DOCSLIB.ORG

Morphological and Molecular Diagnostic Characters Reveal a New Species of Pachyphytum(Crassulaceae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

14Haseltonia 26: 14–22. 2019 Haseltonia 26: 14–22. 201914 Morphological and molecular diagnostic characters reveal a new species of Pachyphytum (Crassulaceae) Jerónimo Reyes Santiago1, Luis E. de La Cruz-López2*, Maria Kuzmina3, & Francisco Ver- gara-Silva1* 1 Jardín Botánico, Instituto de Biología, Universidad Nacional Autónoma de México. Circuito exterior s/n, Ciudad Universitaria, Copilco, Coyoacán, C.P. 04510, Ciudad de México, Mexico. 2 Posgrado en Ciencias Biológicas, Instituto de Biología, Universidad Nacional Autónoma de México. Av. Ciudad Universitaria 3000, C.P. 04360, Coyoacán, Ciudad de México, Mexico. 3 Centre for Biodiversity & Genomics, Biodiversity Institute of Ontario. University of Guelph, ON N1G 2W1, Ontario, Canada. * Authors for correspondence: [email protected]; [email protected] Manuscript received 26th October 2018 Abstract: Pachyphytum viscidum (Crassulaceae: Saxifragales) is described as a new species to science. The speci- mens analyzed come from the Sierra de Santa Bárbara, Guanajuato, Mexico. Some morphological diagnostic characters for the new species are: sticky stems and leaves; dark green leaves; absence of wax on all their or- gans; and pale pink flowers. The new species is placed in the section Diotostemon of the genus, with pos- sible proximity to P. brevifolium and P. hookeri. DNA sequence analysis from the matK and rbcL chloroplast regions, as well as ITS2 nuclear loci, revealed the presence of molecular diagnostic sites which, in addition to the aforementioned morphological character states, further support the taxonomic description as well as future integrative taxonomy studies in Mexican Crassulaceae. Resumen: Se describe a Pachyphytum viscidum (Crassulaceae: Saxifragales) como una especie nueva para la ciencia. Los especímenes analizados provienen de la Sierra de Santa Bárbara, Guanajuato, México. Algunos caracteres morfológicos diagnósticos para esta especie son: sus tallos y hojas glutinosas; hojas verde oscuro; la ausencia de cera en sus órganos; y el color rosa tenue de sus flores. Se le ubica dentro de la sección Diotoste- mon, en posible cercanía con P. brevifolium y P. hookeri. El análisis de secuencias de ADN de las regiones del cloroplasto matK y rbcL, así como del locus nuclear ITS2, reveló la presencia de sitios diagnósticos molecula- res que, en adición a los morfológicos, también apoyan la descripción taxonómica así como estudios futuros de taxonomía integrativa en Crassulaceae de México. Keywords: Crassulaceae, character-based DNA barcoding, integrative taxonomy, ITS2, matK, Pachyphytum INTRODUCTION Moran´s nor Thiede´s groupings match García- Ruíz´s results. The genus Pachyphytum (Crassulaceae) was pro- A recent molecular phylogenetic analysis of the posed by Link, Klotzsch et Otto (Klotzsch, 1841) genus Echeveria and related genera including Pachy- with P. bracteosum Klotzsch (Moran, 1989) as the phytum, based on a combined DNA matrix of rbcL, type species. Moran (1968) recognized three sec- matK and ITS2 genomic regions, retrieved the lat- tions based on morphological affinities: Pachyphytum, ter genus as a monophyletic group (Cruz-López et Diotostemon and Ixiocaulon. Later, J. Thiede (in Eggli, al., 2019) sister to the rest of Cremnophila, Echeve- 2003) merged the species of sect. Ixiocaulon into sect. ria, Graptopetalum, and some Sedum and Thompson- Pachyphytum, resulting in only two sections: Diotoste- ella species. Another significant result of this work mon and Pachyphytum. Genetic distance-based clas- indicated that Pachyphytum cuicatecanum (J.Reyes, sification of the genus employing AFLP molecular Joel Pérez & Brachet) Kimnach is closely related to markers suggested two groups inside Pachyphytum several Echeveria species (E. penduliflora and oth- (García-Ruíz 2003). In this classification, group A ers) and clearly do not belong to Pachyphytum, de- included species P. bracteosum, P. brevifolium, P. glu- spite sharing many morphological character states. tinicaule, P. hookeri, P. longifolium, and P. oviferum; Nevertheless, low resolution problems do not allow while group B incorporated P. caesium, P. coeruleum, the identification of groups (sections) inside Pachy- P. compactum, P. contrerasii, P. fittkaui, P. garciae, P. phytum. Previous studies on the “Echeveria Group” kimnachii, P. machucae, P. rzedowskii, P. viride, and (Carrillo-Reyes et al., 2009; Vázquez-Cotero et al., P. werdermannii. It should be noted that neither 2017) also recovered Pachyphytum as a monophyletic Author Copy HASELTONIA 26. 2019 15 Table 1. GenBank accession numbers for the taxa sampled. Taxa/locus rbcL matK ITS2 BOLD ID P. brachetii J.Reyes, O.González & A.Gut. MG220464.1 MG220520.1 MG217180.1 JE-4350 P. bracteosum Link, Klotzsch & Otto MG220447.1 MG220503.1 MG217163.1 JE-6275 P. brevifolium Rose MG220451.1 MG220507.1 MG217167.1 JE-5048 P. caesium Kimnach & Moran MG220475.1 MG220531.1 MG217191.1 JE-5185 P. compactum Rose MG521706.1 MG521586.1 MG521432.1 JE-5273 P. contrerasii Pérez-Calix, I.García & Cházaro MG521760.1 MG521636.1 MG521484.1 JE-5627 P. fittkaui Moran MG521807.1 MG521675.1 MG521528.1 JE-5237 P. garciae Pérez-Calix & Glass MG521764.1 MG521639.1 MG521488.1 JE-5885 P. glutinicaule Moran MG521736.1 MG521613.1 MG521461.1 JE-5653 P. hookeri A.Berger MG521819.1 MG521687.1 MG521539.1 JE-5036 P. kimnachii Moran MG521809.1 MG521677.1 MG521530.1 JE-5305 P. longifolium Rose MG521693.1 MG521573.1 MG521419.1 JE-6276 P. machucae I.García, Glass & Cházaro MG521768.1 MG521643.1 MG521492.1 JE-5071 P. oviferum J.A.Purpus MG521718.1 MG521597.1 MG521444.1 JE-6038 P. rzedowskii I.García, Pérez-Calix & J.Meyrán MG521770.1 MG521645.1 MG521494.1 JE-5562 P. saltense Brachet, J.Reyes & Mondragón MG521799.1 MG521670.1 MG521521.1 JE-3644 P. viscidum sp. nov. MG521795.1 MG521666.1 MG521518.1 JE-5043 P. viride E.Walther MG521815.1 MG521683.1 MG521535.1 JE-5873 P. werdermannii Poelln. MG521785.1 MG521657.1 MG521509.1 JE-5451 group, resting on partial species sampling. Histori- this national collection program, botanical explora- cally, the placement of taxa in infrageneric catego- tions were necessary, as well as the cultivation and ries (sections) has been complicated, because there maintenance of species of different genera with a is often little congruence between morphological, geo-referenced database. During fieldwork, the genus biogeographic and DNA datasets; this discrepancy Pachyphytum received primary attention. The work between different sources of evidence may have con- with the collection has received a great impulse from trasting explanations (e.g. recent diversification vs. Christian Brachet, member of the Mexican Cactus decoupling between molecular and morphological Society (Sociedad Mexicana de Cactología, A.C.), evolution). who has provided significant help with the logistics The most outstanding character states of Pachy- of the explorations and with finding information phytum are: presence of membranous scale-like struc- about the type localities of the known species. tures known as appendages on the inside of every The present paper derives from the “Crassulaceae petal, one on each side of the epipetalous filaments of Mexico” (“Crasuláceas de México”) long-term re- although, some Echeveria species also possess ap- search project, based on the National Crassulaceae pendages (E. heterosepala, E. longissima var. longis- Collection and hosted by JB-IBUNAM. A primary sima, E. dactylifera, E. purhepecha, E. rulfiana, among aim of this project has been the gradual construction many others); pronounced succulence of the leaves; of a DNA barcoding reference library for Mexican and pendant scorpioid cymose inflorescences (Reyes Crassulaceae, to be linked with other datasets in an et al., 2007). At present, the genus consists of 24 integrative taxonomy (DeSalle et al., 2005; Gold- described species — based on morphological, phe- stein and DeSalle, 2011) framework. Character- nological, ecological and geographical distribution based methods, such as CAOS (Sarkar et al., 2008), aspects — all endemic to Mexico and distributed have been given preference to establish DNA bar- mainly in central and western regions of this country. codes, as they allow the definition of discrete DNA In 2003, a collection of living plants of the fam- diagnostics compatible with apomorphic, morpho- ily Crassulaceae (Saxifragales: Rosidae) was started at logical character states. the Jardín Botánico, Instituto de Biología, Univer- The species described here was first located near sidad Nacional Autónoma de México. In 2005, the La Presita at the base of the Sierra de Santa Bárbara, Mexican Association of Botanical Gardens (Aso- Guanajuato, in May of 2004 by the team of Chris- ciación Mexicana de Jardines Botánicos) declared tian Brachet, Joel Pérez Crisanto, Roxana Mon- this collection as “Colección Nacional” (National dragón, and Jerónimo Reyes Santiago. The discovery Collection), representing 70% of the Crassulaceae was made during a trip to locate populations of Ech- species known in Mexico. For the establishment of everia calderoniae Perez-Calix growing in the same Author Copy 16 REYES SANTIAGO ET AL. — DIAGNOSTICS OF A NEW PACHYPHYTUM Table 2. Primer sequences and PCR thermocycler programs used to amplify DNA fragments. Primer Sequence Program rbcLa-F ATGTCACCACAAACAGAGACTAAAGC 94°C for 4 min; 35 cycles of 94°C for 30 sec, 55°C for 30 sec, rbcLa-R GTAAAATCAAGTCCACCRCG 72°C for 1 min; final extension 72°C for 10 min. MatK-1RKIM-f ACCCAGTCCATCTGGAAATCTTGGTTC 94°C for 1 min; 35 cycles of 94°C for 30 sec, 52°C for 20 sec, MatK-3FKIM-r CGTACAGTACTTTTGTGTTTACGAG 72°C for 50 sec; final extension 72°C for 5 min. ITS2-S2F ATGCGATACTTGGTGTGAAT 94°C for 5 min; 35 cycles of 94°C for 30 sec, 56°C for 30 sec, ITS4 TCCTCCGCTTATTGATATGC 72°C for 45 sec; final extension 72°C for 10 min. Table 3. Molecular diagnostic sites summary for Pachyphytum viscidum and the sampled species of Pachyphytum. Loci rbcL matK ITS2 Taxa/Site 376 50 114 159 198 357 591 624 636 754 820 144 298 388 439 440 P. brachetii C C G T T C C G C A A C C T C C P. bracteosum C C G T A C C G C A A A C C C C P.
Recommended publications
  • The 2014 Golden Gate National Parks Bioblitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event

    The 2014 Golden Gate National Parks Bioblitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event

    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science The 2014 Golden Gate National Parks BioBlitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event Natural Resource Report NPS/GOGA/NRR—2016/1147 ON THIS PAGE Photograph of BioBlitz participants conducting data entry into iNaturalist. Photograph courtesy of the National Park Service. ON THE COVER Photograph of BioBlitz participants collecting aquatic species data in the Presidio of San Francisco. Photograph courtesy of National Park Service. The 2014 Golden Gate National Parks BioBlitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event Natural Resource Report NPS/GOGA/NRR—2016/1147 Elizabeth Edson1, Michelle O’Herron1, Alison Forrestel2, Daniel George3 1Golden Gate Parks Conservancy Building 201 Fort Mason San Francisco, CA 94129 2National Park Service. Golden Gate National Recreation Area Fort Cronkhite, Bldg. 1061 Sausalito, CA 94965 3National Park Service. San Francisco Bay Area Network Inventory & Monitoring Program Manager Fort Cronkhite, Bldg. 1063 Sausalito, CA 94965 March 2016 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado, publishes a range of reports that address natural resource topics. These reports are of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Report Series is used to disseminate comprehensive information and analysis about natural resources and related topics concerning lands managed by the National Park Service.
  • April 2019 on the Dry Side

    April 2019 on the Dry Side

    1 Volume 33 Issue 4 On the Dry Side Newsletter of the Monterey Bay Area Cactus & Succulent April 2019 Society Contents President’s Message Early reports indicate that our 2019 Spring Show was a great success. We will have more information on this experience during our April meeting, and will express thanks to the several people who provided leadership and willing hands for this important event. Contents 1 Our Show & Sale provides great opportunities for our members to sell their plants and display Pres. Message 1 their exceptional specimens. Board Minutes 2 This activity also enables our society to serve the growing number of succulent gardeners and April Program 3 raise funds to support services to members throughout the year. April Mini-Show 4 You have undoubtedly noticed that this issue of On the Dry Side is both later than usual and March Mini-Show 5 different in appearance. Also, due to technical issues, this issue does not include March Mini- CSSA Show & Sale 6 show Winners. These changes have resulted from the hassle of working with a recent update of computer software. Microsoft Office 365 appears to provide many desirable new capabilities, Open Greenhouse 7 and definitely requires time on the learning curve. Show Winners 8 Our April meeting will feature Stan Verkler’s talk about his recent visit to South Africa. Spring Sale Pics 9 This will be another interesting and informative presentation that adds substantial value to our Officers, Chairs 10 monthly meetings, along with the enjoyment of getting together with friends and growers of succulent plants.
  • Outline of Angiosperm Phylogeny

    Outline of Angiosperm Phylogeny

    Outline of angiosperm phylogeny: orders, families, and representative genera with emphasis on Oregon native plants Priscilla Spears December 2013 The following listing gives an introduction to the phylogenetic classification of the flowering plants that has emerged in recent decades, and which is based on nucleic acid sequences as well as morphological and developmental data. This listing emphasizes temperate families of the Northern Hemisphere and is meant as an overview with examples of Oregon native plants. It includes many exotic genera that are grown in Oregon as ornamentals plus other plants of interest worldwide. The genera that are Oregon natives are printed in a blue font. Genera that are exotics are shown in black, however genera in blue may also contain non-native species. Names separated by a slash are alternatives or else the nomenclature is in flux. When several genera have the same common name, the names are separated by commas. The order of the family names is from the linear listing of families in the APG III report. For further information, see the references on the last page. Basal Angiosperms (ANITA grade) Amborellales Amborellaceae, sole family, the earliest branch of flowering plants, a shrub native to New Caledonia – Amborella Nymphaeales Hydatellaceae – aquatics from Australasia, previously classified as a grass Cabombaceae (water shield – Brasenia, fanwort – Cabomba) Nymphaeaceae (water lilies – Nymphaea; pond lilies – Nuphar) Austrobaileyales Schisandraceae (wild sarsaparilla, star vine – Schisandra; Japanese
  • Alphabetical Lists of the Vascular Plant Families with Their Phylogenetic

    Alphabetical Lists of the Vascular Plant Families with Their Phylogenetic

    Colligo 2 (1) : 3-10 BOTANIQUE Alphabetical lists of the vascular plant families with their phylogenetic classification numbers Listes alphabétiques des familles de plantes vasculaires avec leurs numéros de classement phylogénétique FRÉDÉRIC DANET* *Mairie de Lyon, Espaces verts, Jardin botanique, Herbier, 69205 Lyon cedex 01, France - [email protected] Citation : Danet F., 2019. Alphabetical lists of the vascular plant families with their phylogenetic classification numbers. Colligo, 2(1) : 3- 10. https://perma.cc/2WFD-A2A7 KEY-WORDS Angiosperms family arrangement Summary: This paper provides, for herbarium cura- Gymnosperms Classification tors, the alphabetical lists of the recognized families Pteridophytes APG system in pteridophytes, gymnosperms and angiosperms Ferns PPG system with their phylogenetic classification numbers. Lycophytes phylogeny Herbarium MOTS-CLÉS Angiospermes rangement des familles Résumé : Cet article produit, pour les conservateurs Gymnospermes Classification d’herbier, les listes alphabétiques des familles recon- Ptéridophytes système APG nues pour les ptéridophytes, les gymnospermes et Fougères système PPG les angiospermes avec leurs numéros de classement Lycophytes phylogénie phylogénétique. Herbier Introduction These alphabetical lists have been established for the systems of A.-L de Jussieu, A.-P. de Can- The organization of herbarium collections con- dolle, Bentham & Hooker, etc. that are still used sists in arranging the specimens logically to in the management of historical herbaria find and reclassify them easily in the appro- whose original classification is voluntarily pre- priate storage units. In the vascular plant col- served. lections, commonly used methods are systema- Recent classification systems based on molecu- tic classification, alphabetical classification, or lar phylogenies have developed, and herbaria combinations of both.
  • The Huntington Botanical Gardens) Who Was Employed at the UC Garden at the Time

    The Huntington Botanical Gardens) Who Was Employed at the UC Garden at the Time

    June 30, 2005 Gary Lyons, Editor-in-Chief Joanne Gram, Editor Welcome to The Jumping Cholla. Click on the titles below to go directly to each article, or simply read the articles in order by scrolling down. Most photos may be viewed in a larger size if you click on them. When you want to return to the newsletter, just click on your Back button. If you have questions or comments, please feel free to email the editors by clicking on their names above. That will open a blank email pre-addressed to them. Contents Yuccas in the Huntington Desert Garden Milieu The Weird and Wonderful Boojum Tree, Fouquieria columnaris, and its Relatives Curator’s Comments New Additions to the Huntington's Website and a Little Desert Collections History Yuccas in the Huntington Desert Garden Milieu by Gary Lyons, Curator of the Desert Garden The spiky-leaved yuccas are among the oldest plants in the Huntington landscape. Plantings dating back to 1908 and still thriving give the garden much of its character. Their bright festive panicles of white blossoms add a cheery background and accent to the symphony of spring color in the lower Desert Garden. According to the latest authorities there are 45 yucca species and 14 varieties and they are placed in the agave family. Most of the species are found in the Southwest, northern and central Mexico and Baja California. But the genus is more widespread with species found along the Atlantic seaboard, the Great Plains, into Canada, and south as far as Guatemala. Yucca blossoms, with the exception of at least one species (the rose-tinged Yucca endlichiana) are mostly creamy white.
  • Crassulaceae, Eurytoma Bryophylli, Fire, Invasions, Madagascar, Osphilia Tenuipes, Rhembastus Sp., Soil

    Crassulaceae, Eurytoma Bryophylli, Fire, Invasions, Madagascar, Osphilia Tenuipes, Rhembastus Sp., Soil

    B I O L O G I C A L C O N T R O L O F B R Y O P H Y L L U M D E L A G O E N S E (C R A S S U L A C E A E) Arne Balder Roderich Witt A thesis submitted to the Faculty of Science, University of the Witwatersrand, Johannesburg, in fulfillment of the requirements for the degree of Doctor of Philosophy JOHANNESBURG, 2011 DECLARATION I declare that this thesis is my own, unaided work. It is being submitted for the Degree of Doctor of Philosophy in the University of the Witwatersrand, Johannesburg. It has not been submitted before for any degree or any other examination in any other University. ______________________ ______ day of ______________________ 20_____ ii ABSTRACT Introduced plants will lose interactions with natural enemies, mutualists and competitors from their native ranges, and possibly gain interactions with new species, under new abiotic conditions in their new environment. The use of biocontrol agents is based on the premise that introduced species are liberated from their natural enemies, although in some cases introduced species may not become invasive because they acquire novel natural enemies. In this study I consider the potential for the biocontrol of Bryophyllum delagoense, a Madagascan endemic, and hypothesize as to why this plant is invasive in Australia and not in South Africa. Of the 33 species of insects collected on B. delagoense in Madagascar, three species, Osphilia tenuipes, Eurytoma bryophylli, and Rhembastus sp. showed potential as biocontrol agents in Australia.
  • La Familia Crassulaceae En La Flora Alóctona Valenciana

    La Familia Crassulaceae En La Flora Alóctona Valenciana

    Monografías de la revista Bouteloua, 4 La familia Crassulaceae en la flora alóctona valenciana Daniel Guillot Ortiz, Emilio Laguna Lumbreras & Josep Antoni Rosselló Picornell La familia Crassulaceae en la flora alóctona valenciana Autores: Daniel GUILLOT ORTIZ, Emilio LAGUNA LUMBRERAS & Josep Antoni ROSSELLÓ PICORNELL Monografías de la revista Bouteloua, nº 4, 106 pp. Disponible en: www.floramontiberica.org [email protected] Portada: ejemplar del género Aeonium, imagen tomada de la obra de Munting (1696) Naauwkeurige Beschyving der Aardgewassen, cortesía de Piet Van der Meer. Edición ebook: José Luis Benito Alonso (Jolube Consultor Botánico y Editor. www.jolube.es) Jaca (Huesca), septiembre de 2009. ISBN ebook: 978-84-937291-1-0 Derechos de copia y reproducción gestionados por el Centro Español de Derechos reprográficos. Monografías de la revista Bouteloua, 4 La familia Crassulaceae en la flora alóctona valenciana Daniel Guillot Ortiz, Emilio Laguna Lumbreras & Josep Antoni Rosselló Picornell Valencia, 2008 Agradecimientos: A Piet Van der Meer La familia Crassulaceae en la flora alóctona valenciana Índice Introducción ................................................................. 7 Corología ...................................................................... 7 Descripción ................................................................... 7 Taxonomía .................................................................... 7 Claves de géneros ......................................................... 8 Géneros, especies y taxones
  • Name: Echeveris - Mixed Varieties

    Name: Echeveris - Mixed Varieties

    Name: Echeveris - Mixed Varieties Echeveria is a large genus of succulents in the Crassulaceae family. They are native from Mexico to northwestern South America. The genus Echeveria is named after the 18th century Spanich botanist Atanasio Echeverria Codoy. Several of these species are outstanding garden plants. A large number offsets heavily and are given the common name of 'Hen and Chicks'. Most species grow in the shade and can take some frost. Hybrids tend to be less accomodating about their growing conditions. All the species are drought resistant, but they grow better with regular deep watering and fertilizing. They can be propagated with offsets, leaf cuttings, and if they are not hybrids, by seeds. Offsets is the easier way. Most species lose their lower leaves in winter. Depending on your level of humidity, these leaves are fertile ground for fungus that can then attack the plant. It is better to remove them regularly. Another consequence is that after a couple of years the plants look untidy. It is better to re-root the main rosette(s) and keep the rest of the plant for propagation. The Echeveria cactus is a rosette-forming succulent plant with foliage that comes in a variety of shapes and colors. The flowers appear on the top of stalks that grow from between the leaves The plant does not die after it has bloomed as do plants that have flowers which develop from the center growing point. Echeverias need bright light, heavy soil and excellent drainage. When grown in soilless mixes, they grow large and lush and lose their color and character.
  • Plethora of Plants - Collections of the Botanical Garden, Faculty of Science, University of Zagreb (2): Glasshouse Succulents

    Plethora of Plants - Collections of the Botanical Garden, Faculty of Science, University of Zagreb (2): Glasshouse Succulents

    NAT. CROAT. VOL. 27 No 2 407-420* ZAGREB December 31, 2018 professional paper/stručni članak – museum collections/muzejske zbirke DOI 10.20302/NC.2018.27.28 PLETHORA OF PLANTS - COLLECTIONS OF THE BOTANICAL GARDEN, FACULTY OF SCIENCE, UNIVERSITY OF ZAGREB (2): GLASSHOUSE SUCCULENTS Dubravka Sandev, Darko Mihelj & Sanja Kovačić Botanical Garden, Department of Biology, Faculty of Science, University of Zagreb, Marulićev trg 9a, HR-10000 Zagreb, Croatia (e-mail: [email protected]) Sandev, D., Mihelj, D. & Kovačić, S.: Plethora of plants – collections of the Botanical Garden, Faculty of Science, University of Zagreb (2): Glasshouse succulents. Nat. Croat. Vol. 27, No. 2, 407- 420*, 2018, Zagreb. In this paper, the plant lists of glasshouse succulents grown in the Botanical Garden from 1895 to 2017 are studied. Synonymy, nomenclature and origin of plant material were sorted. The lists of species grown in the last 122 years are constructed in such a way as to show that throughout that period at least 1423 taxa of succulent plants from 254 genera and 17 families inhabited the Garden’s cold glass- house collection. Key words: Zagreb Botanical Garden, Faculty of Science, historic plant collections, succulent col- lection Sandev, D., Mihelj, D. & Kovačić, S.: Obilje bilja – zbirke Botaničkoga vrta Prirodoslovno- matematičkog fakulteta Sveučilišta u Zagrebu (2): Stakleničke mesnatice. Nat. Croat. Vol. 27, No. 2, 407-420*, 2018, Zagreb. U ovom članku sastavljeni su popisi stakleničkih mesnatica uzgajanih u Botaničkom vrtu zagrebačkog Prirodoslovno-matematičkog fakulteta između 1895. i 2017. Uređena je sinonimka i no- menklatura te istraženo podrijetlo biljnog materijala. Rezultati pokazuju kako je tijekom 122 godine kroz zbirku mesnatica hladnog staklenika prošlo najmanje 1423 svojti iz 254 rodova i 17 porodica.
  • Prickly News South Coast Cactus & Succulent Society Newsletter | August 2020

    Prickly News South Coast Cactus & Succulent Society Newsletter | August 2020

    PRICKLY NEWS SOUTH COAST CACTUS & SUCCULENT SOCIETY NEWSLETTER | AUGUST 2020 ZOOM PRESENTATION SHARE YOUR GARDEN VIDEO PRESENTATIONS: Sunday, August 9, 2020 @ 1:30 pm CSSA (Cactus and Succulent Jackson (Members watch for an email invitation) Society of America), is sharing the complete video Burkholder presentations of the lectures The Botany of Cacti: from the 2015 and 2017 An Introduction Conventions. This is a chance to hear from world renowned lecturers and experience Greetings from Home, still! the high level information Thank you to all of you who sent photos of received at the Conventions. your plants and gardens. You will see them in Please go to this website to our Newsletter and at our Zoom meetings for Email me with photos of access the videos. interest. I am always inspired by seeing other’s your garden and/or plants https:// that we can publish as a way gardens and hope that you enjoy these as well. cactusandsucculentsociety. of staying connected. org/ Our first Zoom meeting went well and Gary [email protected] Duke was well prepared for his talk. Thanks to Scott Bunnel for hosting the meeting for us. I hope more of you will join us for the August meeting where we will hear Jackson Burkholder give us a Cactus Botany presentation-very instructive! To learn more visit southcoastcss.org CALL FOR PHOTOS: Please continue to send photos for the Plant of the Month. The Mini-show categories have been published online with information about each genera. Our genera for August Like us on our facebook page are Cactus: Astrophytum and Succulent: Sedum, Pachyphytum and Sempervivum.
  • Universidad Nacional Autónoma De México Facultad De Estudios

    Universidad Nacional Autónoma De México Facultad De Estudios

    Universidad Nacional Autónoma de México Facultad de Estudios Superiores Zaragoza “LAS CRASULÁCEAS DEL VALLE DEL MEZQUITAL’’ Tesis de licenciatura que para obtener el título de Biólogo presentan: Gabriela de Jesús Espino Ortega Luis Emilio de la Cruz López Área de Botánica Director de tesis: M. en C. Balbina Vázquez Benítez. _____________________________ Marzo 2009 UNAM – Dirección General de Bibliotecas Tesis Digitales Restricciones de uso DERECHOS RESERVADOS © PROHIBIDA SU REPRODUCCIÓN TOTAL O PARCIAL Todo el material contenido en esta tesis esta protegido por la Ley Federal del Derecho de Autor (LFDA) de los Estados Unidos Mexicanos (México). El uso de imágenes, fragmentos de videos, y demás material que sea objeto de protección de los derechos de autor, será exclusivamente para fines educativos e informativos y deberá citar la fuente donde la obtuvo mencionando el autor o autores. Cualquier uso distinto como el lucro, reproducción, edición o modificación, será perseguido y sancionado por el respectivo titular de los Derechos de Autor. Agradecimientos A la UNAM por brindarme la oportunidad de desarrollarme mejor tanto en el sentido humano como en el profesional. Por hacer la diferencia en mi vida. A la FES Zaragoza y a las personas que en ella laboran, por ser mi casa de estudios. Al grupo de sinodales formado por M. en C. Ramiro Ríos Gómez, M. en C. Balbina Vázquez Benítez, M. en C. Efraín Ángeles Cervantes, M. en C. Carlos Castillejos Cruz y Florencia Becerril Cruz, por las observaciones hechas pertinentemente para la mejora de este trabajo, por los comentarios y el tiempo dedicado al mismo. Por su amistad A la Maestra Balbina con quien estaré siempre agradecida porque trabajó con mucho entusiasmo en nuestro trabajo.
  • Greenhouse of UNI Del’S Greenhouse Joe and Joan Traylor Ben and Tina Donath Bev Edmondson Patricia Hampton

    Greenhouse of UNI Del’S Greenhouse Joe and Joan Traylor Ben and Tina Donath Bev Edmondson Patricia Hampton

    A special thank you to: Harry and Molly Stine and Stine Seeds Merle Philips The Shea Foundation Greenhouse of UNI Del’s Greenhouse Joe and Joan Traylor Ben and Tina Donath Bev Edmondson Patricia Hampton BUENA VISTA Iowa’s accessibly scaled, eye-opening university. Estelle Siebens Science Center 610 West Fourth Street Storm Lake, Iowa 50588 1 800 383 9600 ph www.bvu.edu Greenhouse Only in a greenhouse can you have a desert right next to a rainforest. The western most of the three rooms has a number of cacti, aloes, agaves and euphorbia collected from the American Southwest and South Africa. The middle room has many species from the warm and wet parts of our planet, several of which make good houseplants. The nearest room is reserved for research projects, new plants and display of plants that are blooming. Greenhouse funds were Rainforest provided by Stine Seeds. Bambusa verticillata (Gramineae) (Bamboo) Carissa grandiflora (Apocynaceae) (Natural Plum Jasmine) Cissus rhombifolia (Grape Ivy) Desert Citrus lemoni (Ritaceae) (Ponderosa Lemon) Adromischus cristatus (Crassulaceae)(Crinkle Leaf Plant) Cyperus alternifolius (Cyperaceae) Aloe brevifolia (Liliaceae) (Crocodile Jaws) Drypterus marginalis (Eastern Wood Fern) Astrophytum myriostigma (Cactaceae) (Bishop’s Cap) Evolvulus speciosa (Convulaceae) Bryophyllum daigremontianum (Crassulaceae) (Mother of thousands) Ficus benjamina (Braided Ficus Tree) Crassula arborescens (Crassulaceae) (Silver Dollar Jade) Ficus elastica (Rubber Plant) Crassula perforata (Crassulaceae) (String of Buttons)