Sulfite Oxidation in the Purple Sulfur Bacterium Allochromatium Vinosum: Identification of Soeabc As a Major Player and Relevance of Soxyz in the Process

Microbiology (2013), 159, 2626–2638 DOI 10.1099/mic.0.071019-0

Editor’s Choice Sulfite oxidation in the purple sulfur bacterium Allochromatium vinosum: identification of SoeABC as a major player and relevance of SoxYZ in the process

Christiane Dahl, Bettina Franz,3 Daniela Hensen,4 Anne Kesselheim and Renate Zigann

Correspondence Institut fu¨r Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universita¨t Bonn, Christiane Dahl Meckenheimer Allee 168, 53115 Bonn, Germany [email protected]

In phototrophic sulfur bacteria, sulfite is a well-established intermediate during reduced sulfur compound oxidation. Sulfite is generated in the cytoplasm by the reverse-acting dissimilatory sulfite reductase DsrAB. Many purple sulfur bacteria can even use externally available sulfite as a photosynthetic electron donor. Nevertheless, the exact mode of sulfite oxidation in these organisms is a long-standing enigma. Indirect oxidation in the cytoplasm via adenosine-59- phosphosulfate (APS) catalysed by APS reductase and ATP sulfurylase is neither generally present nor essential. The inhibition of sulfite oxidation by tungstate in the model organism Allochromatium vinosum indicated the involvement of a molybdoenzyme, but homologues of the periplasmic molybdopterin-containing SorAB or SorT sulfite dehydrogenases are not encoded in genome-sequenced purple or green sulfur bacteria. However, genes for a membrane-bound polysulfide reductase-like iron–sulfur molybdoprotein (SoeABC) are universally present. The catalytic subunit of the protein is predicted to be oriented towards the cytoplasm. We compared the sulfide- and sulfite-oxidizing capabilities of A. vinosum WT with single mutants deficient in SoeABC or APS reductase and the respective double mutant, and were thus able to prove that SoeABC is the major sulfite-oxidizing enzyme in A. vinosum and probably also in other phototrophic sulfur bacteria. The genes also occur in a large number of chemotrophs, indicating a general importance of SoeABC for sulfite oxidation in the cytoplasm. Furthermore, we showed that the periplasmic sulfur substrate-binding protein SoxYZ is needed in parallel to the Received 1 July 2013 cytoplasmic enzymes for effective sulfite oxidation in A. vinosum and provided a model for the Accepted 11 September 2013 interplay between these systems despite their localization in different cellular compartments.

INTRODUCTION purple sulfur bacterium that can also utilize thiosulfate and sulfite (Imhoff et al., 1998; Weissgerber et al., 2011). The Anoxygenic purple sulfur bacteria like the gammaproteo- first major process in the oxidation of thiosulfate and bacterium Allochromatium vinosum, a member of the sulfide is the formation of intracellularly stored sulfur family Chromatiaceae, are able to derive energy from light globules. The oxidation of thiosulfate to sulfate with sulfur by using reduced sulfur compounds as photosynthetic globules as an intermediate involves the periplasmic Sox electron donors. The substrates of purple sulfur bacteria proteins SoxYZ, SoxB, SoxXAK and SoxL (Pott & Dahl, primarily include sulfide and elemental sulfur (Imhoff, 1998; Hensen et al., 2006; Welte et al., 2009). For the 2005a). A. vinosum is a metabolically especially versatile oxidation of sulfide, A. vinosum possesses the genetic equipment for at least three different enzymes catalysing 3Present address: Institut fu¨r Medizinische Mikrobiologie und this reaction, namely the soluble periplasmic flavocyto- Krankenhaushygiene, Zentrum der Hygiene, Universita¨tsklinikum chrome c and the membrane-bound sulfide : quinone Frankfurt, Paul-Ehrlich-Straße 40, 60596 Frankfurt am Main, Germany. oxidoreductases SqrD and SqrF. The last two are both 4Present address: Merck Millipore, Boulevard Industrial Park, Padge predicted to be oriented towards the periplasm (Reinartz Road, Nottingham NG9 2JR, UK. et al., 1998; Gregersen et al., 2011; Weissgerber et al., 2011). Abbreviation: APS, adenosine-59-phosphosulfate. In A. vinosum, the sulfur globules are deposited in the Two supplementary tables are available with the online version of this same cellular compartment as the periplasmic thiosulfate- paper. and sulfide-oxidizing enzymes. This is evidenced by the

2626 071019 G 2013 SGM Printed in Great Britain Sulfite oxidation in A. vinosum presence of signal peptide-encoding sequences in the genes Recently, involvement of a putative heterotrimeric mem- for the three structural proteins constituting the sulfur brane-bound complex named SoeABC (sulfite-oxidizing globule envelope (Pattaragulwanit et al., 1998; Prange et al., enzyme) in sulfite oxidation in the cytoplasm of the 2004; Frigaard & Dahl, 2008). For further oxidation of organosulfonate-degrading chemotrophic alphaproteobac- stored sulfur, the so-called Dsr system is of essential terium Ruegeria pomeroyi has been reported, although not importance (Pott & Dahl, 1998; Dahl et al., 2005; Lu¨bbe rigorously documented, by Lehmann et al. (2012). The et al., 2006; Sander et al., 2006). The product of the Dsr SoeABC protein appears to be a member of the complex pathway is sulfite, generated by a reverse-acting dissimilat- iron–sulfur molybdoproteins and consists of an NrfD/PsrC- ory sulfite reductase (DsrAB), an enzyme that is well like membrane anchor (SoeC) and two cytoplasmic known to be located in the cytoplasm (Hipp et al., 1997; subunits: an iron–sulfur protein (SoeB) and a molybdopro- Pott & Dahl, 1998; Frigaard & Dahl, 2008). tein with an N-terminal iron–sulfur cluster binding site The last step is the oxidation of sulfite, yielding sulfate as (SoeA). It should be noted that SoeABC and the periplasmic the final product. Sulfate formation from sulfite is Sor-type sulfite dehydrogenases belong to completely energetically favourable and carried out by a wide range different families of molybdoenzymes. SorA and relatives of organisms (Simon & Kroneck, 2013). Many sulfite- belong to the sulfite oxidase proteins, which bind a single oxidizing enzymes are located outside the cytoplasmic molybdopterin without a second nucleotide. SoeA falls into membrane (in the periplasm in Gram-negative bacteria). the molybdopterin-binding MopB superfamily. In many The best-characterized enzyme belonging to this group, characterized members of this family molybdopterin is present SorAB, stems from Starkeya novella and consists of a in the form of a dinucleotide, with two molybdopterin dinu- molybdopyranopterin cofactor-carrying subunit (SorA) cleotide units per molybdenum. Similarities are obvious and a monohaem cytochrome c (SorB) (Kappler et al., within each molybdoenzyme family sequence, whereas no 2000; Kappler & Bailey, 2005). SorA-type molybdoproteins significant homologies can be detected between members of without a SorB subunit have been termed SorT (D’Errico different families (Kisker et al., 1998). Genes encoding et al., 2006; Wilson & Kappler, 2009), but recently this proteins related to SoeABC are present in purple as well as discrimination has been questioned (Simon & Kroneck, green sulfur bacteria, and in the past years have repeatedly 2013). A second option for oxidation of sulfite in the been speculated to be involved in the oxidation of sulfite periplasm is the Sox system. It has been shown that sulfite generated by the Dsr system in the cytoplasm (Frigaard & is accepted in vitro as a substrate of the reconstituted Sox Bryant, 2008; Frigaard & Dahl, 2008). Notably, soeABC-like system from the chemotroph Paracoccus denitrificans genes co-localize with dsr genes not only in the meta- (Friedrich et al., 2001). Notably, Friedrich and coworkers genome-derived sequence of another bacterium that belongs proved this reaction to be independent of the presence of to the Roseobacter clade like R. pomeroyi (Lenk et al., 2012), SoxCD, a molybdohaemoprotein catalysing the six-elec- but also in several green sulfur bacteria and in Halorhodospira tron oxidation of SoxY-cysteine-bound persulfide to halophila, a purple sulfur bacterium of the family Ecto- sulfone sulfur. Purple bacteria that form sulfur globules thiorhodospiraceae (Dahl, 2008; Frigaard & Dahl, 2008). during thiosulfate oxidation contain the Sox system, albeit Independent experimental evidence for the involvement of a without the SoxCD proteins (Hensen et al., 2006; Meyer molybdoprotein was obtained by inhibition of sulfite et al., 2007; Frigaard & Dahl, 2008). oxidation in A. vinosum with the molybdate-antagonist tungstate (Dahl, 1996). Oxidation of sulfite generated by the cytoplasmic Dsr proteins via the periplasmic pathways described would first In this work, we aimed to obtain a clearer picture of the require transport across the cytoplasmic membrane. proteins involved in the oxidation of sulfite in purple sulfur However, such transport is probably not necessary in bacteria and chose A. vinosum as the model organism. An organisms that contain a further well-characterized sulfite array of strains carrying single and multiple deletions of oxidation pathway: it is firmly established that a number of relevant genes was studied with regard to the oxidation of purple as well as green anoxygenic phototrophic sulfur externally supplied and internally generated sulfite. bacteria oxidize sulfite in the cytoplasm using an indirect Thereby, we identified AvSoeABC (Alvin_2491-2489) as a pathway via adenosine-59-phosphosulfate (APS) catalysed major player in the oxidation of sulfite. In addition, we by APS reductase and ATP sulfurylase (Dahl, 1996; Sa´nchez present evidence that SoxYZ is also essential in sulfite et al., 2001; Frigaard & Dahl, 2008; Rodriguez et al., 2011). oxidation, whilst the other Sox proteins are dispensable for The electrons generated by the oxidative formation of APS the process. from sulfite and AMP are fed into the photosynthetic electron transport chain at the level of menaquinone either by AprM or by the much better characterized METHODS QmoABC/QmoABHdrCB complex (Meyer & Kuever, Bacterial strains, plasmids, PCR primers and growth condi- 2007; Rodriguez et al., 2011; Ramos et al., 2012; Grein tions. The bacterial strains, plasmids and primers used in this study et al., 2013). Notably, however, neither is the APS reductase are listed in Table 1. A. vinosum strains were cultivated photo- pathway generally present in purple sulfur bacteria nor is it organoheterotrophically in RCV medium (Weaver et al., 1975) or essential in A. vinosum (Dahl, 1996; Sa´nchez et al., 2001). photolithoautotrophically in Pfennig medium (Pfennig & Tru¨per, http://mic.sgmjournals.org 2627 C. Dahl and others

Table 1. Bacterial strains and plasmids used in this study

Strain or plasmid Genotype or phenotype Reference

Escherichia coli strain + S17-1 294 (recA thi pro hsdR2M )Tpr Smr [RP4-2-Tc : : Mu-Km : Tn7] Simon et al. (1983) Allochromatium vinosum strains Rif50 Rif r, spontaneous rifampicin-resistant mutant of DSM 180T Lu¨bbe et al. (2006) SM50 Smr, spontaneous streptomycin-resistant mutant of DSM 180T Dahl (1996) soxXVKm Kmr, soxX ::VKm in DSM 180T Hensen et al. (2006) soxBXVKm Kmr, soxX ::VKm in DSM 180T Hensen et al. (2006) DsoxY Rif r, in-frame deletion of soxY in Rif50 Hensen et al. (2006) DsoxY+YZ Rif r Kmr, complementation of DsoxY Hensen et al. (2006) DsoxY DsoeAEm Rif r Emr; DsoeA Em 51 nt upstream of soeA ATG in DsoxY This work aprB ::VKm Kmr Smr, aprB ::VKm in SM50 Dahl (1996) DsoxY aprB ::VKm Kmr Rif r, aprB ::VKm in DsoxY This work DsoeAEm Emr Rif r, DsoeA Em 51 nt upstream of soeA ATG in Rif50 This work aprB ::VKm DsoeAEm Kmr Emr,Smr, DsoeA Em 51 nt upstream of soeA ATG in aprB ::VKm This work DsoxY aprB ::VKm DsoeAEm Kmr Emr Rif r, Em 51 nt upstream of soeA ATG in DsoxY aprB ::VKm This work Plasmids + pBBR1-MCS2 Kmr Mob , rep lacZa Kovach et al. (1995) pDsoxY+YZ Kmr, 1.5 kb PCR fragment of soxYZ (XbaI) in XbaI of pBBR1-MCS2 Hensen et al. (2006) pNTS35 Kmr cartridge (EcoRI) from pHP45VKm in PvuII within aprB Dahl (1996) + pK18mobsacB Kmr Mob , sacB oriV oriT lacZa Scha¨fer et al. (1994) pK18mobsacBDsoeA Kmr HindIII fragment of PCR-amplified genome region around soeA This work (Alvin_2491) with deletion of 2864 bp of the soeA sequence pK18mobsacBDsoeAEm Kmr Emr, 1.1 kb blunt-ended HindIII–EcoRI fragment from pUC19Ery This work in SspI of pK18mobsacBDsoeA pUC19Ery Apr Emr, from pE194 in SmaI of pUC19 Leenhouts et al. (1990) + pSUP301 Apr Kmr Mob Simon et al. (1983) pSUP301DsoeAEm Apr Emr, 2.9 kb HindIII fragment from pK18mobsacBDsoeAEm in This work HindIII of pSUP301 Primers Avin2491fw1 GGCGGGAAGCTTTCCGAATGATCCGCT This work Avin2491rev1 TTGCTTCCCGAAGATACTGGCTGGATCCTG This work Avin2491fw2 CAGGATCCAGCCAGTATCTTCGGGAAGCAA This work Avin2491rev2 GCGAACAAGCTTCCGACGGCATAGAAC This work

1992) without reduced sulfur compound, referred to as ‘0 medium’. Plasmid DNA from E. coli was purified using the QIAprep Spin Sulfide or sulfite was added as electron source at the desired Miniprep Kit (Qiagen). concentration. The cultivation was performed under anoxic conditions and continuous illumination at 30 uC either in completely filled Construction of A. vinosum single-, double- and triple-mutant screw-capped culture bottles or in thermostatted glass fermenters. strains. For the substitution of soeA (Alvin_2491) in the genome of Escherichia coli was cultivated in LB medium (Sambrook et al., 1989). A. vinosum by an erythromycin cassette, SOE PCR (Horton, 1995) Antibiotics used for mutant selection were applied at the following fragments were constructed using primer pairs Avin2491fw1/ concentrations: for E. coli: ampicillin 100 mgml21, kanamycin 50 mg Avin2491rev1 and Avin2491fw2/Avin2491rev2 (Table 1). The result- ml21, erythromycin 100 mgml21, chloramphenicol 50 mgml21; for ing fragment was inserted into plasmid pK18mobsacB (Scha¨fer A. vinosum: rifampicin 50 mgml21, streptomycin 50 mgml21, et al., 1994) by HindIII restriction sites resulting in plasmid ampicillin 10 mgml21, kanamycin 10–25 mgml21, erythromycin pK18mobsacBDsoeA. After digestion with HindIII and EcoRI the 10 mgml21. erythromycin cassette from pUC19Ery was blunt-ended using Klenow polymerase and ligated into the SspI site of pK18mobsacBDsoeA, Recombinant DNA techniques. Standard methods were used for resulting in pK18mobsacBDsoeAEm. The SspI site is situated 51 nt molecular biological techniques. Chromosomal DNA of A. vinosum upstream of the soeA ATG start codon and 110 nt downstream of the strains was obtained by a modified sarcosyl lysis (Bazaeal & Helinski, TGA stop codon of the preceding gene Alvin_2492. Thus, it was 1968). The genotypes of the A. vinosum recombinants used in this guaranteed that expression of Alvin_2492 was not affected by study were confirmed by Southern hybridization and PCR. The latter insertion of the antibiotic resistance cassette. The 2.9 kb HindIII is the only method of choice to confirm complementation strains. fragment of pK18mobsacBDsoeAEm was then inserted at the HindIII Southern hybridization was performed overnight at 68 uC. PCR site of pSUP301. The final mobilizable construct pSUP301DsoeAEm. amplifications with Taq DNA polymerase and Pfu DNA polymerase was transferred from E. coli S17-1 to A. vinosum strains Rif50, were done essentially as described previously (Dahl, 1996). DNA aprB ::VKm, DsoxY and DsoxY aprB ::VKm by conjugation probes for Southern hybridization were digoxigenin labelled by PCR. (Pattaragulwanit & Dahl, 1995). For the insertional inactivation of

2628 Microbiology 159 Sulfite oxidation in A. vinosum aprB, plasmid pNTS35 (Dahl, 1996) was conjugationally transferred violascens (Table 2). The only probable sulfite-oxidizing from E. coli S17-1 to A. vinosum strain DsoxY. Transconjugants were unit that is encoded in all sequenced purple sulfur bacteria selected on RCV plates containing the appropriate antibiotics under is SoeABC (Table 2), pointing to a general and major anoxic conditions in the light. Double cross-over recombinants lost the vector-encoded ampicillin resistance. The genotype of double importance of this membrane-bound complex iron–sulfur cross-over recombinants was verified by Southern hybridization molybdoprotein. experiments. In A. vinosum, SoeABC is encoded by genes Alvin_2491 Characterization of phenotypes, detection of sulfur species (soeA), Alvin_2490 (soeB) and Alvin_2489 (soeC). The and protein determination. A. vinosum WT and mutant strains protein consists of the 108.95 kDa molybdoprotein SoeA [ ] were characterized in batch culture experiments essentially as carrying one Fe4S4 cluster at the N-terminus, the described previously (Prange et al., 2004; Hensen et al., 2006). Cells 26.995 kDa iron–sulfur protein SoeB, which upon com- of A. vinosum, grown photo organoheterotrophically on malate [RCV parison with related structurally characterized proteins ] medium (Weaver et al., 1975) for 3 days were used as an inoculum (Jormakka et al., 2008) is predicted to bind four [Fe S ] for experiments concerned with transformation of sulfide and sulfite. 4 4 The culture volume of the precultures was 500 ml. Inoculum cells clusters, and a 35.715 kDa NrfD/PsrC-like membrane were harvested by centrifugation (10 min, 2680 g) and washed once protein (Simon & Kern, 2008) with eight transmembrane in ‘0 medium’. The culture volume for phenotypic analyses of WT helices. Neither AvSoeA and AvSoeB nor any of the other and mutant strains on 5 mM sulfite was 250 ml. Experiments purple sulfur bacterial SoeA or SoeB proteins listed in concerned with transformation of sulfide were performed in 1.5 l Table 2 are synthesized with cleavable TAT signal peptides fermenters. To maintain pH 7.0, sterile HCl (0.5 M) and Na2CO3 that are usually present on the active-site subunits of the (0.5 M) solutions were added automatically. biochemically well-characterized periplasmic sulfur-meta- Sulfide, thiosulfate and sulfate were determined either by HPLC bolizing complex iron–sulfur molybdoproteins, i.e. poly- (Rethmeier et al., 1997), or by classical colorimetric or turbidometric sulfide and sulfur reductase (PsrABC, SreABC), thiosulfate methods as described previously (Dahl, 1996). Elemental sulfur and reductase (PhsABC) or tetrathionate reductase (TtrABC) tetrathionate were determined colorimetrically by cyanolysis (Bartlett (Krafft et al., 1992; Heinzinger et al., 1995; Hensel et al., & Skoog, 1954; Kelly et al., 1969; Dahl, 1996). Sulfite was determined via the fuchsin method as described by Dahl (1996). Protein 1999; Laska et al., 2003). We can thus state conservatively concentrations were determined using the Bradford reagent (Sigma) that SoeA and SoeB are located in the cytoplasm and as specified by the manufacturer. attached to the cytoplasmic membrane by interaction with SoeC. The holoprotein would therefore be well suited for oxidation of sulfite generated in the cytoplasm. RESULTS Further indication for an involvement of SoeABC in dissimilatory sulfur oxidation in A. vinosum was gathered Occurrence of sulfite oxidation-related genes in during recent genome-wide transcriptional profiling genome-sequenced purple sulfur bacteria (Weissgerber et al., 2013). Relative transcription of all A survey of all genome sequences available for a three A. vinosum soe genes was found to be increased ~3- physiologically coherent group of bacteria can provide fold during photolithoautotrophic growth on sulfide revealing insights into pathways of general, major or or thiosulfate compared to photo organoheterotrophic possibly only minor importance. We therefore searched the growth on malate (2.99-, 2.77- and 2.93-fold increase on currently completely sequenced phototrophic members of sulfide and 1.96, 1.98 and 3.00-fold increase on thiosulfate, the families Chromatiaceae and Ectothiorhodospiraceae for for soeA,-B and -C, respectively). Changes in the same the presence of sulfite oxidation-related genes. Table 2 range were observed for the genes encoding the enzymes of provides a compilation of our results. From these findings, the APS reductase pathway when thiosulfate replaced it is evident that periplasmic sulfite-oxidizing systems are malate, whilst relative transcript levels for the sat-aprMBA not present universally in purple sulfur bacteria. Whilst the genes were 7.6- to 9.7-fold higher in the presence of sulfide sulfur substrate-binding protein SoxYZ is present irre- compared with the presence of malate. spective of the organisms’ substrate range, with only one exception (Thioflaviococcus mobilis), the presence of Oxidation of externally supplied sulfite by SoxXA(K) and SoxB appears to be strictly linked to the A. vinosum: role of SoeABC and APS reductase ability of the cells to utilize thiosulfate (Table 2). Nevertheless, participation of the Sox system in sulfite To assess the importance of the SoeABC protein in A. oxidation in those strains that contain Sox proteins is not vinosum, a mutant strain (A. vinosum DsoeAEm) was completely excluded. Furthermore, our survey showed that constructed that carries a deletion of the soeA gene and an only a single purple sulfur bacterium, T. mobilis, contains a insertion of an erythromycin resistance cassette. The latter sorA-like gene (Table 2), implying that the encoded enzyme was positioned immediately upstream of the original soeA is of very restricted importance in this organism group. gene, but well downstream of the stop codon of the The cytoplasmic APS reductase pathway occurs in several, preceding gene Alvin_2492, thereby ensuring that expres- although not all, purple sulfur bacteria. The electron- sion of Alvin_2492 was not affected. The same DsoeAEm accepting unit for AprBA appears to be AprM in most mutation was also introduced into an A. vinosum strain cases, but is replaced by QmoABHdrBC in Thiocystis already lacking APS reductase (Dahl, 1996). Previously, we http://mic.sgmjournals.org 2629 2630 others and Dahl C.

Table 2. Proteins related to sulfite oxidation encoded in genome-sequenced purple sulfur bacteria

With the exception of Thiorhodospira sibirica all organisms listed in this table contain a complete set of dsr genes (dsrABEFHCMKLJOPN).The soxCD genes are not listed here because they do not occur in any of the sequenced anoxygenic phototrophic bacteria. The absence of signal peptides was confirmed for all SoeA and SoeB homologues listed here. The proteins are thus predicted to be cytoplasmic.

Organism Sulfur substrate Sat AprBA AprM Qmo SorA SoeABC SoxXAK SoxB SoxYZ

Family Chromatiaceae Allochromatium vinosum Sulfide, S0, thiosulfate, Alvin_1118 Alvin_1120-1121 Alvin_1119 – – Alvin_2491-2489 Alvin_2168-2170 Alvin_2167 Alvin_2111-2112 DSM 180T sulfite Thiorhodovibrio sp. 970 Sulfide, S0 (thiosulfate and Thi970DRAFT_ Thi970DRAFT_00963- Thi970DRAFT_00962 – – Thi970DRAFT_ – – Thi970DRAFT_01660-01661 sulfite not reported) 00961 00964 00955-00957 Thiocapsa marina 5811 Sulfide, S0, thiosulfate, ThimaDRAFT_1689 ThimaDRAFT_ ThimaDRAFT_4550 – – ThimaDRAFT_ ThimaDRAFT_ ThimaDRAFT_4579 ThimaDRAFT_0728-0729, (DSM 5653T) sulfite 4551-4552 0331-0329 4578-4576 ThimaDRAFT_3536-3537 Thiocystis violascens Sulfide, S0, thiosulfate, Thivi_0893 Thivi_3300-3299 – Thivi_3114-3111 – Thivi_4531-4533 Thivi_3804-3802 Thivi_2200 Thivi_3138-3139 DSM 198T sulfite (qmoABhdrCB), no QmoC Thiorhodococcus drewsii Sulfide, S0, thiosulfate ThidrDRAFT_3161 ThidrDRAFT_ ThidrDRAFT_1494 – – ThidrDRAFT_ ThidrDRAFT_ ThidrDRAFT_2415 ThidrDRAFT_2534-2535 AZ1 (DSM 15006T) 1495-1496 2883-2881 2416–2418 Thioflaviococcus mobilis Sulfide, S0 (sulfite not Thimo_1948 Thimo_1220-1219 Thimo_1221 – Thimo_2977 Thimo_1580-1582 – – – DSM 8321T tested) Marichromatium Sulfide, S0, thiosulfate – – – – – MarpuDRAFT_ MarpuDRAFT_ MarpuDRAFT_0224 MarpuDRAFT_0579-0580 purpuratum 984 (DSM (sulfite not tested) 2159-2161 0223-0221 1591T) Family Ectothiorhodospiraceae Thiorhodospira sibirica Sulfide, S0 (sulfite not – – – – – ThisiDRAFT_1377, – – ThisiDRAFT_0337-0336 ATCC 700588T tested) ThisiDRAFT_0834, ThisiDRAFT_2148 Halorhodospira halophila Sulfide, thiosulfate – – – – – Hhal_1936-1934 Hhal_1948 (fused Hhal_1939 Hhal_1941-1942 SL1 (DSM 244T) soxXA), no soxK

The genes for the following biochemically well characterized proteins served as baits: aprMBA and sat genes from A. vinosum and qmoABC from Desulfovibrio desulfuricans for the APS reductase pathway, soxYZ, soxXAK and soxL from A. vinosum and soxCD from Paracoccus pantotrophus for the Sox pathway, sorAB from S. novella and soeABC from R. pomeroyi. In the case of the soeABC Microbiology genes, a function for the encoded proteins has been reported but not rigorously documented (Lehmann et al., 2012). References for substrate ranges: Bryantseva et al. (1999), Zaar et al. (2003), Caumette et al. (2004) and Imhoff (2005a, b). 159 Sulfite oxidation in A. vinosum reported that crude extracts of WT A. vinosum catalysed regard to the oxidation of externally added sulfite than the sulfite-dependent ferricyanide reduction in the absence of mutant solely lacking APS reductase. The specific sulfite AMP (Dahl, 1996). This activity was no longer detectable oxidation rate of the former amounted to only 17±10 % of in the A. vinosum DsoeAEm mutant strain. We concluded the WT (Table 3). This finding is again in full agreement therefore that the protein encoded by the soeABC genes is with Sańchez et al. (2001), who reported that under all the identical with the AMP-independent sulfite-oxidizing conditions tested an APS reductase-independent pathway entity in A. vinosum. was responsible for most of the sulfur flow to sulfate (69– 100 %) in A. vinosum. A knockout of both aprB and soeA In a first set of experiments, we studied the phenotypes of led to an additive effect with a residual specific rate of A. vinosum WT, the APS reductase and SoeABC-deficient sulfite oxidation for whole cells of only ~7 % of the WT single-mutant strains as well as that of the corresponding (Table 3). double mutant regarding the oxidation of externally supplied sulfite under anoxic conditions in the light. The experiments were performed in batch culture in 250 ml Oxidation of externally supplied sulfite by bottles that were completely filled with medium containing A. vinosum: role of Sox proteins 5 mM sulfite as the only source of sulfur and electrons. The As already outlined in the Introduction, it has been A. vinosum strain lacking only APS reductase exhibited a demonstrated convincingly that sulfite is accepted in vitro phenotype clearly discernible from that of the WT, i.e. as a substrate of the reconstituted Sox system from the sulfite was oxidized with a significantly lower rate (Table chemotroph P. denitrificans (Rother et al., 2001). In this 3). This finding is in agreement with results reported by case, the reaction cycle has been proposed to be simpler Sańchez et al. (2001) who compared sulfide oxidation by A. than that needed for oxidation of thiosulfate. The cycle vinosum WT and the APS reductase-deficient strain in would start with SoxXA-catalysed oxidative coupling of continuous culture. While Sańchez et al. (2001) observed sulfite to the cysteine in the C-terminal SoxY ‘GGCGG’ only small differences between WT and APS reductase- motif followed by a SoxB-mediated hydrolysis reaction deficient strains at light-limiting irradiances, the presence releasing sulfate (Sauve´ et al., 2007; Kappler & Maher, of the APS reductase pathway was clearly advantageous for 2013). An involvement of the periplasmic Sox proteins in A. vinosum at high irradiances. This finding explains why the oxidation of sulfite in purple sulfur bacteria is thus not initial batch culture experiments performed in 1.5 l culture a priori excluded, especially where the oxidation of external vessels allowing only limited light penetration to the centre sulfite is concerned. We therefore conducted a series of of the culture failed to demonstrate an effect of APS experiments in which we studied the effect of a deficiency reductase deficiency (Dahl, 1996). in various Sox proteins on sulfite oxidation in A. vinosum. As evident from Table 3, the SoeABC-deficient A. vinosum The assumption that coordinated action of the A. vinosum mutant exhibited an even more apparent phenotype with Sox proteins is necessary for their in vivo function originally led us to the conclusion that, if any phenotype of Sox protein deficiency was detectable, it should be the same or at least very similar, irrespective of which specific Sox protein or which combination thereof is removed. Table 3. Sulfite oxidation rates in A. vinosum WT and mutant However, surprisingly this was not the case. While both an strains lacking functional APS reductase, SoeABC, SoxYZ or A. vinosum mutant lacking functional SoxXAK and a combinations thereof mutant additionally lacking SoxB behaved virtually indis- cernibly from the WT (Table S1, available in Microbiology Strain Sulfite oxidation rate Online), the DsoxY mutant showed a significant decrease in [nmol min”1 (mg protein)”1] sulfite oxidation rate (Tables 3 and S1). It should be emphasized that the experiments compiled in Tables 3 and WT 64.6±4.6 S1 were not performed under exactly the same experi- aprB ::VKm 26.0±8.2 DsoeAEm 10.9±8.0 mental conditions. The experiments summarized in Table aprB ::VKm DsoeAEm 4.5±0.5 S1 were run in 1.5 l culture vessels and thus light intensities DsoxY 5.2±0.4 in the centre of the cultures were lower than in the 250 ml DsoxY aprB ::VKm 6.4±1.2 cultures used for the experiments compiled in Table 3. It is DsoxY DsoeAEm 6.5±0.6 evident that the specific sulfite oxidation rates for WT A. [ DsoxY aprB ::VKm DsoeAEm 4.0±1.2 vinosum are higher at higher irradiance 64.6±4.6 versus 36.2±1.6 nmol min21 (mg protein)21 in 250 ml and 1.5 l ] Initial sulfite concentration: 5 mM. Experiments were performed in cultures, respectively . The lack of a protein important for completely filled 250 ml culture bottles. A background rate of sulfite oxidation (SoxYZ in this case) has a more drastic chemical sulfite oxidation was determined for medium incubated effect under high irradiances, just as has already been found under the same experimental conditions (0.33 nmol min21 ml21) for APS reductase (Sanchez et al., 2001). Reintroduction of and has already been deducted from the rates given. Initial protein soxYZ into the soxY-deficient mutant (strain A. vinosum concentration: 56–134 mgml21. DsoxY+YZ) resulted in complete restoration of the WT http://mic.sgmjournals.org 2631 C. Dahl and others phenotype with regard to oxidation of externally supplied (a) 4.0 sulfite (Table S1). These findings suggested the periplasmic sulfur substrate-binding protein SoxYZ as another impor- 3.0 tant player in sulfite metabolism in A. vinosum, whilst SoxXAK and SoxB do not appear to play a significant role 2.0 in this process.

Sulfide (mM) 1.0 Oxidation of externally supplied sulfite by A. vinosum: connection of cytoplasmic systems (b) 4.0 and SoxYZ 3.0 To further dissect the importance of SoxYZ in relation to the cytoplasmic sulfite-oxidizing systems we constructed A. 2.0 vinosum mutants lacking SoxYZ as well as SoeABC and/or APS reductase. It now appeared that the specific sulfite 1.0 oxidation rates of neither the double nor the triple mutants were significantly different from that of the DsoxY single Intracellular sulfur (mM) mutant (Table 3). These observations suggest that SoxYZ is (c) 4.0 needed for oxidation of externally added sulfite in A. vinosum even in the presence of both cytoplasmic sulfite- 3.0 oxidizing systems. The requirement of SoxYZ is not absolute, though, because we found conditions under 2.0 which the SoxYZ-deficient mutant still exhibited a sulfite oxidation rate well above background (Table S1). Sulfite (mM) 1.0

Oxidation of sulfide in A. vinosum strains (d) 4.0 deficient in SoeABC, APS reductase and/or SoxYZ 3.0 We now set out to define the roles of the newly detected cytoplasmically oriented membrane-bound molybdenum 2.0 cofactor-containing SoeABC complex as well as the periplasmic SoxYZ protein in the very complex trans- 1.0 tetrathionate (mM) formation of sulfur compounds occurring during oxida- Sulfate/thiosulfate/ tion of sulfide to sulfate. To this end, a suitable set of A. 0.0 vinosum mutant strains was studied in 1.5 l fermenter 0 10 20 30 40 50 60 70 80 140 150 cultures under pH control. This experimental design Time (h) guaranteed full comparability of results obtained for this multi-step process and enabled sampling for various different sulfur compounds at ample time points. We Fig. 1. Sulfide oxidation in A. vinosum WT and mutant strains. could thus lay a special focus on intermediates of the Representative experiments of biological triplicates are shown. (a) process as well as the final sulfur product(s). Sulfide, (b) intracellular sulfur, (c) sulfite, and (d) sulfate, thiosulfate and tetrathionate. A. vinosum strains: WT ($), DsoeAEm (h), The WT A. vinosum control cultures behaved as expected: DsoxY (D), aprB ::VKm DsoeAEm (&), DsoxY aprB ::VKm sulfide was rapidly converted (Fig. 1a) to sulfur, which DsoeAEm (#). Thiosulfate and tetrathionate concentrations are transiently accumulated in sulfur globules (Fig. 1b). depicted in (d) using dotted and dashed lines, respectively. Initial Polysulfides were formed as intermediates in the process protein concentration: WT 0.19 mg ml”1, DsoeAEm 0.17 mg ml”1, (Prange et al., 2004), but are not shown here for better DsoxY 0.11 mg ml”1, aprB ::VKm DsoeAEm 0.13 mg ml”1 and clarity. In the next step, sulfite was generated in the DsoxY aprB ::VKm DsoeAEm 0.14 mg ml”1. Note the break in cytoplasm by the Dsr proteins. In WT cultures, sulfite does timescale. The period between 84 and 134 h was omitted to not accumulate in the medium to more than 30 mM (Dahl, enable a good overview of the ongoing sulfur transformations 1996) (Fig. 1c). Finally, the end product sulfate appeared in during the first 3 days of the experiments and to depict the final the medium (Fig. 1d). Thiosulfate and tetrathionate situation for the triple-mutant strain in the same figure. concentrations were below detection limits once sulfide was used up. In accordance with previous results (Dahl, 1996), the phenotype of the APS reductase-negative Like the apr-negative A. vinosum mutant strain, neither the mutant was indiscernible from the WT under the SoeABC-deficient mutant nor the tested double mutant conditions chosen and is therefore not shown in Fig. 1. was affected with regard to sulfide removal from the

2632 Microbiology 159 Sulfite oxidation in A. vinosum cultures, whilst the DsoxY aprB ::VKm DsoeAEm triple cytoplasmic sulfite-oxidizing enzymes appeared to be mutant exhibited a significantly reduced sulfide oxidation completely incapable of sulfate formation. The small rate (Table 4). We conclude that neither SoxYZ nor APS amount of sulfate found in the medium after prolonged reductase and SoeABC is involved directly in oxidation of incubation (144 h) is completely accounted for by sulfide to intracellular sulfur in A. vinosum. Oxidation rates chemical formation from sulfite. The main product in for intracellularly stored sulfur were found to be reduced the sulfide-exposed triple-mutant strain was thiosulfate, by ~50 % in the SoeABC-deficient and the SoxYZ-deficient which to some extent was again transformed to tetra- mutant, whilst the rate was even further reduced in the thionate by the action of the periplasmic thiosulfate strain lacking both cytoplasmic sulfite-oxidizing systems, dehydrogenase. and found to be only 20 % of the original rate in the triple mutant (Table 4). DISCUSSION Quantitative analysis of inorganic sulfur compounds in the medium revealed that all mutants lacking SoeABC and/or In this work, we identified the membrane-bound iron– SoxYZ accumulated massive amounts of sulfite up to a sulfur molybdoprotein SoeABC as a major enzyme maximum of 1.2 mM in the aprB ::VKm DsoeAEm strain catalysing direct oxidation of sulfite to sulfate in the that is no longer capable of cytoplasmic sulfite oxidation. cytoplasm of A. vinosum. The function of SoeABC was Up to 0.43 mM sulfite accumulated in the DsoeAEm strain, proven by strongly reduced specific oxidation rates for again underlining the major importance of direct SoeABC- externally supplied sulfite and by massive excretion of catalysed sulfite oxidation over the indirect APS reductase sulfite into the medium during oxidation of sulfide in A. pathway. In both tested mutants still containing SoxYZ, i.e. vinosum SoeABC-deficient strains. Our conclusion is DsoeAEm and aprB ::VKm DsoeAEm mutants, sulfate was corroborated by the lack of AMP-independent sulfite- formed as the only detectable final product (Fig. 1d). oxidizing activity in the crude extract of SoeABC-deficient Thiosulfate was not detected at any time in these cultures. A. vinosum. SoeABC appears to be of general importance in In contrast, the DsoxY mutant produced not just sulfate, purple sulfur bacteria because it is encoded in all genomes but also thiosulfate (Fig. 1d). Part of this thiosulfate was of organisms belonging to this group (Table 2). further oxidized to tetrathionate, which can be explained Database searches revealed the presence of three linked genes by the action of the periplasmic thiosulfate dehydrogenase related closely to soeABC and encoding the three subunits of (Denkmann et al., 2012). The amount of thiosulfate a cytoplasmically oriented membrane-bound iron–sulfur consumed (0.473 mM in the experiment shown in Fig. molybdoprotein not only in phototrophic sulfur oxidizers, 1d) and that of tetrathionate formed (0.210 mM) adhered but also in a large number of chemotrophic bacteria. exactly to the predicted 2 : 1 stoichiometry. Once formed, Examples are compiled in Table S2. Whilst the so-far thiosulfate could obviously no longer be transformed into sequenced epsilon- and deltaproteobacteria do not appear to sulfate in the DsoxY strain. This result is in complete contain soeABC, these genes occur in several chemotrophic agreement with earlier findings that tetrathionate is the sulfur oxidizers belonging to the gammaproteobacteria only product of thiosulfate-exposed A. vinosum DsoxY cells including the bacterial endosymbionts of Riftia pachyptila (Hensen et al., 2006). The inability of the DsoxY strain to and Tevnia jerichonana, Thioalkalivibrio species and form sulfate from thiosulfate is clearly due to the Acidithiobacillus species. Furthermore, a number of known incompleteness of the Sox system. Nevertheless, the mutant sulfur oxidizers belonging to the betaproteobacteria contain formed sulfate as the major end product of the oxidation of the genes, including Sulfuricella denitrificans, Thiomonas sulfide. This is explained by the presence and action of the species as well as Thiobacillus denitrificans. Among the APS reductase/SoeABC systems in the cytoplasm. In alphaproteobacteria containing soeABC, Magnetospirillum contrast, the triple mutant lacking SoxYZ as well as the species and Magnetococcus species are established sulfur

Table 4. Rates for oxidation of externally added sulfide and intracellular sulfur in A. vinosum WT, single- and double-mutant strains defective in soe, apr and/or sox genes

Strain Sulfide oxidation rate Sulfur oxidation rate [nmol min”1 (mg protein)”1] [nmol min”1 (mg protein)”1]

WT 69.3±4.5 26.5±4.0 DsoeAEm 69.0±6.3 15.3±1.3 DsoxY 94.8±5.8 13.4±1.2 aprB ::VKm DsoeAEm 73.3±20.9 10.2±2.3 DsoxY aprB ::VKm DsoeAEm 10.5±5.4 4.4±0.8

Initial sulfide concentration: 4 mM. Protein concentration at the onset of fermentations: 110–193 mgml21. http://mic.sgmjournals.org 2633 C. Dahl and others oxidizers. The presence and genomic linkage of soeABC with In the current work, we furthermore collected evidence for dsr and sox genes in bacteria belonging to the Roseobacter an involvement of the periplasmic sulfur substrate-binding clade has recently been noted by Mussmann and coworkers protein SoxYZ in the sulfite metabolism in A. vinosum, (Lenk et al., 2012). The genes are also present in several whilst other Sox proteins (SoxXAK and SoxB) do not genome-sequenced Roseovarius species and Roseobacter appear to play a significant role in this process. We suggest species. Among the soeABC-containing alpha- and betapro- that SoxYZ may serve the same function – and thus be of teobacteria, we find a number of species for which sulfur- considerably higher importance than previously assumed – oxidizing capabilities have not been described and/or tested in other purple sulfur bacteria as well. This is suggested by (e.g. Herminiimonas arsenicoxydans and several Burkholderia our observation that genes encoding the protein are almost species) or in which sulfur-oxidizing capabilities are universally present in this group of organisms irrespective restricted to oxidizing sulfite released as an intermediate of whether the organism contains further sox genes and is during organosulfur compound degradation, as in the able to metabolize thiosulfate (Table 1). The exact nature Roseobacter clade bacterium R. pomeroyi (Lehmann et al., of SoxYZ participation in sulfite metabolism cannot yet be 2012). We can thus state that the A. vinosum and the deduced from in vitro experiments, but nevertheless can be currently not well described R. pomeroyi soeABC genes pinpointed by our experiments with A. vinosum mutant encode the prototypes of a new protein family within the strains. One important conclusion from these studies is complex iron–sulfur molybdoenzymes that is widespread that SoxYZ cannot be a component of a sulfite-oxidizing among several branches of proteobacteria. We propose that pathway running independently of the cytoplasmic path- the so-far largely unrecognized SoeABC sulfite dehydrogen- ways. Mutants lacking SoxYZ and mutants lacking both ase is of major importance for the oxidation of sulfite in the cytoplasmic sulfite oxidation pathways are each very cytoplasm generated either by the Dsr system or by strongly affected with regard to degradation of external cytoplasmic desulfonating enzymes like sulfoacetaldehyde sulfite as well as with regard to turnover of sulfite formed acetyltransferase (Xsc) in a wide range of physiologically and as an intermediate by the cells. The effects are not additive, phylogenetically diverse bacteria. rather both SoxYZ and the cytoplasmic pathways need to co-exist. Obviously, both the periplasmic SoxYZ and the Furthermore, the compilation of the occurrence of cyto- cytoplasmic sulfite-oxidizing enzymes are needed in plasmic sulfite-generating and sulfite-oxidizing systems in parallel for effective sulfite oxidation in A. vinosum, selected proteobacteria in Table S2 shows that there is no suggesting some kind of interplay between these systems tight correlation between specific modes of sulfite genera- despite localization in two different cellular compartments. tion (here, Dsr or Xsc) and the sulfite-oxidizing module present (here, SoeABC or AprBA combined with either The simplest model into which these results and con- AprM or QmoABHdrCB). In most cases, the presence of Xsc siderations can be integrated is the suggestion that SoxYZ is coupled with the presence of SoeABC; however, may act as a sulfite-binding protein in the periplasm of A. ‘Candidatus Pelagibacter ubique’ is a well-recognized vinosum and that in this function the protein acts exception (Meyer & Kuever 2007, Table S2). The Dsr system independently of the other Sox proteins, i.e. SoxXAK and may occur in parallel with SoeABC alone, with AprBA alone SoxB. Originally, we rationalized that binding of sulfite to (e.g. in ‘Candidatus Ruthia magnifica’, see Table S2) or with SoxYZ may only be possible in an oxidative step yielding a combination of both systems. The possession of the APS SoxY-cysteine-sulfonate catalysed by a protein containing a reductase pathway in addition to or instead of SoeABC may redox-active site. However, in vivo such a process is be advantageous because additional energy is gained by obviously not exerted by the most likely candidate SoxXA substrate phosphorylation in the ATP sulfurylase-catalysed since the sulfite oxidation capability of the SoxXA-deficient step by transferring the AMP moiety of APS onto pyrophos- strain is undisturbed. An alternative mode for attachment phate (Parey et al., 2013). Furthermore, it may be especially of sulfite to SoxYZ not involving a redox reaction is the advantageous to be equipped with the Qmo-related reaction of the thiolate of the conserved SoxY-cysteine electron-accepting unit for APS reductase. Irrespective of (Sox-Cys2) with aqueous sulfite yielding SoxY-cysteine-S- 2 whether SoeABC or AprMBA is used, the electrons sulfinate (SoxY-Cys-SO2 ). Such a reaction is indeed stemming from sulfite are proposed to enter the electron feasible at the moderate pH values prevalent in the transport chain at the energetic level of quinones (via SoeC bacterial periplasm (Steudel & Steudel, 2010). However, or AprM). However, the presence of the HdrA-like QmoA in it should be kept in mind that the reaction has so far only the Qmo complex opens the possibility that – in a reverse been shown for free cysteine and not for an active-site manner to the mechanism suggested for sulfate reducers residue of a complex protein. We also considered an (Ramos et al., 2012; Grein et al., 2013) – an electron alternative mechanism for the generation of SoxY-cysteine- bifurcation occurs that could result in simultaneous S-sulfinate. In aqueous solution sulfite can form disulfite 2 22 reduction of low-potential electron acceptors like ferredoxin by a chemical reaction (2 HSO3 (aq) > S2O5 (aq) + + or NAD . Such a process would be of significant energetic H2O, equation 1). This disulfite could serve as substrate advantage especially for chemolithoautotrophic growth for SoxZY according to equation 2: SoxZY-Cys2 + [ ]2– + 2 2 because it would result in a lower energy demand for O2S-SO3 +H « SoxZY-Cys-SO2 +HSO3 . Based on reverse electron flow. this mechanism, SoxYZ could act as a binding protein not

2634 Microbiology 159 Sulfite oxidation in A. vinosum only shielding components of the periplasm from chemical of sulfite in WT culture supernatants albeit at only very low reactions with sulfite, but possibly also delivering sulfite for concentrations (Dahl, 1996). Once formed, sulfite is transport into the cytoplasm. We suggest that the SoxY- obviously removed with high efficiency. Two principally cysteine-S-sulfinate may act as a substrate donor for an as- different mechanisms appear to play a role here. The first is yet unknown transport system importing sulfite into the the oxidation to sulfate in the cytoplasm either by SoeABC cytoplasm. Either sulfite could be released by the alone or by a combination of the SoeABC/APS reductase transporter by simple addition of water to the SoxY- pathways depending on the organism (Table 1). The cysteine-S-sulfinate or disulfite may be released in reverse second mechanism working in parallel to avoid any of equation 2 shown above. In Fig. 2, the role of SoxYZ as a accumulation of sulfite in the cytoplasm would be transfer donor for a sulfite-importing system is depicted for the across the cytoplasmic membrane into the periplasm. simplest case, i.e. the degradation of externally available Transporters mediating such a sulfite efflux have not yet sulfite. The A. vinosum genome contains an array of genes been described for purple sulfur bacteria. Putative encoding putative (ABC) transporters that could in permeases resembling sulfite exporters of the TauE/SafE principle serve such a function and work together with a family (Pfam accession no. PF01925) (Weinitschke et al., sulfite-binding protein. Once in the cytoplasm, sulfite is 2007; Krejcˇı´k et al., 2008) are encoded in some purple immediately oxidized to sulfate via the direct SoeABC and/ sulfur bacteria including A. vinosum (Alvin_1107), but not or the indirect APS reductase pathway. At present, we in all genome-sequenced members of this group. Other cannot discount the possibility that sulfite is also taken up described sulfite efflux pumps stem from fungal sources, e.g. into the cytoplasm in the absence of SoxYZ – albeit with a SSU1 from Saccharomyces cerevisiae (Park & Bakalinsky, significantly slower rate – as the DsoxY mutant shows 2000; Nardi et al., 2010) or Aspergillus fumigatus (Le´chenne residual sulfite-oxidizing capability under light-limited et al., 2007). However, genes encoding closely related conditions (Table S1). proteins are not present in the currently sequenced purple sulfur bacteria with the exception of Thiorhodococcus We also present a model for the interplay of SoxYZ and drewsii. Once sulfite anions reach the periplasm, they are cytoplasmic sulfite oxidation when sulfide, the most readily possibly bound by SoxYZ just as outlined above. available substrate in its natural habitat, is metabolized by A. vinosum. Here, the picture is much more complicated. It We considered the possibility that either the SoxY-Cys- was already outlined above that zero-valent sulfur stored in sulfinate could act as a substrate for oxidation to SoxY- sulfur globules is an intermediate during the oxidation of Cys-sulfonate or sulfite could be oxidatively bound to the this most highly reduced sulfur compound to sulfate. conserved cysteine of SoxY in a reaction catalysed by a Sulfite is also a well-established intermediate further periplasmic enzyme other than SoxXA. The membrane- downstream in the process. Although this intermediate is bound trihaem cytochrome c DsrJ would be a candidate for formed in the cytoplasm, it appears to be excreted, i.e. catalysing such a reaction as it contains a putative active transported across the cytoplasmic membrane, to some site similar to that of SoxXA. It has been proposed that extent even by WT cells. This is evidenced by the detection DsrJ catalyses oxidation of a sulfur substrate and uses the released electrons for transmembrane electron transfer to a disulfide of DsrC via the other components of the SoxZY-Cys–+ HSO– DsrMKJOP complex (Grein et al., 2010a, b). However, in 3 such a process, production of each sulfite molecule in the SoxZY-Cys-SO–+ H O 2– Periplasm 2 2 SO4 cytoplasm would require oxidation of exactly one molecule of sulfite in the periplasm. Sulfite oxidation in the MKH MKH AprM 2 SoeC 2 cytoplasm would be obsolete and thus such a mechanism MK MK is discounted. It is more likely that SoxYZ acts as a ‘sulfite + Apr AMP H B H2O buffer’ again shielding periplasmic components from Cytoplasm AprA HSO– MoCo 3 SoeA reaction with free sulfite (see above) and also keeping APS sulfite on hold for reimport into the cytoplasm. We SO2– 2 H+ attribute the accumulation of external sulfite in the DsoxY PP ATP 4 i single mutant to the latter of the proposed functions. When the major cytoplasmic sulfite-oxidizing system is absent (SoeABC) or sulfite oxidation in the cytoplasm is no Fig. 2. Model for oxidation of external sulfite in A. vinosum WT. The thiolate of conserved SoxY-Cys152 is predicted to react with longer possible at all, as in the A. vinosum SoeABC/APS hydrogen sulfite, resulting in the corresponding sulfinate derivative. reductase double mutant, the whole system runs out of Such a mechanism is feasible at moderate pH values as shown by balance even in the presence of SoxYZ and free sulfite starts Steudel & Steudel (2010). The SoxY-sulfinate could then serve as to accumulate outside of the cells in the medium. When a substrate donor for an as-yet unknown sulfite transport system. cells still contain periplasmically stored zero-valent sulfur ” Hydrogen sulfite (HSO3 ) has a pKa of 6.97 and therefore exists in such a situation, this sulfur is in principle accessible to predominantly in the protonated form at the slightly acidic pH of abiotic attack by the strong nucleophile sulfite. Such a the bacterial periplasm. reaction would yield thiosulfate (Roy & Trudinger, 1970; http://mic.sgmjournals.org 2635 C. Dahl and others

Suzuki, 1999). In cells with a complete Sox system, such as ACKNOWLEDGEMENTS the DsoeAEm and the DsoeAEm aprB ::VKm mutants, thiosulfate should still to be completely degraded to sulfate. This work was supported by the Deutsche Forschungsgemeinschaft (grant nos DA351/4-3 and DA351/4-4). The oxidized sulfone group of thiosulfate would be released immediately by SoxB, whilst the sulfane sulfur would be hooked up again to stored sulfur, which would in turn be REFERENCES transformed to cytoplasmic sulfite by the Dsr proteins. Sulfite would then be transported out of the cytoplasm, Bartlett, J. K. & Skoog, D. A. (1954). Colorimetric determination of leading to thiosulfate formation and the same series of elemental sulfur in hydrocarbons. Anal Chem 26, 1008–1011. reactions would restart. Finally, sulfate would be the only Bazaral, M. & Helinski, D. R. (1968). Circular DNA forms of detectable end product. In fact, this is exactly what we colicinogenic factors E1, E2 and E3 from Escherichia coli. J Mol Biol observed in our experiments: degradation of stored sulfur 36, 185–194. took significantly longer in the DsoeAEm and the DsoeAEm Bryantseva, I. A., Gorlenko, V. M., Kompantseva, E. I., Imhoff, J. F., aprB ::VKm mutants than in the WT, and the final product Su¨ ling, J. & Mityushina, L. (1999). Thiorhodospira sibirica gen. nov., in all cases was sulfate. In these cultures, thiosulfate never sp. nov., a new alkaliphilic purple sulfur bacterium from a Siberian soda lake. Int J Syst Bacteriol 49, 697–703. accumulated, whilst this was clearly the case for cells that lacked SoxYZ and could thus not run a complete Sox cycle. Caumette, P., Guyoneaud, R., Imhoff, J. F., Su¨ ling, J. & Gorlenko, V. (2004). Thiocapsa marina sp. nov., a novel, okenone-containing, The only transformation that thiosulfate underwent in purple sulfur bacterium isolated from brackish coastal and marine SoxYZ-deficient cultures was oxidation to tetrathionate environments. Int J Syst Evol Microbiol 54, 1031–1036. catalysed by a completely independent enzyme, thiosulfate D’Errico, G., Di Salle, A., La Cara, F., Rossi, M. & Cannio, R. (2006). dehydrogenase (Denkmann et al., 2012). In the A. vinosum Identification and characterization of a novel bacterial sulfite oxidase triple mutant, neither sulfite nor thiosulfate could be with no heme binding domain from Deinococcus radiodurans. further metabolized, leading to a very significant reduction J Bacteriol 188, 694–701. not only of the rate of degradation, but also of formation of Dahl, C. (1996). Insertional gene inactivation in a phototrophic sulfur globules and furthermore to a complete inability of sulphur bacterium: APS-reductase-deficient mutants of Chromatium the cells to produce sulfate. vinosum. Microbiology 142, 3363–3372. Dahl, C. (2008). Inorganic sulfur compounds as electron donors in Our proposal for a more general role of SoxYZ not only as purple sulfur bacteria. In Sulfur in Phototrophic Organisms, pp. 289–317. a thiosulfate- but also as a sulfite-binding protein goes well Edited by R. Hell, C. Dahl, D. B. Knaff & T. Leustek. Dordrecht: Springer. along with our finding that the respective genes occur even Dahl, C., Engels, S., Pott-Sperling, A. S., Schulte, A., Sander, J., in purple sulfur bacteria that do not contain other sox Lu¨ bbe, Y., Deuster, O. & Brune, D. C. (2005). Novel genes of the dsr genes and have accordingly been reported not to be capable gene cluster and evidence for close interaction of Dsr proteins during of thiosulfate utilization (Table 1). The only exception to sulfur oxidation in the phototrophic sulfur bacterium Allochromatium this pattern is T. mobilis. However, T. mobilis is the only vinosum. J Bacteriol 187, 1392–1404. genome-sequenced purple sulfur bacterium so far that Denkmann, K., Grein, F., Zigann, R., Siemen, A., Bergmann, J., van contains a gene encoding a periplasmic sulfite dehydro- Helmont, S., Nicolai, A., Pereira, I. A. C. & Dahl, C. (2012). Thiosulfate dehydrogenase: a widespread unusual acidophilic c-type cytochrome. genase of the SorA type. It is thus tempting to speculate Environ Microbiol 14, 2673–2688. that the periplasmic sulfite-binding SoxYZ is not necessary Friedrich, C. G., Rother, D., Bardischewsky, F., Quentmeier, A. & in the presence of a periplasmic sulfate-forming enzyme. Fischer, J. (2001). Oxidation of reduced inorganic sulfur compounds Obviously, purple sulfur bacteria are equipped with by bacteria: emergence of a common mechanism? Appl Environ different modules, and thereby means, to cope with Microbiol 67, 2873–2882. externally available and internally generated sulfite. Frigaard, N.-U. & Bryant, D. A. (2008). Genomic insights into the sulfur metabolism of phototrophic green sulfur bacteria. In Sulfur Metabolism in Phototrophic Organisms, pp. 337–355. Edited by R. Hell, Conclusions C. Dahl, D. B. Knaff & T. Leustek. Dordrecht: Springer. The results presented in this study clearly show that the Frigaard, N.-U. & Dahl, C. (2008). Sulfur metabolism in phototrophic membrane-bound, cytoplasmically oriented iron–sulfur sulfur bacteria. Adv Microb Physiol 54, 103–200. molybdoprotein SoeABC plays a major role in the oxidation Gregersen, L. H., Bryant, D. A. & Frigaard, N.-U. (2011). Mechanisms of sulfite in the cytoplasm of A. vinosum, and very probably and evolution of oxidative sulfur metabolism in green sulfur bacteria. also in other phototrophic and chemotrophic bacteria. The Front Microbiol 2, 116. periplasmic SoxYZ protein and the cytoplasmic sulfite- Grein, F., Pereira, I. A. C. & Dahl, C. (2010a). Biochemical oxidizing enzymes are needed in parallel for effective sulfite characterization of individual components of the Allochromatium oxidation in A. vinosum, suggesting some kind of interplay vinosum DsrMKJOP transmembrane complex aids understanding of complex function in vivo. J Bacteriol 192, 6369–6377. between these systems despite their localization in two Grein, F., Venceslau, S. S., Schneider, L., Hildebrandt, P., Todorovic, different cellular compartments. While the exact function of S., Pereira, I. A. C. & Dahl, C. (2010b). DsrJ, an essential part of the SoxYZ in sulfite oxidation remains elusive at this point, it is DsrMKJOP transmembrane complex in the purple sulfur bacterium tempting to speculate that it acts as a periplasmic sulfite- Allochromatium vinosum, is an unusual triheme cytochrome c. binding protein. Biochemistry 49, 8290–8299.

2636 Microbiology 159 Sulfite oxidation in A. vinosum

Grein, F., Ramos, A. R., Venceslau, S. S. & Pereira, I. A. C. (2013). Krejcˇ´ık, Z., Denger, K., Weinitschke, S., Hollemeyer, K., Paces, V., Unifying concepts in anaerobic respiration: insights from dissimilat- Cook, A. M. & Smits, T. H. M. (2008). Sulfoacetate released during the ory sulfur metabolism. Biochim Biophys Acta 1827, 145–160. assimilation of taurine-nitrogen by Neptuniibacter caesariensis: Heinzinger, N. K., Fujimoto, S. Y., Clark, M. A., Moreno, M. S. & purification of sulfoacetaldehyde dehydrogenase. Arch Microbiol Barrett, E. L. (1995). Sequence analysis of the phs operon in 190, 159–168. Salmonella typhimurium and the contribution of thiosulfate reduction Laska, S., Lottspeich, F. & Kletzin, A. (2003). Membrane-bound to anaerobic energy metabolism. J Bacteriol 177, 2813–2820. hydrogenase and sulfur reductase of the hyperthermophilic and Hensel, M., Hinsley, A. P., Nikolaus, T., Sawers, G. & Berks, B. C. acidophilic archaeon Acidianus ambivalens. Microbiology 149, 2357–2371. (1999). The genetic basis of tetrathionate respiration in Salmonella Le´ chenne, B., Reichard, U., Zaugg, C., Fratti, M., Kunert, J., Boulat, O. typhimurium. Mol Microbiol 32, 275–287. & Monod, M. (2007). Sulphite efflux pumps in Aspergillus fumigatus Hensen, D., Sperling, D., Tru¨ per, H. G., Brune, D. C. & Dahl, C. and dermatophytes. Microbiology 153, 905–913. (2006). Thiosulphate oxidation in the phototrophic sulphur bac- Leenhouts, K. J., Kok, J. & Venema, G. (1990). Stability of integrated terium Allochromatium vinosum. Mol Microbiol 62, 794–810. plasmids in the chromosome of Lactococcus lactis. Appl Environ Hipp, W. M., Pott, A. S., Thum-Schmitz, N., Faath, I., Dahl, C. & Microbiol 56, 2726–2735. Tru¨ per, H. G. (1997). Towards the phylogeny of APS reductases and Lehmann, S., Johnston, A. W. B., Curson, A. R. J., Todd, J. D. & Cook, sirohaem sulfite reductases in sulfate-reducing and sulfur-oxidizing A. M. (2012). SoeABC, a novel sulfite dehydrogenase in the prokaryotes. Microbiology 143, 2891–2902. Roseobacters? In Programme & Abstract Book EMBO Workshop on Horton, R. M. (1995). PCR-mediated recombination and mutagenesis. Microbial Sulfur Metabolism, Noordwijkerhout, p. 29. Mol Biotechnol 3, 93–99. Lenk, S., Moraru, C., Hahnke, S., Arnds, J., Richter, M., Kube, M., Imhoff, J. F. (2005a). Family I. Chromatiaceae Bavendamm 1924, Reinhardt, R., Brinkhoff, T., Harder, J. & other authors (2012). 125AL emend. Imhoff 1984b, 339. In Bergey’s Manual of Systematic Roseobacter clade bacteria are abundant in coastal sediments and Bacteriology, pp. 3–40. Edited by D. J. Brenner, N. R. Krieg, J. T. Staley encode a novel combination of sulfur oxidation genes. ISME J 6, & G. M. Garrity. New York: Springer. 2178–2187. Imhoff, J. F. (2005b). Family II. Ectothiorhodospiraceae Imhoff Lu¨ bbe, Y. J., Youn, H.-S., Timkovich, R. & Dahl, C. (2006). 1984b, 339VP.InBergey’s Manual of Systematic Bacteriology, pp. 41– Siro(haem)amide in Allochromatium vinosum and relevance of DsrL 57. Edited by D. J. Brenner, N. R. Krieg, J. T. Staley & G. M. Garrity. and DsrN, a homolog of cobyrinic acid a,c-diamide synthase, for New York: Springer. sulphur oxidation. FEMS Microbiol Lett 261, 194–202. Imhoff, J. F., Su¨ ling, J. & Petri, R. (1998). Phylogenetic relationships Meyer, B. & Kuever, J. (2007). Molecular analysis of the distribution among the Chromatiaceae, their taxonomic reclassification and and phylogeny of dissimilatory adenosine-59-phosphosulfate reduc- description of the new genera Allochromatium, Halochromatium, tase-encoding genes (aprBA) among sulfur-oxidizing prokaryotes. Isochromatium, Marichromatium, Thiococcus, Thiohalocapsa, and Microbiology 153, 3478–3498. Thermochromatium. Int J Syst Bacteriol 48, 1129–1143. Meyer, B., Imhoff, J. F. & Kuever, J. (2007). Molecular analysis of the Jormakka, M., Yokoyama, K., Yano, T., Tamakoshi, M., Akimoto, S., distribution and phylogeny of the soxB gene among sulfur-oxidizing Shimamura, T., Curmi, P. & Iwata, S. (2008). Molecular mechanism bacteria – evolution of the Sox sulfur oxidation enzyme system. of energy conservation in polysulfide respiration. Nat Struct Mol Biol Environ Microbiol 9, 2957–2977. 15, 730–737. Nardi, T., Corich, V., Giacomini, A. & Blondin, B. (2010). A sulphite- Kappler, U. & Bailey, S. (2005). Molecular basis of intramolecular inducible form of the sulphite efflux gene SSU1 in a Saccharomyces electron transfer in sulfite-oxidizing enzymes is revealed by high cerevisiae wine yeast. Microbiology 156, 1686–1696. resolution structure of a heterodimeric complex of the catalytic Parey, K., Demmer, U., Warkentin, E., Wynen, A., Ermler, U. & Dahl, molybdopterin subunit and a c-type cytochrome subunit. J Biol Chem C. (2013). Structural, biochemical and genetic characterization of 280, 24999–25007. ATP sulfurylase from Allochromatium vinosum. PLoS ONE 8, e74707. Kappler, U. & Maher, M. J. (2013). The bacterial SoxAX cytochromes. Park, H. & Bakalinsky, A. T. (2000). SSU1 mediates sulphite efflux in Cell Mol Life Sci 70, 977–992. Saccharomyces cerevisiae. Yeast 16, 881–888. Kappler, U., Bennett, B., Rethmeier, J., Schwarz, G., Deutzmann, R., Pattaragulwanit, K. & Dahl, C. (1995). Development of a genetic McEwan, A. G. & Dahl, C. (2000). Sulfite : cytochrome c oxido- system for a purple sulfur bacterium: conjugative plasmid transfer in reductase from Thiobacillus novellus. Purification, characterization, Chromatium vinosum. Arch Microbiol 164, 217–222. and molecular biology of a heterodimeric member of the sulfite Pattaragulwanit, K., Brune, D. C., Tru¨ per, H. G. & Dahl, C. (1998). oxidase family. J Biol Chem 275, 13202–13212. Molecular genetic evidence for extracytoplasmic localization of sulfur Kelly, D. P., Chambers, L. A. & Trudinger, P. A. (1969). Cyanolysis and globules in Chromatium vinosum. Arch Microbiol 169, 434–444. spectrophotometric estimation of trithionate in mixture with Pfennig, N. & Tru¨ per, H. G. (1992). The family Chromatiaceae. In The thiosulfate and tetrathionate. Anal Chem 41, 898–901. Prokaryotes. A Handbook on the Biology of Bacteria: Ecophysiology, Kisker, C., Schindelin, H., Baas, D., Re´ tey, J., Meckenstock, R. U. & Isolation, Identification, Applications, pp. 3200–3221. Edited by Kroneck, P. M. (1998). A structural comparison of molybdenum A. Balows, H. G. Tru¨per, M. Dworkin, W. Harder & K.-H. Schleifer. cofactor-containing enzymes. FEMS Microbiol Rev 22, 503–521. New York: Springer. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Pott, A. S. & Dahl, C. (1998). Sirohaem sulfite reductase and other Roop, R. M., II & Peterson, K. M. (1995). Four new derivatives of the proteins encoded by genes at the dsr locus of Chromatium vinosum are broad-host-range cloning vector pBBR1MCS, carrying different involved in the oxidation of intracellular sulfur. Microbiology 144, antibiotic-resistance cassettes. Gene 166, 175–176. 1881–1894. Krafft, T., Bokranz, M., Klimmek, O., Schro¨ der, I., Fahrenholz, F., Prange, A., Engelhardt, H., Tru¨ per, H. G. & Dahl, C. (2004). The role Kojro, E. & Kro¨ ger, A. (1992). Cloning and nucleotide sequence of the of the sulfur globule proteins of Allochromatium vinosum: mutagen- psrA gene of Wolinella succinogenes polysulphide reductase. Eur J esis of the sulfur globule protein genes and expression studies by real- Biochem 206, 503–510. time RT-PCR. Arch Microbiol 182, 165–174. http://mic.sgmjournals.org 2637 C. Dahl and others

Ramos, A. R., Keller, K. L., Wall, J. D. & Pereira, I. A. C. (2012). The Simon, J. & Kern, M. (2008). Quinone-reactive proteins devoid of membrane QmoABC complex interacts directly with the dissimilatory haem b form widespread membrane-bound electron transport adenosine 59-phosphosulfate reductase in sulfate reducing bacteria. modules in bacterial respiration. Biochem Soc Trans 36, 1011–1016. Front Microbiol 3, 137. Simon, J. & Kroneck, P. M. (2013). Microbial sulfite respiration. Adv Reinartz, M., Tscha¨ pe, J., Bru¨ ser, T., Tru¨ per, H. G. & Dahl, C. (1998). Microb Physiol 62, 45–117. Sulfide oxidation in the phototrophic sulfur bacterium Chromatium Simon, R., Priefer, U. & Pu¨ hler, A. (1983). A broad host range vinosum. Arch Microbiol 170, 59–68. mobilization system for in vivo genetic engineering: transposon Rethmeier, J., Rabenstein, A., Langer, M. & Fischer, U. (1997). mutagenesis in gram negative bacteria. Biotechnology (N Y) 1, 784– Detection of traces of oxidized and reduced sulfur compounds in 791. small samples by combination of different high- performance liquid Steudel, R. & Steudel, Y. (2010). Derivatives of cysteine related to the chromatography methods. J Chromatogr A 760, 295–302. thiosulfate metabolism of sulfur bacteria by the multi-enzyme Rodriguez, J., Hiras, J. & Hanson, T. E. (2011). Sulfite oxidation in complex ‘‘Sox’’ studied by B3LYP-PCM and G3X(MP2) calculations. Chlorobaculum tepidum. Front Microbiol 2, 112. Phys Chem Chem Phys 12, 630–644. Rother, D., Henrich, H. J., Quentmeier, A., Bardischewsky, F. & Suzuki, I. (1999). Oxidation of inorganic sulfur compounds: chemical Friedrich, C. G. (2001). Novel genes of the sox gene cluster, and enzymatic reactions. Can J Microbiol 45, 97–105. mutagenesis of the flavoprotein SoxF, and evidence for a general Weaver, P. F., Wall, J. D. & Gest, H. (1975). Characterization of sulfur-oxidizing system in Paracoccus pantotrophus GB17. J Bacteriol Rhodopseudomonas capsulata. Arch Microbiol 105, 207–216. 183, 4499–4508. Weinitschke, S., Denger, K., Cook, A. M. & Smits, T. H. M. (2007). The Roy, A. B. & Trudinger, P. A. (1970). The Biochemistry of Inorganic DUF81 protein TauE in Cupriavidus necator H16, a sulfite exporter in Compounds of Sulfur. London: Cambridge University Press. the metabolism of C2 sulfonates. Microbiology 153, 3055–3060. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: Weissgerber, T., Zigann, R., Bruce, D., Chang, Y.-J., Detter, J. C., Han, a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring C., Hauser, L., Jeffries, C. D., Land, M. & other authors (2011). (T) Harbor Laboratory Press. Complete genome sequence of Allochromatium vinosum DSM 180 . Stand Genomic Sci 5, 311–330. Sa´ nchez, O., Ferrera, I., Dahl, C. & Mas, J. (2001). In vivo role of adenosine-59-phosphosulfate reductase in the purple sulfur bacterium Weissgerber, T., Dobler, N., Polen, T., Latus, J., Stockdreher, Y. & Allochromatium vinosum. Arch Microbiol 176, 301–305. Dahl, C. (2013). Genome-wide transcriptional profiling of the purple sulfur bacterium Allochromatium vinosum DSM 180T during growth Sander, J., Engels-Schwarzlose, S. & Dahl, C. (2006). Importance of on different reduced sulfur compounds. J Bacteriol 195, 4231–4245. the DsrMKJOP complex for sulfur oxidation in Allochromatium Welte, C., Hafner, S., Kra¨ tzer, C., Quentmeier, A. T., Friedrich, C. G. & vinosum and phylogenetic analysis of related complexes in other Dahl, C. (2009). Interaction between Sox proteins of two physio- prokaryotes. Arch Microbiol 186, 357–366. logically distinct bacteria and a new protein involved in thiosulfate Sauve´ , V., Bruno, S., Berks, B. C. & Hemmings, A. M. (2007). The oxidation. FEBS Lett 583, 1281–1286. SoxYZ complex carries sulfur cycle intermediates on a peptide Wilson, J. J. & Kappler, U. (2009). Sulfite oxidation in Sinorhizobium swinging arm. J Biol Chem 282, 23194–23204. meliloti. Biochim Biophys Acta 1787, 1516–1525. Scha¨ fer, A., Tauch, A., Ja¨ ger, W., Kalinowski, J., Thierbach, G. & Zaar, A., Fuchs, G., Golecki, J. R. & Overmann, J. (2003). A new Pu¨ hler, A. (1994). Small mobilizable multi-purpose cloning vectors purple sulfur bacterium isolated from a littoral microbial mat, derived from the Escherichia coli plasmids pK18 and pK19: selection Thiorhodococcus drewsii sp. nov. Arch Microbiol 179, 174–183. of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69–73. Edited by: D. Kelly

2638 Microbiology 159