DOCSLIB.ORG

PWD/Ph-Encoded Genetic Variants Modulate the Cellular Wnt/B-Catenin Response to Suppress Apcmin-Triggered Intestinal Tumor Formation Alexandra L

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PWD/Ph-Encoded Genetic Variants Modulate the Cellular Wnt/B-Catenin Response to Suppress Apcmin-Triggered Intestinal Tumor Formation Alexandra L Published OnlineFirst November 5, 2020; DOI: 10.1158/0008-5472.CAN-20-1480 CANCER RESEARCH | GENOME AND EPIGENOME PWD/Ph-Encoded Genetic Variants Modulate the Cellular Wnt/b-Catenin Response to Suppress ApcMin-Triggered Intestinal Tumor Formation Alexandra L. Farrall1,2, Matthias Lienhard1, Christina Grimm1,3, Heiner Kuhl1,4, Susanna H.M. Sluka1, Marta Caparros1, Jiri Forejt5, Bernd Timmermann1, Ralf Herwig1, Bernhard G. Herrmann1,6, and Markus Morkel7 ABSTRACT ◥ Genetic predisposition affects the penetrance of tumor-initiating suggesting that PWD variants restrict adenoma initiation by mutations, such as APC mutations that stabilize b-catenin and controlling stem cell homeostasis. Gene expression of modifier cause intestinal tumors in mice and humans. However, the mechan- candidates and DNA methylation on chromosome 5 were isms involved in genetically predisposed penetrance are not well predominantly cis controlled and largely reflected parental understood. Here, we analyzed tumor multiplicity and gene expres- patterns, providing a genetic basis for inheritance of tumor þ sion in tumor-prone ApcMin/ mice on highly variant C57BL/6J susceptibility. Human SNP variants of several modifier candi- (B6) and PWD/Ph (PWD) genetic backgrounds. (B6 Â PWD) F1 dates were depleted in colorectal cancer genomes, suggesting APCMin offspring mice were largely free of intestinal adenoma, and that similar mechanisms may also affect the penetrance of several chromosome substitution (consomic) strains carrying single cancer driver mutations in humans. Overall, our analysis high- PWD chromosomes on the B6 genetic background displayed lights the strong impact that multiple genetic variants acting in reduced adenoma numbers. Multiple dosage-dependent modifier networks can exert on tumor development. loci on PWD chromosome 5 each contributed to tumor suppres- sion. Activation of b-catenin–driven and stem cell–specific gene Significance: These findings in mice show that, in addition to expression in the presence of ApcMin or following APC loss accidental mutations, cancer risk is determined by networks of remained moderate in intestines carrying PWD chromosome 5, individual gene variants. Introduction human colon and mouse intestinal cancer (1), preventing the destruc- tion of nuclear b-catenin, thereby stabilizing stem cell fate (2). Cancers are driven by genetic mutations and epigenetic alterations The sequential acquisition of multiple mutations in oncogenes or arising in individual somatic cells, primarily adult stem cells. Loss of tumor suppressors during a lifetime that eventually leads to cancer has the tumor suppressor APC is the most frequent initiating mutation in been considered as a matter of “bad luck” (3). In this model, cancer occurs via DNA replication errors generating cancer driver mutations, which is a random process related to the number of stem cell divisions in the tissue. In familial cancer, high-penetrance susceptibility muta- 1Max Planck Institute for Molecular Genetics, Berlin, Germany. 2College of Medicine and Public Health, Flinders University, Adelaide, South Australia, tions provide a cancer driver allele already in the germline, thereby Australia. 3Department of Translational Epigenetics and Tumor Genetics, Uni- strongly increasing cancer risk. In colon cancer, inherited heterozy- versity Hospital Cologne, Cologne, Germany. 4Leibniz-Institute of Freshwater gous mutations in the APC tumor suppressor gene cause familial Ecology and Inland Fisheries, Department of Ecophysiology and Aquaculture, adenomatous polyposis (4–6). 5 Berlin, Germany. Institute of Molecular Genetics, Academy of Sciences of the Adding complexity to this simple stochastic model, studies in 6 – € Czech Republic, Vestec, Prague, Czech Republic. Charite Universitatsmedizin human individuals, twins, and populations have demonstrated that Berlin, corporate member of Freie Universitat€ Berlin, Humboldt-Universitat€ zu Berlin, and Berlin Institute of Health, Institute for Medical Genetics, Berlin, the incidence of sporadic (nonfamilial) cancers also has a genetic Germany. 7Charite – Universitatsmedizin€ Berlin, corporate member of Freie component (7, 8). For instance, monozygotic twins were found to have Universitat€ Berlin, Humboldt-Universitat€ zu Berlin, and Berlin Institute of Health, a higher than random chance of developing cancer of the same organ, Institute of Pathology, Berlin, Germany. including the colorectum (9). Chances of developing sporadic cancer Note: Supplementary data for this article are available at Cancer Research may thus partly depend on largely undefined sets of low-penetrance Online (http://cancerres.aacrjournals.org/). alleles of multiple genes, each making some contribution to the A.L. Farrall and M. Lienhard contributed equally as co-first authors of this article. individual lifetime risk of developing cancer. The assessment of cancer incidence in mice with inbred genetic B.G. Herrmann and M. Morkel contributed equally to this article. backgrounds provides an opportunity to determine genetic factors and Corresponding Authors: Markus Morkel, Charite Universitatsmedizin€ Berlin, mechanisms modifying cancer susceptibility (10–13). Commonly, Chariteplatz 1, Berlin 10117, Germany. Phone: 4930-450-536107; E-mail: these modifier genes are identified by comparing defined, but different, [email protected]; and Bernhard G. Herrmann, Max Planck Institute for Molecular Genetics, Ihnestrasse 63, 14195 Berlin. Phone: 4930-8413-1409; E-mail: inbred genomes in cancer models carrying a high-penetrance allele, [email protected] resulting in high tumor multiplicity per animal. The most common mouse model for colon cancer is the ApcMin mouse carrying a Cancer Res 2021;81:38–49 heterozygous germline mutation in Apc (14, 15). On a C57BL/6 inbred þ doi: 10.1158/0008-5472.CAN-20-1480 genetic background, ApcMin/ mice can develop more than a 100 Ó2020 American Association for Cancer Research. intestinal adenomas by the age of 3 months. Environmental factors, AACRJournals.org | 38 Downloaded from cancerres.aacrjournals.org on January 12, 2021. © 2021 American Association for Cancer Research. Published OnlineFirst November 5, 2020; DOI: 10.1158/0008-5472.CAN-20-1480 PWD-Encoded Modifiers Suppress APCMin-Induced Tumorigenesis such as the diet and the gut microbiome, also affect tumor multiplic- Organoid culture ity (16). Multiple loci have been identified that modify tumor incidence Intestinal organoids were cultured according to procedures þ of ApcMin/ mice (17). However, how modifier candidates interact with published previously (19) in Matrigel (Corning). Normal intestinal the cell signaling network controlling intestinal homeostasis has not organoid medium contained the growth factors, EGF, Noggin, and been investigated in detail. R-Spondin. Adenoma cultures were selected for spheroid formation by Here, we employed C57BL/6J (B6) and PWD/Ph (PWD) chromo- omission of R-Spondin. some substitution (consomic) mouse lines as a rich source of genetic variation (18). We found that PWD chromosomes encode multiple Library preparations and methylated DNA immunoprecipitation modifiers of Min with tumor-protective effects. We show that the For RNA sequencing (RNA-seq), 4 mg total RNA was depleted expression of many PWD and B6 alleles, as well as patterns of DNA for ribosomal RNA using RiboMinus Eukaryote Kit for RNA-seq methylation, are cis-controlled and preserved in offspring F1 mice. We (Invitrogen), and used for generation of single-end RNA-seq libraries, provide evidence that differences in intestinal tumor multiplicity as described previously (20). cDNA libraries were size selected (150– between B6 and PWD mice correlate with the control of intestinal 200 bp) on a 2% agarose gel, and purified using the Qiaquick Gel Wnt/b-catenin activity. Our study, therefore, provides genetic evi- Extraction Kit (Qiagen). DNA sequencing was performed on NextSeq dence for the inheritance of individual cancer risks via modifier gene 500 Sequencers (Illumina) with 2 Â 150-bp read lengths, using 500 bp variants controlling cell signaling networks. insert sizes and several mate-pair libraries without size selection with sizes ranging from 3 to 15 kb. Methyl-DNA immunoprecipitation and sequencing were performed as published previously (21), using a Materials and Methods GAIIx Sequencer (Illumina) and Illumina 1.5 and 1.6 pipelines. Mice C57BL/6J(B6,TheJacksonLaboratory)miceweremaintainedby Assembly of the PWD genome backcrossing to C57BL/6JOlaHsd (Harlan). PWD mice and con- DNA reads were assembled in a hybrid approach, using IDBA-UD somic strains were obtained from the Academy of Sciences of the assembler (22), followed by NEWBLER v3 (Roche/454) and SSPACE2 Czech Republic (Vestec, Czech Republic) and imported to the scaffolding (23, 24), yielding a total contig length of 2.351 gigabases animal facility of the MPIMG by embryo transfer. Animals were and N50 length of 10,731 bp. We used Platanus gap close (25) and housed at a 12-hour/12-hour light/dark cycle and fed ad libitum. SOAPdenovo's GapCloser (26) for an initial draft assembly spanning Mice were genotyped for Apc wild-type and Min alleles from tail 2.535 gigabases, corresponding to 92.8% of the mouse genome size DNA. Genotyping for B6 and PWD sequences on chromosome 5 with an N50 scaffold length of 2.46 megabases. Comparing these was done using a panel of 36 polymorphic SNP markers, as scaffolds to mm10 reference identified 573 breaks of colinearity with published previously (18). an average 340-fold mate-pair physical coverage.
Load more

Recommended publications
  • Preclinical Research 2020 Sections
    Sackler Faculty of Medicine Preclinical Research 2020 Sections Cancer and Molecular Therapies 8 Dental Health and Medicine 52 Diabetes, Metabolic and Endocrine Diseases 62 Genomics & Personalized Medicine 78 Hearing, Language & Speech Sciences and Disorders 98 Infectious Diseases 117 Inflammatory and Autoimmune Diseases 137 Medical Education and Ethics 147 Nervous System and Brain Disorders 154 Nursing, Occupational and Physical Therapy 200 Public Health 235 Reproduction, Development and Evolution 263 Stem Cells and Regenerative Medicine 280 Cover images (from bottom left, clockwise): Image 1: Human embryonic stem cell derived cardiomyocytes stained with fluorescent antibodies. The cardiac marker alpha-actinin (green), calcium channel modulator, Ahnak1 (red) – Shimrit Oz, Nathan Dascal. Image 2: Islet of Langerhans containing insulin-producing beta-cells (green) and glucagon- producing alpha-cells (red) – Daria Baer, Limor Landsman. Image 3: β-catenin in C. elegans vulva – Michal Caspi, Limor Broday, Rina Rosin-Arbesfeld. Image 4: Stereocilia of a sensory outer hair cell from a mouse inner ear – Shaked Shivatzki, Karen Avraham. Image 5: Electron scanning micrograph of middle ear ossicles from a mouse ear stained with pseudo colors – Shaked Shivatski, Karen Avraham. Image 6: Resistin-like molecule alpha (red), eosinophil major basic protein (green) and DAPI (blue) staining of asthmatic mice – Danielle Karo-Atar, Ariel Munitz. © All rights reserved Editor: Prof. Karen Avraham Graphic design: Michal Semo Kovetz, TAU Graphic Design Studio February 2020 Sackler Faculty of Medicine Research 2020 2 The Sackler Faculty of Medicine The Sackler Faculty of Medicine is Israel’s largest diabetes, neurodegenerative diseases, infectious medical research and training complex. The Sackler diseases and genetic diseases, including but not Faculty of Medicine of Tel Aviv University (TAU) was imited to Alzheimer’s disease, Parkinson’s disease founded in 1964 following the generous contributions and HIV/AIDS.
    [Show full text]
  • Datasheet BA0931 Anti-HSPH1 Antibody
    Product datasheet Anti-HSPH1 Antibody Catalog Number: BA0931 BOSTER BIOLOGICAL TECHNOLOGY Special NO.1, International Enterprise Center, 2nd Guanshan Road, Wuhan, China Web: www.boster.com.cn Phone: +86 27 67845390 Fax: +86 27 67845390 Email: [email protected] Basic Information Product Name Anti-HSPH1 Antibody Gene Name HSPH1 Source Rabbit IgG Species Reactivity human,rat,mouse Tested Application WB,IHC-P,ICC/IF,FCM Contents 500ug/ml antibody with PBS ，0.02% NaN3 , 1mg BSA and 50% glycerol. Immunogen A synthetic peptide corresponding to a sequence at the C-terminus of human Hsp105(713-733aa EVMEWMNNVMNAQAKKSLDQD), different from the related mouse sequence by one amino acid, and different from the related rat sequence by two amino acids. Purification Immunogen affinity purified. Observed MW 110KD Dilution Ratios Western blot: 1:500-2000 Immunohistochemistry in paraffin section IHC-(P)： 1:50-400 Immunocytochemistry/Immunofluorescence (ICC/IF): 1:50-400 Flow cytometry (FCM)： 1-3μg/1x106 cells (Boiling the paraffin sections in 10mM citrate buffer,pH6.0,or PH8.0 EDTA repair liquid for 20 mins is required for the staining of formalin/paraffin sections.) Optimal working dilutions must be determined by end user. Storage 12 months from date of receipt，-20℃ as supplied.6 months 2 to 8℃ after reconstitution. Avoid repeated freezing and thawing Background Information HSP105(HEAT-SHOCK 105/110-KD PROTEIN 1), also called HSPH1 or HSP110, is a protein that in humans is encoded by the HSPH1 gene. Immunohistochemical analysis localizes HSP105 mainly in the cytoplasm. Database analysis indicates that both HSP105 isoforms are highly conserved during evolution.
    [Show full text]
  • Genomic Identification, Evolution and Sequence Analysis of the Heat
    G C A T T A C G G C A T genes Article Genomic Identification, Evolution and Sequence Analysis of the Heat-Shock Protein Gene Family in Buffalo 1, 2, 3 4 1 Saif ur Rehman y, Asif Nadeem y , Maryam Javed , Faiz-ul Hassan , Xier Luo , Ruqayya Bint Khalid 3 and Qingyou Liu 1,* 1 State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangxi University, Nanning 530005, China; [email protected] (S.u.R.); [email protected] (X.L.) 2 Department of Biotechnology, Virtual University of Pakistan, Lahore-54000, Pakistan; [email protected] 3 Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore-54000, Pakistan; [email protected] (M.J.); [email protected] (R.B.K.) 4 Institute of Animal and Dairy Sciences, Faculty of Animal Husbandry, University of Agriculture, Faisalabad-38040, Pakistan; [email protected] * Correspondence: [email protected]; Tel.: +86-138-7880-5296 These authors contributed equally to this manuscript. y Received: 26 October 2020; Accepted: 18 November 2020; Published: 23 November 2020 Abstract: Heat-shock proteins (HSP) are conserved chaperones crucial for protein degradation, maturation, and refolding. These adenosine triphosphate dependent chaperones were classified based on their molecular mass that ranges between 10–100 kDA, including; HSP10, HSP40, HSP70, HSP90, HSPB1, HSPD, and HSPH1 family. HSPs are essential for cellular responses and imperative for protein homeostasis and survival under stress conditions. This study performed a computational analysis of the HSP protein family to better understand these proteins at the molecular level.
    [Show full text]
  • Deep Multiomics Profiling of Brain Tumors Identifies Signaling Networks
    ARTICLE https://doi.org/10.1038/s41467-019-11661-4 OPEN Deep multiomics profiling of brain tumors identifies signaling networks downstream of cancer driver genes Hong Wang 1,2,3, Alexander K. Diaz3,4, Timothy I. Shaw2,5, Yuxin Li1,2,4, Mingming Niu1,4, Ji-Hoon Cho2, Barbara S. Paugh4, Yang Zhang6, Jeffrey Sifford1,4, Bing Bai1,4,10, Zhiping Wu1,4, Haiyan Tan2, Suiping Zhou2, Laura D. Hover4, Heather S. Tillman 7, Abbas Shirinifard8, Suresh Thiagarajan9, Andras Sablauer 8, Vishwajeeth Pagala2, Anthony A. High2, Xusheng Wang 2, Chunliang Li 6, Suzanne J. Baker4 & Junmin Peng 1,2,4 1234567890():,; High throughput omics approaches provide an unprecedented opportunity for dissecting molecular mechanisms in cancer biology. Here we present deep profiling of whole proteome, phosphoproteome and transcriptome in two high-grade glioma (HGG) mouse models driven by mutated RTK oncogenes, PDGFRA and NTRK1, analyzing 13,860 proteins and 30,431 phosphosites by mass spectrometry. Systems biology approaches identify numerous master regulators, including 41 kinases and 23 transcription factors. Pathway activity computation and mouse survival indicate the NTRK1 mutation induces a higher activation of AKT down- stream targets including MYC and JUN, drives a positive feedback loop to up-regulate multiple other RTKs, and confers higher oncogenic potency than the PDGFRA mutation. A mini-gRNA library CRISPR-Cas9 validation screening shows 56% of tested master regulators are important for the viability of NTRK-driven HGG cells, including TFs (Myc and Jun) and metabolic kinases (AMPKa1 and AMPKa2), confirming the validity of the multiomics inte- grative approaches, and providing novel tumor vulnerabilities.
    [Show full text]
  • Neuronal Vulnerability and Multilineage Diversity in Multiple Sclerosis
    Europe PMC Funders Group Author Manuscript Nature. Author manuscript; available in PMC 2020 January 17. Published in final edited form as: Nature. 2019 June 13; 573(7772): 75–82. doi:10.1038/s41586-019-1404-z. Europe PMC Funders Author Manuscripts Neuronal vulnerability and multilineage diversity in multiple sclerosis Lucas Schirmer#1,2,3,4, Dmitry Velmeshev#1,5, Staffan Holmqvist2, Max Kaufmann6, Sebastian Werneburg7, Diane Jung1,5, Stephanie Vistnes1,4, John H. Stockley2, Adam Young8, Maike Steindel2,8, Brian Tung1,5,9, Nitasha Goyal1,5,9, Aparna Bhaduri1,5, Simone Mayer1,5, Jan Broder Engler6, Omer A. Bayraktar2, Robin J. M. Franklin8, Maximilian Haeussler10, Richard Reynolds11, Dorothy P. Schafer7, Manuel A. Friese6, Lawrence R. Shiow1,4, Arnold R. Kriegstein1,5,†, David H. Rowitch1,2,4,† 1Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research, University of California, San Francisco, San Francisco, CA 94143, USA 2Department of Paediatrics and Wellcome-MRC Cambridge Stem Cell Institute, University of Cambridge, Cambridge, CB2 0QQ, UK 3Department of Neurology, Medical Faculty Mannheim, University of Heidelberg, 68167 Mannheim, Germany 4Department of Pediatrics/Neonatology, University of California, San Francisco, San Francisco, CA 94158, USA 5Department of Neurology, University of California, San Francisco, San Francisco, CA 94158, Europe PMC Funders Author Manuscripts USA 6Institute of Neuroimmunology and Multiple Sclerosis, Center for Molecular Neurobiology Hamburg, University Medical Center Hamburg-Eppendorf,
    [Show full text]
  • Transcriptome-Wide Profiling of the Neonatal Monocyte Response to E
    Transcriptome-wide profiling of the neonatal monocyte response to E. coli and S. epidermidis Emma de Jong, B.Sc. (Hons) This thesis is presented for the degree of Doctor of Philosophy School of Veterinary & Life Sciences 2015 Declaration I declare that this thesis is my own account of my research, and contains as its main content work that has not previously been submitted for a degree at any other tertiary education institution. .................................... (Emma de Jong) i ii Abstract Preterm infants are extremely vulnerable to life-threatening invasive infections (particularly with Staphylococcus epidermidis and Escherichia coli) however our understanding of their innate immune defences is limited. Furthermore, prenatal exposure to histologic chorioamnionitis (HCA) complicates 40–70% of preterm births and is known to modulate the risk for sepsis, yet the impact of HCA on the development of innate immunity is largely unknown. We hypothesised that inadequate monocyte activation by neonatal pathogens results in impaired innate immune responses thereby increasing preterm infants’ susceptibility to invasive infection, and that prenatal exposure to HCA overrides these impairments. Cell sorting and bacterial stimulation methodologies were developed and optimised specifically for working with human infant cord blood samples. RNA-sequencing was performed on purified cord blood monocytes from very preterm (≤31 weeks gestational age (GA)) and term infants (37–40 weeks GA) following challenge with live S. epidermidis or E. coli to identify gene/pathway differences specific to the preterm infant. Protein levels of inflammatory cytokines and chemokines were measured in paired monocyte culture supernatants. Preterm infants displayed a quantitative monocyte deficiency compared to term infants, manifesting as reduced frequencies of classical monocytes with significantly reduced CD14 expression.
    [Show full text]
  • Population Genomics in a Disease Targeted Primary Cell Model
    Downloaded from genome.cshlp.org on October 8, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Population genomics in a disease targeted primary cell model Elin Grundberg,1,2,12 Tony Kwan,1,2,12 Bing Ge,2 Kevin C.L. Lam,2 Vonda Koka,2 Andreas Kindmark,3 Hans Mallmin,4 Joana Dias,2 Dominique J. Verlaan,1,2,5 Manon Ouimet,5 Daniel Sinnett,5,6 Fernando Rivadeneira,7,8 Karol Estrada,7 Albert Hofman,8 Joyce M. van Meurs,7 Andre´ Uitterlinden,7,8 Patrick Beaulieu,5 Alexandru Graziani,5 Eef Harmsen,2 O¨ sten Ljunggren,3 Claes Ohlsson,9 Dan Mellstro¨m,9 Magnus K. Karlsson,10 Olle Nilsson,4 and Tomi Pastinen1,2,11,13 1Department of Human Genetics, McGill University, Montre´al H3A 1B1, Canada; 2McGill University and Genome Que´bec Innovation Centre, Montre´al H3A 1A4, Canada; 3Department of Medical Sciences, Uppsala University, Uppsala 75185, Sweden; 4Department of Surgical Sciences, Uppsala University, Uppsala 75185, Sweden; 5Sainte-Justine University Health Center, Montre´al H3T 1C5, Canada; 6Department of Pediatrics, University of Montre´al, Montre´al H3T 1C5, Canada; 7Department of Internal Medicine, Erasmus MC, Rotterdam 3015GE, The Netherlands; 8Department of Epidemiology, Erasmus MC, Rotterdam 3015GE, The Netherlands; 9Center for Bone Research at the Sahlgrenska Academy, Department of Internal Medicine, Go¨teborg University, Gothenburg 41345, Sweden; 10Clinical and Molecular Osteoporosis Research Unit, Department of Clinical Science, Lund University and Department of Orthopaedics, Malmo¨University Hospital, Malmo¨20502, Sweden; 11Department of Medical Genetics, McGill University, Montre´al H3H 1P3, Canada The common genetic variants associated with complex traits typically lie in noncoding DNA and may alter gene regu- lation in a cell type-specific manner.
    [Show full text]
  • Heat Shock Proteins (HSP)-60, -70, -90, and 105 Display Variable Spatial and Temporal Immunolocalization Patterns in the Involuting Rat Uterus
    DOI: 10.21451/1984-3143-AR917 Anim. Reprod., v.14, n.4, p.1072-1086, Oct./Dec. 2017 Heat shock proteins (HSP)-60, -70, -90, and 105 display variable spatial and temporal immunolocalization patterns in the involuting rat uterus Narin Liman1 Department of Histology and Embryology, Faculty of Veterinary Medicine, Erciyes University, Kayseri, Turkey. Abstract (PR) and the subsequent regulation of transcription of the target genes in this tissue. Evidence shows that the Uterine involution involves substantial tissue function of the steroid hormone receptors is regulated destruction and subsequent repair and remodelling, with by a group of constitutively synthesized heat shock similarities to the microenvironments present during proteins (HSPs) (Picard, 1998). HSPs, or stress proteins, wound healing. Although involution is a physiologically are endogenous proteins that are either present normal process, it may generate a stressful constitutively, functioning as chaperones (Craig et al., microenvironment for the uterine cells, and thus it can 1994), or induced upon cell stress, such as heat, induce the expression of heat shock proteins (HSPs), oxidative stress, ischaemia, and hypoxia (Knowlton et which were originally identified as stress-responsive al., 1991). These proteins protect the cells from stressful proteins. The aim of this study was to determine the stimuli by preventing the aggregation of unfolded spatial and temporal expression and localization of four proteins (Hendrick and Hartl, 1993) and may have critical heat shock proteins (HSPD1/HSP60, HSPA/HSP70, functions during cell growth that are specifically HSPC/HSP90 and HSPH1/HSP105/110) in the associated with the cell cycle and the proliferative involuting rat uterus using immunohistochemistry.
    [Show full text]
  • Termination of RNA Polymerase II Transcription by the 5’-3’ Exonuclease Xrn2
    TERMINATION OF RNA POLYMERASE II TRANSCRIPTION BY THE 5’-3’ EXONUCLEASE XRN2 by MICHAEL ANDRES CORTAZAR OSORIO B.S., Universidad del Valle – Colombia, 2011 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirements for the degree of Doctor of Philosophy Molecular Biology Program 2018 This thesis for the Doctor of Philosophy degree by Michael Andrés Cortázar Osorio has been approved for the Molecular Biology Program by Mair Churchill, Chair Richard Davis Jay Hesselberth Thomas Blumenthal James Goodrich David Bentley, Advisor Date: Aug 17, 2018 ii Cortázar Osorio, Michael Andrés (Ph.D., Molecular Biology) Termination of RNA polymerase II transcription by the 5’-3’ exonuclease Xrn2 Thesis directed by Professor David L. Bentley ABSTRACT Termination of transcription occurs when RNA polymerase (pol) II dissociates from the DNA template and releases a newly-made mRNA molecule. Interestingly, an active debate fueled by conflicting reports over the last three decades is still open on which of the two main models of termination of RNA polymerase II transcription does in fact operate at 3’ ends of genes. The torpedo model indicates that the 5’-3’ exonuclease Xrn2 targets the nascent transcript for degradation after cleavage at the polyA site and chases pol II for termination. In contrast, the allosteric model asserts that transcription through the polyA signal induces a conformational change of the elongation complex and converts it into a termination-competent complex. In this thesis, I propose a unified allosteric-torpedo mechanism. Consistent with a polyA site-dependent conformational change of the elongation complex, I found that pol II transitions at the polyA site into a mode of slow transcription elongation that is accompanied by loss of Spt5 phosphorylation in the elongation complex.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • ID AKI Vs Control Fold Change P Value Symbol Entrez Gene Name *In
    ID AKI vs control P value Symbol Entrez Gene Name *In case of multiple probesets per gene, one with the highest fold change was selected. Fold Change 208083_s_at 7.88 0.000932 ITGB6 integrin, beta 6 202376_at 6.12 0.000518 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1553575_at 5.62 0.0033 MT-ND6 NADH dehydrogenase, subunit 6 (complex I) 212768_s_at 5.50 0.000896 OLFM4 olfactomedin 4 206157_at 5.26 0.00177 PTX3 pentraxin 3, long 212531_at 4.26 0.00405 LCN2 lipocalin 2 215646_s_at 4.13 0.00408 VCAN versican 202018_s_at 4.12 0.0318 LTF lactotransferrin 203021_at 4.05 0.0129 SLPI secretory leukocyte peptidase inhibitor 222486_s_at 4.03 0.000329 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1552439_s_at 3.82 0.000714 MEGF11 multiple EGF-like-domains 11 210602_s_at 3.74 0.000408 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 229947_at 3.62 0.00843 PI15 peptidase inhibitor 15 204006_s_at 3.39 0.00241 FCGR3A Fc fragment of IgG, low affinity IIIa, receptor (CD16a) 202238_s_at 3.29 0.00492 NNMT nicotinamide N-methyltransferase 202917_s_at 3.20 0.00369 S100A8 S100 calcium binding protein A8 215223_s_at 3.17 0.000516 SOD2 superoxide dismutase 2, mitochondrial 204627_s_at 3.04 0.00619 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 223217_s_at 2.99 0.00397 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 231067_s_at 2.97 0.00681 AKAP12 A kinase (PRKA) anchor protein 12 224917_at 2.94 0.00256 VMP1/ mir-21likely ortholog
    [Show full text]
  • Loci Associated with Bone Strength in Laying Hens
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Epsilon Archive for Student Projects Faculty of Veterinary Medicine and Animal Science Department of Animal Breeding and Genetics Loci associated with bone strength in laying hens Biaty Raymond Examensarbete / Swedish University of Agricultural Sciences Master’s Thesis, 30 hp Department of Animal Breeding and Genetics 488 Uppsala 2016 Faculty of Veterinary Medicine and Animal Science Department of Animal Breeding and Genetics Loci associated with bone strength in laying hens Biaty Raymond Supervisors: D.J. De-Koning, SLU, Department of Animal Breeding and Genetics Anna Maria Johansson, SLU, Department of Animal Breeding and Genetics Examiner: Erling Strandberg, SLU, Department of Animal Breeding and Genetics Credits: 30 hp Course title: Degree project in Animal Science Course code: EX0556 Level: Advanced, A2E Place of publication: Uppsala Year of publication: 2016 Name of series: Examensarbete / Swedish University of Agricultural Sciences, Department of Animal Breeding and Genetics, 488 On-line publicering: http://epsilon.slu.se Key words: Osteoporosis, GWAS, Fracture, Genes, QTLs ABSTRACT One of the growing welfare concern in the layer industry is the high incidences of bone fracture. This is thought to result from reduction in bone strength due to osteoporosis which is exacerbated by environmental stresses and mineral deficiencies. Despite these factors however, the primary cause of bone weakness and the resulting fractures is believed to be genetic predisposition. In this study, we performed a genome-wide association study to identify with high reliability the loci associated with bone strength in laying hens. Genotype information and phenotype data were obtained from 752 laying hens belonging to the same pure line population.
    [Show full text]