181
European Journal of Endocrinology -19-0017 Tennessee, USA, 6 4 University MedicalCenter,IFBAdiposityDiseases, 1 Michael Stumvoll Sabine Paeschke Susan Kralisch kidney disease is decreasedinhumanandmurinechronic The brownfat-secretedadipokineneuregulin4 for adeclineinrenalfunction anddeathinarecent has alsobeenshowntobe anindependentriskfactor hypertension ascardiometabolic diseasestates,obesity rates forthesediseases( disease (CKD)isincreasing and resultsinariseofdeath The prevalenceofdiabetesmellitusandchronickidney Introduction beneficial glucoseandlipidprofilesupportingNRG4as potentialtreatmenttargetinmetabolicandrenaldiseasestates. -Nrg4 Conclusions: significantly alter was decreasedinalladiposetissuedepotscomparedtocontrolmice.Theuremictoxinindoxylsulfatedidnot independently associatedwithabeneficialrenal,glucoseandlipidprofile.InmiceDKD, Results: as wellhepatocytes,aftertreatmentwiththeuremictoxinindoxylsulfate. Moreover, mRNAexpressionof two mousemodelsofdiabetickidneydisease(DKD)ascomparedtodifferentgroupsnon-diabeticcontrolmice. Within bothgroups,abouthalfofthepatientshadaT2DM.Furthermore,mRNAexpression compared to60subjectswithanestimatedglomerularfiltrationrate Design/methods: diabetes mellitus(T2DM)hasnotbeenelucidated,sofar. with beneficialmetaboliceffectsinmice.However,regulationofNrg4end-stagekidneydisease(ESKD)andtype2 Objective: Abstract Medicine, DepartmentofClinicalScience,InterventionandTechnology,KarolinskaInstitutet,Stockholm,Sweden Department ofMedicine,NashvilleVeteransAffairsHospital,VanderbiltUniver University ofLeipzig,InstituteAnatomy,Germany, Medical DepartmentIII–Endocrinology,Nephrology,Rheumatology,University ofLeipzigMedicalCenter, https://doi.org/ https://eje.bioscientifica.com Clinical Study isreducedinadiposetissuedepotsofmicewithDKD.TheBAT-secretedadipokinefurtherassociateda MedianserumNRG4wassignificantlylowerinpatientswithESKDcomparedtocontrolsandtheadipokine Neuregulin4(NRG4)hasrecentlybeenintroducedasanovelbrownadiposetissue(BAT)-secretedadipokine 10.1530/EJE CirculatingNRG4isindependentlyassociatedwithapreservedrenalfunctionandmRNAexpressionof 7 Justus-Liebig-University, InstituteofNutritionalScience,Giess 1 SerumNRG4levelswerequantifiedbyELISAin60subjectswithESKDonchronichemodialysisas , 2 Nrg4 , Annett Hoffmann 4 1 , Anette Bachmann -19-0017 , Mathias Fasshauer mRNAexpressioninadipocytesandhepatocytes, 1 ). Besidesdiabetesmellitus and 2 © 2019EuropeanSociety ofEndocrinology Nrg4 S Kralischandothers wasinvestigatedincultured,differentiatedmousebrownandwhiteadipocytes, 1 3 , Nora Klöting Department ofRespiratoryMedicine,UniversityLeipzig, 1 , Matthias Blüher 1 , 2 Printed inGreatBritain , 7 and 5 Division ofNephrology,DepartmentMedicine, Thomas Ebert 2 , Armin Frille
1 , Ming-Zhi Zhang en, Germany,and kidney disease (ESKD) after bariatric surgery-induced kidney disease (ESKD) after bariatric surgery-induced demonstrate a long-term protection against end-stage a BMIof25 filtration rate(eGFR)decline ascomparedtosubjectswith had ahazardratioof2.02 for anestimatedglomerular meta-analysis ( sity SchoolofMedicine,Nashville, Neuregulin 4andrenalfunction Q1 Published byBioscientifica Ltd. 1 , 2 , 8 2 , > 3 , Hartmut Kuhn 50 mL/min/1.73 m in vitro kg/m 8 Division ofRenal 2 5 ). Thus,patientswithaBMIof40 2 , 6 ( , Raymond C Harris . 2 ). Conversely, Shulman andcoworkers 2 Leipzig Downloaded fromBioscientifica.com at09/27/202106:41:03PM 3 , Marcin Nowicki 2 inacross-sectionalcohort. Nrg4 (2019) Endocrinology European Journalof uni-leipzig.de Thomas.ebert@medizin. Email Ebert T to addressed be should Correspondence Nrg4 mRNAexpression 181 wasdeterminedin 5 181 , 6 , :2 , 151–159 ,
4 , 151 –159 kg/m via freeaccess 2
European Journal of Endocrinology https://eje.bioscientifica.com disease states. as apotentialtreatmenttarget inmetabolicandrenal BAT-secreted adipokineisdecreasedinDKDandcanserve compared tocontroltreatment. after treatmentwiththeuremictoxinindoxylsulfate as brown andwhiteadipocytes,aswellinhepatocytes, Nrg4 non-diabetic controlmice.Finally, mRNA expressionof background, ascomparedtotwodifferentgroups of that is, mRNA expressionof of BAT function. Moreover, weinvestigated differential BAT-secreted adipokinewascorrelatedwithothermarkers diabetes mellitus (T2DM). Furthermore, the beneficial both groups,abouthalfofthepatientshadatype2 to 60subjectswithaneGFR renal replacementtherapy(RRT)treatmentascompared concentrations in 60 patients with ESKD on maintenance brown adipokine. causes addressingapotentialeliminationofthenovel disease (DKD) has to be compared to non-diabetic ESKD NRG4 regulation in ESKD dueto severe diabetic kidney of ESKDhasnotbeeninvestigated,sofar. Furthermore, as apotentiallyprotectivefactorforthedevelopment patients withCKDisfarfromclearandtheroleofNRG4 and itsmetaboliccomplications. novel brownadipokinewithbeneficialeffectsonobesity controls ( dyslipidemia andinsulinsensitivity, ascomparedto metabolic status, that is lessbodyweightgain, improved are exposedtohigh-fatdiet,theyhaveanimproved when micewithatransgenicoverexpressionofNRG4 hepatic steatosisafterhigh-fatdietfeeding( Nrg4-deficient micehaveincreasedinsulinresistanceand ( induced insulinresistanceandhepaticsteatosisinmice BAT-secreted adipokinewhichprotectsagainstdiet- pharmacological targets( introduced as brown adipokines/batokines and potential homeostasis andseveralBAT-secreted cytokineshavebeen has emergedasamajorfactorcontributingtoweight could mediatetheassociationbetweenobesityandCKD. tissue-secreted factors,so-calledadipokines,potentially Obese Subjects(SOS)study( weight lossascomparedtocontrolpatientsintheSwedish 6 ). Inmoredetail,Wang andcoworkersdemonstratethat Clinical Study Our hypothesis was that the metabolically beneficial Therefore, wequantifiedcirculating NRG4 However, theregulationofcirculating NRG4in Neuregulin 4(NRG4)isanovelandpredominantly During thelastyears,brownadiposetissue(BAT) wasinvestigated in cultured, differentiated murine eNOS 6 ). Basedonthesedata,NRG4appearstobea − / − ;db/db miceand Nrg4 4 intwomousemodelsofDKD, , 5 3 ). ). Thus,circulating adipose db/db > S Kralischandothers 50 mL/min/1.73m miceonaC57BLKS 6 ). Conversely, 2 . In oral hypoglycemicmedications( as a fasting glucose (FG) Nephrology, UniversityofLeipzig.AT2DMwasdefined trained staffoftheDepartmentEndocrinology and andanthropometricdatawereobtainedby history were coded as controls. In all participants, past medical Collaboration (CKD-EPI)equation( according totheChronicKidneyDiseaseEpidemiology without CKD( on maintenanceRRTbyhemodialysis.Studyparticipants cohort ( University ofLeipzig,from2005and2007.Ofthetotal by theDepartmentofEndocrinologyandNephrology, subjects (women: previously ( The design of this cross-sectional study has been described Subjects Methods All animalshadfreeaccess to waterandanormalpellet 21 mice weremaintainedunder pathogen-freeconditionsat Leipzig; approvalnos.TVV12/14 andTVV65/15).Briefly, Committee of the StateofSaxony (Landesdirektion animal experimentswereapprovedbytheLocalEthics of Leipzigasdescribedpreviously( in theMedicalExperimentalCenteratUniversity background. Allanimalexperimentswereperformed included model formildDKD( severe DKD( mice. Thus, were comparedtotwogroupsofnon-diabeticcontrol models ofCKDduetoDKDonaC57BLKSbackground To determineNRG4regulationin more detail, two animal Animal study informed consentbeforetakingpartinthestudy. of theUniversityLeipzigandallsubjectsgavewritten abuse. ThestudywasapprovedbytheEthicsCommittee ofdrug inflammation, acuteinfectiousdiseaseandhistory criteria: end-stage malignant diseases, acute generalized pregnant, providedwritteninformedconsent;exclusion present study:Inclusioncriteriaareage inclusion andexclusioncriteriawereappliedforthe calculated aspreviouslydescribed( model assessmentofinsulinresistance(HOMA-IR)was 60 controlpatientswerecodedasT2DM.Homeostasis 32 ofthe60patientswithESKDonRRTand30out Neuregulin 4andrenalfunction ±
1°C ona12-hlight/darkness cycle (6:00 n
eNOS = 120), abouthalf( 7 eNOS , 14 − n / 8 −
), whereas = , mice,aswell 60) hadaneGFR − 9 / − , n ;db/db 8 men: =58; 10 15 Downloaded fromBioscientifica.com at09/27/202106:41:03PM ). Briefly, about120Caucasian ≥ ). Non-diabeticcontrolanimals 126 mice served asamodelfor miceserved n db/db
= mg/dL or useof insulin or 60) hadanESKDandwere 12 db/+ micewereusedasa n ). Usingthesecriteria, 2 wr recruited were =62) > 181 miceonaC57BLKS 11 13 50 mL/min/1.73m 10 ) and,therefore, ). Thefollowing :2 > , 18 years, non- 18 years, 16 h–18:00 , 17 ). All 152 h). via freeaccess 2
European Journal of Endocrinology expression wasdetermined relativetoacidicribosomal In animalandin Analysis of 1 Group (EUTox) ( recommendations oftheEuropeanUremicToxin Work 24 hepatocytes were treated with 0.5 of 24 1 starvation, According toStockler-Pintoandcoworkers( L1 whiteadipocytes:( as previouslydescribed (brown adipocytes: ( cells (AmericanType CultureCollection)weregrown cells (AmericanType CultureCollection)andAML12 Briefly, immortalizedbrownpreadipocytes( adipocytes, aswellhepatocytes, mRNA expressioninmurinebrownandwhite Effect oftheuremictoxinindoxylsulfateon calculated, respectively. PA, USA)andalbumin-creatinineratios(ACR)were M andCreatinineCompanionkits(Exocell,Philadelphia, creatinine weredeterminedinspoturineusingAlbuwell bystandardmethods. in acertifiedlaboratory cholesterol, as well as free fatty acids (FFA) were measured lipoprotein (HDL)andlow-density(LDL) fasting insulin(FI),triglycerides(TG),total,high-density 18 quantified byELISAsasdescribedpreviously( the manufacturer’s instructions.Allotheradipokineswere CA, USA)werequantifiedusinganELISAaccordingto levels ofNRG4(PhoenixPharmaceuticals,Burlingame, was obtainedjustbeforehemodialysisstarted.Serum fasting periodofatleast8 In humansubjects,allbloodsamplesweretakenaftera Assays nitrogen forRNAandproteinisolation. brown (BAT) adiposetissue,weresnap-frozeninliquid kidney, aswellvisceral(VAT), subcutaneous(SAT) and Health Care,Wuppertal, Germany).Portionsoftheliver, ketamine (WDT, Garbsen,Germany)andxylazine(Bayer killed byexsanguinationunderdeepanesthesiawith themicewere morning attheageof24 weeks. Afterward, diet. Spoturinewascollectedfromallthemicein mM or0.5 Clinical Study ). Routineserumparametersincludingcreatinine,FG, h. The experiments were performed according to the In animal experiments, urinary albumin and In animal experiments, urinary h tobrownandwhiteadipocytes,whereasAML12 mM potassiumsulfate(Sigma),respectively. Nrg4 mM indoxylsulfatewasaddedforaperiod in vitro 21 and ) andcontrolcellsweretreatedwith experiments, Erbb4 7 ), AML12hepatocytes:( h. InallESKDpatients,blood mRNAproduction S Kralischandothers mM indoxyl sulfate for Nrg4 in vitro and Erbb4 19 20 19 ), 3T3-L1 7 Nrg4 ), after ), 3T3- mRNA , 8 17 ,
)). 9 , Control/T2DM+; RRT/T2DM hoc non-parametric Kruskal–Wallis testwithBonferroni T2DM+; RRT/T2DM between thefoursubgroups(Control/T2DM analyses of human data. Overall, group differences SPSS softwareversion24.0(IBM)wasusedforallstatistical Statistical analysis (antisense). GCATTGTCT (sense)andCCGCAGGGGCAGCAGTGGT GGAATGGCCCGT (antisense); CATGGACCGGGACCTGACAA (sense)andGGTAAAGT and GGCAAAATGACCTGTGCCTG (antisense); pairs wereused: GmbH) essentiallyasdescribed in ( LightCycler 480ProbesMasterMix(RocheDiagnostics LightCycler 480real-timePCR96-wellthermocyclerusing time RT-PCR. OnemicrolitercDNAwasquantifiedona phosphoprotein P0( divided intothefoursubgroups (i.e.Control/T2DM Basic clinicalcharacteristics ofthestudypopulation ( Baseline characteristicsofthehumancohort Results significant inallanalyses. t Tukey’s multiplecomparisons test, as well as by Student’s experiments wereanalyzedbyone-wayANOVA with analyses. Groupdifferencesintheanimaland All parameterswerelogarithmicallytransformedprior animal and to controlmice,thatis is 36B4 Erbb4 6 (GraphPadSoftwareInc.)wasused.Relative by non-parametricSpearman’s rankcorrelationmethod. other BAT-related adipokineswithNRG4 wereanalyzed logarithmically transformed.Univariatecorrelationsof regression analyses, all continuous parameters were for allparameters.Beforeperformingmultivariatelinear with adjustmentforage,sexandBMIwerecalculated linearregressionmodels categorical parameters.Afterward, Neuregulin 4andrenalfunction test,respectively n = 120) eNOS analysisforcontinuousparametersand A For animaland , aswell ACR, wereanalyzed in micewithDKD,that mRNAexpressionindifferenttissuesadjustedfor P − value of / − ;db/db in vitro mice and experimentsareshownasmean < Nrg4 in vitro 0.05 was considered as statistically 36B4 (Rplp0) − ; RRT/T2DM+)wereassessedby eNOS , CACTTGTGAAACGCTGCATGT Downloaded fromBioscientifica.com at09/27/202106:41:03PM db/db experiments,GraphPadPrism − − / − ; RRT/T2DM+)areshown and mice and were compared https://eje.bioscientifica.com 36B4 ) usingquantitativereal- 7 ). The following primer db/+ 181 , AAGCGCGTCCTG :2 mice.Resultsfor − χ ; Control/ 2 Nrg4 testfor in vitro Erbb4 153 ± and post
s . via freeaccess − d ; . ,
European Journal of Endocrinology https://eje.bioscientifica.com HDL cholesterol(mmol/L) Cholesterol (mmol/L) HOMA-IR FI (pmol/L) FG (mmol/L) DBP (mmHg) SBP (mmHg) WHtR WHR BMI (kg/m Age (years) Nrg4 (µg/L) Sex (m/f) n significant by Kruskal–WallistestfollowedBonferroni numbers (percentage)areshown.Categoricalparameterswereanalyzedusingthe subgroups, i.e.Control/T2DM Table 1 and negativelyassociatedwithFI,HOMA-IR,TG concentrations ofNRG4remainedindependently Linear regressionanalysisrevealedthatserum the totalcohort( Association ofNRG4withmetabolicparametersin between thefoursubgroups( RRT/T2DM+, circulating NRG4wassignificantlydifferent that is,Control/T2DM (2.3 (0.7) of theadipokineascomparedtonon-diabeticsubjects (2.1 (0.8) subjects ( female (2.3(0.7) cohort, circulating NRG4wassignificantlyhigherin levels were2.3(0.7) in Creatinine ( FFA (mmol/L) TG (mmol/L) LDL cholesterol(mmol/L) waist-to-height ratio. maintenance renalreplacementtherapy; SBP,systolicbloodpressure;T2DM,type2diabetesmellitus;TG,triglycerides; WHR,waist-to-hipratio;WHtR, lipoprotein; HOMA-IR,homeostasis model assessmentofinsulinresistance;hsIL-6,high-sensitivityinterleukin-6; LDL,low-densitylipoprotein;RRT, BMI, bodymassindex;DBP,diastolic bloodpressure;eGFR,estimatedglomerularfiltrationrate;FFA,freefatty acids;FI,fastinginsulin;HDL,high-density *,†,‡,§ Superscriptnumbers(*,†,‡,§)indicate subgroupcomparisonswithBonferroni hsIL-6 (ng/L) eGFR (mL/min/1.73 m Metformin treatment(%) Leptin ( Clinical Study Indicates al 1 Table When patientswerestratifiedbythefoursubgroups, μ g/L) µg/L) did not have different serum concentrations µg/L) didnothavedifferentserumconcentrations Baseline characteristicsofthestudypopulation.populationstratifiedbyfour µg/L) ( 2 P ) P P μ values(<0.05)aredepictedinboldd. . Median (interquartile range) serum NRG4
mol/L) = < 0.05 ascomparedto*RRT/T2DM 0.026). Incontrast,patientswithT2DM P µg/L) ascomparedtomale(2.1(0.6) =0.059). n 2 µg/L inthetotalsample.In ) = 120) − ; Control/T2DM+;RRT/T2DM − , Control/T2DM+,RRT/T2DM P .1) ( =0.010) Control/T2DM S Kralischandothers 45.1 (33.3) 0.57 (0.08) 0.88 (0.12) 28.2 (5.6) 1.87 (2.11) 78.8 (24.4) 17.8 (25.4) 125 (21) 1.4 (0.4) 5.3 (0.9) 1.4 (1.2) 5.1 (1.3) 2.5 (0.7) 0.5 (0.2) 1.1 (0.8) 3.5 (1.1) 77 (10) 63 (19) 76 (17) 11/19 0 (0) 30 − , Table 1 † Control/T2DM post hoc *,§ *,§ *,§ ‡ * *,§ *,‡,§ § § *,§ *,§ − ). analysis.Overall µg/L) − , − ‡ Control/T2DM+ Control/T2DM+, and andRRT/T2DM+.Valuesformedian(interquartilerange)ortotal − 47.9 (62.6) 0.62 (0.10) 0.94 (0.10) 29.1 (5.2) 85.2 (23.0) 16.8 (22.3) 2.07 (1.25) 126 (20) 0.6 (0.4) 1.4 (0.9) 2.9 (0.9) 1.2 (0.5) 4.9 (1.5) 2.8 (3.0) 7.6 (3.2) 2.1 (1.0) ; 72 (22) 73 (15) 63 (16) 21 (70)
16/14 30 LDL cholesterol,FFA andinflammation( not independently associated with markers ofobesity, 2 Table blood pressure,HDLcholesterolandeGFR(all and positiveassociationbetweenNRG4systolic age, sex and BMI. There was a significant, independent creatinine (all ( correlated toirisin( In the total cohort,NRG4 serum levels were positively total cohort( adipokines andmarkersofBATfunctioninthe Correlation ofNRG4withotherBAT-secreted not shown). cholesterol andrenalfunctionremainedsignificant(data associations betweenNRG4andFI,HOMA-IR,TG,HDL After excludingpatientsonmetformintreatment,the Neuregulin 4andrenalfunction post hoc P *,§ .1) ( =0.016) † § * *,†,§ * § *,§ *,§ P valuesoftheKruskal–Wallistestareshownand analysis. ). In contrast, the BAT-secreted adipokine was § RRT/T2DM+, respectively. al 3 Table RRT/T2DM χ 28.2 (47.6) 0.57 (0.16) 0.96 (0.18) 25.2 (6.5) 11.4 (35.1) 6.14 (4.91) n 125 (38) 829 (431) 2 1.0 (0.5) 4.4 (1.1) 0.8 (1.4) 4.6 (1.2) 2.2 (0.2) 0.6 (0.5) 1.6 (0.9) 2.7 (0.9) 5.0 (3.2) 77 (20) 59 (23) P test.Continuousparameterswereanalyzed = 120) 15/13 0 (0)
< 28 0.05; ). Furthermore,NRG4wasnegatively P † † ‡ ‡ ‡ † † † †,‡ − †,‡
= †,‡ Downloaded fromBioscientifica.com at09/27/202106:41:03PM 0.004) andadiponectinlevels al 2 Table RRT/T2DM+ 50.1 (91.6) 0.66 (0.11) 1.00 (0.14) 27.9 (6.6) 7.48 (7.30) 28.0 (54.4) 717 (221) 120 (25) 0.7 (0.5) 1.8 (1.4) 2.1 (1.4) 1.0 (0.3) 4.2 (1.3) 1.4 (3.3) 5.2 (3.3) 2.1 (0.8) 5.7 (2.7) ) afteradjustmentfor 70 (18) 68 (12) 20/12 0 (0) 32 181 :2 †,‡ † ‡ †,‡ † † †,‡ †,‡ † †,‡ al 2 Table Overall < < < < < < < < < < P 0.173 0.230 0.095 0.339 0.051 0.239 0.065 0.001 0.003 0.001 0.006 0.001 0.004 0.010 0.001 0.001 0.001 0.001 0.001 0.001 0.001
< – 154 0.05; P via freeaccess ). European Journal of Endocrinology n.s., non-significantmodel. Adiponectin (mg/L) Angptl8 (µg/L) Irisin (µg/L) Neuregulin 4(µg/L) values aregiven. Univariate correlationsofserumlevelstherespectiveadipokines witheachotherinthetotalstudypopulation( Table 3 two mousemodelsofDKD,thatis Figure 1 Nrg4 between angiopoietin-likeprotein8andNRG4( ( related tofibroblastgrowthfactor21(FGF21)( Leptin (µg/L) hsIL-6 (ng/L) eGFR (mL/min/1.73 m Creatinine (µmol/L) FFA (mmol/L) TG (mmol/L) LDL cholesterol(mmol/L) HDL cholesterol(mmol/L) Cholesterol (mmol/L) HOMA-IR FI (pmol/L) FG (mmol/L) DBP (mmHg) SBP (mmHg) WHtR WHR BMI (kg/m Age (years) Standardized β -coefficients and were logarithmicallytransformedpriortoanalyses. adjusted forage,sexandBMI,respectively.Allparameters Associations wereassessedinlinearregressionmodels metabolism, serumlipids,inflammationandrenalfunction. with anthropometricparametersandmarkersofglucose Table 2 FGF21 (ng/L) Angptl8, angiopoietin-likeprotein8; BAT,brownadiposetissue;FGF21,fibroblastgrowthfactor21. Bold valuesindicatesignificantcorrelation asassessedbySpearman’scorrelationmethod. Table 3 Clinical Study and ). In contrast, there was no significant correlation summarizesanimaldataonNRG4regulationin Univariate correlationsofseveralBAT-secretedadipokinesandmarkersBATfunctionwithserumneuregulin4. Association ofserumneuregulin4concentrations 2 ) Erbb4 mRNAexpressioninmicewithDKD 2 ) P P P P P r r r r r P valuesaregiven. S Kralischandothers eNOS − − − − 0.277 0.276 0.452 0.441 0.222 0.240 0.203 – – – – – – – – – – – β Neuregulin 4 − − / − 0.220 0.174 0.125 0.261 0.266 0.016 0.004 0.003 ;db/db – – miceand P < < Table 3 =0.003) n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0.001 0.001 0.021 0.013 0.030 0.003 0.004 P ). − Irisin 0.976 0.001 0.258 0.008 0.849 0.004 – – data Fig. 1,mice (Supplementary seesectionon significantly higherin that is, was unaltered( ( as comparedtotwogroupsofnon-diabeticcontrols the liverwassignificantly increasedin micewith DKD in VAT ( C that is expression of reduced in24-week-oldmicewithDKD.Thelowest VAT andSAT, diabetic controlmice,thatis, db/db treated withpotassiumsulfate. mRNA expressionof indoxyl sulfatefor24 AML12 hepatocytes( 3T3-L1 whiteadipocytes( Treatment ofmurinebrownadipocytes( 3T3-L1 adipocytesandAML12hepatocytes mRNA expressioninmurinebrownadipocytes, Effect oftheuremictoxinindoxylsulfateon DKD, thatis mice, thatis, mErbb4 Neuregulin 4andrenalfunction Fig. 1D ), aswellinmicewithmildDKD,thatis In thekidneys, ACRwasincreasedinmicewithsevereDKD, Urinary In alladiposetissuedepotsinvestigated,thatisBAT, given at the end of this article). In contrast, renal miceascomparedtotwodifferentgroupsofnon- eNOS mRNAexpressionwasnotdifferentwithcontrol eNOS ), whereas i. 1B Fig. Angptl8 − − − − eNOS / / Nrg4 0.100 0.275 0.101 0.150 − − db/+ – – ;db/db ;db/db Fig. 1E Nrg4 ). In contrast, − was observed inmicewithsevereDKD, wasobserved mice,comparedtomicewithsevere / Nrg4 − mRNAexpressionwassignificantly ;db/db mice,inBAT andSAT ( mice( ). Nrg4 i. 2C Fig. eNOS h didnotsignificantlyalterthe mErbb4 mRNAexpressioninthekidney Downloaded fromBioscientifica.com at09/27/202106:41:03PM mice (Supplementary Fig. 1). mice(Supplementary ascomparedtocontrolcells Fig. 1F − i. 2B Fig. / − Adiponectin eNOS miceascomparedto ), withtheuremictoxin Nrg4 mRNAexpressionwas < https://eje.bioscientifica.com 0.238 0.001 – – ). − ), aswellmurine mRNA expression in / − 181 miceand :2 Fig. 2A n supplementary supplementary = 120). Fig. 1A db/db db/+ ), murine in vitro FGF21 Nrg4 r and mice, mice. 155 db/db – – and via freeaccess
P
European Journal of Endocrinology https://eje.bioscientifica.com expression inadiposetissue whichisthemainsource of non-diabetic control mice.Interestingly, models withCKDduetoDKD ascompared to twogroups quantified mRNAexpression of of NRG4inCKDmore detail,we,therefore,have ( ESKD havealsobeenreportedfortheadipokinesirisin elevated inESKD.Interestingly, lowerconcentrations in ( progranulin ( ( NRG4, other metabolic cytokines including leptin with aneGFR brown adipokineNRG4ascomparedtocontrolpatients lower circulating levelsofthemetabolicallybeneficial in adipocytesandhepatocytes indoxyl sulfatedoesnotreducethe non-diabetic controlmice.Moreover, theuremictoxin reduced inadiposetissueascomparedtotwogroupsof models ofDKD, other BAT-related adipokines.Intwo differentmouse associated with a beneficial glucose and lipid profile and NRG4. Furthermore,theBAT-secreted adipokineis positively andindependentlyassociatedwithcirculating with ESKDonRRTascomparedtocontrolsandeGFRis adipokine NRG4issignificantlydecreasedinpatients In thecurrentstudy, weshowthatthenovelBAT-secreted Discussion DE AB 18 25 22 Fold change (mNrg4/m36B4) Fold change (mNrg4/m36B4) 0.0 0.5 1.0 1.5 Clinical Study 0 1 2 3 4 5 , ), FGF21( ), adiponectin( Our resultsindicatethatpatientswithESKDhave 27 db/+ db/+ ) andfetuinB( * eNOS-/- eNOS-/- * 26 **** *** 24 db/d db/d ) andfollistatin-like3( **** ** ), adipocytefattyacid-bindingprotein be be Nrg4 > ** * db/db 50 mL/min/1.73m NOS-/- db/db NOS-/- 23 mRNAexpressionissignificantly ), retinol-bindingprotein-4( 10 ). To investigatetheregulation Fold change (mNrg4/m36b4) Fold change (mNrg4/m36B4) 0 1 2 3 4 0 1 2 3 db/ in vitro db/+ +e S Kralischandothers Nrg4 eNOS-/ NOS-/- Nrg4 **** . 17 2 **** -d . Incontrastto ** mRNAexpression db/db intwomouse ) aresignificantly **** b/db eNOS-/- eNOS-/- db/d Nrg4 db/d b b mRNA C F Spot ACR (µg/mg) Fold change (mNrg4/m36B4) 15000 20000 10000 0. 0. 1. 1. 1000 5000 500 0 5 0 5 8 ), db/+ db/+ * **** eNOS-/ of CKD.Importantly, ourtranslationalfindingssuggest effects ofNRG4directlycontribute tothedevelopment future studiesalsoneedto investigate whethervascular the activationofeNOSin cardiac myocytes( ( adipose tissuetherebyamelioratinghypoxia directly induces angiogenesis and angiogenic function in coworkers haveconvincinglydemonstratedthatNRG4 in CKD.IthastobepointedoutthatNugrohoand the pathophysiologicalmechanismsofNRG4regulation direct andcausaleffectsonrenalfunctiontoidentify therefore, are needed to investigate whether NRG4 has effects, i.e. insulin resistance in CKD ( bound uremictoxin,directlyinducescardiometabolic effects. Thus, p-cresylsulfate, another protein- observed CKD (reviewedin( indoxyl sulfateotheruremictoxinsareincreasedin NRG4 inESKD.Itshouldbenotedthatadditionto uremic toxinisnotresponsibleforreducedcirculating of toxin indoxylsulfatedoesnotalterthemRNAexpression with theuremictoxinindoxylsulfate.Here, and whiteadipocytes,aswellmurinehepatocytes, irisin ( renal dysfunctiononatranscriptionallevelsimilarto in CKDandDKDmightinfluence results, uremicand/ormetabolicdisturbancesobserved adipose tissuedepots,i.e.BAT, VAT andSAT. Basedonour DKD ascomparedtonon-diabeticcontrolmiceinall of NRG4 ( Neuregulin 4andrenalfunction eNOS-/- 30 ** * Nrg4 , - **** **** * 31 db/d db/db * *** 27 inallthreecelltypessuggestingthatthismajor ). Furthermore, ERBB4 signaling is involved in be **** ). We, therefore,havetreatedmurinebrown db/d NOS-/- 6 eNOS-/- db/d ) is significantly downregulated in mice with b b ** n with Tukey’smultiplecomparisonstest. P shown asmeans ratio (ACR)inspoturine.Resultsare (E) kidney.(F)Urinaryalbumin-creatinine adipose tissue(SAT),(D)liver,aswell adipose tissue(VAT),(C)subcutaneous brown adiposetissue(BAT),(B)visceral expression normalizedto bars). (A,B,C,DandE) mice (lightgreybars)and non-diabetic controlmice,i.e. grey bars)ascomparedtotwogroupsof black bars)andmildDKD( mice withsevereDKD( Neuregulin 4regulationin24-week-old Figure 1 valuesasassessedbyone-wayANOVA
≥ 28 P 3 pergroup.*Indicates
< )) potentiallycontributingtothe 0.01; *** Downloaded fromBioscientifica.com at09/27/202106:41:03PM P
< ± 0.001, **** standard deviation. 181 29 Nrg4 eNOS Nrg4 ). Further studies, :2 db/+ 36B4 expressionin db/db P mRNA −
< / − P eNOS mice(white 0.05, ;db/db in(A)
32 < ; dark 0.0001. ). Thus, − / − 156 ;
via freeaccess European Journal of Endocrinology Student’s means normalized to potassium sulfatefor24 h.The mRNAexpressionof control cellstreatedwith1 mM (AandB)or0.5 mM(C) (A andB)or0.5 mM(C)indoxylsulfatefor24 hascomparedto and (C)murineAML12hepatocytesaftertreatmentwith1 mM murine brownadipocytes,(B)3T3-L1whiteadipocytes Neuregulin 4regulationin(A)differentiated,immortalized Figure 2 Clinical Study ± standard deviation. t test. 36B4 n
≥ 5 pergroup. isdepicted.Resultsareshown as P valueasassessedby S Kralischandothers
Nrg4
between NRG4andHDLcholesterolin311Chinese have shownanindependentand positive association the liverandplasma( overexpression ofNRG4showlowerTGlevelsinboth Wang patients with ESKD. In accordance with this hypothesis, data suggest a beneficial metabolic regulation of NRG4 in only inpatientswithT2DM(datanotshown).These subgroups separately, correlationsremainsignificant with HDLcholesterolandTGareinvestigatedinthefour (data notshown).WhentheassociationbetweenNRG4 ESKD andsubjectswithoutCKDareanalyzedseparately these results are virtually the same when patients with negatively correlated to TG, in our cohort. Interestingly, positively associatedwithHDLcholesterol,aswell physiology. eGFR, should be included in all future studies on Nrg4 that markers ofrenal function, for example, creatinine or of NRG4inadipocytesisolated from comparable to insulin treatment, whereas there is noeffect recombinant NRG4hasincreased glucoseuptaketolevels treatment ofepididymaladipocytes fromWTmicewith 4 demonstrate thatheartrescuedERBB4deletionmice( ERBB4 receptor( exerts its beneficial metabolic effects by binding to the compared tocontrols( of NRG4havehadanimprovedinsulinsensitivity as demonstrate thatmicewithatransgenicoverexpression controls. Mechanistically, Wang and coworkerselegantly ( and somestudiessuggestdecreased( of Nrg4inpatientswithT2DMareinconsistent,sofar to controls( women withgestationaldiabetesmellitusascompared from our group demonstrating reduced NRG4 levels in non-diabetic controls.Thisisincontrasttopreviousdata T2DM haveunalteredNRG4serumlevelsascomparedto cardiometabolic diseasestates( mediated bythewell-knownupregulationofFGF21in negative association of NRG4 with FGF21 might also be dyslipidemia hasbeenreportedpreviously( both adipokines, a beneficial correlation with markers of correlated with irisin and adiponectin in our cohort. For lipoprotein particles.Furthermore,NRG4ispositively investigate whether NRG4 causally regulates plasma subgroup analyses( patients withnewlydiagnosedT2DMsupportingour Neuregulin 4andrenalfunction 39 − / − ) NRG4levelsinpatientswithT2DMascomparedto ht It isinterestingtonotethatinourcohort,patientswith Besides renalfunction,NRG4isindependentlyand + ) haveincreasedHOMA-IRlevels ( t al et . demonstratethatmicewithatransgenic 37 ). Furthermore,dataoncirculating levels 6 ). Zengandcoworkersconvincingly 33 6 ). Furthermore,Yan andcoworkers 6 ). Thus,futurestudiesneedto Downloaded fromBioscientifica.com at09/27/202106:41:03PM ). Inmoredetail,theadipokine 36 https://eje.bioscientifica.com ). Erbb4 181 40 38 :2 − ). Furthermore, ) orincreased / − ht 34 + mice( , 35 ). The 157 Erbb 40 via freeaccess ). European Journal of Endocrinology https://eje.bioscientifica.com epniiiy o te nert o te aa n te cuay f h data the of accuracy analysis. SK,AH,MFandTEequally contributedtothiswork. the and data the of integrity the for responsibility of this work and, as such, guarantor had full access to all the data the in the study and takes is Ebert Thomas Dr Guarantor: reviewed/ manuscript. and the discussion edited the to contributed S M and H C R Z, M-Z B, M H K, M N, S P and A B researched data and reviewed/edited the manuscript. F, A K, N data. researched and manuscript the wrote E T and F M H, A K, S Author contributionstatement Faculty, UniversityofLeipzig. supported by a grant from the Nachwuchsförderprogramm of the Medical was H A Sweden. Stockholm, Institutet, Karolinska with partnership in run Postdoctoral AdiposityDiseases, program), as (IFB well as 01EO1501 by a FKZ: Novo Germany, Nordisk postdoctoral (BMBF), fellowship Research Education of and Ministry Federal the by supported was TE K6a-87). project AdiposityDiseases, (IFB 01EO1501 FKZ: Germany, (BMBF), Research and B1 to M B, B4 to N K and C6 to M F) and by the Federal Ministry of Education 1052/2, SFB – 209933838 Projektnummer - Foundation Research German (DFG; Forschungsgemeinschaft Deutsche the by supported was work This Funding be could that interest of conflict perceived asprejudicingtheimpartialityofthisstudy. no is there that declare authors The Declaration ofinterest EJE-19-0017 at paper the of version online the to linked is This Supplementary data metabolic andrenaldiseasestates. supporting NRG4aspotentialtreatmenttargetin associated withabeneficialglucoseandlipidprofile mice withDKD.TheBAT-secreted adipokine isfurther expression of renalfunctionandmRNA associated withapreserved hypertension inhumanmetabolicdiseasestates. future studiesneedtoassessthecausalroleofNRG4on for confoundersintheirChinesestudy( statistical significance has been lost after adjustment as comparedtonormotensivecontrols( decreased NRG4 levels in patientswithhypertension is in contrast to data from Cai and coworkers showing with systolicbloodpressureinourhumancohort.This renalassociations. in theobserved ERBB4 regulationdoesnotseemtobecausallyinvolved expression inadiposetissuedepots.Thus,adisturbed of renal on ourdatainmicewithDKD,thereisnosimilarpattern supporting therodentdatafromZeng insulin resistance,forexample,HOMA-IR,inourcohort negative associationoftheadipokinewithmarkers It isworthnotingthatwehaveshownabeneficialand Clinical Study Taken together, circulating NRG4isindependently We havefurtherfoundapositiveassociationofNRG4 . Erbb4 Nrg4 mRNAexpressionascomparedto is reduced in adipose tissue depots of S Kralischandothers https://doi.org/10.1530/ t al et 41 . ( ). However, 41 40 ). Thus, ). Based Nrg4
References
Neuregulin 4andrenalfunction 15 14 13 12 10 11 2 9 8 6 5 3 4 1 7 Chang AR, Grams ME,Ballew SH,Bilo H,Correa A,Evans M, Lozano R, Naghavi M,Foreman K,Lim S,Shibuya K,Aboyans V, Sharma K, McCue P&Dunn SR.Diabetic kidneydiseaseinthedb/ Zhao HJ, Wang S, Cheng H,Zhang MZ,Takahashi T, Fogo AB, Matthews DR, Hosker JP, Rudenski AS,Naylor BA,Treacher DF American DiabetesAssociation.Diagnosisandclassificationof Levey AS, Stevens LA,Schmid CH,Zhang YL,Castro AF, Feldman HI, Kralisch S, Hoffmann A,Klöting N,Bachmann A,Kratzsch J, Stein S, Bachmann A,Lossner U,Kratzsch J,Bluher M,Stumvoll M& Ziegelmeier M, Bachmann A,Seeger J,Lossner U,Kratzsch J, Ebert T, Kralisch S,Hoffmann A,Bachmann A,Lössner U,Kratzsch J, Wang GX, Zhao XY, Meng ZX,Kern M,Dietrich A,Chen Z, Villarroya F, Cereijo R,Villarroya J &Giralt M.Brownadiposetissue Shulman A, Peltonen M,Sjöström CD,Andersson-Assarsson JC, Cypess AM &Kahn CR.Brownfatasatherapyforobesityand individual participantdatainaglobalconsortium. and riskofdeclineinglomerularfiltrationrate:meta-analysis Gutierrez OM, Hosseinpanah F, Iseki K,Kenealy T 2012 a systematicanalysisfortheGlobalBurdenofDiseaseStudy2010. mortality from235causesofdeathfor20agegroupsin1990and2010: Abraham J, Adair T, Ahn SY Aggarwal R, F1138–F1144. db mouse. org/10.1681/ASN.2006070798) American SocietyofNephrology produces acceleratednephropathyin diabeticmice. Breyer MD &Harris RC.Endothelialnitricoxidesynthasedeficiency org/10.1007/BF00280883) concentrations inman. and beta-cellfunctionfromfastingplasmaglucoseinsulin & Turner RC. Homeostasismodelassessment:insulinresistance org/10.2337/dc13-S067) diabetes mellitus. 604–612. estimate glomerularfiltrationrate. Kusek JW, Eggers P, Van Lente F, Greene T (https://doi.org/10.1016/j.diabet.2017.01.005) diabetic kidneydisease. novel adipokine/hepatokinefetuinBinseverehumanandmurine Blüher M, Zhang MZ,Harris RC,Stumvoll M,Fasshauer M dc08-1054) function. Fasshauer M. SerumlevelsoftheadipokineFGF21dependonrenal 2007 retinol-binding protein-4inrelationtorenalfunction. Blüher M, Stumvoll M&Fasshauer M.Serumlevelsofadipokine 2014 type 2diabetesmellitus. like protein8isindependentlyassociatedwithfastingplasmaglucoseand Blüher M, Stumvoll M,Tönjes A &Fasshauer M.Circulating angiopoietin- 1436–1443. secreted factor Nrg4 preserves metabolichomeostasisthrough secreted factorNrg4preserves Cozacov Z, Zhou D,Okunade AL,Su X (https://doi.org/10.1038/nrendo.2016.136) organ. as asecretory 17 Swedish obesesubjectsstudy. inthe Incidence ofend-stagerenaldiseasefollowingbariatricsurgery Taube M, Sjöholm K,leRoux CW, Carlsson LMS&Svensson PA. k5301. attenuation ofhepaticlipogenesis. diabetes. 964–973. 143–149. 99 380 30 (https://doi.org/10.1136/bmj.k5301) E2510–E2517. 2588–2592. (https://doi.org/10.7326/0003-4819-150-9-200905050-00006) 2095–2128. Current OpinioninEndocrinology, Diabetes,andObesity (https://doi.org/10.1038/s41366-018-0045-x) Diabetes Care American Journal ofPhysiology:RenalPhysiology American Journal (https://doi.org/10.1038/nm.3713) (https://doi.org/10.1097/MED.0b013e328337a81f) (https://doi.org/10.1152/ajprenal.00315.2002) Diabetes Care Nature Reviews:Endocrinology (https://doi.org/10.2337/dc07-0275) (https://doi.org/10.1016/S0140-6736(12)61728-0) (https://doi.org/10.1210/jc.2013-4349) 2009 Journal ofClinicalEndocrinologyandMetabolism Journal Diabetologia Diabetes andMetabolism Downloaded fromBioscientifica.com at09/27/202106:41:03PM 32 2006 International Journal ofObesity Journal International 2012 126–128. Annals of Internal Medicine Annals ofInternal Nature Medicine 17 1985 36 2664–2669. et al. et al. S67–S74. et al 28 (https://doi.org/10.2337/ Global and regional Globalandregional 181 Thebrownfat-enriched 412–419. . A new equation to . Anewequationto :2 2017 (https://doi. 2017 et al. 2014 (https://doi. BMJ Journal ofthe Journal 43 Adiposity (https://doi. Diabetes Care 2019 13 20 465–468. 2003 26–35. et al. 2009
2018
364 2010 158 284 The Lancet 150
42 via freeaccess
European Journal of Endocrinology
28 27 26 25 24 23 22 21 20 19 17 16 18 Clinical Study Duranton F, Cohen G,Smet RD,Rodriguez M,Jankowski J, Wen MS, Wang CY, Lin SL&Hung KC.Decreaseinirisinpatients Hindricks J, Ebert T, Bachmann A,Kralisch S,Lössner U,Kratzsch J, Ebert T, Hopf LM,Wurst U, Bachmann A,Kralisch S,Lössner U, Richter J, Focke D,Ebert T, Kovacs P, Bachmann A,Lössner U, Zoccali C, Mallamaci F, Tripepi G, Benedetto FA, Cutrupi S, Merabet E, Dagogo-Jack S,Coyne DW, Klein S,Santiago JV, Hmiel SP Cohen G, Glorieux G, Thornalley P, Schepers E, Meert N, Jankowski J, Stockler-Pinto MB, Saldanha JF, Yi D, Mafra D,Fouque D& Klein J, Fasshauer M,Ito M,Lowell BB,Benito M&Kahn CR. Ebert T, Focke D,Petroff D,Wurst U, Richter J,Bachmann A,Lössner U, Kralisch S, Hoffmann A,Klöting N,Bachmann A,Kratzsch J, Ebert T, Kralisch S,Klöting N,Hoffmann A,Blüher M,Zhang MZ, ASN.2011121175) Society ofNephrology pathologic concentrationsofuremictoxins. Vanholder R &Argiles A.Group onbehalfoftheEUTW. Normaland org/10.1371/journal.pone.0064025) with chronickidneydisease. org/10.1111/cen.12380) dysfunction. fibroblast growthfactor-21areincreasedinchronicandacuterenal Stolzenburg JU, Dietel A,Beige J,Anders M 2014 renal dysfunction. adipocyte fattyacidbindingproteinisincreasedinchronicandacute Platz M, Kratzsch J,Stolzenburg JU,Dietel A 36 adipokine progranulindependonrenalfunction. Kralisch S, Kratzsch J,Beige J,Anders M Nephrology patients withend-stagerenaldisease. Adiponectin, metabolicriskfactors,andcardiovasculareventsamong Parlongo S, Malatino LS,Bonanno G,Seminara G,Rapisarda F 847–850. disease. & Landt M.Increasedplasmaleptinconcentrationinend-stagerenal (https://doi.org/10.1093/ndt/gfm210) uraemia. solutes invitrotowardsastandardizedapproachforresearch on uraemic toxinsIII:recommendationsforhandlingretention Jankowski V, Argiles A, Anderstam B,Brunet P 5762.2015.1125996) Free RadicalResearch oxygen speciesproductionandinflammationin3T3-L1adiposecells. Soulage CO. Theuremictoxinindoxylsulfateexacerbatesreactive org/10.1074/jbc.274.49.34795) ofBiologicalChemistry Journal and decreasesinsulin-inducedglucoseuptakeinbrownadipocytes. β Endocrinology irisin inrelationtometabolicandrenalfunction. Kralisch S, Kratzsch J,Beige J 2017 increased inrenaldysfunction. Stolzenburg JU, Dietel A,Beige J,Anders M,Bast I ki.2015.266) Kidney International not renalprogranulinexpressionisincreasedindysfunction. Harris RC, Stumvoll M&Fasshauer M.Circulating progranulinbut 3-Adrenergic stimulationdifferentiallyinhibitsinsulinsignaling 410–414. 24 32 Journal ofClinicalEndocrinologyandMetabolism Journal 1027–1034. 1637–1644. Nephrology, Dialysis,Transplantation (https://doi.org/10.1210/jcem.82.3.3817) 2002 2014 (https://doi.org/10.2337/dc12-0220) Clinical Endocrinology 13 170 Nutrition, Metabolism,andCardiovascular Diseases 2015 134–141. 2012 2016 (https://doi.org/10.1093/ndt/gfw472) (https://doi.org/10.1016/j.numecd.2014.03.006) 501–506. 88 23 50 et al. 1197–1198. 1258–1270. 337–344. 1999 PLoS ONE Nephrology, Dialysis,Transplantation (https://doi.org/10.1530/EJE-13-1053) Serum levels of the myokine Serumlevelsofthemyokine 2014 274 Journal oftheAmericanSociety Journal S Kralischandothers 2013 (https://doi.org/10.3109/1071 34795–34802. et al. 80 (https://doi.org/10.1681/ (https://doi.org/10.1038/ 918–924. et al. 2007 Journal oftheAmerican Journal et al. Serumlevelsofthe 8 e64025. et al. European Journal of of European Journal Serumlevelsof Circulating Diabetes Care et al. 22 Reviewon 3381–3390. (https://doi. (https://doi. 1997 FSTL3is (https://doi. 82 et al. 2013
Accepted 31May2019 Revised versionreceived16May2019 Received 8January\2019
Neuregulin 4andrenalfunction 34 33 32 31 30 29 41 40 39 38 36 35 37 Ebert T, Kralisch S,Wurst U, Scholz M,Stumvoll M,Kovacs P, Yan P, Xu Y, Wan Q, Feng J,Li H,Yang J, Zhong H&Zhang Z. Feron O, Zhao YY&Kelly RA.Theinsandoutsofcaveolarsignaling: Nugroho DB, Ikeda K,Kajimoto K,Hirata KI&Emoto N.Activation Nugroho DB, Ikeda K,Barinda AJ,Wardhana DA, Yagi K, Miyata K, Koppe L, Pillon NJ,Vella RE, Croze ML,Pelletier CC,Chambert S, Cai C, Lin M,Xu Y, Li X,Yang S &Zhang H.Associationof Zeng F, Wang Y, Kloepfer LA,Wang S &Harris RC.ErbB4deletion Kang YE, Kim JM,Choung S,Joung KH,Lee JH,Kim HJ&Ku BJ. Zhang L, Fu Y, Zhou N,Cheng X&Chen C.Circulating neuregulin Kralisch S, Hoffmann A,Kratzsch J,Blüher M,Stumvoll M,Fasshauer M Zhang X, Yeung DCY, Karpisek M,Stejskal D,Zhou ZG,Liu F, Ebert T, Gebhardt C,Scholz M,Wohland T, Schleinitz D,Fasshauer M, Fasshauer M &Tönjes A. Associationofmetabolicparametersand Markers in patientsnewlydiagnosedwithtype2diabetesmellitus. Plasma neuregulin4levelsareassociatedwithmetabolicsyndrome org/10.1111/j.1749-6632.1999.tb09220.x) the NewYork AcademyofSciences neuregulin andErbB4signalingincardiacmyocytesa. m2 muscariniccholinergicreceptorsandeNOSactivationversus org/10.1016/j.bbrc.2018.08.197) Research Communications enhancing adiposetissueangiogenesis. of neuregulin-4inadipocytesimprovesmetabolichealthby 2018 vasculature. that iscriticallyinvolvedinthemaintenanceofadiposetissue Oike Y, Hirata KI&Emoto N.Neuregulin-4isanangiogenicfactor org/10.1681/ASN.2012050503) of theAmericanSocietyNephrology sulfate promotesinsulinresistanceassociatedwithCKD. Massy Z, Glorieux G,Vanholder R, Dugenet Y org/10.1186/s12916-016-0703-6) a cross-sectionalstudy. circulating neuregulin4withmetabolicsyndromeinobeseadults: E583–E593. ofPhysiology:EndocrinologyandMetabolism American Journal predisposes todevelopmentofmetabolicsyndromeinmice. org/10.1016/j.diabres.2016.04.007) Diabetes Research andClinicalPractice diagnosed type2diabetesmellitusandcontrolswithoutdiabetes. Comparison ofserumneuregulin4(Nrg4)levelsinadultswithnewly org/10.1007/s12020-017-1324-3) a cross-sectionalstudy. 4 concentrationsinpatientswithnewlydiagnosedtype2diabetes: (https://doi.org/10.1016/j.diabet.2017.06.001) gestational diabetesmellitus. & Ebert T. Thebrown-fat-secretedadipokineneuregulin4isdecreasedin (https://doi.org/10.2337/db07-1476) the metabolicsyndromeinhumans. are increasedinobesityandindependentlyassociatedwith Wong RLC, Chow WS,Tso AWK, Lam KSL (https://doi.org/10.1210/jc.2017-02085) ofClinicalEndocrinologyandMetabolism Journal adipocytokines anddistinctcomponentsofthemetabolicsyndrome. Blüher M, Stumvoll M,Kovacs P&Tönjes A. Relationshipbetween12 ijo.2015.157) ofObesity Journal rs726344 inFNDC5withserumirisinconcentrations. 503 2018 378–384. (https://doi.org/10.1152/ajpendo.00166.2018) Biochemical andBiophysicalResearch Communications 2018 2016 6974191. (https://doi.org/10.1016/j.bbrc.2018.06.043) 40 BMC Medicine Endocrine 2018 260–265. Downloaded fromBioscientifica.com at09/27/202106:41:03PM Diabetes andMetabolism (https://doi.org/10.1155/2018/6974191) 504 1999 2017 427–433. 2013 (https://doi.org/10.1038/ https://eje.bioscientifica.com 2016 2016 Diabetes 874 57 Biochemical andBiophysical 24 535–538. 11–19. et al. 117 181 14 88–99. 2018 2008 (https://doi. 165. et al. 1–3. :2 SerumFGF21levels (https://doi. 103 2018 p-cresyl 57 (https://doi. (https://doi. (https://doi. (https://doi. 1246–1253. 1015–1023. 1015–1023. International International Annals of 44 Journal Journal Disease 150–154. 150–154. 2018 159
315 via freeaccess