearts dissected from HIF-1αWT (black) and TH-HIF-1αKO (blue) mice
WT 1418 before and after 21 days in hypoxia (10% O2). HIF-1α , 21% O2, n = 7; 10%
KO 1419 O2, n = 8; TH-HIF-1α , n = 8, per condition. Data are expressed as mean
1420 ±SEM. Two-way ANOVA, ****p < 0.0001, ns, non-significant. RV, right
1421 ventricle. LV, left ventricle.
1422
1423 Figure 5. Effects of CB dysfunction on blood pressure regulation. (A-C)
1424 Circadian variations in baseline systolic blood pressure (A, continued line),
1425 diastolic blood pressure (A, broken line), mean blood pressure (B) and heart
1426 rate (C) of HIF-2αWT (black, n = 10) and TH-HIF-2αKO (red, n = 8) littermates
1427 recorded by radiotelemetry. White and black boxes depict diurnal and
1428 nocturnal periods, respectively. Data are presented as averaged values every
1429 hour ±SEM. Area under the curve followed by unpaired t-test are shown. BP,
1430 blood pressure. HR, heart rate in beats per minute. (D-F) Mean blood
1431 pressure (D), heart rate (E) and subcutaneous temperature (F) alteration in
1432 response to hypoxia in radiotelemetry-implanted TH-HIF-2αKO (red, n = 5)
WT 1433 compared to HIF-2α (black, n = 5). Shift and duration of 10% O2 are
1434 indicated in the graph. White and black boxes represent diurnal and nocturnal
1435 periods, respectively. Data are presented as averaged values every hour
1436 ±SEM. Recovery across the hypoxia period was analysed by one-phase
1437 association curve fitting. BP, blood pressure. HR, heart rate in beats per
1438 minute. (G) Schematic representation of the protocol followed in the Ang II-
1439 induced experimental hypertension model. (H-M) Mean blood pressure and
65 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1440 heart rate recorded from HIF-2αWT (black, n = 8) and TH-HIF-2αKO (red, n = 8)
1441 mice after 7 days (H and K), 14 days (I and L) and 21 days (J and M) of Ang II
1442 infusion. White and black boxes depict diurnal and nocturnal periods,
1443 respectively. Data are presented as averaged values every hour ±SEM. Area
1444 under the curve followed by unpaired t-test are shown. BP, blood pressure.
1445 HR, heart rate in beats per minute.
1446
1447 Figure 5-figure supplement 1. Cardiovascular homeostasis in response to
1448 hypoxia and Ang II-induced experimental hypertension. (A and B) Circadian
1449 oscillations in subcutaneous temperature (A) and physical activity (B) of
1450 radiotelemetry-implanted HIF-2αWT (black, n = 10) and TH-HIF-2αKO (red, n =
1451 8). White and black boxes depict diurnal and nocturnal periods, respectively.
1452 Data are presented as averaged values every hour ±SEM. Area under the
1453 curve followed by unpaired t-test are shown. (C and D) Systolic blood
1454 pressure (C) and diastolic blood pressure (D) alteration in response to
1455 hypoxia in TH-HIF-2αKO (red, n = 5) compared to HIF-2αWT (black, n = 5)
1456 measured by radiotelemetry. Shift and duration of 10% O2 are indicated in the
1457 graph. White and black boxes depict diurnal and nocturnal periods,
1458 respectively. Data are presented as averaged blood pressure values every
1459 hour ±SEM. Recovery across the hypoxia period was analysed by one-phase
1460 association curve fitting. (E) Physical activity recorded by radiotelemetry of
1461 HIF-2αWT (black, n = 5) and TH-HIF-2αKO (red, n = 5) littermates exposed to
1462 10% O2 environment. Shift and duration of 10% O2 are indicated in the graph.
1463 White and black boxes depict diurnal and nocturnal periods, respectively.
1464 Data are presented as averaged blood pressure values every hour ±SEM.
66 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1465 Area under the curve followed by unpaired t-test is shown. (F-Q) Circadian
1466 fluctuations in systolic blood pressure, diastolic blood pressure, subcutaneous
1467 temperature and physical activity of HIF-2αWT (black, n = 5) and TH-HIF-2αKO
1468 (red, n = 5) after 7 days (F-I), 14 days (J-M) and 21 days (N-Q) of Ang II
1469 infusion recorded by radiotelemetry. White and black boxes represent diurnal
1470 and nocturnal periods, respectively. Data are presented as averaged values
1471 every hour ±SEM. Area under the curve followed by unpaired t-test are
1472 shown. ns, non-significant.
1473
1474 Figure 6. Exercise performance and glucose management in mice lacking
1475 CBs. (A-D). Time course showing the increment in O2 consumption (A),
1476 increment in CO2 generation (B), respiratory exchange ratio (C) and
1477 increment in heat production (D) from HIF-2αWT (black, n = 8) and TH-HIF-
1478 2αKO (red, n = 10) mice during exertion on a treadmill. Mice were warmed up
1479 for 5 minutes (5m/min) and then the speed was accelerated 2m/min at 2.5
1480 minutes intervals until exhaustion. Averaged measurements every 2.5
1481 minutes intervals ±SEM are charted. Two-way ANOVA, *p < 0.05, **p < 0.01,
1482 ***p < 0.001, ****p < 0.0001. RER, respiratory exchange ratio. (E) Running
1483 total time spent by HIF-2αWT (black, n = 8) and TH-HIF-2αKO (red, n = 10)
1484 mice to become exhausted. Data are expressed as mean ±SEM. Unpaired t-
1485 test. (F and G) Aerobic capacity (F) and power output (G) measured in HIF-
1486 2αWT (black, n = 8) mice compared to TH-HIF-2αKO (red, n = 10) mice when
1487 performing at VO2max. Data are expressed as mean ±SEM. Unpaired t-test.
1488 *p < 0.05. (H and I) Plasma glucose (H) and lactate (I) levels of HIF-2αWT
1489 (black, before, n = 7; after, n = 12) and TH-HIF-2αKO (black, before, n = 6;
67 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1490 after, n = 12) littermates before and after running to exhaustion. Data are
1491 expressed as mean ±SEM. Two-way ANOVA, *p < 0.05. ***p < 0.001. ns,
1492 non-significant. (J and K) Plasma glucose levels of HIF-2αWT (black, n = 6)
1493 and TH-HIF-2αKO (red, n = 6) mice fed (J, n = 6 per genotype) or fasted over
1494 night (K, HIF-2αWT (n = 8) and TH-HIF-2αKO (n = 10). Data are expressed as
1495 mean ±SEM. Unpaired t-test. (L-M) Time courses showing the tolerance of
1496 HIF-2αWT and TH-HIF-2αKO mice to glucose (L, n = 7 per genotype) insulin
1497 (M, n = 11 per genotype) and lactate (N, n = 7 per genotype) injected bolus.
1498 Data are presented as mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01,
1499 ns, non-significant.
1500
1501 Figure 6-figure supplement 1. Related to Figure 6. Whole-body metabolic
1502 activity of TH-HIF-2αKO in response to fasting-induced hypoglycemia. (A-D)
1503 Oxygen consumption (A, VO2), carbon dioxide generation (B, VCO2),
1504 respiratory exchange rate (C) and heat production (D) of HIF-2αWT (black, n =
1505 7) and TH-HIF-2αKO (red, n = 7) littermates under feed and over night fasting
1506 conditions. White and black boxes represent diurnal and nocturnal periods,
1507 respectively. Data are presented as averaged values every hour ±SEM. Area
1508 under the curve followed by unpaired t-test are shown. ns, non-significant.
1509
1510 Figure 7. mTORC1 activation in CB development and hypoxia-induced CB
1511 neurogenesis. (A) Double TH and p-S6 (mTORC1 activation marker)
1512 immunofluorescence on adult wild type CB slices to illustrate the increased p-
1513 S6 expression after 14 days in hypoxia (10% O2). For clarity, bottom panels
1514 only show p-S6 staining. TH+ outlined area (top panels) indicates the region
68 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1515 used for pixels quantification. Scale bars: 50 µm. (B) Quantification of p-S6
1516 (top) and TH (bottom) mean pixels intensity within the CB TH+ cells of wild
1517 type mice breathing 21% O2 or 10% O2 for 14 days. Each data point depicts
1518 the average of 3-4 pictures. 21% O2, n = 5; 10% O2 14d, n = 9 per genotype.
1519 Data are presented as mean ±SEM. Unpaired t-test, *p < 0.05. (C)
1520 Representative micrographs of TH and p-S6 double immunostaining of HIF-
1521 2αWT and TH-HIF-2αKO embryonic (E18.5) carotid bifurcations. TH+ outlined
1522 area indicates the region used for pixels quantification. Scale bars: 50µm. (D)
1523 Quantitative analysis performed on HIF-2αWT (black, n = 12) and TH-HIF-2αKO
1524 (red, n = 10) micrographs previously immuno-stained for p-S6 and TH. Each
1525 data point depicts the average of 3-4 pictures. Data are presented as mean
1526 ±SEM. Unpaired t-test, **p < 0.01. (E) Double BrdU and TH
1527 immunofluorescence on carotid bifurcation sections from wild type mice
1528 exposed to 10% O2 and injected with rapamycin or vehicle control for 14 days.
1529 Notice the striking decrease in double BrdU+ TH+ cells (white arrowheads) in
1530 the rapamycin treated mice compared to vehicle control animals. Scale bars:
1531 100µm. (F-H) Quantification of total CB volume (F), TH+ cells number (G) and
1532 percentage of double BrdU+ TH+ over the total TH+ cells (H) in wild type mice
1533 breathing 10% O2 and injected with rapamycin or vehicle control for 14 days.
1534 n = 5 mice per treatment. (K) Averaged breaths per minute during the first 2
1535 minutes of acute hypoxia (10% O2) exposure from vehicle or rapamycin
1536 injected mice before and after 7 days of chronic hypoxia (10% O2) treatment.
1537 n = 14 mice per condition and treatment. Data are presented as mean ±SEM.
1538 B, D, F, G and H, unpaired t-test, *p < 0.05, ****p < 0.0001. K, two-way
69 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1539 ANOVA followed by Tukey’s multiple comparison test. ****p < 0.0001, ns,
1540 non-significant.
1541
1542 Figure 7-figure supplement 1. mTORC1 activity in SCG TH+ sympathetic
1543 neurons and effect of rapamycin treatment. (A) Double TH and p-S6
1544 (mTORC1 activation marker) immunofluorescence on adult wild type SCG
+ 1545 slices after 14 days in hypoxia (10% O2). TH outlined area indicates the
1546 region used for pixels quantification. Scale bars: 100 µm. SCG, superior
1547 cervical ganglion. (B) Quantification of p-S6 (red) and TH (green) mean pixels
+ 1548 intensity within the SCG TH area of wild type mice breathing 21% O2 or 10%
1549 O2 for 14 days. Each data point depicts the average of 3-4 pictures. 21% O2,
1550 n = 3; 10% O2, n = 4. Data are presented as mean ±SEM. Unpaired t-test, ns,
1551 non-significant. (C) Representative micrographs of TH and p-S6 double
1552 immunostaining of HIF-2αWT and TH-HIF-2αKO embryonic (E18.5) carotid
1553 bifurcations. SCG TH+ outlined area indicates the region used for pixels
1554 quantification. SCG, superior cervical ganglion. Scale bars: 100 µm. (D)
1555 Quantitative analysis performed on HIF-2αWT (black) and TH-HIF-2αKO (red)
1556 micrographs previously immune-stained for TH (green) and p-S6 (red). Each
1557 data point depicts the average of 3-4 pictures. 21% O2, n = 12; 10% O2, n =
1558 10. Data are presented as mean ±SEM. Unpaired t-test, ns, non-significant.
1559 (E) Double TH and p-S6 immunofluorescence on vehicle control or rapamycin
1560 injected adult wild type SCG slices after 14 days breathing in a 10% O2
1561 atmosphere. Notice the absence of p-S6 signal as a consequence of mTORC
1562 inhibition by rapamycin. SCG, superior cervical ganglion. CB, carotid body.
1563 Scale bars: 100 µm. (F) Haematocrit levels of vehicle control (n = 14) and
70 bioRxiv preprint doi: https://doi.org/10.1101/250928; this version posted January 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1564 rapamycin (n = 14) injected mice after 7 days at 10% O2. Un-paired t-test, ns,
1565 non-significant.
1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578
71