Loss of TRIM29 Alters Keratin Distribution to Promote Cell Invasion in Squamous

Author Manuscript Published OnlineFirst on November 2, 2018; DOI: 10.1158/0008-5472.CAN-18-1495 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

#CANCER RESEARCH CAN-18-1495-AT, Revised version R2.

Loss of TRIM29 alters keratin distribution to promote cell invasion in squamous

cell carcinoma

1, *Teruki Yanagi, 2Masashi Watanabe, 1Hiroo Hata, 1Shinya Kitamura, 1Keisuke

Imafuku, 3Hiroko Yanagi, 3Akihiro Homma, 4, 5Lei Wang, 6Hidehisa Takahashi,

1Hiroshi Shimizu, 2, *Shigetsugu Hatakeyama

Departments of 1Dermatology, 2Biochemistry, 3Otolaryngology - Head and Neck

Surgery, and 4Cancer Pathology, Faculty of Medicine and Graduate School of

Medicine, Hokkaido University; 5Global Station for Soft Matter, Global Institution for

Collaborative Research and Education (GI-CoRE), Hokkaido University; 6Department

of Molecular Biology, Yokohama City University Graduate School of Medical Science

*Correspondence and requests for materials should be addressed to T. Y.

([email protected]) or S. H. ([email protected]).

Conflicts of Interest

The authors have no conflicts of interest to declare.

Word count: Abstract 199 words, Text 5000 words

References: 36

Tables: 0, Figures: 7, Supplemental Figures: 18, Supplemental Table: 1

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on November 2, 2018; DOI: 10.1158/0008-5472.CAN-18-1495 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Short title: TRIM29 in squamous cell carcinoma

Abbreviations:

TRIM: tripartite motif-containing protein

SCC: squamous cell carcinoma

EMT: epithelial mesenchymal transition

SPC: sphingosylphosphorylcholine

IP: immunoprecipitation

IS: immunoscore

Significance:

Findings identify TRIM29 as a novel diagnostic and prognostic marker in stratified

epithelial tissues.

ABSTRACT

TRIM29 (tripartite motif-containing protein 29) is a TRIM family protein that has been

implicated in breast, colorectal, and pancreatic cancers. However, its role in stratified

squamous epithelial cells and tumors has not been elucidated. Here we investigate the

expression of TRIM29 in cutaneous head and neck squamous cell carcinomas (SCC)

and its functions in the tumorigenesis of such cancers. TRIM29 expression was lower

in malignant SCC lesions than in adjacent normal epithelial tissue or benign tumors.

Lower expression of TRIM29 was associated with higher SCC invasiveness. Primary

tumors of cutaneous SCC showed aberrant hypermethylation of TRIM29. Depletion of

TRIM29 increased cancer cell migration and invasion; conversely, overexpression of

TRIM29 suppressed these. Comprehensive proteomics and immunoprecipitation

analyses identified keratins and keratin-interacting protein FAM83H as TRIM29

interactors. Knockdown of TRIM29 led to ectopic keratin localization of keratinocytes.

In primary tumors, lower TRIM29 expression correlated with the altered expression of

keratins. Our findings reveal an unexpected role for TRIM29 in regulating the

distribution of keratins, as well as in the migration and invasion of SCC. They also

suggest that the TRIM29-keratin axis could serve as a diagnostic and prognostic

marker in stratified epithelial tumors and may provide a target for SCC therapeutics.

Introduction

Tripartite motif (TRIM) family proteins have various functions in cellular

processes, including intracellular signaling, cell development, apoptosis, protein

quality control, and carcinogenesis (1). TRIM family proteins have conserved domains

that include a RING, a B box type 1, a B box type 2, and a coiled-coil region.

Although most TRIM family proteins have a RING domain, TRIM29 (also known as

ataxia-telangiectasia group D complementing protein, or ATDC) lacks it (2). We

previously showed that TRIM29 regulates the assembly of DNA repair proteins into

damaged chromatin (3). TRIM29 interacts with BRCA1-associated surveillance

complex, cohesion, DNA-PKcs, and components of the TIP60 complex, suggesting

that TRIM29 functions as a scaffold protein in DNA damage response. Further, a study

on TRIM29 knockout mice revealed TRIM29 to be a regulator for the activation of

alveolar macrophages, the expression of type I interferons and the production of

proinflammatory cytokines in the lungs (4). Moreover, TRIM29 has been reported to

be overexpressed in several cancers, including lung (5), colorectal (6), and pancreatic

cancers (7). A review of the expression of TRIM29 in many cancers revealed an

important link between upregulated TRIM29 expression and poor prognosis in patients

with malignant neoplasms (8). TRIM29 transgenic mice revealed that TRIM29

upregulates CD44 in pancreatic cancer cells via the activation of beta-catenin signaling,

leading to the induction of epithelial mesenchymal transition (EMT) along with the

expression of Zeb1 and Snail1 (9). These studies suggest that TRIM29 promotes

tumorigenesis and tumor progression in certain cancers. Conversely, in breast cancer,

TRIM29 is often silenced due to aberrant gene hyper-methylation, which leads to the

invasive behavior of breast cancers (10). Further, we previously reported that the

TRIM29-positive cells disappear in prostate cancers (11). Thus, the expression levels

of TRIM29 in cancers may depend on the cell/tissue types (12). Its role in stratified

squamous epithelial cells/tumors has not been elucidated.

Cutaneous squamous cell carcinoma (SCC) is a common cancer in Caucasian

populations, accounting for 20-30% of skin malignancies (13). The risk of metastasis

is low for most patients, not exceeding 5%; however, aggressive SCC is associated

with high morbidity and mortality. Although cutaneous SCC can be treated by surgical

removal, radiation, or chemotherapy, or by a combination of these therapies, the

prognosis of patients with metastatic SCC is poor (14). Even in head and neck lesions,

squamous cell carcinoma is the most common histological type. The risk factors of

distant metastasis for head and neck SCC (HN-SCC) are related to age, the site of the

primary cancer, local and/or regional extension, and histological grading (15). Patients

with localized HN-SCC are treated with potentially curative therapy using treatment

modalities that include surgery, radiation therapy, chemotherapy, and biologic therapy

(16). The recurrence rate in early-stage HN-SCC ranges from 10 to 20%, and the

recurrence rate in locally advanced HN-SCC exceeds 50%. Patients with metastatic

HN-SCC have a poor prognosis with a median overall survival of less than 1 year (16).

Therefore, identifying the molecular mechanisms involved in cutaneous, and head and

neck SCC pathogenesis is of vital clinical importance.

In this study, we investigated the role of TRIM29 in the tumorigenesis/

progression of squamous cell carcinoma. Searches of public databases revealed that

TRIM29 is highly expressed in stratified epithelial tissues, including in skin, and head

and neck lesions. Immunohistochemically, TRIM29 has lower expression in malignant

SCC lesions than in adjacent normal epithelial tissue or benign tumors. DNA

methylation analysis revealed the CpG lesion of TRIM29 in primary cutaneous SCC

tumors to be aberrantly hypermethylated, whereas that in normal epidermis is not

methylated. RNAi-mediated gene-knockdown of TRIM29 increases cancer cell

migration and invasion; conversely, overexpression of TRIM29 inhibits these. Using

non-biased comprehensive proteomics analysis, keratins and keratin-interacting protein

FAM83H have been identified as TRIM29 interactors. Immunohistochemically,

TRIM29 co-localizes with keratins in the cytoplasm, and the knockdown of TRIM29

alters the distribution of keratins. Furthermore, in primary tumors, lower levels of

TRIM29 expression correlate with altered distribution patterns of keratins. Our

findings reveal a critical function of TRIM29 in regulating keratin distribution as well

as migration/invasion of SCC.

Materials and Methods

Cell lines and cell culture

The human cutaneous SCC A431 cells were purchased from the American Type

Culture Collection. The human cutaneous SCC DJM-1 cells were isolated from human

skin squamous cell carcinoma (17). The human immortalized keratinocyte cell line

(HaCaT) was purchased from Cell Lines Service (Eppelheim, Germany). The SAS

human head and neck squamous cell carcinoma (HN-SCC) cell line was obtained from

the Japanese Collection of Research Bioresources cell bank. Cell lines were cultured in

DMEM supplemented with 10% FBS. All cells were authenticated by short tandem

repeat profiling (Promega, August 2018) and were used within six months of

continuous passage. All cells were tested and checked for the absence of Mycoplasma

(VenorGeM).

Reagents and antibodies

Antibodies against TRIM29/ATDC (mouse: A-5, Santa Cruz; rabbit: HPA020053,

Sigma), FAM83H (rabbit: HPA024604 , Sigma), keratin 5 (rabbit: PRB160P, Covance),

keratin 14 (rabbit: PRB155P, Covance), pan-cytokeratin (rabbit: 10550, Progen;

mouse: AE1/AE3, Dako; mouse: 34bE12, Abcam), FLAG (mouse, M2, F1804, Sigma),

HA (rat, 3F10, Roche), beta-actin (mouse, AC-74, Sigma) and horseradish-peroxidase

(HRP)-conjugated secondary antibodies (GE Health Care, UK) were purchased from

the indicated sources. Pre-designed pooled small interfering RNAs (siRNAs) directed

against human TRIM29 and the negative scramble control were purchased from

Dharmacon. 5-Azacytizine (A2033) was purchased from Tokyo Chemical Industry.

siRNA transfection

For the transient knockdown, cells were transfected with siRNA duplexes by a reverse

transfection method using Lipofectoamine RNAiMAX (Life Technologies).

shRNA constructs, luciferase expression vector, lentivirus and infection

GIPZ-TRIM29 shRNA#1 (TGTGCTCCTGGAACATGCA), shRNA#2

(TGGGTGTCAGGTACATGGA) and non-silencing scramble-control were purchased

from Dharmacon. pLenti PGK Blast V5-LUC (w528-1) was a gift from Eric Campeau

and Paul Kaufman (Addgene plasmid # 19166) (18). Lentiviral supernatants were

generated according to an established protocol (19). Cells were selected with 1 µg/ml

puromycin (Thermo Fisher Scientific) or 10 µg/ml blasticidin (Wako), and then

expanded.

Retroviral transfection and generation of stable cell lines

cDNAs encoding full-length TRIM29 and various mutated versions of TRIM29 were

inserted into a pQCXI-puro vector. Retroviral supernatants were generated according

to an established protocol (20). Briefly, the murine EcoVR was first introduced into

cells by using an amphotropic virus in order to make the human cells susceptible to the

subsequent infection by ecotropic viral vectors. Infected cell populations were selected

using puromycin (MP Biomedicals) and then expanded.

Extraction of total RNA and quantitative RT-PCR analysis

We isolated total RNA from cultured cells or fresh-frozen sections using the RNeasy

Plus Mini Kit (QIAGEN). RNA concentrations were measured spectrophotometrically

and samples were stored at -80 °C until use. We reverse-transcribed RNA using

SuperScript IV VILO Master Mix (11756050, Thermo Fisher Scientific).

Complementary DNA samples were analyzed by the SYBR Green system (Takara).

The sequences for primers specific for human TRIM29 and the control housekeeping

genes for human GAPDH are as follows:

Human TRIM29

Forward: 5’- TTCCAGGAGCACAAGAATCA -3’

Reverse: 5’- GCAATGACAGCTCCGTCTC -3’

Human GAPDH

Forward: 5’- GAAGGTGAAGGTCGGAGTC -3’

Reverse: 5’- ATGGGATTTCCATTGATGAC -3’

All experiments were performed in duplicate and normalized with respect to GAPDH

levels.

Cell proliferation assay. Cells were plated at a density of 3,000-5,000 cells per well,

and cultured for 24, 48 or 72 hours. MTT assay was performed according to the

manufacture’s protocol (Cell titer 96 non-radioactive cell proliferation assay, Promega).

Also, we assessed cell growth by direct cell-counting. 1.0 x 105 cells with shRNA were

plated onto 60-mm-diameter plates. The cells were counted 1, 3, and 5 days after

seeding.

Cell migration and invasion analysis

For analysis of cell motility, cells were seeded onto 6-cm-diameter plates in DMEM

with 10% FBS overnight. The injury line was made with a yellow tip on the confluent

cell monolayer. After 4 to 24 hours, the lengths of movement were measured (21). The

cell invasion assay was performed using the Corning BioCoat Matrigel invasion

chamber with 8.0-micron pore size (Corning 354480). Seventy-two hours after the top

well was seeded, the bottom well was fixed and stained with 0.4% crystal violet

solution. Invading cells were photographed in four randomly selected fields and

counted.

SDS-PAGE and immunoblotting

Cells were harvested with radioimmunoprecipitation assay (RIPA) buffer (Wako) or IP

buffer (1% NP40 buffer, Thermo Fisher Scientific). Cells were left on ice for 20 min

and then centrifuged at 14,000 g for 10 minutes. The Bio-Rad protein assay kit

(Bio-Rad) was used to determine protein concentrations. Proteins were separated with

SDS-PAGE 4-15% gradient gels (Life Technologies) and transferred onto PVDF

membranes. The membranes were blocked for 1 hour in Tris-buffered saline (TBS)

with 5% non-fat dry milk and then incubated overnight at 4°C with primary antibodies.

The membranes were rinsed three times in TBS and incubated with secondary

HRP-conjugated antibodies for 1 hour at room temperature. An enhanced

chemiluminescence (ECL) method (GE Health Care) was used for antibody detection.

To distinguish between soluble and insoluble proteins, cells were washed with PBS

and resuspended in 1% NP40 buffer. Cell extracts were then centrifuged at 14,000 g

for 10 min, the soluble fraction collected, and the pellets resuspended with 1x Laemmli

SDS sample buffer as the insoluble fraction.

Immunoprecipitation

For immunoprecipitation (IP), cells were lysed in IP lysis buffer (Thermo Fisher)

containing 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1mM EDTA, 1% Nonidet P-40,

5 mM NaF and an EDTA-free cOmplete protease cocktail tablet. Three milligrams of

protein lysate were used for immunoprecipitation by incubation with 2 µg of the

antibody for 2 hours at 4°C. 30 µl of Dynabeads protein G (#10004D, Life

Technologies) was added for 1 hour at 4°C, and the IPs were washed four times with

lysis buffer. Sample buffer was then added, and the beads were heated for 10 minutes

at 70°C. Samples were then analyzed by SDS-PAGE followed by immunoblotting.

Sample preparation for mass spectrometry analysis

Cells were lysed in a solution containing 50 mM Tris-HCl (pH 7.6), 300 mM NaCl,

10% glycerol, 0.2% NP-40, 10 mM iodoacetamide (Sigma-Aldrich), 10 mM

n-ethylmaleimide (Sigma-Aldrich), 0.5 mM 4-(2-aminoethyl)-benzenesulfonyl fluoride

hydrochloride (AEBSF, Roche, Branchburg, NJ), 10 μM MG132 (Merck, Darmstadt,

DE), and PhosStop phosphatase inhibitors (Sigma-Aldrich). The cell lysates were

sonicated and centrifuged at 16,000 g for 10 min at 4°C, and the resulting supernatant

was incubated with anti-FLAG M2 agarose (Sigma-Aldrich) for 2 hours at 4°C. The

resin was separated by centrifugation, washed five times with ice-cold lysis buffer, and

eluted with 250 μg/ml of FLAG peptides (Sigma-Aldrich). The eluate was then treated

with 0.1 U of Benzonase Nuclease (Sigma-Aldrich) for 30 min at 37°C. After

precipitation with trichloroacetic acid, proteins were dissolved in 50 mM ammonium

bicarbonate (Wako), reduced in 5 mM dithiothreitol (Thermo Fisher Scientific) for 5

min at 95°C, and alkylated with 10 mM iodoacetamide (Thermo Fisher Scientific) for

20 min at room temperature. Reduced and alkylated proteins were digested overnight

with 5 μg of Trypsin Gold (Promega) at 37°C with rotation. After tryptic digestion,

samples were acidified with TFA and desalted by solid-phase extraction using GL-Tip

GC and GL-Tip SDB (GL Sciences, Tokyo, Japan) before LC-MS analysis.

Mass spectrometry analysis

Desalted tryptic digests were analyzed by nanoflow ultra-HPLC (EASY-nLC 1000;

Thermo Fisher Scientific) on-line coupled to the Orbitrap Elite instrument (Thermo

Fisher Scientific). The mobile phases were 0.1% formic acid in water (solvent A) and

0.1% formic acid in 100% acetonitrile (solvent B). Peptides were directly loaded onto

a C18 Reprosil analytical column (3-μm particle size, 75-μm i.d., and 12-cm length;

Nikkyo Technos, Tokyo, Japan) and separated using a 150-min two-step gradient

(0-35% in 130 min, 35-100% in 5 min, and 100% in 15 min of solvent B) at a constant

flow rate of 300 nL/min. For ionization, 1.6 kV of liquid junction voltage and a

capillary temperature of 200°C were used. The Orbitrap Elite instrument was operated

in the data-dependent MS/MS mode using Xcalibur software (Thermo Fisher

Scientific), with survey scans acquired at a resolution of 120,000 at m/z 400. The 10

most abundant isotope patterns with charges ranging from 2-4 were selected from the

survey scans with an isolation window of 2.0 m/z and fragmented by collision-induced

dissociation with normalized collision energies of 35. The maximum ion injection time

for the survey and the MS/MS scans was 60 ms, and the ion target values were set to

1e6 for the survey and MS/MS scans. Ions selected for MS/MS were dynamically

excluded for 60 sec for binding protein identification.

Protein identification from MS data

Proteome Discoverer software (version 1.4; Thermo Fisher Scientific) was used to

generate peak lists. The MS/MS spectra were searched against the UniProt

Knowledgebase (version 2015_09) using the SequestHT search engine. The precursor

and fragment mass tolerances were set to 10 ppm and 0.6 Da, respectively. Methionine

oxidation, protein amino-terminal acetylation, Asn/Gln deamidation, Ser/Thr/Tyr

phosphorylation, and diglycine modification of Lys side chains were set as variable

modifications, and Cys carbamidemethyl modification was set as a static modification

for database searches. Peptide identification was filtered at a 1% false discovery rate.

To identify binding proteins, the results of samples (cells expressing FLAG-TRIM29

or not) were assembled into one multi-consensus report using Proteome Discoverer

software. Cumulative protein scores were compared based on the protein sequence

coverages and the total numbers of identified sequences (PSMs).

Immunofluorescence and microscopy

Immunofluorescence staining was performed as described previously (19). Cells were

seeded on 8-well chamber culture slides (Lab-Tek II, Thermo Fisher Scientific). After

appropriate treatment or transfection, the cells were fixed with 4% paraformaldehyde

(Wako) for 20 minutes at room temperature and permeabilized with 0.5% Triton-X100

in PBS buffer for 15 minutes. The cells were incubated overnight at 4°C with primary

antibodies diluted in PBS with 3% bovine serum albumin (BSA). After three

10-minute washes in PBS, the cells were incubated for 60 minutes at room temperature

with fluorochrome-conjugated secondary antibodies. Culture slides were washed three

times for 10 minutes in PBS. For imaging, cells were stored in Vectashiled hard set

mounting medium with DAPI (H-1500, Vector Laboratories). Cell imaging was

accomplished with a BZ-9000 microscope (Keyence) or a FV-1000 confocal

microscope (Olympus).

Experimental metastasis model

All animal experiments were approved by the Institutional Animal Care and Use

Committee of Hokkaido University (17-0100). In in vivo imaging experiments,

luciferase-tagged A431 cells (A431-LUC) with or without shRNA targeting TRIM29

cells (5x105 cells, GFP-tagged) were injected into the tail vein of athymic (nu/nu) mice,

and metastatic incidence was determined using an IVIS imaging system over time. On

the final day (Day 23), we assessed the number of metastases in all extracted lungs by

GFP channel using fluorescence microscopy (BZ-9000, Keyence). Metastatic colonies

in the lungs were detected by GFP expression in fresh tissues. Similar experiments

were performed using GFP-tagged DJM1 cells containing shRNA (control or

targeting-TRIM29-#2).

Animal imaging

Live animal images were captured using the IVIS system, Xenogen (Caliper Life

Sciences). D-Luciferin potassium salt (VivoGlo Luciferin, Promega) was injected

intraperitoneally (300 mg/kg) and animals were anesthetized in an oxygen-rich

induction chamber with 2% isoflurane (Abbie). Images were collected 10 min after

d-luciferin injection using the IVIS System (Exposure time: 2 min). Photons were

quantified using Living Image Software (Xenogen).

Immunohistochemistry

Dewaxed tissue sections (4.0-5.0 μm) were immunostained as reported previously

using primary antibodies (22). The application of the primary antibody was followed

by incubation with goat anti-mouse or rabbit polymer-based EnVision-HRP-enzyme

conjugate (Dako, Japan). DAB chromogen was applied to yield a brown color. For the

evaluation of immunohistochemical staining, the total score (value from 0 to 6) was

calculated by measuring the staining intensity (negative = 0, weak = 1, moderate = 2,

strong = 3) plus the proportion of immunopositive tumor cells (0% = 0, 1-25 % = 1,

26-50% = 2, >50% = 3).

Patient specimens

For cutaneous SCC, Bowen’s disease, verruca vulgaris, seborrheic keratosis,

keratoacanthoma (KA), KA-like SCC, and head and neck SCC (HN-SCC) analyses,

specimens were procured retrospectively under an Institutional Review Board-approved

protocol at the Hokkaido University Hospital, which deemed this retrospective analysis

appropriate for a waiver of informed consent (016-0435, 017-0263). These studies were

conducted in accordance with the Declaration of Helsinki. Thirty-six patients with SCC,

10 patients with Bowen’s disease, 5 patients with verruca vulgaris, 5 patients with

seborrheic keratosis, 4 patients with KA, 6 patients with KA-like SCC, and 35 patients

with HN-SCC were enrolled. Normal epidermis was harvested from the patients with

SCC (N = 29). The patients’ attributes are shown in Supplemental Table. 1.

DNA methylation analysis

To identify the methylation status of CpG islands in the TRIM29 promoter, published

methods were used (10). Briefly, a total of 0.5 μg of genomic DNA extracted from

each frozen tissue sample using the QIAmp DNA Mini Kit (Qiagen, Chatsworth, CA)

was treated with the EZ DNA Methylation-Gold Kit (Zymo Research, Orange, CA) for

bisulfate reaction. The promoter region of the TRIM29 genes was amplified by PCR

using the following gene-specific primers.

Left primer: 5’-TTAGGTGGGGTTTGAGATGTAGT-3’

Right primer: 5’-CCAACTAAAAACTACCAAAAAACCA-3’

PCR products were cloned into the pCR4-TOPOVector (Life Technologies, Carlsbad,

CA). To define the methylation status of the TRIM29 promoter region, six SCC

samples and two normal epidermal tissues were sequenced with the 3130xl Genetic

Analyzer (Applied Biosystems, Foster City, CA).

Gene expression

Tissue-specific gene expression data were downloaded from the Human Protein Atlas

(https://www.proteinatlas.org/) (23).

Statistical Analysis

Statistical analysis was performed using the Excel add-in software Statcel (OMS Ltd.,

Tokyo, Japan). Means and standard deviation (SD) were calculated statistically from

three determinations. The data are expressed as mean ± SD. We used t-tests (Student’s

or Welch’s t) to assess the statistical significance of differences between various samples.

Kaplan–Meier survival curves were calculated for the two groups (high TRIM29 or low

TRIM29), and the log-rank test was used to compare overall survival (OS). Fisher’s

exact test was used in the analysis of contingency tables. p < 0.05 was considered

significant.

Results

Loss of TRIM29 in squamous cell carcinoma

To clarify the kinds of tissues in which TRIM29 is highly expressed, we accessed the

Human Protein Atlas public database (https://www.proteinatlas.org/). Investigation

using public databases revealed that TRIM29 is highly expressed in stratified epithelial

cells, including skin, esophagus, and tonsil (Supplemental Fig. 1). Based on the

previous reports on the roles of TRIM29 in certain cancers, we assessed the levels of

TRIM29 expression in primary cutaneous SCC tumor specimens by

immunohistochemistry. Expression levels of TRIM29 were high in normal epidermis

and were markedly lower in cutaneous SCC (Fig. 1A). Similar results were observed in

Bowen’s disease (Supplemental Fig. 2A). We further examined the expression of

TRIM29 in patients with metastatic cutaneous SCC. The expression levels of TRIM29

were lower in the samples of lymph node metastasis than in those of primary tumors

(Fig. 1B). Moreover, the expression levels of TRIM29 in benign tumors (seborrheic

keratosis, verruca vulgaris, and keratoacanthoma) were high (Supplemental Fig. 2, B

and C, and Supplemental Fig. 3). Also, we assessed the levels of TRIM29 in head and

neck SCC (HN-SCC, primary tongue cancer, N = 35). TRIM29 expression levels in

HN-SCC tumors were lower than in adjacent epithelium (Fig. 1, C-G). In the cases

with lower expression of TRIM29 in primary tumors (N = 23), the expression level of

TRIM29 in invasive tumors was even lower than that in microinvasive lesions (Fig. 1,

E, F, H). The prognostic value of TRIM29 was assessed in the patients with stage

III/IV tongue tumors. Low TRIM29 protein levels significantly correlated with lower

overall survival (Fig. 1I).

Next, we assessed the mRNA expression of TRIM29 in cutaneous SCC

samples. mRNA expression of TRIM29 in six fresh-frozen cutaneous SCC tumors was

lower than in normal epidermis (Supplemental Fig. 4A). Further, we analyzed

epigenetic silencing of TRIM29 using frozen cutaneous SCC samples in bisulfite

sequence testing, which revealed that aberrant DNA methylation in the CpG island of

TRIM29 was observed in all of the cutaneous SCC samples, whereas very few

methylations were detected in normal epidermis (Supplemental Fig. 4, B-D). Also, we

assessed the DNA methylation of cultured cells. DNA methylation in the CpG lesion of

TRIM29 was observed in A431 SCC cells, whereas none was detected in normal

keratinocytes or in HaCaT cells (Supplemental Fig. 5A). We treated A431 cells with

the DNA demethylating drug 5-azacytidine for 10 days and harvested RNA and

genomic DNA. Quantitative RT-PCR analysis revealed a 5- to 7-fold rise in TRIM29

transcript (Supplemental Fig. 5B). Consistent with gene re-expression, 10 days of

5-azacytidine produced a decrease in TRIM29 methylation of A431 cells

(Supplemental Fig. 5C).

Knockdown of TRIM29 increases SCC cell motility and invasiveness

To investigate the effect of TRIM29 knockdown on cutaneous SCC cells, we

performed gene-knockdown experiments using two shRNAs. Quantitative RT-PCR

and immunoblotting confirmed the knockdown of mRNA and protein levels by both of

the TRIM29-targeting shRNAs in A431 SCC cells (Fig. 2A). Through direct

cell-counting and MTT proliferation assays, we determined that the growth rates of the

TRIM29-knockdown cells did not differ significantly from those of the control cells

(Supplemental Fig. 6, A-C, and Supplemental Fig. 7, A and B). In the cell migration

assay, we observed greater cell migration into the wound in the TRIM29 knockdown

A431 cell lines than in the control lines (Fig. 2B). Conversely, the cell migration of

A431 lines overexpressing TRIM29 was lower than that of mock A431 lines (Fig. 2, C

and D). Similar results were obtained for the SCC DJM-1 and immortalized HaCaT

keratinocytes (Supplemental Fig. 8, A-D, and Supplemental Fig. 9, A-D). Invasion

assays using A431 cells with or without A431 knockdown were performed using a

Matrigel chamber assay, which showed that TRIM29 knockdown enhanced the

invasion activity (Fig. 3A). The cell invasion of A431 cells overexpressing TRIM29

was lower than those of mock cell lines (Fig. 3B). Similar results were obtained for

DJM1, HaCaT cells, and oral SCC SAS cells (Supplemental Fig. 10, A-D, and

Supplemental Fig. 11, A and B). To extend these studies to an in vivo context, we used

luciferase-tagged A431 SCC cells (A431-LUC) containing control-shRNA or

TRIM29-shRNA (#2) in a xenograft model. Immunocompromised (nu/nu) mice were

injected intravenously with A431-LUC cells, and lung metastases were observed over

time. A live-animal imaging system (IVIS) revealed that TRIM29 knockdown

enhanced the cancer cell metastasis to the lungs (Fig. 3, C and D). Extracted lungs also

showed that the number of tumor metastases was greater for the TRIM29-knockdown

A431 cells than for the control cells (Fig. 3, E and F). Similar results were observed in

the in vivo metastasis model using GFP-tagged DJM1 cells (Supplemental Fig. 12, A

and B).

TRIM29 expresses in the cytosol, and interacts with keratins and keratin-interacting

protein FAM83H

To clarify the molecular function of TRIM29, we first assessed the subcellular

localization of TRIM29. Immunofluorescence staining of TRIM29 revealed that

TRIM29 was mainly expressed in the cytosol, where the expression patterns were

filamentous or perinuclear (Fig. 4, A-C). Also, immunoblotting using whole cell

lysates (1x Laemmli buffer) and 1%NP40 lysate showed that TRIM29 mainly presents

in a detergent-insoluble fraction (Fig. 4D). Next, we established HaCaT and A431 cells

that stably expressed FLAG-tagged TRIM29. To detect the TRIM29-interacting

protein, we immunopurified FLAG-TRIM29 and TRIM29-associated proteins from

cell lysates (Fig. 4E) and performed mass spectrometry analysis. From screening by

mass spectrometry analysis, 67 proteins were identified as interacting specifically with

FLAG-TRIM29 (Supplemental Fig. 13, A and B). Immunoprecipitation analysis using

HaCaT cell lysates revealed that endogenous TRIM29 interacts with FAM83H and

keratins (Fig 4, F-H). Furthermore, immunofluorescence analysis using confocal

microscopy showed that TRIM29 co-localizes with keratin 5, 14 and FAM83H in the

cytosol (Fig. 4, I-K, Supplemental Fig. 14, A-E, and Supplemental Fig. 15). These

results indicate that the TRIM29 forms a complex with keratins and keratin-interacting

proteins. To identify the domains of TRIM29 which are necessary for interaction with

keratins/FAM83H, we generated HaCaT cells that stably express the series of

truncated mutants of FLAG-TRIM29 (Supplemental Fig. 16A).

Immunoprecipitation/SDS-PAGE analysis revealed that the zinc finger, B-box,

coiled-coil, and C-terminal domains of TRIM29 were necessary for the formation of

the TRIM29-keratin-FAM83H complex (Supplemental Fig. 16, B-D), which was

consistent with the findings of immunofluorescence staining (Supplemental Fig. 16E).

TRIM29 regulates the distribution of keratins

To clarify the physiological role of TRIM29 in stratified epithelial cells, we performed

siRNA transfection experiments. HaCaT cells were reverse-transfected with pooled

siRNA targeting TRIM29 or a negative control. Immunoblotting revealed that TRIM29

knockdown did not alter the expression levels of keratin 5 (Fig. 5A).

Immunofluorescence staining showed that TRIM29 knockdown led to a perinuclear

distribution of keratins, whereas control cells showed cytosolic diffuse keratin

expression (Fig. 5B). We also established HaCaT keratinocytes that stably contained

HA-tagged TRIM29. The lysates from HaCaT cells containing HA-tagged TRIM29

did not show altered expression levels of keratin 5, either (Fig. 5C). Confocal

immunofluorescence images showed that forced-expressed TRIM29 led to the diffuse

or unbiased distributions of keratins, which co-localized with TRIM29 (Fig. 5D).

These data suggest that TRIM29 regulates the cellular distribution of keratins.

Loss of TRIM29 is associated with altered keratin distribution in both the clinical

samples and a lung metastasis mouse model

We further examined the cutaneous SCC samples based on the keratin staining patterns

(Supplemental Fig. 17). In adjacent normal epidermis, keratin staining patterns were

diffuse. Also, SCC samples with high TRIM29 expression showed relatively diffuse

keratin patterns. In turn, cutaneous SCC with low TRIM29 expression showed

perinuclear or random “non-diffuse” keratin patterns (Fig. 6A). “Non-diffuse”

distribution patterns were significantly more common in low-TRIM29 tumor tissue

than in high-TRIM29 tumors (Fig. 6B). Similar results were observed in HN-SCC

samples (Fig. 6 C, D). Moreover, we analyzed the expression of keratins in an in vivo

lung metastasis model. TRIM29 knockdown altered the keratin expression of lung

metastatic tumors, whereas control xenograft tumors showed relatively diffuse

expression of keratins (Supplemental Fig. 18). These findings indicate that the loss of

TRIM29 correlates with the altered distribution of keratins.

Discussion

We herein reported that TRIM29 plays a crucial role in cutaneous and

head/neck SCC cell migration and invasion by regulating keratin distribution (Fig. 7).

Clinically, the loss of TRIM29 was observed in only malignant tissues, and not in

normal epithelium or benign tumors. The expression levels of TRIM29 in invasive or

advanced lesions showed greater decreases than in primary tumors. These results

strongly suggest that TRIM29 is a novel diagnostic and prognostic biomarker for

stratified epithelial tumors.

In this study, immunohistochemistry and immunofluorescence analyses

revealed that TRIM29 localizes mainly in the cytoplasm. Previous studies suggested

that cytosolic TRIM29 has onco-suppressive effects in breast and prostate cancers

(10-12), whereas nuclear TRIM29 has pro-oncogenic effects in pancreatic, lung,

bladder, and gastric cancers (9, 24-27). Thus, the localization (cytosolic or

nuclear)-related physiological function of TRIM29 was determined by the kinds of

cells/tissues. Our results indicate that TRIM29 localizes mainly in the cytoplasm in

stratified epithelial cells, which is consistent with TRIM29 having an onco-suppresive

role in such cells.

Keratins are the intermediate filament-forming proteins of epithelial cells.

Keratin filaments play a role in the formation of an insoluble structural framework

within the cytoplasm, which plays a critical role in cell protection. Today, keratins

have been recognized as regulators of other cellular functions, including polarization,

motility, and signaling (28). Further, keratins are involved in cancer cell invasion and

metastasis, as well as in treatment responsiveness. It has been reported that keratin

distribution regulates cell migration in cancer cells as well as in normal cells. In injury

experiments using human volunteers, injury to human epidermis prompted the keratin

filaments to reorganize from a diffuse cytoplasmic distribution to a perinuclear

distribution, which lead to keratinocyte migration to the wound (29). Further, human

epithelial tumor cells including pancreatic cancers treated with

sphingosylphosphorylcholine (SPC) show the reorganization of keratins to perinuclear

areas and enhanced cancer cell migration (30, 31). A study by Seltmann et al. using

keratin-knockout mice showed that keratin-knockout keratinocytes migrate faster than

wild-type keratinocytes (32). These results suggest that the absence of expression (or

the juxtanuclear localization) of keratins could facilitate cell migration. In the SPC

model, the phosphorylation of keratins by the MEK-ERK pathway is thought to be a

molecular mechanism in keratin reorganization. In our study, we analyzed the

phosphorylation of keratins (K5 and K14) using lysates of HaCaT with or without

TRIM29 knockdown; however, phos-tag SDS-PAGE (Wako) found no obvious

differences. Also, we analyzed the dimerization of keratins (K5, K14) through native

page analysis (33), which showed no obvious differences between TRIM29

knockdown and control HaCaT cells. Thus, the detailed mechanism of

TRIM29-mediated keratin re-organization remains unknown.

In the present study, keratin-interacting protein FAM83H was detected as a

novel interactor with TRIM29. Recently, the Kuga group discovered that FAM83H is

involved in certain cancer cell migrations via the regulation of keratins. High

expression of FAM83H in colorectal cancer cells causes casein kinase 1 alpha to be

recruited to keratins and disrupts the keratin cytoskeleton, which leads to cell

migration/invasion (34, 35). Based on these reports, we investigated the FAM83H

expression in primary cutaneous SCCs samples and found no marked differences in

FAM83H protein expression. Also, in cell cultures, TRIM29 knockdown or forced

expression did not change the expression levels of FAM83H (Fig. 5, A and C). At this

point, it remains unclear whether FAM83H is directly associated with the interactions

between TRIM29 and keratins in stratified epithelial cells.

To date, TRIM29 has been reported to be positively or negatively involved in

epithelial mesenchymal transition (EMT) in cancers (10, 36). RNAi-mediated gene

knockdown of TRIM29 in breast cancer cell lines increases the expression of

mesenchymal markers (N-cadherin and vimentin), decreases the expression of

epithelial markers (E-cadherin), and increases the expression of the oncogenic

transcriptional factor TWIST1, which is a key driver of EMT (10). Another study used

epigenetic change analysis to identify TRIM29 as a driver candidate during EMT (36).

Further, experimental model mice have revealed that TRIM29 facilitates EMT in

pancreatic cancer cells (9). Based on these studies, we also assessed the protein

expression of EMT-related molecules including SNAIL2, TWIST1/2, FAK, p-FAK

and p63 using the lysate of TRIM29-knockdown cells, in which obvious alterations of

protein expression were not observed. As such, TRIM29-knockdown-mediated

migration/invasion in stratified epithelial cells may be associated with keratin

distribution/re-organization, rather than with the EMT process.

In conclusion, we revealed an unrecognized role of TRIM29 in the cell

migration/invasion of cutaneous and head/neck SCC tumors. The present results

suggest that TRIM29 could be a novel diagnostic/prognostic marker in stratified

epithelial tumors. Also, the TRIM29-keratin axis may be a novel therapeutic target in

intractable/metastatic SCCs.

Acknowledgements

We thank Ms. Yuko Tateda and Dr. Kanae Takahashi for their technical assistance. This

work was supported in part by KAKENHI (#15H05998, #16K1970106, #18K08259 to

T. Yanagi; #17K19506, #18H02607 to S. Hatakeyama) from the Ministry of Education,

Culture, Sports, Science and Technology in Japan, and by the Ichiro Kanehara

Foundation for the Promotion of Medical Science (T. Yanagi), the Cosmetology

Research Foundation (T. Yanagi), the Ono Cancer Research Foundation (T. Yanagi),

the Takeda Science Foundation (T. Yanagi, and S. Hatakeyama), the Suhara Memorial

Foundation (T. Yanagi), the Geriatric Dermatology Foundation (T. Yanagi), the Uehara

Memorial Foundation (T. Yanagi), the Pias Skin Research Foundation (T. Yanagi), the

Life Science Foundation of Japan (S. Hatakeyama), the Princess Takamatsu Cancer

Research Fund (S. Hatakeyama), the Japan Foundation for Applied Enzymology (S.

Hatakeyama), the Tokyo Biochemical Research Foundation (S. Hatakeyama), and the

Project Mirai Research Grants (S. Hatakeyama).

References

1. Hatakeyama S. TRIM Family Proteins: Roles in Autophagy, Immunity, and

Carcinogenesis. Trends Biochem Sci 2017;42:297-311.

2. Sho T, Tsukiyama T, Sato T, Kondo T, Cheng J, Saku T, et al. TRIM29 negatively

regulates p53 via inhibition of Tip60.

Biochim Biophys Acta 2011;1813:1245-53.

3. Masuda Y, Takahashi H, Sato S, Tomomori-Sato C, Saraf A, Washburn MP, et al.

TRIM29 regulates the assembly of DNA repair proteins into damaged chromatin.

Nat Communications 2015;6:7299.

4. Xing J, Weng L, Yuan B, Wang Z, Jia L, Jin R, et al. Identification of a role for

TRIM29 in the control of innate immunity in the respiratory tract.. Nat Immunol

2016;17:1373-1380.

5. Song X, Fu C, Yang X, Sun D, Zhang X, Zhang J.

Tripartite motif-containing 29 as a novel biomarker in non-small cell lung cancer.

Oncol Lett 2015;10:2283-8.

6. Jiang T, Tang HM, Lu S, Yan DW, Yang YX, Peng ZH.

Up-regulation of tripartite motif-containing 29 promotes cancer cell proliferation and

predicts poor survival in colorectal cancer.

Med Oncol 2013;30:715.

7. Wang L, Yang H, Palmbos PL, Ney G, Detzler TA, Coleman D, et al.

ATDC/TRIM29 phosphorylation by ATM/MAPKAP kinase 2 mediates

radioresistance in pancreatic cancer cells.

Cancer Res 2014;74:1778-88.

8. Liang C, Dong H, Miao C, Zhu J, Wang J, Li P, et al.

TRIM29 as a prognostic predictor for multiple human malignant neoplasms: a

systematic review and meta-analysis. Oncotarget 2017;9:12323-32.

9．Wang L, Yang H, Abel EV, Ney GM, Palmbos PL, Bednar F, et al.

ATDC induces an invasive switch in KRAS-induced pancreatic tumorigenesis.

Genes Dev 2015;29:171-83.

10. Ai L, Kim WJ, Alpay M, Tang M, Pardo CE, Hatakeyama S, et al.

TRIM29 suppresses TWIST1 and invasive breast cancer behavior.

Cancer Res 2014;74:4875-87.

11. Kanno Y, Watanabe M, Kimura T, Nonomura K, Tanaka S, Hatakeyama S.

TRIM29 as a novel prostate basal cell marker for diagnosis of prostate cancer.

Acta Histochem 2014;116:708-12.

12. Hatakeyama S. Early evidence for the role of TRIM29 in multiple cancer models.

Expert Opin Ther Targets 2016;20:767-70.

13. Yanagi T, Kitamura S, Hata H.

Novel Therapeutic Targets in Cutaneous Squamous Cell Carcinoma.

Front Oncol 2018;8:79.

14. Stratigos A, Garbe C, Lebbe C, Malvehy J, Marmol V, Pehamberger H, et al.

Diagnosis and treatment of invasive squamous cell carcinoma of the skin: European

consensus-based interdisciplinary guideline.

Eur J Cancer 2015;51:1989-2007.

15. Garavello W, Ciardo A, Spreafico R, Gaini RM.

Risk factors for distant metastases in head and neck squamous cell carcinoma.

Arch Otolaryngol Head Neck Surg 2006;132:762-6.

16. Argiris A, Harrington KJ, Tahara M, Schulten J, Chomette P, Ferreira-Castro A, et

al. Evidence-Based Treatment Options in Recurrent and/or Metastatic Squamous Cell

Carcinoma of the Head and Neck. Front Oncol 2017;7:72.

17. Kitajima Y, Inoue S, Yaoita H.

Effects of pemphigus antibody on the regeneration of cell-cell contact in keratinocyte

cultures grown in low to normal Ca++ concentration.

J Invest Dermatol 1987;89:167-71.

18. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, et al. A

versatile viral system for expression and depletion of proteins in mammalian cells.

PLoS One 2009;4:e6529.

19. Yanagi T, Krajewska M, Matsuzawa S, Reed JC.

PCTAIRE1 phosphorylates p27 and regulates mitosis in cancer cells.

Cancer Res 2014;74:5795-807.

20. Sasai K, Akagi T, Aoyanagi E, Tabu K, Kaneko S, Tanaka S.

O6-methylguanine-DNA methyltransferase is downregulated in transformed astrocyte

cells: implications for anti-glioma therapies.

Mol Cancer 2007;6:36.

21. Yanagi H, Wang L, Nishihara H, Kimura T, Tanino M, Yanagi T, et al. CRKL

plays a pivotal role in tumorigenesis of head and neck squamous cell carcinoma

through the regulation of cell adhesion.

Biochem Biophys Res Commun 2012;418:104-109.

22. Yanagi T, Hata H, Mizuno E, Kitamura S, Imafuku K, Nakazato S, et al.

PCTAIRE1/CDK16/PCTK1 is overexpressed in cutaneous squamous cell carcinoma

and regulates p27 stability and cell cycle.

J Dermatol Sci 2017;86:149-57.

23. Fagerberg L, Hallström BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, et al.

Analysis of the human tissue-specific expression by genome-wide integration of

transcriptomics and antibody-based proteomics.

Mol Cell Proteomics 2014;13:397-406.

24. Wang L, Heidt DG, Lee CJ, Yang H, Logsdon CD, Zhang L, et al.

Oncogenic function of ATDC in pancreatic cancer through Wnt pathway activation

and beta-catenin stabilization. Cancer Cell 2009;15:207-19.

25. Tang ZP, Dong QZ, Cui QZ, Papavassiliou P, Wang ED, Wang EH.

Ataxia-telangiectasia group D complementing gene (ATDC) promotes lung cancer cell

proliferation by activating NF-κB pathway. PLoS One. 2013;8:e63676.

26. Palmbos PL, Wang L, Yang H, Wang Y, Leflein J, Ahmet ML, et al.

ATDC/TRIM29 Drives Invasive Bladder Cancer Formation through miRNA-Mediated

and Epigenetic Mechanisms. Cancer Res 2015;75:5155-66.

27. Qiu F, Xiong JP, Deng J, Xiang XJ.

TRIM29 functions as an oncogene in gastric cancer and is regulated by miR-185.

Int J Clin Exp Pathol. 2015;8:5053-61.

28. Karantza V. Keratins in health and cancer: more than mere epithelial cell markers.

Oncogene 2011;30:127-38.

29. Paladini RD, Takahashi K, Bravo NS, Coulombe PA.

Onset of re-epithelialization after skin injury correlates with a reorganization of keratin

filaments in wound edge keratinocytes: defining a potential role for keratin 16.

J Cell Biol 1996;132:381-397.

30. Beil M, Micoulet A, von Wichert G, Paschke S, Walther P, Omary MB, et al.

Sphingosylphosphorylcholine regulates keratin network architecture and visco-elastic

properties of human cancer cells.

Nat Cell Biol 2003;5:803-11.

31. Busch T, Armacki M, Eiseler T, Joodi G, Temme C, Jansen J, et al.

Keratin 8 phosphorylation regulates keratin reorganization and migration of epithelial

tumor cells. J Cell Sci 2012;125:2148-59.

32. Seltmann K, Roth W, Kröger C, Loschke F, Lederer M, Hüttelmaier S, et al.

Keratins mediate localization of hemidesmosomes and repress cell motility.

J Invest Dermatol 2013;133:181-90.

33. Shinkuma S, Guo Z, Christiano AM.

Site-specific genome editing for correction of induced pluripotent stem cells derived

from dominant dystrophic epidermolysis bullosa.

Proc Natl Acad Sci U S A 2016;113:5676-81.

34. Kuga T, Kume H, Kawasaki N, Sato M, Adachi J, Shiromizu T, et al.

A novel mechanism of keratin cytoskeleton organization through casein kinase Iα and

FAM83H in colorectal cancer. J Cell Sci 2013;126:4721-31.

35. Kuga T, Sasaki M, Mikami T, Miake Y, Adachi J, Shimizu M, et al.

FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and

formation of desmosomes. Sci Rep 2016;6:26557.

36. Choi SK, Pandiyan K, Eun JW, Yang X, Hong SH, Nam SW, et al.

Epigenetic landscape change analysis during human EMT sheds light on a key EMT

mediator TRIM29. Oncotarget 2017;8:98322-35.

Figure legends

Fig. 1. Loss of TRIM29 in squamous cell carcinoma. (A) TRIM29 immunoscore (IS)

data were generated from cutaneous squamous cell carcinoma (SCC) primary tumors.

Data (mean ± SD) comparing adjacent normal epidermis (N = 29) and cutaneous SCC

(N = 36). *** p < 0.001 Scale bar = 100 µm. (B) TRIM29 IS data were generated from

six patients with metastatic cutaneous SCC. Data (mean ± SD) comparing adjacent

normal epidermis (N = 6), primary tumor (N = 6), and metastatic lymph nodes (N = 6).

* p < 0.05, ** p < 0.01, *** p < 0.001, Scale bar = 100 µm. (C) Representative

examples of TRIM29 immunostaining results are provided for normal/in situ tongue

epithelium (D) and tongue cancer (E: microinvasive, F: invasive). Scale bar = 200 μm.

(G) Data (mean ± SD) comparing adjacent tongue epithelium (N = 35) and tongue

cancer (N = 35). *** p < 0.001 (H) In 23 cases with pathological decrease of TRIM29

in tongue cancer, we compared TRIM29 IS from the non-invasive and invasive lesions

(*** p < 0.001). (I) In 13 cases with stage III/IV tongue SCC, the overall survival was

compared between high (IS = 5, 6 ) or low (IS = 0-4) expression of TRIM29 (high = 8

cases, low = 5 cases). ** p < 0.01, Log-rank test.

Fig. 2. TRIM29 regulates migration of SCC cells. (A) mRNA and proteins were

generated from A431 SCC cells that stably contained shRNAs (#1, #2) and a scramble

control. mRNA and proteins were analyzed by qRT-PCR (left) and immunoblotting

(right), respectively. (B) Cell cultures were wounded with a pipette tip and

photographed (0 hours and 12 hours after wounding). Scale bar = 200 µm. Data

indicate recovery lengths (N = 3 each). ** p < 0.01, *** p < 0.001 (C) Protein lysates

were generated from A431 SCC cells that stably contained HA-tagged TRIM29 and a

mock control. Proteins were analyzed by SDS-PAGE/immunoblotting using the

indicated antibodies. (D) Cultures were wounded with a yellow tip and photographed

(0 hours, 24 hours). Scale bar = 200 µm. Data indicate recovery lengths (N = 3 each).

*** p < 0.001

Fig 3. TRIM29 knockdown increases cell invasion in SCC cells. (A) A431 SCC cells

stably containing shRNAs (#1, #2) and the scramble control were employed for cell

invasion analysis. Invaded cells were counted in four randomly chosen fields, and the

averages of the invaded cells were bar-graphed (mean ± SD). * p < 0.05, ** p < 0.01

(B) A431 cells stably containing HA-tagged TRIM29 and mock control were

employed for cell invasion analysis. The averages of the invaded cells were

bar-graphed (mean ± SD). ** p < 0.01 (C). TRIM29 knockdown increases the

metastatic potential of A431 cells. sh-control-LUC cells or sh-TRIM29 (#2)-LUC cells

(5x105 A431 cells, GFP-tagged) were injected into the tail vein of athymic mice, and

metastatic incidence was determined using an IVIS imaging system over time. Animals

were injected with d-luciferin (300 mg/kg) and bioluminescence was detected using

IVIS spectrum on days 15 and 23 after tumor cell injection. (D) Luminescent signals of

Regions of Interest (red dotted circles) on Day 23 (the lower panel of C) were

quantified by Living Image Software (Xenogen) (N= 3, mean ± SD, * p < 0.05). (E)

On the final day (Day 23), the lungs were extracted, and metastases were analyzed.

The numbers of tumor metastases were counted by low-magnification fluorescent

microscopy (GFP channel, BZ-9000, Keyence). The representative results are shown

by merged image of bright field and GFP channel. (E, scale bar = 1.0 mm; yellow

arrows indicate metastatic tumors). (F) The averages of tumor metastases are

bar-graphed (mean ± SD). ** p < 0.05

Fig. 4. TRIM29 expresses in cytosol and interacts with keratins and

keratin-interacting protein FAM83H. (A-C) HaCaT cells were reverse-transfected

with pooled siRNA targeting TRIM29 and a negative control. At 48 hours, mRNA

levels of TRIM29 were analyzed by qRT-PCR (C). Immunofluorescent staining

revealed that the TRIM29 mainly expressed in the cytosol (A, B; scale bar = 20 µm).

(D) Also, immunoblotting using whole cell lysate (1x Laemmli buffer) and 1%NP40

lysate indicates that TRIM29 exists in the insoluble fraction of the 1% NP40 lysate

(Sol: 20% of total soluble fraction; Ins: 5% of total insoluble fraction). (E) Silver

staining was performed using the TRIM29-containing protein complex

immunopurified from HaCaT and A431 cells stably expressing FLAG-tagged TRIM29

on 4-20% gradient SDS-PAGE gel. TRIM29-associated proteins identified by mass

spectrometry. (See Supplemental Fig. 13) Among the candidate proteins, we focused

on the keratin-interacting protein FAM83H. (F, G, H) Immunoprecipitation analysis

using 1%NP40 lysate shows that endogenous TRIM29 interacts with FAM83H and

keratins. (I, J, K) Confocal immunofluorescence images show the co-localization of

endogenous TRIM29, keratin 5 (K5), keratin 14 (K14), and FAM83H. Scale bar = 20

µm.

Fig. 5. TRIM29 regulates the distribution of keratins. (A) HaCaT cells were

reverse-transfected with pooled siRNA targeting TRIM29 and a negative control. At 48

hours, the cell lysates were harvested and were analyzed by

SDS-PAGE/immunoblotting using the indicated antibodies. TRIM29 knockdown did

not change the expression levels of keratin 5. (B) Confocal immunofluorescence

images show that TRIM29 knockdown leads to the perinuclear distribution of keratins

(Scale bar = 20 µm). (C) The lysates from HaCaT cells containing HA-tagged TRIM29

or a mock control were analyzed by SDS-PAGE/immunoblotting. Forced expression of

TRIM29 did not change the expression levels of keratin 5 remarkably. (D) Confocal

immunofluorescence images show that keratins co-localize with forced-expressed

TRIM29 (white arrowheads, scale bar = 20 µm).

Fig. 6. Loss of TRIM29 correlates with altered keratin distribution. (A) Keratin

distribution was analyzed immunohistochemically using an anti-cytokeratin antibody

(34bE12) in cutaneous SCC and adjacent normal epidermis. The keratin distribution

patterns were classified as either diffuse or non-diffuse (perinuclear or random). The

non-diffuse pattern was significantly more common in low-TRIM29 tumor tissue than

in high-TRIM29 tumors (B, ** p < 0.01). (C) Keratin distribution was analyzed in

head and neck SCC using an anti-cytokeratin antibody (AE1/AE3). The non-diffuse

pattern was significantly more common in low-TRIM29 tumor tissue than in

high-TRIM29 tumors (D, ** p < 0.01).

Fig. 7. Model of TRIM29 function in stratified epithelial tissue.

In normal stratified epithelial tissue (left), TRIM29 is required for the normal

distribution of keratins. In squamous cell carcinoma cells (right), the methylation of

DNA suppresses the expression of TRIM29, leading to the aberrant distribution of

keratins. Altered keratin distribution helps the cancerous cells to migrate and invade,

which leads to tumor metastasis and poor prognosis.

Loss of TRIM29 alters keratin distribution to promote cell invasion in squamous cell carcinoma

Teruki Yanagi, masashi watanabe, Hiroo Hata, et al.

Cancer Res Published OnlineFirst November 2, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-18-1495

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2018/10/17/0008-5472.CAN-18-1495.DC1 http://cancerres.aacrjournals.org/content/suppl/2018/10/20/0008-5472.CAN-18-1495.DC2 http://cancerres.aacrjournals.org/content/suppl/2018/10/23/0008-5472.CAN-18-1495.DC3

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet Manuscript been edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2018/10/20/0008-5472.CAN-18-1495. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.