Phylogeny and Taxonomy of a Diverse Collection of Bradyrhizobium Strains

International Journal of Systematic and Evolutionary Microbiology (2009), 59, 2934–2950 DOI 10.1099/ijs.0.009779-0

Phylogeny and taxonomy of a diverse collection of Bradyrhizobium strains based on multilocus sequence analysis of the 16S rRNA gene, ITS region and glnII, recA, atpD and dnaK genes

Paˆmela Menna,1,2,3 Fernando Gomes Barcellos1,3 and Mariangela Hungria1,2,3

Correspondence 1Embrapa Soja, Cx Postal 231, 86001-970 Londrina, Parana´, Brazil Mariangela Hungria 2Universidade Estadual de Londrina, Department of Microbiology, Cx Postal 60001, 86051-990 [email protected] or Londrina, Parana´, Brazil [email protected] 3Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq-MCT), Brasilia, Federal District, Brazil

The genus Bradyrhizobium encompasses a variety of bacteria that can live in symbiotic and endophytic associations with legumes and non-legumes, and are characterized by physiological and symbiotic versatility and broad geographical distribution. However, despite indications of great genetic variability within the genus, only eight species have been described, mainly because of the highly conserved nature of the 16S rRNA gene. In this study, 169 strains isolated from 43 different legumes were analysed by rep-PCR with the BOX primer, by sequence analysis of the 16S rRNA gene and the 16S–23S rRNA intergenic transcribed spacer (ITS) and by multilocus sequence analysis (MLSA) of four housekeeping genes, glnII, recA, atpD and dnaK. Considering a cut-off at a level of 70 % similarity, 80 rep-PCR profiles were distinguished, which, together with type strains, were clustered at a very low level of similarity (24 %). In both single and concatenated analyses of the 16S rRNA gene and ITS sequences, two large groups were formed, with bootstrap support of 99 % in the concatenated analysis. The first group included the type and/or reference strains of Bradyrhizobium japonicum, B. betae, B. liaoningense, B. canariense and B. yuanmingense and B. japonicum USDA 110, and the second group included strains related to Bradyrhizobium elkanii USDA 76T, B. pachyrhizi PAC48T and B. jicamae PAC68T. Similar results were obtained with MLSA of glnII, recA, atpD and dnaK. Greatest variability was observed when the atpD gene was amplified, and five strains related to B. elkanii revealed a level of variability never reported before. Another important observation was that a group composed of strains USDA 110, SEMIA 5080 and SEMIA 6059, all isolated from soybean, clustered in all six trees with high bootstrap support and were quite distinct from the clusters that included B. japonicum USDA 6T. The results confirm that MLSA is a rapid and reliable way of providing information on phylogenetic relationships and of identifying rhizobial strains potentially representative of novel species.

INTRODUCTION several leguminous species and characterized by slow growth and an alkaline reaction in culture media contain- The genus Bradyrhizobium was created to accommodate ing mannitol as a carbon source (Jordan, 1982). Based on bacteria capable of establishing N -fixing symbioses with 2 16S rRNA gene sequences, the genus Bradyrhizobium forms Abbreviations: ITS, intergenic transcribed spacer; MLSA, multilocus a clade in the Alphaproteobacteria, along with oligotrophic sequence analysis. soil and aquatic bacteria such as Rhodopseudomonas The GenBank/EMBL/DDBJ accession numbers for the sequences palustris, Rhodoplanes roseus, Nitrobacter winogradskyi and obtained in this study are detailed in Supplementary Table S3. Blastobacter denitrificans and pathogens such as Afipia species, among others (Saito et al., 1998; Willems et al., Details of strains, host plants and sequence accession numbers and BOX-PCR profiles are available as supplementary material with the 2001a; van Berkum & Eardly, 2002; Sawada et al., 2003). online version of this paper. Symbiotic Bradyrhizobium strains have been isolated from

2934 009779 G 2009 IUMS Printed in Great Britain MLSA of Bradyrhizobium strains the nodules of highly divergent legume tribes, including Nevertheless, at present, the use of a small number of herbaceous and woody species of tropical and temperate housekeeping genes cannot replace DNA–DNA hybridiza- origin and aquatic legumes such as Aeschynomene species, tion in species delineation. and the non-legume Parasponia andersonii (Trinick, 1973; In this study, the genetic diversity of 169 Bradyrhizobium Sprent, 2001; Menna et al., 2006). In addition, bacteria strains isolated from various legumes from various countries belonging to this genus have been reported as endophytes was analysed using the amplification of repetitive and of wild and modern rice (Oryza sativa L.) (e.g. Tan et al., conserved DNA elements (rep-PCR) and sequence analysis 2001), and Bradyrhizobium betae refers to endophytes, of the 16S rRNA gene, the 16S–23S rRNA intergenic isolated from sugar beet (Beta vulgaris L.) roots affected by transcribed spacer (ITS) and four additional conserved tumour-like deformations, that do not nodulate legumes housekeeping genes (glnII, recA, atpD and dnaK). The (Rivas et al., 2004). objective was to apply a polyphasic approach to the appraisal In the last few years, much attention has been focused on the of the genetic diversity, phylogenetic relationships and genus Bradyrhizobium, and high genetic diversity among strains taxonomic position of these strains, thus gaining a better has been demonstrated with several molecular markers (van understanding of the genus Bradyrhizobium. Berkum & Fuhrmann, 2000; Tan et al., 2001; van Berkum & Eardly, 2002; Willems et al., 2003; Liu et al., 2005; Vinuesa et al., 2005b; Germano et al., 2006; Giongo et al., 2008; Menna et al., METHODS 2009). Intriguing questions arise on the evolution and ecology of Strains. One hundred and sixty-nine Bradyrhizobium strains from this versatile genus. However, despite its impressive diversity the Brazilian Rhizobium Culture Collection SEMIA, of the and worldwide distribution, only eight species have been FEPAGRO-MIRCEN [Fundac¸a˜o Estadual de Pesquisa Agropecua´ria described to this point: three symbionts of Glycine species (Rio Grande do Sul, Brazil) – Microbiological Resources Center] (IBP [Bradyrhizobium japonicum (Jordan, 1982), B. elkanii World Catalogue of Rhizobium Collections no. 443 in the WFCC (Kuykendall et al., 1992) and B. liaoningense (Xu et al., 1995)], World Data Center on Microorganisms), were used in this study one nodulating Lespedeza cuneata [Bradyrhizobium yuanmin- (Table 1). Additional information about the strains is given in gense (Yao et al., 2002)], another nodulating shrubs of the tribes Supplementary Table S1, available in IJSEM Online. The strains were isolated from members of the three subfamilies and 12 tribes of the Genisteae and Loteae [Bradyrhizobium canariense (Vinuesa et al., ] family Leguminosae (Supplementary Table S2). Fifty of these strains 2005a) , the already mentioned B. betae (Rivas et al., 2004) and are recommended for use in commercial inoculants in Brazil, and 68 two species that nodulate Pachyrhizus erosus (Bradyrhizobium were previously analysed by BOX-PCR (Menna et al., 2009) and 16S pachyrhizi and B. jicamae) that have been described recently rRNA gene sequencing (Menna et al., 2006). Preparation of stock (Ramı´rez-Bahena et al., 2009). The new combination cultures, strain growth conditions and maintenance were as described ‘Bradyrhizobium denitrificans’, proposed by van Berkum et al. by Menna et al. (2006). Three type strains were used in the studies, B. japonicum USDA 6T, B. liaoningense LMG 18230T and B. elkanii (2006) as a result of the reclassification of Blastobacter USDA 76T, provided by the USDA (Beltsville, MD, USA) and denitrificans, is yet to be validly published. A variety of other deposited at the Culture Collection of Diazotrophic and Plant Growth strains are commonly referred to as Bradyrhizobium sp., Promoting Bacteria of Embrapa Soja. followed by the name of the host legume. Apparently, the definition of species in the genus is limited by the low diversity of DNA extraction and rep-PCR (BOX) genomic fingerprinting. the 16S rRNA gene sequences reported so far (e.g. van Berkum & Total genomic DNA of the 169 strains was extracted as described by Fuhrmann, 2000; Willems et al., 2001b; Qian et al., 2003). Kaschuk et al. (2006a), and amplification by PCR with the primer BOX A1R (Versalovic et al., 1994; Koeuth et al., 1995) was performed DNA–DNA hybridization is generally required in order to as described by Kaschuk et al. (2006a), with a 1 kb DNA marker define a novel species (Garrity & Holt, 2001); however, an (Invitrogen) being included on the left and right and in the centre of increasing number of arguments against insistence on its each gel. The amplified fragments were separated by horizontal electrophoresis on 1.5 % agarose gels (Kaschuk et al., 2006a), which use has been raised, including the high cost and intensive were then stained with ethidium bromide, visualized under UV work required for its development (Vandamme et al., 1996; irradiation and photographed. Coenye et al., 2005), the existence of more accurate approaches (Konstantinidis & Tiedje, 2004) and doubts Sequencing of the 16S rRNA gene and ITS. The DNA of 80 about its adequacy (Achtman & Wagner, 2008). Multilocus strains representative of the rep-PCR groups was submitted to sequence analysis (MLSA), which consists of examination amplification with primers for the 16S rRNA gene and ITS region (Table 2). The PCR products were purified with the PureLink PCR of the sequences of several conserved housekeeping genes Purification kit (Invitrogen), and the reactions were performed as dispersed over at least 100 kb of the genome, has been described by Menna et al. (2006). Sequencing was performed on a proposed as a more accessible tool for assessing phylogeny MEGA BACE 1000 (Amersham Biosciences) capillary sequencer, as and taxonomy of prokaryotes (Brett et al., 1998; Maiden described by Menna et al. (2006). et al., 1998; Godoy et al., 2003; Cooper & Feil, 2004). Using MLSA, Moulin et al. (2004) observed high genetic diversity Sequencing of glnII, recA, atpD and dnaK genes. DNA from 40 strains selected after analysis of the 16S rRNA gene and ITS sequences among Bradyrhizobium strains, and Ribeiro et al. (2009) was amplified using primers specific to the regions coding for four found strong concordance between MLSA of five house- housekeeping genes, glnII, recA, atpD and dnaK. The primers, keeping genes and DNA–DNA hybridization in Rhizobium amplification conditions and references are listed in Table 2. microsymbionts of common bean (Phaseolus vulgaris L.). Purification and sequencing were performed as described above. http://ijs.sgmjournals.org 2935 P. Menna, F. G. Barcellos and M. Hungria

Table 1. Strains included in this study

Strain Host plant rep-PCR group 16S rRNA+ITS MLSA group Classification based group on MLSA

USDA 6T Glycine max Group IX GI-4 GI-7 B. japonicum USDA 76T Glycine max Group XVIII GII-3 GII-1 B. elkanii T LMG 18230 Glycine max Isolated GI-7 ND B. liaoningense SEMIA 501 Glycine max Group XIX ND ND ND SEMIA 509 Glycine max Group XIII ND ND ND SEMIA 510 Glycine max Group XXVI GI-6 ND ND SEMIA 511 Glycine max Isolated GI-isolated GI-7 B. japonicum SEMIA 512 Glycine max Group IX GI-4 GI-7 B. japonicum SEMIA 513 Not known Group XII ND ND ND SEMIA 515 Glycine max Group XII ND ND ND SEMIA 516 Glycine max Group XXVI ND ND ND SEMIA 518 Glycine max Group XI ND ND ND SEMIA 527 Glycine max Group XIV ND ND ND SEMIA 528 Glycine max Group XII ND ND ND SEMIA 538 Glycine max Group XIX ND ND ND SEMIA 542 Glycine max Group XIX ND ND ND SEMIA 543 Glycine max Group XII ND ND ND SEMIA 549 Glycine max Group XIX ND ND ND SEMIA 556 Glycine max Group IX ND ND ND SEMIA 560 Glycine max Group XI GI-3 GI-3 Bradyrhizobium sp. SEMIA 565 Glycine max Group XIX ND ND ND SEMIA 566 Glycine max Group XII ND ND ND SEMIA 567 Glycine max Group XII ND ND ND SEMIA 568 Glycine max Group XII ND ND ND SEMIA 571 Glycine max Group XII ND ND ND SEMIA 574 Glycine max Group XXV ND ND ND SEMIA 576 Glycine max Group XIII ND ND ND SEMIA 577 Glycine max Group XXI ND ND ND SEMIA 579 Glycine max Group XII ND ND ND SEMIA 580 Glycine max Group XII GI-4 ND ND SEMIA 581 Glycine max Group XXV ND ND ND SEMIA 583 Glycine max Group VI ND ND ND SEMIA 584 Glycine max Group XVIII ND ND ND SEMIA 587* Glycine max Group XX GII-isolated GII-1 B. elkanii SEMIA 589 Glycine max Group XXV ND ND ND SEMIA 590 Glycine max Group XIX ND ND ND SEMIA 591 Glycine max Group XVIII ND ND ND SEMIA 593 Glycine max Group XII ND ND ND SEMIA 598 Glycine max Group XIX ND ND ND SEMIA 613 Vigna unguiculata Group VII GI-3 ND ND SEMIA 621 Lespedeza striata Isolated GII-5 ND ND SEMIA 635 Vigna unguiculata Group VII ND ND ND SEMIA 637 Acacia mearnsii Isolated GI-5 ND ND SEMIA 656* Neonotonia wightii Isolated GI-isolated GI-4 Bradyrhizobium sp. SEMIA 662* Vigna unguiculata Group II ND ND ND SEMIA 695* Neonotonia wightii Group II GII-2 GII-1 B. elkanii SEMIA 696D Desmodium uncinatum Group XX ND ND ND SEMIA 839D Lotus pedunculatus Isolated GI-1 ND ND SEMIA 905D Ornithopus sativus Group V ND ND ND SEMIA 928D Lupinus sp. Isolated GI-2 GI-5 B. canariense SEMIA 929D Ornithopus sativus Group V GI-9 ND ND SEMIA 938* Lupinus albus Group II ND ND ND SEMIA 5000 Glycine max Group XIII ND ND ND SEMIA 5002 Glycine max Group XVIII GII-3 ND ND SEMIA 5003 Glycine max Group VI GI-10 ND ND SEMIA 5005 Glycine max Group XIII ND ND ND

2936 International Journal of Systematic and Evolutionary Microbiology 59 MLSA of Bradyrhizobium strains

Table 1. cont.

Strain Host plant rep-PCR group 16S rRNA+ITS MLSA group Classification based group on MLSA

SEMIA 5010 Glycine max Group XXIII ND ND ND SEMIA 5011 Glycine max Group XIX GII-3 GII-1 B. elkanii SEMIA 5012 Glycine max Group XIX ND ND ND SEMIA 5013 Glycine max Group XXII ND ND ND SEMIA 5014 Glycine max Group XVIII ND ND ND SEMIA 5015 Glycine max Group XVIII ND ND ND SEMIA 5016 Glycine max Group XIX ND ND ND SEMIA 5018 Glycine max Group XVIII ND ND ND SEMIA 5019* Glycine max Group XX GII-3 GII-1 B. elkanii SEMIA 5020 Glycine max Isolated GI-6 ND ND SEMIA 5021 Glycine max Isolated GI-6 ND ND SEMIA 5022 Glycine max Isolated GI-7 ND ND SEMIA 5023 Glycine max Group XXIII ND ND ND SEMIA 5024 Glycine max Group XXV ND ND ND SEMIA 5025 Glycine max Group XXIII GI-7 GI-1 B. liaoningense SEMIA 5026 Glycine max Isolated GII-3 GII-1 B. elkanii SEMIA 5027 Glycine max Group XXI GII-2 GII-1 B. elkanii SEMIA 5028 Glycine max Group IX ND ND ND SEMIA 5029 Glycine max Group X GI-4 ND ND SEMIA 5030 Glycine max Group XXIII ND ND ND SEMIA 5032 Glycine max Group XXV ND ND ND SEMIA 5034 Glycine max Isolated GI-3 ND ND SEMIA 5036 Glycine max Group XXV GI-6 ND ND SEMIA 5037 Glycine max Group IX ND ND ND SEMIA 5038 Glycine max Group XIII ND ND ND SEMIA 5039 Glycine max Group IX ND ND ND SEMIA 5042 Glycine max Group XIII ND ND ND SEMIA 5043 Glycine max Isolated GI-6 ND ND SEMIA 5044 Glycine max Group XVI ND ND ND SEMIA 5045 Glycine max Isolated GI-1 GI-7 B. japonicum SEMIA 5046 Glycine max Isolated GI-1 ND ND SEMIA 5048 Glycine max Isolated GI-1 ND ND SEMIA 5051 Glycine max Group IX ND ND ND SEMIA 5052 Glycine max Group IX ND ND ND SEMIA 5055 Glycine max Group X ND ND ND SEMIA 5056 Glycine max Isolated GI-1 ND ND SEMIA 5057 Glycine max Group IX ND ND ND SEMIA 5058 Glycine max Group XVII ND ND ND SEMIA 5059 Glycine max Group XVI ND ND ND SEMIA 5060 Glycine max Isolated GI-6 ND ND SEMIA 5061 Glycine max Group XVIII ND ND ND SEMIA 5062 Glycine max Isolated GI-10 GI-1 B. liaoningense SEMIA 5063 Glycine max Group XI ND ND ND SEMIA 5064 Glycine max Group VIII GI-1 ND ND SEMIA 5065 Glycine max Group XIV ND ND ND SEMIA 5066 Glycine max Group XXII GII-2 ND ND SEMIA 5067 Glycine max Group XVIII ND ND ND SEMIA 5068 Glycine max Group XIII GI-4 ND ND SEMIA 5069 Glycine max Group XX ND ND ND SEMIA 5070 Glycine max Group XX ND ND ND SEMIA 5071 Glycine max Group VIII ND ND ND SEMIA 5072 Glycine max Group XXVI ND ND ND SEMIA 5073 Glycine max Group XXVI ND ND ND SEMIA 5074 Glycine max Group XXVI ND ND ND SEMIA 5075 Glycine max Group XIII ND ND ND SEMIA 5079* Glycine max Group XV GI-4 GI-7 B. japonicum http://ijs.sgmjournals.org 2937 P. Menna, F. G. Barcellos and M. Hungria

Table 1. cont.

Strain Host plant rep-PCR group 16S rRNA+ITS MLSA group Classification based group on MLSA

SEMIA 5080* Glycine max Group XVI GI-6 GI-6 B. japonicum SEMIA 5081 Glycine max Group IX ND ND ND SEMIA 5082 Glycine max Group XV ND ND ND SEMIA 5083 Glycine max Group XVII GI-6 ND ND SEMIA 5084 Glycine max Group XVI ND ND ND SEMIA 5085 Glycine max Isolated GI-4 ND ND SEMIA 5086 Glycine max Group XIII ND ND ND SEMIA 5087 Glycine max Group XVIII ND ND ND SEMIA 5090 Glycine max Group XVII ND ND ND SEMIA 6002* Vigna unguiculata Group III ND ND ND SEMIA 6014 Stylosanthes guianensis Isolated GI-isolated GI-4 Bradyrhizobium sp. SEMIA 6028* Desmodium uncinatum Isolated GII-6 GII-3 Bradyrhizobium sp. SEMIA 6053* Clitoria ternatea Isolated GII-1 GII-3 Bradyrhizobium sp. SEMIA 6056 Arachis hypogaea Isolated GII-5 ND ND SEMIA 6057 Psophocarpus tetragonolobus Group XXVII ND ND ND SEMIA 6059* Psophocarpus tetragonolobus Group XXVII GI-6 GI-6 B. japonicum SEMIA 6069D Leucaena leucocephala Isolated GII-5 GII-3 Bradyrhizobium sp. SEMIA 6071 Stylosanthes sp. Group IX ND ND ND SEMIA 6077 Stylosanthes sp. Isolated GI-12 GI-2 B. yuanmingense SEMIA 6093 Aeschynomene americana Isolated GII-5 GII-3 Bradyrhizobium sp. SEMIA 6099D Dimorphandra exaltata Isolated GII-6 GII-3 Bradyrhizobium sp. SEMIA 6100* Albizia falcataria Group IV ND ND ND SEMIA 6101* Dalbergia nigra Isolated GII-isolated GII-2 Bradyrhizobium sp. SEMIA 6118 Stylosanthes sp. Isolated GII-6 ND ND SEMIA 6144* Arachis hypogaea Group III GI-12 ND ND SEMIA 6145* Crotalaria juncea Isolated GII-1 ND ND SEMIA 6146* Centrosema sp. Isolated GII-6 GII-2 Bradyrhizobium sp. SEMIA 6148* Neonotonia wightii Isolated GII-6 GII-isolated Bradyrhizobium sp. SEMIA 6149* Galactia striata Group IV ND ND ND SEMIA 6150* Acacia mearnsii Isolated GII-6 ND ND SEMIA 6152* Calopogonium sp. Isolated GII-4 GII-3 Bradyrhizobium sp. SEMIA 6155* Stylosanthes sp. Isolated GI-4 ND ND SEMIA 6156* Crotalaria spectabilis Isolated GI-9 GI-3 Bradyrhizobium sp. SEMIA 6157* Cajanus cajans Isolated GII-6 ND ND SEMIA 6158* Crotalaria spectabilis Isolated GII-6 ND ND SEMIA 6160* Albizia lebbek Group IV GII-1 GII-3 Bradyrhizobium sp. SEMIA 6163* Acacia mearnsii Group I GI-11 GI-isolated Bradyrhizobium sp. SEMIA 6164* Acacia mearnsii Isolated GI-5 GI-8 Bradyrhizobium sp. SEMIA 6169* Albizia falcataria Group IV ND ND ND SEMIA 6175* Pueraria phaseoloides Isolated GII-1 ND ND SEMIA 6179 Acacia miersii Isolated GI-isolated GI-8 Bradyrhizobium sp. SEMIA 6181 Melanoxylum brauna Group XXIV ND ND ND SEMIA 6186 Acacia miersii Group XXIV GI-8 GI-8 Bradyrhizobium sp. SEMIA 6187 Acacia miersii Isolated GI-11 GI-8 Bradyrhizobium sp. SEMIA 6189 Acacia miersii Group I ND ND ND SEMIA 6192* Tipuana tipa Isolated GI-12 GI-3 Bradyrhizobium sp. SEMIA 6208* Desmodium ovalifolium Isolated GII-4 ND ND SEMIA 6319* Arachis sp. Isolated GI-10 GI-2 B. yuanmingense SEMIA 6368 Centrosema plumieri Isolated GI-8 ND ND SEMIA 6374 Arachis pintoi Isolated GI-12 GI-4 Bradyrhizobium sp. SEMIA 6384* Mimosa acutistipula Isolated GII-2 ND ND SEMIA 6388D Acacia podalyriaefolia Group XXVIII ND ND ND SEMIA 6391* Acacia auriculiformis Group IV ND ND ND SEMIA 6420* Acacia mangium Group I ND ND ND SEMIA 6424* Centrosema pubescens Isolated GII-4 ND ND SEMIA 6425* Centrosema pubescens Isolated GII-6 ND ND

2938 International Journal of Systematic and Evolutionary Microbiology 59 MLSA of Bradyrhizobium strains

Table 1. cont.

Strain Host plant rep-PCR group 16S rRNA+ITS MLSA group Classification based group on MLSA

SEMIA 6426D Erythrina poeppigeana Group XVIII ND ND ND SEMIA 6434D Inga sp. Isolated GI-isolated GI-isolated Bradyrhizobium sp. SEMIA 6440* Arachis pintoi Isolated GII-1 GII-3 Bradyrhizobium sp. SEMIA 6443D Acosmium nitens Group XXVIII GII-4 ND ND

ND, Not determined in this study. *Analysed by Menna et al. (2006, 2009). DStrains recommended as commercial inoculants in Brazil.

Cluster analyses. In the rep-PCR analysis, the sizes of the fragments differing in intensity and varying in size from 200 to were normalized according to the sizes of the DNA marker. Cluster 5000 bp (Supplementary Fig. S1). analyses were performed with the Bionumerics program version 4.6 (Applied Maths), using the UPGMA algorithm (Sneath & Sokal, Cluster analysis allowed the identification of numerous 1973) and the Jaccard coefficient (J; Jaccard, 1912), with the optimum well-defined groups of bradyrhizobia, with a high level of values indicated by the Bionumerics program for the tolerance and intraspecific diversity. Considering a cut-off at 70 % optimization parameters. similarity, as suggested for studies of diversity of rhizobia The 16S rRNA gene, ITS, glnII, recA, atpD and dnaK sequences using rep-PCR (Grange & Hungria, 2004; Alberton et al., generated were analysed with the programs Phred (Ewing & Green, 2006; Kaschuk et al., 2006a, b), 80 profiles were 1998; Ewing et al., 1998), Phrap (http://www.phrap.org) and Consed distinguished and, together with the type strains, all strains (Gordon et al., 1998). The sequences obtained and confirmed in the 39 were clustered at the very low level of 24 % similarity and 59 directions were submitted to GenBank under the accession (Supplementary Fig. S1 and Table 1). In some of the numbers listed in Supplementary Table S3. The single and concate- groups, strains isolated from the same host legume and in nated sequences obtained were analysed using the MEGA software version 4.0 with the default parameters, K2P distance model (Kimura, the same country were clustered with similarities higher 1980) and the neighbour-joining algorithm (Saitou & Nei, 1987). The than 70 %, e.g. SEMIA strains 6163, 6420 and 6189, conserved, variable and parsimony-informative regions were analysed isolated from Acacia species in Brazil. However, in other in consensus sequences containing gaps; therefore, the number of groups, strains isolated from different legume species and analysed sites is always greater because it includes gaps. A site is countries showed similarities as high as 100 %, e.g. SEMIA parsimony-informative if it contains at least two types of nucleotide (or strains 662, 695 and 938, respectively isolated from Vigna amino acid) and at least two of them occur with a minimum frequency unguiculata, Neotonia wightii and Lupinus albus of two, and the parameter was estimated using the MEGA program. Statistical support for tree nodes was evaluated by bootstrap analyses (Supplementary Fig. S1 and Table 1). (Felsenstein, 1985) with 1000 samplings (Hedges, 1992). Sequences of reference and type strains used for alignment and Diversity in the 16S rRNA gene and ITS region comparison are detailed in Supplementary Table S4. The genome sequence of Caulobacter crescentus CB15 (GenBank accession no. When DNA of the 80 strains representative of each rep- AE005673) was used as an outgroup. PCR group was submitted to sequence analysis of the 16S rRNA gene and ITS region, unique bands were obtained in each amplification, of approximately 1500 and 700 bp, respectively. For the alignment of the 16S rRNA gene, a RESULTS region of 1480 bp was considered. No statistical differences were detected among the strains in the contents of T, C, A Morpho-physiological properties and G, and the estimated mean frequencies for these All 169 strains were characterized by slow growth and an nucleotides were respectively 20.1, 24.1, 24.3 and 31.5 % alkaline reaction in a culture medium containing mannitol (Table 3). In the consensus sequence of all Bradyrhizobium as carbon source after 5–7 days of growth, typical morpho- strains, containing 1492 analysed sites, there were 1365 conserved positions, 119 variable positions and 68 physiological properties of Bradyrhizobium strains. Mucus parsimony-informative sites. production in vitro varied from little to profuse after this period, with no correlation with the host plant or the The phylogenetic tree built with the 16S rRNA gene ecosystem of isolation (data not shown). sequences split the strains into two large groups, with respective bootstrap support of 96 and 99 % (Fig. 1a). The first group included 48 SEMIA strains and the following rep-PCR genomic fingerprinting reference strains: B. japonicum USDA 6T, B. betae DNA profiles after amplification with the BOX primer were PL7HG1T, B. liaoningense LMG 18230T, B. canariense obtained for all 169 strains, with a mean of 20 bands BC-C2, B. yuanmingense CCBAU 10071T and B. japonicum http://ijs.sgmjournals.org 2939 P. Menna, F. G. Barcellos and M. Hungria

USDA 110. In this first group, it was possible to observe 11 subgroups, six of which did not include any type or (2005) (2005) (2005)

(1991) reference strains, in addition to two isolated strains (B. (1996)

B. japonicum T

al. betae PL7HG1 and SEMIA 839). Bootstrap support for et al. et al. et al. et

et al. these subgroups ranged from 62 to 95 %. The second group

Reference comprised 32 SEMIA strains and the reference strains B. pachyrhizi PAC48T, B. jicamae PAC68T and B. elkanii T Weisburg USDA 76 , and was split in four subgroups and three isolated strains (SEMIA strains 695, 6056 and 6093), with

C Laguerre 83 % bootstrap support (Fig. 1a). u C This study C Stepkowski C Stepkowski C Stepkowski u u u u When compared with the 16S rRNA gene, greater C),

u variability was detected in the ITS region (Fig. 1b). Similar to the results obtained with the 16S rRNA gene,

C), 6 min 72 no statistical variation was observed in the percentages of u C), 7 min 72 C), 7 min 72 C), 7 min 72 C), 7 min 72 u u u u T, C, A and G, and, considering the gaps and insertion of C, 2 min 72

u nucleotides observed in some strains, the consensus sequence of the Bradyrhizobium strains contained 1115

C, 2 min 72 analysed sites, with 590 conserved positions, 377 variable u positions and 294 parsimony-informative sites (Table 3). C, 45 s 55 C, 1.5 min 72 C, 1.5 min 72 C, 1.5 min 72 C, 1.5 min 72 u u u u u The phylogenetic tree of the ITS sequences resulted in two large groups with 76 and 99 % bootstrap support, C, 1 min 55

u respectively (Fig. 1b). The first group joined 48 SEMIA C, 45 s 93 C, 30 s 58 C, 30 s 58 C, 30 s 58 C, 30 s 58 u u u u u strains and all type and reference strains except for B. PCR cycling conditions jicamae PAC68T, B. pachyrhizi PAC48T and B. elkanii USDA 76T. It could be split into more subgroups than (15 s 94 (45 s 95 (45 s 95 (45 s 95 (45 s 95 (1 min 94 6 6 6 6 6 6 observed for the 16S rRNA gene, 12, seven of which did not include any type or reference strain, in addition to nine C u C, 30 C, 35 C, 35 C, 35 C, 35 C, 35 u u u u u u isolated strains (SEMIA strains 6163, 6014, 6187, 656, 6164, 511, 6179 and 6434 and B. betae PL7HG1T). The second large group contained 32 SEMIA strains and the reference

5 min 72 T T 2 min 95 2 min 95 strains B. jicamae PAC68 , B. pachyrhizi PAC48 and B. elkanii USDA 76T; it could be split into eight subgroups, with two strains remaining isolated (SEMIA 6158 and B. jicamae PAC68T). Nine SEMIA strains were clustered with B. elkanii USDA 76T in the first subgroup, and SEMIA 587 (1474–1494) showed high genetic divergence in comparison with B. T (1905–1885) (1411–1430) 2 min 95 (804–784) (189–208) 2 min 95 (681–660) (13–38) (620–594) (8–32) elkanii USDA 76 . In addition, four SEMIA strains were rRNA clustered with B. pachyrhizi PAC48T in the eighth Target gene (position) dnaK 16S rRNA (9–29) 2 min 95 glnII dnaK atpD glnII recA atpD recA 16S rRNA (1490–1510) 3 min 94 16S 23S rRNA (148–130) subgroup. The strains from the remaining six subgroups showed no relation with type or reference strains (Fig. 1b). In an attempt to improve the phylogenetic information obtainable from the ribosomal regions, the concatenated )

§ sequences of the 16S rRNA gene and ITS region were

–3 analysed. This was possible because, in a previous study with strains of Bradyrhizobium performed by Willems et al. (2003), the authors observed high correlation between ITS sequencing and DNA–DNA hybridization, such that strains Sequence (5 § with more than 95.5 % ITS sequence similarity belonged to the same genospecies, showing more than 60 % DNA– DNA hybridization. The concatenated sequence of the 16S rRNA gene and ITS region of Bradyrhizobium strains from our study presented 2271 nucleotides, with the consensus Primers and DNA amplification conditions used in this study sequence including gaps consisting of 2597 analysed sites, of which 1919 were conserved, 524 variable and 380 parsimony-informative (Table 3). In the resulting neigh- BRdnaKr GCCTGCTGCKTGTACATGGC fD1 AGAGTTTGATCCTGGCTCAG TSglnIIr SGAGCCGTTCCAGTCGGTGTCG BRdnaKf TTCGACATCGACGCSAACGG TSatpDr CGACACTTCCGARCCSGCCTG TSglnIIf AAGCTCGAGTACATCTGGCTCGACGG TSrecAr CGGATCTGGTTGATGAAGATCACCATG TSatpDf TCTGGTCCGYGGCCAGGAAG TSrecAf CAACTGCMYTGCGTATCGTCGAAGG FGPS1490 TGCGGCTGGATCACCTCCTT rD1 CTTAAGGAGGTGATCCAGCC Primer FGPS130 CCGGGTTTCCCCATTCGG Table 2. Mixtures of bases used at certain positions are given as: K, T or G; S, G or C; Y, C or T; R, A or G; M, A or C. Primer positions are given according to the corresponding sequence of USDA 110. bour-joining tree, two large groups were again well defined,

2940 International Journal of Systematic and Evolutionary Microbiology 59 MLSA of Bradyrhizobium strains

Table 3. Sequence information obtained in this study

Forty (16S rRNA gene, ITS) or 80 (other genes) strains were analysed, together with seven, eight or nine type and reference strains (see Methods).

Locus Strains Nucleotides (%) Frequency T/C/A/G (%) analysed (n) Conserved Variable Parsimony-informative Total*

ITS 89 590 (52.9) 377 (33.8) 294 (26.3) 791/1115 26.0/24.7/20.1/29.1 16S rRNA 89 1365 (91.5) 119 (7.9) 68 (4.5) 1480/1492 20.1/24.1/24.3/31.5 16S rRNA+ITS 89 1919 (73.9) 524 (20.1) 380 (14.6) 2271/2597 22.2/24.3/22.8/30.7 atpD 48 221 (36.6) 378 (62.6) 352 (58.2) 574/604 18.6/32.2/16.1/33.2 dnaK 47 270 (69.2) 107 (27.4) 74 (18.9) 370/390 10.3/31.1/24.6/34.0 glnII 49 423 (66.3) 181 (28.3) 132 (20.6) 602/638 17.3/33.1/19.9/29.7 recA 47 377 (71.8) 148 (28.2) 108 (20.5) 525/525 15.9/30.9/17.2/36.0 ITS 49 574 (52.3) 380 (34.6) 271 (24.7) 793/1097 26.0/24.8/20.0/29.2 16S rRNA 49 1373 (91.9) 111 (7.4) 65 (4.3) 1481/1493 20.1/24.0/24.3/31.5 Concatenated genes 47 1315 (60.6) 791 (36.5) 658 (30.3) 2075/2167 19.2/27.9/21.0/31.8 Concatenated genes 47 1089 (70.0) 417 (26.8) 308 (19.8) 1498/1555 19.3/27.3/21.8/31.6 without atpD

*Mean number of nucleotides amplified/number of sites analysed, including gaps.

Fig. 1. Phylogenetic relationships of 90 taxa based on the 16S rRNA gene (a) and the ITS region (b). Phylogeny was inferred using the neighbour-joining method. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Evolutionary distances were computed using the maximum composite likelihood method and are in units of the number of base substitutions per site. Positions containing gaps and missing data were eliminated from the dataset (com- plete deletion option). Phylogenetic analyses were conducted in MEGA4. http://ijs.sgmjournals.org 2941 P. Menna, F. G. Barcellos and M. Hungria both with bootstrap support of 99 % (Fig. 2). The first Bradyrhizobium. In general, the subgroups formed with comprised 12 subgroups, with five SEMIA strains (SEMIA atpD were also observed in the 16S rRNA gene tree, e.g. the 511, 6179, 6014, 656 and 6434) and B. betae PL7HG1T clusters with B. liaoningense LMG 18230T, B. yuanmingense remaining isolated. All type and reference strains were CCBAU 10071T and B. japonicum USDA 6T.Itis included in this first group, except B. elkanii USDA 76T, B. noteworthy that SEMIA strains 5080 and 6059 were jicamae PAC68T and B. pachyrhizi PAC48T. The second clustered with B. japonicum USDA 110, in a different group contained 32 strains and the latter three type and group from that of the type strain USDA 6T (Fig. 3a), reference strains and could be split into six subgroups, with similar to what was observed in the 16S rRNA gene and ITS two SEMIA strains 6101 and 587 and B. jicamae PAC68T analyses (Figs 1 and 2). occupying isolated positions (Fig. 2). The two large groups observed in the 16S rRNA gene and In general, in the trees built individually with the 16S rRNA ITS trees were also detected in the dnaK and glnII trees, but gene and ITS sequences, it was not possible to establish a were not well defined in the atpD or recA trees. However, clear relation between the clustering of the strains and their three subgroups were observed in all trees, and two host plant species or their geographical origin. included type or reference strains, B. japonicum USDA 6T and SEMIA strains 512 and 5079, both isolated from soybean, and B. canariense BC-C2 and SEMIA 928, the Diversity in the atpD, dnaK, glnII and recA gene latter isolated from Lupinus sp. and of unknown geo- sequences graphical origin. Another noteworthy group present in all The additional housekeeping genes selected to refine the trees was B. japonicum USDA 110 and SEMIA strains 5080 phylogenetic analysis in this study are highly conserved and 6059, all isolated from soybean. Furthermore, the among bacteria of the order Rhizobiales, and are dispersed subgroup that included B. elkanii USDA 76T and SEMIA in the genome of B. japonicum USDA 110. They encode the strains 5026, 587, 5027, 5019 and 5011, also isolated from following important proteins: atpD encodes the ATP soybean, was present in all trees except that generated with synthase beta-chain, glnII encodes glutamine synthetase atpD. B. yuanmingense CCBAU 10071T was also always II, recA encodes the recombination protein RecA and dnaK clustered with SEMIA 6319, isolated from Arachis sp. in encodes a 70 kDa chaperone protein. Forty strains Bolivia, except in the tree generated with glnII sequences. B. representative of the subgroups of the concatenated tree liaoningense LMG 18230T and SEMIA 5025, isolated from built with the 16S rRNA gene and ITS sequences, in soybean in Thailand, were also always clustered together addition to the type and reference strains, were selected for except in the glnII tree. Interestingly, SEMIA strains 511 the analysis and are indicated with asterisks in Fig. 2. The and 5045 were clustered with B. japonicum USDA 6T in the amplification resulted in fragments with mean lengths of analyses of all four housekeeping genes, but not when the 574 bp for atpD, 370 bp for dnaK, 602 bp for glnII and 16S rRNA gene or ITS region were considered. 525 bp for recA; the sequence characteristics are provided in Table 3. The lowest level of conservation was observed Analysis of concatenated atpD, dnaK, glnII and for atpD, only 36.6 %; for the other sequences, the levels of recA sequences conservation were 69.2 % for dnaK, 66.3 % for glnII, 71.8 % for recA and 52.3 % for the ITS region. For each Assuming that each tree represents a partial view of the housekeeping gene, phylogenetic trees were constructed information contained in the genome, all four sequences using the neighbour-joining method and resulted in were concatenated in order to gain a fuller understanding distinct groups (Figs 3 and 4). When neighbour-joining of the strains. The concatenation resulted in a consensus trees were built with the deduced amino acid sequences, sequence of 2075 bp with 2167 analysed sites; 1315 were clustering was not as clear (data not shown). conserved, 791 were variable and 658 were parsimony- informative (Table 3). The greatest variability was observed with the atpD gene (Table 3, Fig. 3a), and five strains (SEMIA strains 5026, The tree built with the concatenated genes resulted in two 5027, 587, 5011 and 5019) formed a distinct cluster. These large groups, with a bootstrap support of 100 % (Fig. 5). strains were isolated from soybean plants (Glycine max L.) Once more, the first group contained 23 SEMIA strains in Brazil, the USA and Thailand (Supplementary Table S1) together with the type or reference strains of B. japonicum, and, in the 16S rRNA gene and ITS analyses, they showed B. liaoningense, B. canariense and B. yuanmingense and B. higher similarity to B. elkanii USDA 76T. Interestingly, the japonicum USDA 110. However, within this group, ten PCR products obtained with atpD primers for these five subgroups were formed, and some subgroups were clearly strains were larger (approx. 700 bp) than for the other distantly related to the type strains, such as subgroups 2, 3, strains. Although the similarity values were low, BLASTX 4, 9 and 10, in addition to three isolated strains, SEMIA showed higher similarity (~50 %) of these sequences to a strains 656, 6163 and 6186. The second large group putative insertion sequence transposase protein of comprised 17 SEMIA strains and B. elkanii USDA 76T, with Rhizobium etli CFN 42T (Gene ID: 1005217 four subgroups and with SEMIA strains 6148 and 695 and RHE_PD00002), while all other subgroups showed high B. elkanii USDA 76T remaining isolated. The fourth atpD sequence similarity to type and/or reference strains of subgroup, containing SEMIA strains 5027, 587, 5011,

2942 International Journal of Systematic and Evolutionary Microbiology 59 MLSA of Bradyrhizobium strains

Fig. 2. Phylogenetic relationships of 90 taxa based on concatenated 16S rRNA gene and ITS region sequences. Asterisks (*) indicate strains that were selected for MLSA. See legend to Fig. 1 for further details.

http://ijs.sgmjournals.org 2943 P. Menna, F. G. Barcellos and M. Hungria

Fig. 3. Phylogenetic trees reconstructed using the neighbour-joining method for 49 strains based on atpD (a) and 48 strains based on dnaK (b). Codon positions included were first+second+third+non-coding. See legend to Fig. 1 for further details.

5026 and 5019, was more distant from the others (Fig. 5), programmes aimed at identifying effective rhizobial strains, which might be attributed to the variability in the atpD and today are officially recommended for use in commer- gene. cial inoculants for application to 64 legumes. Previous analysis of these ‘elite strains’ by Menna et al. (2006, 2009) We then built another tree without the atpD gene (Fig. 6). revealed a level of genetic diversity beyond that described The consensus sequence was 1498 bp long, with 1089 previously for the genus Bradyrhizobium (e.g. van Berkum conserved sites, 417 variable but informative sites and 308 & Fuhrmann, 2000; Willems et al., 2001a, b; Qian et al., parsimony-informative sites (Table 3). The first large 2003; Vinuesa et al., 2005b), suggesting the need for further group (Fig. 6) was similar to that observed in the tree analyses to refine phylogenetic relationships and taxo- built with all housekeeping genes (Fig. 5). However, nomic classification. The additional strains and house- differences were observed in the second large group, in keeping genes included in this study confirmed the which SEMIA strains 5026, 587, 5027, 5019 and 5011 were T presence of high intra- and interspecific genetic diversity clustered with B. elkanii USDA 76 (Fig. 6). The large within the genus Bradyrhizobium. group, subgroups and isolated strains formed in the analysis of concatenated sequences are detailed in Table 1. Genetic characterization and evaluation of Bradyrhizobium strains has greatly improved with the availability of several molecular techniques (van Berkum & Fuhrmann, 2000; ´ DISCUSSION Willems et al., 2003; Rodrıguez-Navarro et al., 2004; Stepkowski et al., 2005). One example is the amplification of The 169 SEMIA strains used in this study had been isolated repetitive regions dispersed in the genome of eubacteria from 43 distinct host legumes, 104 of them from soybean. (rep-PCR), such as the sequences known as BOX, which Forty of these strains were obtained from selection result in highly characteristic bacterial fingerprints

2944 International Journal of Systematic and Evolutionary Microbiology 59 MLSA of Bradyrhizobium strains

Fig. 4. Phylogenetic trees inferred using the neighbour-joining method for 50 strains based on glnII (a) and 48 strains based on recA (b). See legends to Figs 1 and 3 for further details.

(Mostasso et al., 2002; Saldan˜a et al., 2003; Hungria et al., Yamasato, 1993; Young & Haukka, 1996; Garrity & Holt, 2006; Wang et al., 2006; Pinto et al., 2007; Menna et al., 2001; Young et al., 2001). In Bradyrhizobium, as a result of 2009). rep-PCR has been used to assess genetic diversity of the limited diversity of the 16S rRNA gene sequence (Olsen strains isolated from soybean (e.g. Abaidoo et al., 2000; & Woese, 1993; Ludwig & Schleifer, 1994; Barrera et al., Batista et al., 2007; Loureiro et al., 2007), Lupinus species 1997; Wang & Martı´nez-Romero, 2000), only six species (Barrera et al., 1997), Acacia albida (Dupuy & Dreyfus, have been accepted (Jordan, 1982; Kuykendall et al., 1992; 1992), Aeschynomene species (Wong et al., 1994) and other Xu et al., 1995; Yao et al., 2002; Rivas et al., 2004; Vinuesa legumes (Parker & Lunk, 2000; Willems et al., 2003; Wolde- et al., 2005a), in addition to two recently described species Meskel et al., 2004). Similarly, our BOX-PCR profiles have (Ramı´rez-Bahena et al., 2009). shown remarkable diversity among Bradyrhizobium strains The proposed strategy to improve the definition of species isolated from various legumes and countries, such that they – the analysis of additional conserved ribosomal regions, share the low level of similarity of 24 %. the 23S rRNA gene and the ITS (Willems et al., 2001b, BOX-PCR fingerprinting is particularly useful for iden- 2003), which may reveal higher genetic diversity within tification of elite strains, with application in maintaining Bradyrhizobium (Doignon-Bourcier et al., 2000; Willems quality control of both culture collections and commercial et al., 2001b, 2003; van Berkum & Eardly, 2002; Stepkowski inoculants. However, the current definition of a novel et al., 2005; Germano et al., 2006) – is supported in our species as well as its classification is based on a polyphasic study by our analysis of the ITS region (Fig. 1b). Willems classification, taking into account phenotypic as well as et al. (2003), using ITS sequencing and DNA–DNA genetic characteristics (Vandamme et al., 1996), with the hybridization, observed a strong correlation between the sequence of the 16S rRNA gene providing the backbone of results obtained with the two methods, such that strains the classification (Willems & Collins, 1993; Yanagi & with more than 95.5 % ITS sequence similarity belonged to http://ijs.sgmjournals.org 2945 P. Menna, F. G. Barcellos and M. Hungria

Fig. 5. Evolutionary tree inferred using the neighbour-joining method for 47 strains based on concatenated sequences of the atpD, dnaK, glnII and recA genes. See legends to Figs 1 and 3 for further details.

the same genospecies, showing more than 60 % DNA– our study, the use of the ITS sequence in association with DNA hybridization. Indeed, based on the results of the 16S rRNA gene sequence undoubtedly improved Willems et al. (2003), we have being able to concatenate phylogenetic definition (Fig. 2). the 16S rRNA gene and ITS sequences for the Bradyrhizobium strains used in this study. However, that It has been proposed that sequences of at least four may not be possible for other rhizobial species, where the housekeeping genes should be used for phylogenetic rates of evolution of the two genes might be different and analysis and taxonomic classification of bradyrhizobia different copies of the ITS are also often observed. Finally, (Stepkowski et al., 2003, 2005; Vinuesa et al., 2005a). based on the proposal of Willems et al. (2003) of a cut-off This MLSA approach combines congruent genomic data, at 95.5 % similarity, some clusters observed in our study excluding partitions with a significant level of incongru- with high bootstrap support in the ITS analysis should ence, providing reliable genotypic characterization (Bull represent novel species, particularly SEMIA strains 6163, et al., 1993; Miyamoto & Fitch, 1995). Among the 6014, 6187, 656, 6164, 511, 6179, 6434 and 6158 and the housekeeping genes used in MLSA for phylogenetic strains in subgroups 1, 2, 4, 5, 6, 8 and 12 of large group I reconstructions of the order Rhizobiales are atpD, dnaK, and in subgroups 2–7 of large group II (Fig. 1b). In glnII, gltA, glnA, recA, rpoB and thrC (Turner & Young, conclusion, although controversy remains over the use of 2000; Gaunt et al., 2001; Weir et al., 2004; Stepkowski et al., the ITS to resolve evolutionary relationships properly 2005; Vinuesa et al., 2005a; Martens et al., 2007; Ribeiro among strains of Bradyrhizobium (Vinuesa et al., 2005b), in et al., 2009), and the approach has already been used in

2946 International Journal of Systematic and Evolutionary Microbiology 59 MLSA of Bradyrhizobium strains

Fig. 6. Evolutionary tree inferred using the neighbour-joining method for 47 strains based on concatenated sequences of the dnaK, glnII and recA genes. See legends to Figs 1 and 3 for further details.

studies with the genus Bradyrhizobium (Stepkowski et al., subjected to a PCR with primers specific for the atpD 2003, 2005; Parker, 2004). One important example is the gene (Table 3). These strains were isolated in Brazil, USA description of B. canariense, based on the phylogeny of and Thailand, i.e. they show a broad geographical atpD, glnII, recA and the ITS (Vinuesa et al., 2005a). distribution. In other studies with rhizobia, the use of Likewise, the application of MLSA in our study clearly atpD for phylogenetic inference and taxonomic classifica- contributed to a better-defined phylogeny, as well as to the tion has proven to be highly correlated with the phylogeny identification of new subgroups highly indicative of novel based on the 16S rRNA gene (Gaunt et al., 2001; species. One group that should be emphasized in our study Stepkowski et al., 2005; Vinuesa et al., 2005a; Wang et al., is that composed of B. japonicum USDA 110 and SEMIA 2007; Santillana et al., 2008), and the differences seen in strains 5080 and 6059, isolated from soybean, which were this study have not been detected before. For the atpD clustered in all six trees in a different group from that of B. gene, insertions have been reported of 15 bp in japonicum USDA 6T, clearly indicating the existence of a Azorhizobium caulinodans and Brevundimonas bullata and novel species. Complementary studies are now in progress of 12 bp in B. japonicum, providing support for the in our laboratory to describe this novel species. monophyly of these three species (Gaunt et al., 2001). However, in this study, the high genetic heterogeneity of This study also identified sequences that are related to atpD could have resulted from genetic recombination of transposases when the DNA of SEMIA strains 5011, 5019, this gene. Genetic information from such genes can be 587, 5027 and 5026, all symbionts of soybean, was useful to determine the genetic nature of microbial species http://ijs.sgmjournals.org 2947 P. Menna, F. G. Barcellos and M. Hungria

(Achtman & Wagner, 2008). Therefore, we suggest more Barrera, L. L., Trujillo, M. E., Goodfellow, M., Garcia, F. J., Hernandez- studies with atpD, and recommend that the gene should be Lucas, I., Davila, G., van Berkum, P. & Martinez-Romero, E. (1997). used with caution in studies of phylogeny and taxonomy of Biodiversity of bradyrhizobia nodulating Lupinus spp. Int J Syst Bacteriol 47, 1086–1091. bacteria belonging to the genus Bradyrhizobium. Batista, J. S. S., Hungria, M., Barcellos, F. G., Ferreira, M. C. & An important consideration is that, in general, all subgroups Mendes, I. C. (2007). Variability in Bradyrhizobium japonicum and B. formed in the trees built with the housekeeping genes atpD, elkanii seven years after introduction of both the exotic microsymbiont dnaK, glnII and recA, as well as with the ITS, were similar to and the soybean host in a Cerrados soil. Microb Ecol 53, 270–284. those obtained with the 16S rRNA gene, confirming the Brett, P. J., Deshazer, D. & Woods, D. E. (1998). Burkholderia usefulness of these genes for phylogenetic reconstruction of thailandensis sp. nov., a Burkholderia pseudomallei-like species. Int J the genus Bradyrhizobium. In our study, geographical Syst Bacteriol 48, 317–320. origin did not affect the patterns of housekeeping genes, Bull, J. J., Huelsenbeck, J. P., Cunningham, C. W., Swofford, D. L. & thus reinforcing the belief of a common origin for Waddell, P. J. (1993). Partitioning and combining data in phylogen- Bradyrhizobium with subsequent diffusion of the strains by etic analyses. Syst Biol 42, 384–397. soil-contaminated seeds (Pe´rez-Ramı´rez et al., 1998) or by Coenye, T., Gevers, D., Van de Peer, Y., Vandamme, P. & Swings, J. artificial inoculation (Strijdom, 1998). (2005). Towards a prokaryotic genomic taxonomy. FEMS Microbiol Rev 29, 147–167. In conclusion, concatenation of housekeeping gene Cooper, J. E. & Feil, E. J. (2004). Multilocus sequence typing – what is sequences has been suggested as a powerful method to resolved? Trends Microbiol 12, 373–377. improve phylogenetic analysis of Bradyrhizobium Doignon-Bourcier, F., Willems, A., Coopman, R., Laguerre, G., Gillis, M. (Stepkowski et al., 2005; Vinuesa et al., 2005a; Martens & de Lajudie, P. (2000). Genotypic characterization of Bradyrhizobium et al., 2007) and, indeed, in our study, the tree built with the strains nodulating small Senegalese legumes by 16S–23S rRNA inter- concatenated atpD, dnaK, recA and glnII gene sequences, as fgenic gene spacers and amplified length polymorphism fingerprint well as the tree built with concatenated 16S rRNA gene and analyses. Appl Environ Microbiol 66, 3987–3997. ITS sequences, detected high intra- and interspecies genetic Dupuy, N. C. & Dreyfus, B. L. (1992). Bradyrhizobium populations variation. Therefore, although the use of a small number of occur in deep soil under the leguminous tree Acacia albida. Appl housekeeping genes cannot replace DNA–DNA hybridiza- Environ Microbiol 58, 2415–2419. tion in species delineation at present, MLSA has proven to Ewing, B. & Green, P. (1998). Base-calling of automated sequencer be a reliable technique that is applicable to phylogeny and traces using phred. II. Error probabilities. Genome Res 8, 186–194. taxonomic studies of Bradyrhizobium, improving the Ewing, B., Hillier, L., Wendl, M. C. & Green, P. (1998). Base-calling of definition of novel species. Finally, the analysis of four automated sequencer traces using phred. I. Accuracy assessment. housekeeping genes in addition to the 16S rRNA gene and Genome Res 8, 175–185. ITS has clearly indicated that there are novel species of Felsenstein, J. (1985). Confidence limits on phylogenies: an approach Bradyrhizobium still to be described. using the bootstrap. Evolution 39, 783–791. Garrity, G. M. & Holt, J. G. (2001). The road map to the Manual.In Bergey’s Manual of Systematic Bacteriology, 2nd edn, vol. 1, pp. 119– ACKNOWLEDGEMENTS 166. Edited by D. R. Boone, R. W. Castenholz & G. M. Garrity. New York: Springer. The work was partially supported by CNPq (Conselho Nacional de Gaunt, M. W., Turner, S. L., Rigottier-Gois, L., Lloyd-Macgilp, S. A. & Desenvolvimento Cientı´fico e Tecnolo´gico, Brazil), projects 552393/ Young, J. P. (2001). Phylogenies of atpD and recA support the small 2005-3 and 577933/2008-6. The authors thank Professor Fabiano L. subunit rRNA-based classification of rhizobia. Int J Syst Evol Microbiol Thompson and Professor Manuel Megı´as for extremely useful 51, 2037–2048. suggestions and discussion. The authors also thank Ligia Maria Germano, M. G., Menna, P., Mostasso, F. L. & Hungria, M. (2006). Oliveira Chueire (Embrapa Soja) for help in several steps of this work and Dr Manuel Megias for helpful discussion. P. M. has received a RFLP analysis of the rRNA operon of a Brazilian collection of fellowship from CNPq (project 505946/2004-1) and F. G. B. a bradyrhizobial strains from 33 legume species. Int J Syst Evol fellowship from CAPES. M. H. is also a research fellow of CNPq Microbiol 56, 217–229. (300698/2007-0). Giongo, A., Ambrosini, A., Vargas, L. K., Freire, J. R. J., Bodanese- Zanettini, M. H. & Passaglia, L. M. P. (2008). Evaluation of genetic diversity of bradyrhizobia strains nodulating soybean [Glycine max REFERENCES (L.) Merrill] isolated from South Brazilian fields. Appl Soil Ecol 38, 261–269. Abaidoo, R. C., Keyser, H. H., Singleton, P. W. & Borthakur, D. Godoy, D., Randle, G., Simpson, A. J., Aanensen, D. M., Pitt, T. L., (2000). Bradyrhizobium spp. (TGx) isolates nodulating the new Kinoshita, R. & Spratt, B. G. (2003). Multilocus sequence typing and soybean cultivars in Africa are diverse and distinct from bradyrhi- evolutionary relationships among the causative agents of melioidosis zobia that nodulate North American soybeans. Int J Syst Evol and glanders, Burkholderia pseudomallei and Burkholderia mallei. J Microbiol 50, 225–234. Clin Microbiol 41, 2068–2079. Achtman, M. & Wagner, M. (2008). Microbial diversity and the genetic Gordon, D., Abajian, C. & Green, P. (1998). Consed: a graphical tool nature of microbial species. Nat Rev Microbiol 6, 431–440. for sequence finishing. Genome Res 8, 195–202. Alberton, O., Kaschuk, G. & Hungria, M. (2006). Sampling effects on Grange, L. & Hungria, M. (2004). Genetic diversity of indigenous the assessment of genetic diversity of rhizobia associated with soybean common bean (Phaseolus vulgaris) rhizobia in two Brazilian and common bean. Soil Biol Biochem 38, 1298–1307. ecosystems. Soil Biol Biochem 36, 1389–1398.

2948 International Journal of Systematic and Evolutionary Microbiology 59 MLSA of Bradyrhizobium strains

Hedges, S. B. (1992). The number of replications needed for accurate Menna, P., Pereira, A. A., Bangel, E. V. & Hungria, M. (2009). rep-PCR estimation of the bootstrap p-value in phylogenetic studies. Mol Biol of tropical rhizobia for strain fingerprinting, biodiversity appraisal Evol 9, 366–369. and as a taxonomic and phylogenetic tool. Symbiosis 48, 120–130. Hungria, M., Chueire, L. M. O., Megıás, M., Lamrabet, Y., Probanza, A., Miyamoto, M. M. & Fitch, W. M. (1995). Testing species phylogenies Guttierrez-Man˜ ero, F. J. & Campo, R. J. (2006). Genetic diversity of and phylogenetic methods with congruence. Syst Biol 44, 64–76. indigenous tropical fast-growing rhizobia isolated from soybean Mostasso, L., Mostasso, F. L., Dias, B. G., Vargas, M. A. T. & Hungria, M. nodules. Plant Soil 288, 343–356. (2002). Selection of bean (Phaseolus vulgaris L.) rhizobial strains for the Jaccard, P. (1912). The distribution of the flora in the alpine zone. Brazilian Cerrados. Field Crops Res 73, 121–132. New Phytol 11, 37–50. Moulin, L., Be´ na, G., Boivin-Masson, C. & Stepkowski, T. (2004). Jordan, D. C. (1982). Transfer of Rhizobium japonicum Buchan 1980 Phylogenetic analysis of symbiotic nodulation genes support vertical to Bradyrhizobium gen. nov., a genus of slow-growing root nodule and lateral gene co-transfer within the Bradyrhizobium genus. Mol bacteria from leguminous plants. Int J Syst Bacteriol 32, 136–139. Phylogenet Evol 30, 720–732. Kaschuk, G., Hungria, M., Andrade, D. S. & Campo, R. J. (2006a). Olsen, G. J. & Woese, C. R. (1993). Ribosomal RNA: a key to Genetic diversity of rhizobia associated with common bean (Phaseolus phylogeny. FASEB J 7, 113–123. vulgaris L.) grown under no-tillage and conventional systems in Parker, M. A. (2004). rRNA and dnaK relationships of Bradyrhizobium Southern Brazil. Appl Soil Ecol 32, 210–220. sp. nodule bacteria from four Papilionoid legume trees in Costa Rica. Kaschuk, G., Hungria, M., Santos, J. C. P. & Berton-Junior, J. F. Syst Appl Microbiol 27, 334–342. (2006b). Differences in common bean rhizobial populations asso- Parker, M. A. & Lunk, A. (2000). Relationships of bradyrhizobia from ciated with soil tillage management in southern Brazil. Soil Tillage Res Platypodium and Machaerium (Papilionoideae: tribe Dalbergieae) on 87, 205–217. Barro Colorado Island, Panama. Int J Syst Evol Microbiol 50, 1179–1186. Kimura, M. (1980). A simple method for estimating evolutionary rates Pe´ rez-Ramı´rez, N. O., Rogel, M. A., Wang, E., Castellanos, J. Z. & of base substitutions through comparative studies of nucleotide Martıńez-Romero, E. (1998). Seeds of Phaseolus vulgaris bean carry sequences. J Mol Evol 16, 111–120. Rhizobium etli. FEMS Microbiol Ecol 26, 289–296. Koeuth, T., Versalovic, J. & Lupski, J. R. (1995). Differential Pinto, F. G. S., Hungria, M. & Mercante, F. M. (2007). Polyphasic subsequence conservation of interspersed repetitive Streptococcus characterization of Brazilian Rhizobium tropici strains effective in pneumoniae BOX elements in diverse bacteria. Genome Res 5, 408– fixing N2 with common bean (Phaseolus vulgaris L.). Soil Biol Biochem 418. 39, 1851–1864. Konstantinidis, K. T. & Tiedje, J. M. (2004). Trends between gene Qian, J., Kwon, S. W. & Parker, M. A. (2003). rRNA and nifD content and genome size in prokaryotic species with larger genomes. phylogeny of Bradyrhizobium from sites across the Pacific Basin. Proc Natl Acad Sci U S A 101, 3160–3165. FEMS Microbiol Lett 219, 159–165. Kuykendall,L.D.,Saxena,B.,Devine,T.E.&Udell,S.E.(1992).Genetic Ramı´rez-Bahena, M.-H., Peix, A., Rivas, P., Camacho, M., Rodrı´guez- diversity in Bradyrhizobium japonicum Jordan 1982 and a proposal for Navarro, D. N., Mateos, P. F., Martıńez-Molina, E., Willems, A. & Bradyrhizobium elkanii sp. nov. Can J Microbiol 38, 501–505. Vela´ zquez, E. (2009). Bradyrhizobium pachyrhizi sp. nov. and Laguerre, G., Mavingui, P., Allard, M. R., Charnay, M. P., Louvrier, P., Bradyrhizobium jicamae sp. nov., isolated from effective nodules of Mazurier, S. I., Rigottier-Gois, L. & Amarger, N. (1996). Typing of Pachyrhizus erosus. Int J Syst Evol Microbiol 59, 1929–1934. rhizobia by PCR DNA fingerprinting and PCR-restriction fragment Ribeiro, R. A., Barcellos, F. G., Thompson, F. L. & Hungria, M. (2009). length polymorphism analysis of chromosomal and symbiotic gene Multilocus sequence analysis of Brazilian Rhizobium microsymbionts regions: application to Rhizobium leguminosarum and its different of common bean (Phaseolus vulgaris L.) reveals unexpected biovars. Appl Environ Microbiol 62, 2029–2036. taxonomic diversity. Res Microbiol 160, 297–306. Liu, J., Wang, E. T. & Chen, W. X. (2005). Diverse rhizobia associated Rivas, R., Willems, A., Palomo, J. L., Garcıá-Benavides, P., Mateos, P. F., with woody legumes Wisteria sinensis, Cercis racemosa and Amorpha Martıńez-Molina, E., Gillis, M. & Vela´zquez, E. (2004). Bradyrhizobium fruticosa grown in the temperate zone of China. Syst Appl Microbiol betae sp. nov., isolated from roots of Beta vulgaris affected by tumour- 28, 465–477. like deformations. Int J Syst Evol Microbiol 54, 1271–1275. Loureiro, M. F., Kaschuk, G., Alberton, O. & Hungria, M. (2007). Rodrı´guez-Navarro, D. N., Camacho, M., Leidi, E. O., Rivas, R. & Soybean [Glycine max (L.) Merrill] rhizobial diversity in Brazilian Vela´ zquez, E. (2004). Phenotypic and genotypic characterization of oxisols under various soil, cropping and inoculation managements. rhizobia from diverse geographical origin that nodulate Pachyrhizus Biol Fertil Soils 43, 665–674. species. Syst Appl Microbiol 27, 737–745. Ludwig, W. & Schleifer, K. H. (1994). Bacterial phylogeny based on 16S Saito, A., Mitsui, H., Hattori, R., Minamisawa, K. & Hattori, T. (1998). and 23S rRNA sequence analysis. FEMS Microbiol Rev 15, 155–173. Slow-growing and oligotrophic soil bacteria phylogenetically close to Maiden, M. C. J., Bygraves, J. A., Feil, E., Morelli, G., Russell, J. E., Bradyrhizobium japonicum. FEMS Microbiol Ecol 25, 277–286. Urwin, R., Zhang, Q., Zhou, J., Zurth, K. & other authors (1998). Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new Multilocus sequence typing: a portable approach to the identification method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406–425. of clones within populations of pathogenic microorganisms. Proc Natl Saldan˜ a, G., Martinez-Alca´ ntara, V., Vinardell, J. M., Bellogıń, R., Acad Sci U S A 95, 3140–3145. Ruı´z-Sainz, J. E. & Balatti, P. A. (2003). Genetic diversity of fast- Martens, M., Delaere, M., Coopman, R., De Vos, P., Gillis, M. & growing rhizobia that nodulate soybean (Glycine max L. Merr.). Arch Willems, A. (2007). Multilocus sequence analysis of Ensifer and related Microbiol 180, 45–52. taxa. Int J Syst Evol Microbiol 57, 489–503. Santillana, N., Ramı´rez-Bahena, M. H., Garcıá-Fraile, P., Vela´ zquez, E. Menna, P., Hungria, M., Barcellos, F. G., Bangel, E. V., Hess, P. N. & &Zu´ n˜ iga, D. (2008). Phylogenetic diversity based on rrs, atpD, recA Martinez-Romero, E. (2006). Molecular phylogeny based on the 16S genes and 16S–23S intergenic sequence analyses of rhizobial strains rRNA gene of elite rhizobial strains used in Brazilian commercial isolated from Vicia faba and Pisum sativum in Peru. Arch Microbiol 189, inoculants. Syst Appl Microbiol 29, 315–332. 239–247. http://ijs.sgmjournals.org 2949 P. Menna, F. G. Barcellos and M. Hungria

Sawada, H., Kuykendall, L. D. & Young, J. M. (2003). Changing Fixation: a Model System for Analysis of a Biological Process, pp. 177– concepts in the systematics of bacterial nitrogen-fixing legume 186. Edited by E. W. Triplett. Wymondham, UK: Horizon Scientific. symbionts. J Gen Appl Microbiol 49, 155–179. Wang, F. Q., Wang, E. T., Zhang, Y. F. & Chen, W. X. (2006). Sneath, P. H. A. & Sokal, R. R. (1973). Numerical Taxonomy. San Characterization of rhizobia isolated from Albizia spp. in comparison Francisco: W. H. Freeman. with microsymbionts of Acacia spp. and Leucaena leucocephala grown Sprent, J. I. (2001). Nodulation in Legumes. Kew, UK: Royal Botanic in China. Syst Appl Microbiol 29, 502–517. Gardens. Wang, F. Q., Wang, E. T., Liu, J., Chen, Q., Sui, X. H., Chen, W. F. & Stepkowski, T., Czaplıńska, M., Miedzinska, K. & Moulin, L. (2003). Chen, W. X. (2007). Mesorhizobium albiziae sp. nov., a novel The variable part of the dnaK gene as an alternative marker for bacterium that nodulates Albizia kalkora in a subtropical region of phylogenetic studies of rhizobia and related alpha Proteobacteria. Syst China. Int J Syst Evol Microbiol 57, 1192–1199. Appl Microbiol 26, 483–494. Weir, B. S., Turner, S. J., Silvester, W. B., Park, D. C. & Young, J. M. Stepkowski, T., Moulin, L., Krzyzanska, A., McInnes, A., Law, I. J. & (2004). Unexpectedly diverse Mesorhizobium strains and Rhizobium Howieson, J. (2005). European origin of Bradyrhizobium populations leguminosarum nodulate native legume genera of New Zealand, while infecting lupins and serradella in soils of western Australia and South introduced legume weeds are nodulated by Bradyrhizobium species. Africa. Appl Environ Microbiol 71, 7041–7052. Appl Environ Microbiol 70, 5980–5987. Strijdom, B. W. (1998). South African studies on biological nitrogen- Weisburg, W. G., Barns, S. M., Pelletier, D. A. & Lane, D. J. (1991). 16S fixing systems and the exploitation of the nodule bacterium-legume ribosomal DNA amplification for phylogenetic study. J Bacteriol 173, symbiosis. S Afr J Sci 94, 11–23. 697–703. Tan, Z., Hurek, T., Vinuesa, P., Muller, P., Ladha, J. K. & Reinhold- Willems, A. & Collins, M. D. (1993). Phylogenetic analysis of rhizobia Hurek, B. (2001). Specific detection of Bradyrhizobium and and agrobacteria based on 16S rRNA gene sequences. Int J Syst Rhizobium strains colonizing rice (Oryza sativa) roots by 16S–23S Bacteriol 43, 305–313. ribosomal DNA intergenic spacer-targeted PCR. Appl Environ Willems, A., Coopman, R. & Gillis, M. (2001a). Phylogenetic and Microbiol 67, 3655–3664. DNA–DNA hybridization analyses of Bradyrhizobium species. Int J Trinick, M. J. (1973). Symbiosis between Rhizobium and the non- Syst Evol Microbiol 51, 111–117. legume, Trema aspera. Nature 244, 459–460. Willems, A., Doignon-Bourcier, F., Goris, J., Coopman, R., de Turner, S. L. & Young, J. P. W. (2000). The glutamine synthetase of Lajudie, P., De Vos, P. & Gillis, M. (2001b). DNA–DNA hybridization rhizobia: phylogenetics and evolutionary implications. Mol Biol Evol study of Bradyrhizobium strains. Int J Syst Evol Microbiol 51, 1315– 17, 309–319. 1322. van Berkum, P. & Eardly, B. D. (2002). The aquatic budding Willems, A., Munive, A., de Lajudie, P. & Gillis, M. (2003). In most bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Bradyrhizobium groups sequence comparison of 16S–23S rDNA Aeschynomene indica. Appl Environ Microbiol 68, 1132–1136. internal transcribed spacer regions corroborates DNA–DNA hybridi- van Berkum, P. & Fuhrmann, J. J. (2000). Evolutionary relationships zations. Syst Appl Microbiol 26, 203–210. among the soybean bradyrhizobia reconstructed from 16S rRNA gene Wolde-Meskel, E., Terefework, Z., Lindstro¨ m, K. & Frostegard, A. and internally transcribed spacer region sequence divergence. Int J (2004). Rhizobia nodulating African Acacia spp. and Sesbania sesban Syst Evol Microbiol 50, 2165–2172. trees in southern Ethiopian soils are metabolically and genomically van Berkum, P., Leibold, J. M. & Eardly, B. D. (2006). Proposal for diverse. Soil Biol Biochem 36, 2013–2025. combining Bradyrhizobium spp. (Aeschynomene indica)withBlastobacter Wong, F. Y. K., Stackebrandt, E., Ladha, J. K., Fleischman, D. E., denitrificans and to transfer Blastobacter denitrificans (Hirsh and Muller, Date, R. A. & Fuerst, J. A. (1994). Phylogenetic analysis of 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans Bradyrhizobium japonicum and photosynthetic stem-nodulating (comb. nov.). Syst Appl Microbiol 29, 207–215. bacteria from Aeschynomene species grown in separated geographical Vandamme, P., Pot, B., Gillis, M., de Vos, P., Kersters, K. & Swings, J. regions. Appl Environ Microbiol 60, 940–946. (1996). Polyphasic taxonomy, a consensus approach to bacterial systematics. Microbiol Rev 60, 407–438. Xu, L. M., Ge, C., Cui, Z., Li, J. & Fan, H. (1995). Bradyrhizobium liaoningense sp. nov., isolated from the root nodules of soybeans. Int J Versalovic, J., Schneider, M., de Bruijn, F. J. & Lupski, J. R. (1994). Syst Bacteriol 45, 706–711. Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Methods Mol Cell Biol 5, 25–40. Yanagi, M. & Yamasato, K. (1993). Phylogenetic analysis of the family Rhizobiaceae and related bacteria by sequencing of 16S rRNA gene Vinuesa, P., Leo´ n-Barrios, M., Silva, C., Willems, A., Jarabo-Lorenzo, A., using PCR and DNA sequencer. FEMS Microbiol Lett 107, 115–120. Pe´rez-Galdona, R., Werner, D. & Martıńez-Romero, E. (2005a). Bradyrhizobium canariense sp. nov., an acid-tolerant endosymbiont that Yao, Z. Y., Kan, F. L., Wang, E. T., Wei, G. H. & Chen, W. X. (2002). nodulates endemic genistoid legumes (Papilionoideae: Genisteae) from Characterization of rhizobia that nodulate legume species of the the Canary Islands, along with Bradyrhizobium japonicum bv. genis- genus Lespedeza and description of Bradyrhizobium yuanmingense sp. tearum, Bradyrhizobium genospecies alpha and Bradyrhizobium geno- nov. Int J Syst Evol Microbiol 52, 2219–2230. species beta. Int J Syst Evol Microbiol 55, 569–575. Young, J. P. W. & Haukka, K. E. (1996). Diversity and phylogeny of Vinuesa, P., Silva, C., Werner, D. & Martinez-Romero, E. (2005b). rhizobia. New Phytol 133, 87–94. Population genetics and phylogenetic inference in bacterial molecular Young, J. M., Kuykendall, L. D., Martıńez-Romero, E., Kerr, A. & systematics: the roles of migration and recombination in Sawada, H. (2001). A revision of Rhizobium Frank 1889, with an Bradyrhizobium species cohesion and delineation. Mol Phylogenet emended description of the genus, and the inclusion of all species of Evol 34, 29–54. Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. Wang, E. T. & Martıńez-Romero, E. (2000). Phylogeny of root- and 1998 as new combinations: Rhizobium radiobacter, R. rhizogenes, R. stem-nodule bacteria associated with legumes. In Prokaryotic Nitrogen rubi, R. undicola and R. vitis. Int J Syst Evol Microbiol 51, 89–103.

2950 International Journal of Systematic and Evolutionary Microbiology 59 Supplementary Table S1. Additional information about the strains used in this study

Culture collections: ATCC (American Type Culture Collection, Manassas, VA, USA); BR (Embrapa Agrobiologia, Seropédica, Brazil); CB (CSIRO, Canberra, Australia); CIAT (Centro Internacional de Agricultura Tropical, Cali, Colombia); DF (Distrito Federal, Embrapa Cerrados, Planaltina, Brazil); E (Instituto Nacional de Tecnología Agropecuaria – INTA – Castelar, Argentina); H (Embrapa Cerrados, Planaltina, Brazil); LMG (Laboratorium voor Microbiologie, Universiteit Gent, Gent, Belgium); MAR (Grasslands Rhizobium Collection, Soil Productivity Research Laboratory, Marondera, Zimbabwe; also called SPRL); MGAP (Ministerio de Ganadería, Agricultura y Pesca, Laboratorio de Microbiologia y Suelos, Montevideo, Uruguay) CPAC (Centro de Pesquisa Agropecuária dos Cerrados. Embrapa Cerrados, Planaltina, Brazil); NA (NSW Dept of Primary Industries – Agriculture, Orange, NSW, Australia); NC (University of North Carolina, Raleigh, NC, USA); Nit (Nitragin, Inc., Brookfield, WI, USA); PRF (Paraná Feijão, Embrapa Soja, Londrina, Brazil); QA (University of Queensland, St Lucia, Australia); RCR (Rothamsted Rhizobium Collection, Harpenden, UK); SEMIA (Seção de Microbiologia Agrícola, FEPAGRO, Porto Alegre, Brazil); SMS (Seção de Microbiologia do Solo, IAC, Campinas, Brazil); SU (University of Sydney, Sydney, NSW, Australia); TA (Department of Primary Industries, Water and Environment, Tasmanian State Government Agency, Tasmania, Australia); TAL (Nitrogen Fixation by Tropical Agricultural Legumes Project, University of Hawaii, Paia, HI, USA); UMKL (University of Malaya – Kuala Lumpur, Dept of Genetics and Cellular Biology, Kuala Lumpur, Malaysia); UMR (University of Minnesota Rhizobium Collection, St Paul, MN, USA); USDA (United States Department of Agriculture Collection, Beltsville, MD, USA).

Strain Other designation(s) Host plant Geographical origin USDA 6T ATCC 10324T, CCUG 27876T, CIP 106093T, DSM Glycine max USA 30131T, HAMBI 2314T, NBRC 14783T, JCM 20679T, LMG 6138T, NRRL B-4507T, NRRL L-241T, VKM B- 1967T USDA 76T ATCC 49852T, DSM 11554T, NBRC 14791T, LMG Glycine max USA 6134T USDA 3622T ATCC 700350T, CIP 104858T, SFI 2281T Glycine max China SEMIA 501 Original SEMIA Glycine max Brazil SEMIA 509 UW 509, USDA 487 Glycine max USA SEMIA 510 SEMIA 516, SEMIA 5033, UW 510 (USDA 510) Glycine max USA SEMIA 511 UW 511, USDA 500 Glycine max USA SEMIA 512 3I1b73 (USDA- Dr Erdman) Glycine max USA SEMIA 513 3I1b6 (USDA- Dr Erdman Not known USA SEMIA 515 Original SEMIA Glycine max Brazil SEMIA 516 SEMIA 510, SEMIA 5033, UW 510 (USDA Univ. Glycine max USA Wisconsin) SEMIA 518 UW 518, USDA 10, Nit 3I1b10 Glycine max USA SEMIA 527 Original SEMIA Glycine max Brazil SEMIA 528 Original SEMIA Glycine max Brazil SEMIA 538 Not known Glycine max USA SEMIA 542 R 1 Glycine max Brazil SEMIA 543 R 2 Glycine max Brazil SEMIA 549 Not known Glycine max USA SEMIA 556 Original SEMIA Glycine max Brazil SEMIA 560 No synonyms Glycine max Brazil SEMIA 565 No synonyms Glycine max Brazil SEMIA 566 BR 40 Glycine max USA SEMIA 567 No synonyms Glycine max USA SEMIA 568 No synonyms Glycine max USA SEMIA 571 No synonyms Glycine max USA SEMIA 574 Original SEMIA Glycine max Brazil SEMIA 576 Original SEMIA Glycine max Brazil SEMIA 577 Original SEMIA Glycine max Brazil SEMIA 579 Original SEMIA Glycine max Brazi Menna, P., Barcellos, F. G. & Hungria, M. (2009). Phylogeny and taxonomy of a diverse collection of Bradyrhizobium strains based on multilocus sequence analysis of the 16S rRNA gene, ITS region and glnII, recA, atpD and dnaK genes. Int J Syst Evol Microbiol 59, 2934–2950. Strain Other designation(s) Host plant Geographical origin SEMIA 580 Original SEMIA Glycine max Brazil SEMIA 581 Original SEMIA Glycine max Brazil SEMIA 583 CB 1786 Glycine max Thailand SEMIA 584 CB 1795, BR 46 Glycine max USA SEMIA 587 BR 96 Glycine max Brazil SEMIA 589 SM1c Glycine max Brazil SEMIA 590 RT-2a Glycine max Brazil SEMIA 591 A Ia Glycine max Brazil SEMIA 593 R-15a Glycine max Brazil SEMIA 598 R-5a Glycine max Brazil SEMIA 613 3I6n (USDA Dr Erdman) Vigna unguiculata USA SEMIA 621 UW 621, USDA 610 Lespedeza striata USA SEMIA 635 C 57 Vigna unguiculata Brazil SEMIA 637 Original SEMIA Acacia mearnsii Brazil SEMIA 656 Original SEMIA Neonotonia wightii Brazil SEMIA 662 CB 188 Vigna unguiculata Australia SEMIA 695 E 85, QA 922, SU 422, NA 630 Neonotonia wightii Australia SEMIA 696 CB 627 Desmodium uncinatum Australia SEMIA 839 NZP 2021, CC8 29, TAL 925 Lotus pedunculatus USA SEMIA 905 Original SEMIA Ornithopus sativus Not known SEMIA 928 W-72 Lupinus sp. Not known SEMIA 929 Original SEMIA Ornithopus sativus Not known SEMIA 938 No synonyms Lupinus albus USA SEMIA 5000 Original SEMIA Glycine max Brazil SEMIA 5002 Original SEMIA Glycine max Brazil SEMIA 5003 Original SEMIA Glycine max Brazil SEMIA 5005 Original SEMIA Glycine max Brazil SEMIA 5010 Original SEMIA Glycine max Brazil SEMIA 5011 Original SEMIA Glycine max Brazil SEMIA 5012 No synonyms Glycine max Brazil SEMIA 5013 Original SEMIA Glycine max Brazil SEMIA 5014 Original SEMIA Glycine max Brazil SEMIA 5015 Original SEMIA Glycine max Brazil SEMIA 5016 Original SEMIA Glycine max Brazil SEMIA 5018 Original SEMIA Glycine max Brazil SEMIA 5019 29W, BR 29 Glycine max Brazil SEMIA 5020 Original SEMIA Glycine max Brasil SEMIA 5021 Original SEMIA Glycine max Brazil SEMIA 5022 TAL 205 Glycine max Thailand SEMIA 5023 TAL 211, THA 136 Glycine max Thailand SEMIA 5024 TAL 378, CC 709 Glycine max Not known SEMIA 5025 TAL 411, Tha3 Glycine max Tailândia SEMIA 5026 TAL 415, THA 9 Glycine max Thailand SEMIA 5027 TAL 183, 61a76 Glycine max USA SEMIA 5028 TAL 377, USDA 138 Glycine max USA SEMIA 5029 TAL 103 Glycine max USA SEMIA 5030 TAL 216, THA 106 Glycine max Thailand SEMIA 5032 TAL 102, USDA 110, TISTR 339 Glycine max USA SEMIA 5034 USDA 10, 3I1b10 Glycine max USA SEMIA 5036 No synonyms Glycine max Not known SEMIA 5037 Original SEMIA Glycine max Brazil SEMIA 5038 No synonyms Glycine max Not known SEMIA 5039 532c, G3 Glycine max Brazil SEMIA 5042 S 89, 535Re Glycine max Brazil SEMIA 5043 Original SEMIA Glycine max Brazil

Menna, P., Barcellos, F. G. & Hungria, M. (2009). Phylogeny and taxonomy of a diverse collection of Bradyrhizobium strains based on multilocus sequence analysis of the 16S rRNA gene, ITS region and glnII, recA, atpD and dnaK genes. Int J Syst Evol Microbiol 59, 2934–2950. Strain Other designation(s) Host plant Geographical origin SEMIA 5044 8-O Glycine max USA SEMIA 5045 Nit 123P35 Glycine max Not known SEMIA 5046 123P44 Glycine max USA SEMIA 5048 Nit 123P67 Glycine max USA SEMIA 5051 USDA 73, 3Iib73 Glycine max USA SEMIA 5052 USDA 6, ATCC 10324, RCR 3435 Glycine max Not known SEMIA 5055 532Re Glycine max Brazil SEMIA 5056 USDA 6, 3I1B6, ATCC 10324, RCR 3425 Glycine max Not known SEMIA 5057 USDA 59 Glycine max USA SEMIA 5058 Original SEMIA Glycine max Brazil SEMIA 5059 USDA 143, 3I1B143, ACCC 15039 Glycine max Indonesia SEMIA 5060 J 507 Glycine max Japan SEMIA 5061 INPA 037, AR2A Glycine max Argentina SEMIA 5062 SVJ-04 Glycine max Brazil SEMIA 5063 U 284 Glycine max Uruguay SEMIA 5064 U 287 Glycine max Uruguay SEMIA 5065 U 391 Glycine max Uruguay SEMIA 5066 IRJ2 133b Glycine max Nigeria SEMIA 5067 IRJ2 177a Glycine max Nigeria SEMIA 5068 IRC 2180a Glycine max Nigeria SEMIA 5069 CPAC BW Glycine max Brazil SEMIA 5070 CPAC 74K Glycine max Brazil SEMIA 5071 Original SEMIA Glycine max Brazil SEMIA 5072 NC 1005 Glycine max USA SEMIA 5073 NC 1005, Ery SPCA.1 Glycine max USA SEMIA 5074 USDA 123, Ery STRA.1 Glycine max USA SEMIA 5075 HAMBI 1135, ATCC 1032 Glycine max Finland SEMIA 5079 CPAC 15, DF 24 Glycine max Brazil SEMIA 5080 CPAC 7 Glycine max Brazil SEMIA 5081 S 372 Glycine max Brazil SEMIA 5082 CPAC 42 Glycine max Brazil SEMIA 5083 Original SEMIA Glycine max Brazil SEMIA 5084 CPAC 45 Glycine max Brazil SEMIA 5085 E 109 Glycine max Argentina SEMIA 5086 USDA 31 Glycine max USA SEMIA 5087 USDA 76 Glycine max USA SEMIA 5090 USDA 122 Glycine max USA SEMIA 6002 CB 756, TAL 309, RCR 3824 Vigna unguiculata Zimbabwe SEMIA 6014 CIAT 1316, USM 128, TAL 405 Stylosanthes guianensis Peru SEMIA 6028 TAL 569, SPRL 472, MAR 472 Desmodium uncinatum Zimbabwe SEMIA 6053 TAL 827, UMKI 28 Clitoria ternatea Malaysia SEMIA 6056 TAL 1371, SMS 128 Arachis hypogaea Not known SEMIA 6057 Not known Psophocarpus tetragonolobus Not known SEMIA 6059 USDA 3309 Psophocarpus tetragonolobus USA SEMIA 6069 DF 10 Leucaena leucocephala Brazil SEMIA 6071 SMS 55 Stylosanthes sp. Brazil SEMIA 6077 CB 82 Stylosanthes sp. Australia SEMIA 6093 USDA 3331 Aeschynomene americana USA SEMIA 6099 BR 5004, LMG 9989 Dimorphandra exaltata Brazil SEMIA 6100 BR5 608 Albizia falcataria Brazil SEMIA 6101 BR 8404 Dalbergia nigra Brazil SEMIA 6118 CIAT308 Stylosanthes sp. Colombia SEMIA 6144 SMS 400, USDA 3187, MAR 11 Arachis hypogaea Zimbabwe SEMIA 6145 BR 2001 Crotalaria juncea Brazil SEMIA 6146 BR 1808 Centrosema sp. Brazil

Taxonomy of host species is based on ILDIS Legumes of the World (http://www.ildis.org/LegumeWeb/6.00/).

Host species Subfamily Tribe Acacia auriculiformis Mimosoideae Acacieae Acacia mangium Mimosoideae Acacieae Acacia mearnsii Mimosoideae Acacieae Acacia miersii Mimosoideae Acacieae Acacia podalyriaefolia Mimosoideae Acacieae Acosmium nitens Papilionoideae Sophoreae Aeschynomene americana Papilionoideae Aeschynomeneae Albizia falcataria Mimosoideae Ingeae Albizia lebbek Mimosoideae Ingeae Arachis hypogaea Papilionoideae Aeschynomeneae Arachis pintoi Papilionoideae Aeschynomeneae Arachis sp. Papilionoideae Aeschynomeneae Cajanus cajans Papilionoideae Phaseoleae Calopogonium sp. Papilionoideae Phaseoleae Centrosema plumieri Papilionoideae Phaseoleae Centrosema pubescens Papilionoideae Phaseoleae Centrosema sp. Papilionoideae Phaseoleae Clitoria ternatea Papilionoideae Phaseoleae Crotalaria juncea Papilionoideae Crotalarieae Crotalaria spectabilis Papilionoideae Crotalarieae Dalbergia nigra Papilionoideae Dalbergieae Desmodium ovalifolium Papilionoideae Dalbergieae Desmodium uncinatum Papilionoideae Dalbergieae Dimorphandra exaltata Caesalpinioideae Caesalpinieae Erythrina poeppigeana Papilionoideae Phaseoleae Galactia striata Papilionoideae Phaseoleae Glycine max Papilionoideae Phaseoleae Inga sp. Mimosoideae Ingeae Lespedeza striata Papilionoideae Desmodieae Leucaena leucocephala Mimosoideae Mimoseae Lotus pedunculatus Papilionoideae Loteae Lupinus albus Papilionoideae Cytiseae Lupinus sp. Papilionoideae Cytiseae Melanoxylum brauna Caesalpinioideae Caesalpinieae Mimosa acutistipula Mimosoideae Mimoseae Neonotonia wightii Papilionoideae Phaseoleae Ornithopus sativus Papilionoideae Loteae Psophocarpus tetragonolobus Papilionoideae Phaseoleae Pueraria phaseoloides Papilionoideae Phaseoleae Stylosanthes guianensis Papilionoideae Aeschynomeneae Stylosanthes sp. Papilionoideae Aeschynomeneae Tipuana tipa Papilionoideae Dalbergieae Vigna unguiculata Papilionoideae Phaseoleae

Strain 16S rRNA gene ITS atpD dnaK glnII recA SEMIA 510 FJ390928 FJ391125 SEMIA 511 FJ390901 FJ391081 FJ390942 FJ390982 FJ391022 FJ391142 SEMIA 512 FJ390914 FJ391084 FJ390943 FJ390983 FJ391023 FJ391143 SEMIA 560 FJ390916 FJ391077 FJ390944 FJ390984 FJ391024 FJ391144 SEMIA 580 FJ390918 FJ391103 SEMIA 587 AF234890* FJ391095 FJ390945 FJ390985 FJ391025 FJ391145 SEMIA 613 FJ390939 FJ391114 SEMIA 621 FJ390908 FJ391130 SEMIA 637 FJ390899 FJ391118 SEMIA 656 AY904732† FJ391075 FJ390946 FJ390986 FJ391026 FJ391146 SEMIA 695 AY904735† FJ391090 FJ390947 FJ390987 FJ391027 FJ391147 SEMIA 839 FJ390898 FJ391113 SEMIA 928 FJ390904 FJ391078 FJ390948 FJ390988 FJ391028 FJ391148 SEMIA 929 FJ390938 FJ391116 SEMIA 5002 FJ390895 FJ391136 SEMIA 5003 FJ390906 FJ391112 SEMIA 5011 FJ390893 FJ391093 FJ390949 FJ390989 FJ391029 FJ391149 SEMIA 5019 AF237422* FJ391098 FJ390950 FJ390990 FJ391030 FJ391150 SEMIA 5020 FJ390929 FJ391119 SEMIA 5021 FJ390905 FJ391120 SEMIA 5022 FJ390920 FJ391108 SEMIA 5025 FJ390935 FJ391082 FJ390951 FJ390991 FJ391031 FJ391151 SEMIA 5026 FJ390894 FJ391092 FJ390952 FJ390992 FJ391032 FJ391152 SEMIA 5027 FJ390896 FJ391099 FJ390953 FJ390993 FJ391033 FJ391153 SEMIA 5029 FJ390915 FJ391104 SEMIA 5034 FJ390940 FJ391141 SEMIA 5036 FJ390927 FJ391121 SEMIA 5043 FJ390930 FJ391123 SEMIA 5045 FJ390924 FJ391079 FJ390954 FJ390994 FJ391034 FJ391154 SEMIA 5046 FJ390926 FJ391109 SEMIA 5048 FJ390922 FJ391111 SEMIA 5056 FJ390913 FJ391107 SEMIA 5060 FJ390921 FJ391122 SEMIA 5062 FJ390900 FJ391080 FJ390955 FJ390995 FJ391035 FJ391155 SEMIA 5064 FJ390925 FJ391110 SEMIA 5066 FJ390897 FJ391139 SEMIA 5068 FJ390917 FJ391105 SEMIA 5079 AF234888* FJ391085 FJ390956 FJ390996 FJ391036 FJ391156 SEMIA 5080 AF234889* FJ391069 FJ390957 FJ390997 FJ391037 FJ391157 SEMIA 5083 FJ390911 FJ391124 SEMIA 5085 FJ390919 FJ391102 SEMIA 6014 FJ390912 FJ391070 FJ390958 FJ390998 FJ391038 FJ391158 SEMIA 6028 AY904744† FJ391062 FJ390959 FJ390999 FJ391039 FJ391159 SEMIA 6053 AY904745† FJ391101 FJ390960 FJ391000 FJ391040 FJ391160 SEMIA 6056 FJ390902 FJ391126 SEMIA 6059 FJ390931 FJ391068 FJ390961 FJ391001 FJ391041 FJ391161 SEMIA 6069 AY904746† FJ391089 FJ390962 FJ391002 FJ391042 FJ391162

Menna, P., Barcellos, F. G. & Hungria, M. (2009). Phylogeny and taxonomy of a diverse collection of Bradyrhizobium strains based on multilocus sequence analysis of the 16S rRNA gene, ITS region and glnII, recA, atpD and dnaK genes. Int J Syst Evol Microbiol 59, 2934–2950. Strain 16S rRNA gene ITS atpD dnaK glnII recA SEMIA 6077 FJ390936 FJ391076 FJ390963 FJ391003 FJ391043 FJ391163 SEMIA 6093 FJ390909 FJ391086 FJ390964 FJ391004 FJ391044 FJ391164 SEMIA 6099 FJ390941 FJ391091 FJ390965 FJ391005 FJ391045 FJ391165 SEMIA 6101 AY904749† FJ391087 FJ390966 FJ391006 FJ391046 FJ391166 SEMIA 6118 FJ390907 FJ391137 SEMIA 6144 AY904750† FJ391115 SEMIA 6145 AY904751† FJ391135 SEMIA 6146 AY904752† FJ391096 FJ390967 FJ391007 FJ391047 FJ391167 SEMIA 6148 AY904753† FJ391100 FJ390968 FJ391008 FJ391048 FJ391168 SEMIA 6150 AY904755† FJ391133 SEMIA 6152 AY904756† FJ391088 FJ390969 FJ391009 FJ391049 FJ391169 SEMIA 6155 AY904757† FJ391106 SEMIA 6156 AY904758† FJ391071 FJ390970 FJ391010 FJ391050 FJ391170 SEMIA 6157 AY904759† FJ391131 SEMIA 6158 AY904760† FJ391138 SEMIA 6160 AY904762† FJ391097 FJ390971 FJ391011 FJ391051 FJ391171 SEMIA 6163 AY904764† FJ391063 FJ390972 FJ391012 FJ391052 FJ391172 SEMIA 6164 AY904765† FJ391064 FJ390973 FJ391013 FJ391053 FJ391173 SEMIA 6175 AY904771† FJ391140 SEMIA 6179 FJ390903 FJ391065 FJ390974 FJ391014 FJ391054 FJ391174 SEMIA 6186 FJ390937 FJ391066 FJ390975 FJ391015 FJ391055 FJ391175 SEMIA 6187 FJ390923 FJ391067 FJ390976 FJ391016 FJ391056 FJ391176 SEMIA 6192 AY904772† FJ391072 FJ390977 FJ391017 FJ391057 FJ391177 SEMIA 6208 AY904773† FJ391129 SEMIA 6319 AY904774† FJ391083 FJ390978 FJ391018 FJ391058 FJ391178 SEMIA 6368 FJ390933 FJ391117 SEMIA 6374 FJ390910 FJ391074 FJ390979 FJ391019 FJ391059 FJ391179 SEMIA 6384 AY904777† FJ391132 SEMIA 6424 AY904787† FJ391127 SEMIA 6425 AY904788† FJ391134 SEMIA 6434 FJ390934 FJ391073 FJ390980 FJ391020 FJ391060 FJ391180 SEMIA 6440 AY904789† FJ391094 FJ390981 FJ391021 FJ391061 FJ391181 SEMIA 6443 FJ390932 FJ391128

*From the study by Chueire et al. (2003). †From the study by Menna et al. (2006).

References Chueire, L. M. O., Bangel, E., Mostasso, F. L., Campo, R. J., Pedrosa, F. O. & Hungria, M. (2003). Classificação taxonômica das estirpes de rizóbio recomendadas para as culturas da soja e do feijoeiro baseada no seqüenciamento do gene 16S rRNA. Rev Bras Cienc Solo 27, 833–840 (in Portuguese). Menna, P., Hungria, M., Barcellos, F. G., Bangel, E. V., Hess, P. N. & Martinez-Romero, E. (2006). Molecular phylogeny based on the 16S rRNA gene of elite rhizobial strains used in Brazilian commercial inoculants. Syst Appl Microbiol 29, 315–332. Medline

Strain Genome 16S rRNA gene atpD dnaK glnII ITS recA B. betae PL7HG1T AY372184 AY923046.1 AB353733.1 AJ631967.1 AB353734.1 B. jicamae PAC68T AY624134 FJ428211 FJ428204 AY628094 B. pachyrhizi PAC48T AY624135 FJ428208 FJ428201 AY628092 B. canariense BC-C2 AY577427 AY386736 AJ431135 AY386762.1 AY386704.1 AY591541.1 B. yuanmingense B071T (=CCBAU 10071T) AF193818 AY386760.1 AY923039.1 AY386780.1 AY386734.1 AM168343 B. liaoningense LMG 18230T AF208513.1 AY386752.1 AY923041.1 AY386775.1 AF345256.1 AY591564.1 B. elkanii USDA 76T U35000.3 AY386758.1 AY328392.1 AY599117.1 U35000 AY591568.1 B. japonicum USDA 6T U69638 AM168320 AM168362 AM182979 U69638 AM168341 B. japonicum USDA 110 BA000040

Jaccard (Tol 1.5%-1.5%) (H>0.0% S>0.0%) [0.0%-100.0%] BOX BOX 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100 SEMIA 5062 SEMIA 6156 USDA 3622T SEMIA 6155 SEMIA 6164 SEMIA 0656 SEMIA 0839 SEMIA 6175 SEMIA 6440 SEMIA 6028 SEMIA 6163 SEMIA 6420 Group I SEMIA 6189 SEMIA 6425 SEMIA 0662 SEMIA 0695 Group II SEMIA 0938 SEMIA 6145 SEMIA 5060 SEMIA 6208 SEMIA 6069 SEMIA 6101 SEMIA 6146 SEMIA 6150 SEMIA 6157 SEMIA 6319 SEMIA 6053 SEMIA 6002 Group III SEMIA 6144 SEMIA 6152 SEMIA 6148 SEMIA 6100 SEMIA 6169 SEMIA 6391 Group IV SEMIA 6160 SEMIA 6149 SEMIA 6192 SEMIA 0637 SEMIA 6056 SEMIA 6014 SEMIA 6158 SEMIA 6424 SEMIA 0621 SEMIA 6093 SEMIA 6374 SEMIA 6099 SEMIA 0928 SEMIA 5021 SEMIA 0905 SEMIA 0929 Group V SEMIA 0583 SEMIA 5003 Group VI SEMIA 6118 SEMIA 0613 Group VII SEMIA 0635 SEMIA 5034 SEMIA 6384 SEMIA 5048 SEMIA 6187 SEMIA 5045 SEMIA 5064 Group VIII SEMIA 5071 SEMIA 5046 SEMIA 5052 USDA 6T SEMIA 0512 SEMIA 0556 SEMIA 5028 SEMIA 5039 Group IX SEMIA 5051 SEMIA 5081 SEMIA 6071 SEMIA 5037 SEMIA 5057 SEMIA 5029 Group X SEMIA 5055 SEMIA 5056 SEMIA 0518 SEMIA 0560 Group XI SEMIA 5063 SEMIA 0566 SEMIA 0567 SEMIA 0568 SEMIA 0571 Group XII SEMIA 0515 SEMIA 0528 SEMIA 0543

Supplementary Fig. S1. Cluster analysis (UPGMA with the Jaccard coefficient) of products obtained by BOX- PCR analysis of 169 rhizobial strains. Reference and type strains are labelled. More information about the strains is given in Table 1 and Supplementary Tables S1 and S2.

Supplementary Fig. S1. cont.