DOCSLIB.ORG

Evolutionary Relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with Special Emphasis on Dracunculoid Nematodes Inferred from SSU Rrna Gene Sequences Q

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evolutionary Relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with Special Emphasis on Dracunculoid Nematodes Inferred from SSU Rrna Gene Sequences Q International Journal for Parasitology 36 (2006) 1067–1075 www.elsevier.com/locate/ijpara Evolutionary relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with special emphasis on dracunculoid nematodes inferred from SSU rRNA gene sequences q Martina Wijova´ a,b, Frantisˇek Moravec a, Alesˇ Hora´k a,b, Julius Lukesˇ a,b,* a Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, Cˇ eske´ Budeˇjovice, Czech Republic b Faculty of Biological Sciences, University of South Bohemia, Cˇ eske´ Budeˇjovice, Czech Republic Received 12 January 2006; received in revised form 23 March 2006; accepted 19 April 2006 Abstract The analysis of 26 new small subunit rRNA sequences obtained from helminths that primarily parasitize fishes sampled from five continents provided well-supported trees, allowing us to study the phylogenetic relationships among spirurid nematodes. The analyses have shown that Dracunculoidea is a paraphyletic taxon and Anguillicolidae and Gnathostomatidae constitute the basal branch of the suborder Spirurina. The genera Philometra and Philometroides appear to be paraphyletic, while on the higher taxonomic level, good correlation between the morphology-based system and molecular data was observed. Neither co-evolution of the studied helminths with their hosts, nor phylogeographic pattern, are apparent in our dataset. Ó 2006 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. Keywords: Nematoda; Spirurina; Philometridae; SSU rRNA; Phylogeny; Taxonomy 1. Introduction mented by the sequencing of other conserved genes, such as the large subunit rRNA, ITS region or elongation factor 1 Nematodes, which are typically considered a phylum, rep- (Gasser and Newton, 2000; Chilton et al., 2001). Although resent an extremely species-rich group. However, from the the recent dataset of nematode SSU rRNA genes comprises morphological perspective, they constitute a trait-poor more than 300 taxa (Blaxter, 2003), it remains strongly group due to a life-style that seems to preclude appendage biased towards some groups, while sampling remains poor evolution and cephalisation in both free-living and parasitic for several other important groups. One of the underrepre- species (Blaxter, 2003). The current nematode taxonomy is sented groups is the spirurine nematodes, an order/suborder thus primarily based on the morphology of the oesophagus, of obligatory parasites that includes helminths of cold- and male and female reproductive organs and life-cycle patterns warm-blooded terrestrial and aquatic vertebrates, including (Chabaud, 1975a,b; Anderson and Bain, 1976). An initial humans (Chabaud, 1975a,b; Anderson and Bain, 1976). framework for the molecular phylogeny of nematodes, based Opinions about the phylogenetic relationships among on the small subunit (SSU) rRNA dataset (Blaxter et al., the main groups of Spirurida in Anderson’s conception 1998; Dorris et al., 1999), was for a handful of taxa comple- (2000) have been developing gradually, which is reflected in taxonomic systems proposed by different authors (for q Note: The nucleotide sequences reported in this paper have been a recent review see De Ley and Blaxter, 2002). Spirurida deposited in the GenBank under the accession numbers AY852267– was assigned the rank of an order by Chitwood (1933) AY852269, DQ442659–DQ442679, DQ490223, DQ494195. * (subclass Secernentea, class Nematoda in his system), being Corresponding author. Address: Institute of Parasitology, Czech later subdivided into the suborders Camallanina and Spir- Academy of Sciences, Branisˇovska 31, 37005 Cˇ eske´ Budeˇjovice, Czech Republic. Tel.: +420 38 7775416; fax: +420 38 5310388. urina (Chabaud, 1974). The former suborder is comprised E-mail address: [email protected] (J. Lukesˇ). of the superfamilies Camallanoidea and Dracunculoidea, 0020-7519/$30.00 Ó 2006 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijpara.2006.04.005 1068 M. Wijova´ et al. / International Journal for Parasitology 36 (2006) 1067–1075 whereas the suborder Spirurina represented a group of 10 for 1 min, 44 °C for 1 min and 72 °C for 2 min followed superfamilies containing hundreds of named species (Cha- by 24 cycles with the annealing temperature increased to baud, 1974). Several classifications, all based on morphol- 48 °C. The amplicons of expected size were gel-purified ogy and life-cycles, have been created by Chitwood using the Jetquick gel extraction kit (Genomed) and cloned (1933, 1950), Yamaguti (1961), Ivashkin et al. (1971) and into the Topo TA Cloning Vector (Invitrogen). Both Chabaud (1974, 1975a). In the most recent classification strands were sequenced using a Beckman Coulter automat- systems, based on morphology and biology, Spirurida ic sequencer. Internal oligonucleotides designed to match appeared as an order consisting of 28 families (Moravec the conserved regions were used to complete the sequences, et al., 1998; Anderson, 2000). However, these nematodes which have been assembled with Seqman (DNAStar). are classified within a newly defined suborder Spirurina that is placed in Rhabditida, Chromadorea, in the recent 2.2. Phylogenetic analysis classification system based on molecular data (De Ley and Blaxter, 2002). In contrast to previous systems, Spir- Dataset A was created from 29 SSU rRNA sequences of urina in this conception (subdivided into infraorders Asc- species listed in Tables 1 and 2. Plectus aquatilis (Plectidae) aridomorpha, Gnathostomatomorpha, Oxyuridomorpha, and Teratocephalus lirellus (Teratocephalidae) were chosen Rhigonematomorpha and Spiruromorpha, with Dracuncu- as outgroups according to De Ley and Blaxter (2002). For loidea as incertae sedis) is much broader, also including datasets B and C, enriched for sequences of Camallanidae former Ascaridida, Oxyurida and Rhigonematida. and Philometridae, respectively, different outgroups select- In the SSU rRNA-based trees published so far (Blaxter ed based on the analyses of dataset A have been used (see et al., 1998; Blaxter, 2003), the spirurine clade is robustly Section 3 for details). In order to include the partial philo- supported. This finding is complicated by the lack of any metrid SSU rRNA sequences available in GenBank for a sequences from several key representatives, which obscures number of philometrids, an additional 900 bp-long data- the relationships within the clade and with other clades. set D was constructed containing 18 specimens of Philo- Therefore, high expectations are placed on molecular phy- metridae and was rooted with Dracunculus spp. Multiple logeny. Despite the paramount importance of some spiru- alignments of different transition/transversion (Ts/Tv) rines for human health, this approach has not been used weights (1:1/2/3/5) were created with Clustal X 1.83 because of the apparent lack of interest among molecular (Thompson et al., 1997) and further edited using BioEdit biologists in these organisms (Lukesˇ et al., 2005). We have 7.0.4.1 (Hall, 1999) for all datasets. Ambiguously aligned undertaken sequence analysis of the SSU rRNA gene from regions and gaps were removed either with Bioedit or members of major groups within this zooparasitic taxon. Gblocks software (Castresana, 2000) prior to the analyses. The obtained dataset enabled us not only to examine phy- Maximum likelihood trees were calculated from all the logenetic relationships among spirurines and other nema- datasets and Ts/Tv setting under the GTR+C4+I model todes but also to address interesting problems, such as: of evolution using PHYML 2.4.4 (Guindon and Gascuel, (i) what is the ancestral invasion strategy of the spirurines? 2003); gamma shape parameter and proportion of invari- (ii) Did taxa with two-host life-cycles evolve from the base ants (PINVAR) were estimated from the dataset (see figure of the group? (iii) What is the pattern of definitive and/or captions for actual values). The model of evolution was intermediate host usage? (iv) Is there a phylogeographic chosen according to the Akaike criterion as implemented correlation or co-evolution with the host? Furthermore, in Modeltest 3.7 (Posada and Crandall, 1998). Maximum we propose the incorporation of the SSU rRNA-based likelihood (ML) and maximum parsimony (MP) bootstrap phylogenies into a comprehensive classification. support values were calculated by PHYML 2.4.4 and PAUP*4.0b10 (Swofford, 2002) from 1000 replications. 2. Materials and methods Bayesian posterior probabilities were assessed under the above described model with MrBayes 3.0b4 (Huelsenbeck 2.1. Organisms, DNA extraction and PCR and Ronquist, 2001) software (Bayesian inference—BI), where the Markov chain was set to 2·106 generations, Taxa sampled for phylogenetic analysis are listed in every 100th tree was sampled and the first 105 generations Table 1 and taxa for which sequences have been retrieved were omitted from phylogeny reconstruction. Additional from GenBank are listed in Table 2. Most specimens were LogDet analysis of all alignments of dataset A, run using stored in 70% ethanol for between several days up to a dec- PAUP*4.0b10, was performed to unmask possible cases ade prior to DNA isolation (Table 1). Genomic DNA was of the long-branch attraction phenomenon in topologies isolated using the Jetquick Tissue DNA kit (Genomed). obtained with the above-mentioned methods. About 10–50 ng of genomic DNA was used for PCR amplification of the SSU rRNA gene using oligonucleotide 3. Results primers D-1F (GCCTATAATGGTGAAACCGCGAAC) and D-1R (CCGGTTCA
Load more

Recommended publications
  • Gnathostoma Spinigerum Was Positive
    Department Medicine Diagnostic Centre Swiss TPH Winter Symposium 2017 Helminth Infection – from Transmission to Control Sushi Worms – Diagnostic Challenges Beatrice Nickel Fish-borne helminth infections Consumption of raw or undercooked fish - Anisakis spp. infections - Gnathostoma spp. infections Case 1 • 32 year old man • Admitted to hospital with severe gastric pain • Abdominal pain below ribs since a week, vomiting • Low-grade fever • Physical examination: moderate abdominal tenderness • Laboratory results: mild leucocytosis • Patient revealed to have eaten sushi recently • Upper gastrointestinal endoscopy was performed Carmo J, et al. BMJ Case Rep 2017. doi:10.1136/bcr-2016-218857 Case 1 Endoscopy revealed 2-3 cm long helminth Nematode firmly attached to / Endoscopic removal of larva with penetrating gastric mucosa a Roth net Carmo J, et al. BMJ Case Rep 2017. doi:10.1136/bcr-2016-218857 Anisakiasis Human parasitic infection of gastrointestinal tract by • herring worm, Anisakis spp. (A.simplex, A.physeteris) • cod worm, Pseudoterranova spp. (P. decipiens) Consumption of raw or undercooked seafood containing infectious larvae Highest incidence in countries where consumption of raw or marinated fish dishes are common: • Japan (sashimi, sushi) • Scandinavia (cod liver) • Netherlands (maatjes herrings) • Spain (anchovies) • South America (ceviche) Source: http://parasitewonders.blogspot.ch Life Cycle of Anisakis simplex (L1-L2 larvae) L3 larvae L2 larvae L3 larvae Source: Adapted to Audicana et al, TRENDS in Parasitology Vol.18 No. 1 January 2002 Symptoms Within few hours of ingestion, the larvae try to penetrate the gastric/intestinal wall • acute gastric pain or abdominal pain • low-grade fever • nausea, vomiting • allergic reaction possible, urticaria • local inflammation Invasion of the third-stage larvae into gut wall can lead to eosinophilic granuloma, ulcer or even perforation.
    [Show full text]
  • Gastrointestinal Helminthic Parasites of Habituated Wild Chimpanzees
    Aus dem Institut für Parasitologie und Tropenveterinärmedizin des Fachbereichs Veterinärmedizin der Freien Universität Berlin Gastrointestinal helminthic parasites of habituated wild chimpanzees (Pan troglodytes verus) in the Taï NP, Côte d’Ivoire − including characterization of cultured helminth developmental stages using genetic markers Inaugural-Dissertation zur Erlangung des Grades eines Doktors der Veterinärmedizin an der Freien Universität Berlin vorgelegt von Sonja Metzger Tierärztin aus München Berlin 2014 Journal-Nr.: 3727 Gedruckt mit Genehmigung des Fachbereichs Veterinärmedizin der Freien Universität Berlin Dekan: Univ.-Prof. Dr. Jürgen Zentek Erster Gutachter: Univ.-Prof. Dr. Georg von Samson-Himmelstjerna Zweiter Gutachter: Univ.-Prof. Dr. Heribert Hofer Dritter Gutachter: Univ.-Prof. Dr. Achim Gruber Deskriptoren (nach CAB-Thesaurus): chimpanzees, helminths, host parasite relationships, fecal examination, characterization, developmental stages, ribosomal RNA, mitochondrial DNA Tag der Promotion: 10.06.2015 Contents I INTRODUCTION ---------------------------------------------------- 1- 4 I.1 Background 1- 3 I.2 Study objectives 4 II LITERATURE OVERVIEW --------------------------------------- 5- 37 II.1 Taï National Park 5- 7 II.1.1 Location and climate 5- 6 II.1.2 Vegetation and fauna 6 II.1.3 Human pressure and impact on the park 7 II.2 Chimpanzees 7- 12 II.2.1 Status 7 II.2.2 Group sizes and composition 7- 9 II.2.3 Territories and ranging behavior 9 II.2.4 Diet and hunting behavior 9- 10 II.2.5 Contact with humans 10 II.2.6
    [Show full text]
  • 1 References Cited in the U.S. Fish and Wildlife Service American Eel
    References Cited1 in the U.S. Fish and Wildlife Service American Eel Biological Species Report and ESA 12-Month Petition Finding Form Docket Number FWS–HQ–ES–2015–0143 August 2015 Aarestrup, K., and coauthors. 2009. Oceanic Spawning Migration of the European eel (Anguilla anguilla). Science 325(5948):1660. Aarestrup, K., and coauthors. 2010. Survival and progression rates of large European silver eel Anguilla anguilla in late freshwater and early marine phases. Aquatic Biology 9(3):263–270. Able, K. W., and M. P. Fahay. 2010. Ecology of Estuarine Fishes, Chapter 17: Anguilla rostrata (Leseur). Pages 139–144. Johns Hopkins University Press. Aieta, A. E., and K. Oliveira. 2009. Distribution, prevalence, and intensity of the swim bladder parasite Anguillicola crassus in New England and eastern Canada. Diseases of Aquatic Organisms 84(3):229–235. Albert, V., B. Jonsson, and L. Bernatchez. 2006. Natural hybrids in Atlantic eels (Anguilla anguilla, A. rostrata): evidence for successful reproduction and fluctuating abundance in space and time. Molecular Ecology 15(7):1903–1916. Als, T. D., and coauthors. 2011. All roads lead to home: panmixia of European eel in the Sargasso Sea. Molecular Ecology 20(7):1333–1346. Amaral, S. V., F. C. Winchell, B. J. McMahon, and D. A. Dixon. 2003. Evaluation of angled bar racks and louvers for guiding silver phase American eels. Pages 367–376 in D.A. Dixon, editor. Biology, management, and protection of catadromous eels. American Fisheries Society Symposium 33. American Rivers. 2013. 63 dams removed to restore rivers in 2012. Press release, 2013. 87 pages. Aoyama, J. 2003. Origin and evolution of the freshwater eels, genus Anguilla.
    [Show full text]
  • Molecular Identification of the Etiological Agent of Human
    Jpn. J. Infect. Dis., 73, 44–50, 2020 Original Article Molecular Identification of the Etiological Agent of Human Gnathostomiasis in an Endemic Area of Mexico Sylvia Paz Díaz-Camacho1, Jesús Ricardo Parra-Unda2, Julián Ríos-Sicairos2, and Francisco Delgado-Vargas2* 1Research Unit in Environment and Health, Autonomous University of Occident, Sinaloa; and 2Public Health Research Unit "Dra. Kaethe Willms", School of Chemical and Biological Sciences, Autonomous University of Sinaloa, University city, Culiacan, Sinaloa, Mexico SUMMARY: Human gnathostomiasis, which is endemic in Mexico, is a worldwide health concern. It is mainly caused by the consumption of raw or insufficiently cooked fish containing the advanced third-stage larvae (AL3A) of Gnathostoma species. The diagnosis of gnathostomiasis is based on epidemiological surveys and immunological diagnostic tests. When a larva is recovered, the species can be identified by molecular techniques. Polymerase chain reaction (PCR) amplification of the second internal transcription spacer (ITS-2) is useful to identify nematode species, including Gnathostoma species. This study aims to develop a duplex-PCR amplification method of the ITS-2 region to differentiate between the Gnathostoma binucleatum and G. turgidum parasites that coexist in the same endemic area, as well as to identify the Gnathostoma larvae recovered from the biopsies of two gnathostomiasis patients from Sinaloa, Mexico. The duplex PCR established based on the ITS- 2 sequence showed that the length of the amplicons was 321 bp for G. binucleatum and 226 bp for G. turgidum. The amplicons from the AL3A of both patients were 321 bp. Furthermore, the length and composition of these amplicons were identical to those deposited in GenBank as G.
    [Show full text]
  • Gnathostomiasis: an Emerging Imported Disease David A.J
    RESEARCH Gnathostomiasis: An Emerging Imported Disease David A.J. Moore,* Janice McCroddan,† Paron Dekumyoy,‡ and Peter L. Chiodini† As the scope of international travel expands, an ous complication of central nervous system involvement increasing number of travelers are coming into contact with (4). This form is manifested by painful radiculopathy, helminthic parasites rarely seen outside the tropics. As a which can lead to paraplegia, sometimes following an result, the occurrence of Gnathostoma spinigerum infection acute (eosinophilic) meningitic illness. leading to the clinical syndrome gnathostomiasis is increas- We describe a series of patients in whom G. spinigerum ing. In areas where Gnathostoma is not endemic, few cli- nicians are familiar with this disease. To highlight this infection was diagnosed at the Hospital for Tropical underdiagnosed parasitic infection, we describe a case Diseases, London; they were treated over a 12-month peri- series of patients with gnathostomiasis who were treated od. Four illustrative case histories are described in detail. during a 12-month period at the Hospital for Tropical This case series represents a small proportion of gnathos- Diseases, London. tomiasis patients receiving medical care in the United Kingdom, in whom this uncommon parasitic infection is mostly undiagnosed. he ease of international travel in the 21st century has resulted in persons from Europe and other western T Methods countries traveling to distant areas of the world and return- The case notes of patients in whom gnathostomiasis ing with an increasing array of parasitic infections rarely was diagnosed at the Hospital for Tropical Diseases were seen in more temperate zones. One example is infection reviewed retrospectively for clinical symptoms and confir- with Gnathostoma spinigerum, which is acquired by eating uncooked food infected with the larval third stage of the helminth; such foods typically include fish, shrimp, crab, crayfish, frog, or chicken.
    [Show full text]
  • Ascaris Lumbricoides, Roundworm, Causative Agent Of
    http://www.MetaPathogen.com: Human roundworm, Ascaris lumbricoides ● Ascaris lumbricoides taxonomy ● Brief facts ● Developmental stages ● Treatment ● References Ascaris lumbricoides taxonomy cellular organisms - Eukaryota - Fungi/Metazoa group - Metazoa - Eumetazoa - Bilateria - Pseudocoelomata - Nematoda - Chromadorea - Ascaridida - Ascaridoidea - Ascarididae - Ascaris - Ascaris lumbricoides Brief facts ● Together with human hookworms (Ancylostoma duodenale and Necator americanus also described at MetaPathogen) and whipworms (Trichuris trichiura), Ascaris lumbricoides (human roundworms) belong to a group of so-called soil-transmitted helminths that represent one of the world's most important causes of physical and intellectual growth retardation. ● Today, ascariasis is among the most important tropical diseases in humans with more than billion infected people world-wide. Ascariasis is mostly seen in tropical and subtropical countries because of warm and humid conditions that facilitate development and survival of eggs. The majority of infections occur in Asia (up to 73%), followed by Africa (~12%) and Latin America (~8%). ● Ascaris lumbricoides is one of six worms listed and named by Linnaeus. Its name has remained unchanged up to date. ● Ascariasis is an ancient infection, and A. lumbricoides have been found in human remains from Peru dating as early as 2277 BC. There are records of A. lumbricoides in Egyptian mummy dating from 1938 to 1600 BC. Despite of long history of awareness and scientific observations, the parasite's life cycle in humans, including the migration of the larval stages around the body, was discovered only in 1922 by a Japanese pediatrician, Shimesu Koino. ● Unlike the hookworm, whose third-stage (L3) larvae actively penetrate skin, A. lumbricoides (as well as T. trichiura) is transmitted passively within the eggs after being swallowed by the host as a result of fecal contamination.
    [Show full text]
  • Kinomes of Selected Parasitic Helminths - Fundamental and Applied Implications
    KINOMES OF SELECTED PARASITIC HELMINTHS - FUNDAMENTAL AND APPLIED IMPLICATIONS Andreas Julius Stroehlein BSc (Bingen am Rhein, Germany) MSc (Berlin, Germany) ORCID ID 0000-0001-9432-9816 Submitted in fulfilment of the requirements of the degree of Doctor of Philosophy July 2017 Melbourne Veterinary School, Faculty of Veterinary and Agricultural Sciences, The University of Melbourne Produced on archival quality paper ii SUMMARY ________________________________________________________________ Worms (helminths) are a large, paraphyletic group of organisms including free-living and parasitic representatives. Among the latter, many species of roundworms (phylum Nematoda) and flatworms (phylum Platyhelminthes) are of major socioeconomic importance worldwide, causing debilitating diseases in humans and livestock. Recent advances in molecular technologies have allowed for the analysis of genomic and transcriptomic data for a range of helminth species. In this context, studying molecular signalling pathways in these species is of particular interest and should help to gain a deeper understanding of the evolution and fundamental biology of parasitism among these species. To this end, the objective of the present thesis was to characterise and curate the protein kinase complements (kinomes) of parasitic worms based on available transcriptomic data and draft genome sequences using a bioinformatic workflow in order to increase our understanding of how kinase signalling regulates fundamental biology and also to gain new insights into the evolution of protein kinases in parasitic worms. In addition, this work also aimed to investigate protein kinases with regard to their potential as useful targets for the development of novel anthelmintic small-molecule agents. This thesis consists of a literature review, four chapters describing original research findings and a general discussion.
    [Show full text]
  • The Transcriptome of the Invasive Eel Swimbladder Nematode Parasite
    Heitlinger et al. BMC Genomics 2013, 14:87 http://www.biomedcentral.com/1471-2164/14/87 RESEARCH ARTICLE Open Access The transcriptome of the invasive eel swimbladder nematode parasite Anguillicola crassus Emanuel Heitlinger1,2,4*, Stephen Bridgett3, Anna Montazam3, Horst Taraschewski1 and Mark Blaxter2,3 Abstract Background: Anguillicola crassus is an economically and ecologically important parasitic nematode of eels. The native range of A. crassus is in East Asia, where it infects Anguilla japonica, the Japanese eel. A. crassus was introduced into European eels, Anguilla anguilla, 30 years ago. The parasite is more pathogenic in its new host than in its native one, and is thought to threaten the endangered An. anguilla across its range. The molecular bases for the increased pathogenicity of the nematodes in their new hosts is not known. Results: A reference transcriptome was assembled for A. crassus from Roche 454 pyrosequencing data. Raw reads (756,363 total) from nematodes from An. japonica and An. anguilla hosts were filtered for likely host contaminants and ribosomal RNAs. The remaining 353,055 reads were assembled into 11,372 contigs of a high confidence assembly (spanning 6.6 Mb) and an additional 21,153 singletons and contigs of a lower confidence assembly (spanning an additional 6.2 Mb). Roughly 55% of the high confidence assembly contigs were annotated with domain- or protein sequence similarity derived functional information. Sequences conserved only in nematodes, or unique to A. crassus were more likely to have secretory signal peptides. Thousands of high quality single nucleotide polymorphisms were identified, and coding polymorphism was correlated with differential expression between individual nematodes.
    [Show full text]
  • The Phylogenetics of Anguillicolidae (Nematoda: Anguillicolidea), Swimbladder Parasites of Eels
    UC Davis UC Davis Previously Published Works Title The phylogenetics of Anguillicolidae (Nematoda: Anguillicolidea), swimbladder parasites of eels Permalink https://escholarship.org/uc/item/3017p5m4 Journal BMC Evolutionary Biology, 12(1) ISSN 1471-2148 Authors Laetsch, Dominik R Heitlinger, Emanuel G Taraschewski, Horst et al. Publication Date 2012-05-04 DOI http://dx.doi.org/10.1186/1471-2148-12-60 Peer reviewed eScholarship.org Powered by the California Digital Library University of California The phylogenetics of Anguillicolidae (Nematoda: Anguillicoloidea), swimbladder parasites of eels Laetsch et al. Laetsch et al. BMC Evolutionary Biology 2012, 12:60 http://www.biomedcentral.com/1471-2148/12/60 Laetsch et al. BMC Evolutionary Biology 2012, 12:60 http://www.biomedcentral.com/1471-2148/12/60 RESEARCH ARTICLE Open Access The phylogenetics of Anguillicolidae (Nematoda: Anguillicoloidea), swimbladder parasites of eels Dominik R Laetsch1,2*, Emanuel G Heitlinger1,2, Horst Taraschewski1, Steven A Nadler3 and Mark L Blaxter2 Abstract Background: Anguillicolidae Yamaguti, 1935 is a family of parasitic nematode infecting fresh-water eels of the genus Anguilla, comprising five species in the genera Anguillicola and Anguillicoloides. Anguillicoloides crassus is of particular importance, as it has recently spread from its endemic range in the Eastern Pacific to Europe and North America, where it poses a significant threat to new, naïve hosts such as the economic important eel species Anguilla anguilla and Anguilla rostrata. The Anguillicolidae are therefore all potentially invasive taxa, but the relationships of the described species remain unclear. Anguillicolidae is part of Spirurina, a diverse clade made up of only animal parasites, but placement of the family within Spirurina is based on limited data.
    [Show full text]
  • Free-Living Marine Nematodes from San Antonio Bay (Río Negro, Argentina)
    A peer-reviewed open-access journal ZooKeys 574: 43–55Free-living (2016) marine nematodes from San Antonio Bay (Río Negro, Argentina) 43 doi: 10.3897/zookeys.574.7222 DATA PAPER http://zookeys.pensoft.net Launched to accelerate biodiversity research Free-living marine nematodes from San Antonio Bay (Río Negro, Argentina) Gabriela Villares1, Virginia Lo Russo1, Catalina Pastor de Ward1, Viviana Milano2, Lidia Miyashiro3, Renato Mazzanti3 1 Laboratorio de Meiobentos LAMEIMA-CENPAT-CONICET, Boulevard Brown 2915, U9120ACF, Puerto Madryn, Argentina 2 Universidad Nacional de la Patagonia San Juan Bosco, sede Puerto Madryn. Boulevard Brown 3051, U9120ACF, Puerto Madryn, Argentina 3Centro de Cómputos CENPAT-CONICET, Boulevard Brown 2915, U9120ACF, Puerto Madryn, Argentina Corresponding author: Gabriela Villares ([email protected]) Academic editor: H-P Fagerholm | Received 18 November 2015 | Accepted 11 February 2016 | Published 28 March 2016 http://zoobank.org/3E8B6DD5-51FA-499D-AA94-6D426D5B1913 Citation: Villares G, Lo Russo V, Pastor de Ward C, Milano V, Miyashiro L, Mazzanti R (2016) Free-living marine nematodes from San Antonio Bay (Río Negro, Argentina). ZooKeys 574: 43–55. doi: 10.3897/zookeys.574.7222 Abstract The dataset of free-living marine nematodes of San Antonio Bay is based on sediment samples collected in February 2009 during doctoral theses funded by CONICET grants. A total of 36 samples has been taken at three locations in the San Antonio Bay, Santa Cruz Province, Argentina on the coastal littoral at three tidal levels. This presents a unique and important collection for benthic biodiversity assessment of Patagonian nematodes as this area remains one of the least known regions.
    [Show full text]
  • AMPHIBIA: ANURA: LEPTODACTYLIDAE Leptodactylus Pentadactylus
    887.1 AMPHIBIA: ANURA: LEPTODACTYLIDAE Leptodactylus pentadactylus Catalogue of American Amphibians and Reptiles. Heyer, M.M., W.R. Heyer, and R.O. de Sá. 2011. Leptodactylus pentadactylus . Leptodactylus pentadactylus (Laurenti) Smoky Jungle Frog Rana pentadactyla Laurenti 1768:32. Type-locality, “Indiis,” corrected to Suriname by Müller (1927: 276). Neotype, Nationaal Natuurhistorisch Mu- seum (RMNH) 29559, adult male, collector and date of collection unknown (examined by WRH). Rana gigas Spix 1824:25. Type-locality, “in locis palu - FIGURE 1. Leptodactylus pentadactylus , Brazil, Pará, Cacho- dosis fluminis Amazonum [Brazil]”. Holotype, Zoo- eira Juruá. Photograph courtesy of Laurie J. Vitt. logisches Sammlung des Bayerischen Staates (ZSM) 89/1921, now destroyed (Hoogmoed and Gruber 1983). See Nomenclatural History . Pre- lacustribus fluvii Amazonum [Brazil]”. Holotype, occupied by Rana gigas Wallbaum 1784 (= Rhin- ZSM 2502/0, now destroyed (Hoogmoed and ella marina {Linnaeus 1758}). Gruber 1983). Rana coriacea Spix 1824:29. Type-locality: “aquis Rana pachypus bilineata Mayer 1835:24. Type-local MAP . Distribution of Leptodactylus pentadactylus . The locality of the neotype is indicated by an open circle. A dot may rep - resent more than one site. Predicted distribution (dark-shaded) is modified from a BIOCLIM analysis. Published locality data used to generate the map should be considered as secondary sources, as we did not confirm identifications for all specimen localities. The locality coordinate data and sources are available on a spread sheet at http://learning.richmond.edu/ Leptodactylus. 887.2 FIGURE 2. Tadpole of Leptodactylus pentadactylus , USNM 576263, Brazil, Amazonas, Reserva Ducke. Scale bar = 5 mm. Type -locality, “Roque, Peru [06 o24’S, 76 o48’W].” Lectotype, Naturhistoriska Riksmuseet (NHMG) 497, age, sex, collector and date of collection un- known (not examined by authors).
    [Show full text]
  • PROCEEDINGS of the OKLAHOMA ACADEMY of SCIENCE Volume 98 2018
    PROCEEDINGS of the OKLAHOMA ACADEMY OF SCIENCE Volume 98 2018 EDITOR: Mostafa Elshahed Production Editor: Tammy Austin Business Manager: T. David Bass The Official Organ of the OKLAHOMA ACADEMY OF SCIENCE Which was established in 1909 for the purpose of stimulating scientific research; to promote fraternal relationships among those engaged in scientific work in Oklahoma; to diffuse among the citizens of the State a knowledge of the various departments of science; and to investigate and make known the material, educational, and other resources of the State. Affiliated with the American Association for the Advancement of Science. Publication Date: January 2019 ii POLICIES OF THE PROCEEDINGS The Proceedings of the Oklahoma Academy of Science contains papers on topics of interest to scientists. The goal is to publish clear communications of scientific findings and of matters of general concern for scientists in Oklahoma, and to serve as a creative outlet for other scientific contributions by scientists. ©2018 Oklahoma Academy of Science The Proceedings of the Oklahoma Academy Base and/or other appropriate repository. of Science contains reports that describe the Information necessary for retrieval of the results of original scientific investigation data from the repository will be specified in (including social science). Papers are received a reference in the paper. with the understanding that they have not been published previously or submitted for 4. Manuscripts that report research involving publication elsewhere. The papers should be human subjects or the use of materials of significant scientific quality, intelligible to a from human organs must be supported by broad scientific audience, and should represent a copy of the document authorizing the research conducted in accordance with accepted research and signed by the appropriate procedures and scientific ethics (proper subject official(s) of the institution where the work treatment and honesty).
    [Show full text]